JP2011030571A - Method and composition for production of orthogonal trna-aminoacyltrna synthetase pair - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide more efficient and effective methods to alter and improve the biosynthetic mechanism of a cell. <P>SOLUTION: This invention provides compositions and methods for generating components of protein biosynthetic mechanism including orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, and orthogonal pairs of tRNAs/synthetases. These compositions include novel orthogonal tRNA-aminoacyl-tRNA synthetase pairs. The novel orthogonal pairs can be used to incorporate an unnatural amino acid in a polypeptide in vivo. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

CROSS REFERENCE TO RELATED APPLICATIONS This application includes US Provisional Patent Application No. 60 / 285,030 filed April 19, 2001, and US Patent Application No. 60/355, filed February 6, 2002. The priority of 514 is claimed and the entire specification thereof is incorporated herein.

Statement of rights to invention made under federal-sponsored research and development This invention is subject to subsidy grant No. 6502573 from Naval Research Office and grant grant No. GM2159 from National Laboratories It was done with the support of the US government. The US government has certain rights in this invention.

TECHNICAL FIELD The present invention relates to the field of translation biochemistry. In particular, the invention relates to methods for producing mutant orthogonal tRNAs, mutant orthogonal aminoacyl tRNA synthetases and pairs thereof. The present invention also provides methods and related compositions for identifying orthogonal pairs used to incorporate unnatural amino acids into proteins in vivo.

Proteins carry out almost all complex life phenomena, from photosynthesis to signal transduction and immune responses. In order to understand and control these complex functions, it is necessary to deepen the understanding of the relationship between protein structure and function.

Unlike small organic molecule synthesis, where almost any structure can be altered to alter the functional properties of the compound, protein synthesis is limited to changes encoded by 20 natural amino acids. The genetic code of all known organisms from bacteria to humans encodes the same 20 common amino acids. These amino acids can be altered by post-translational modifications of the protein (eg, glycosylation, phosphorylation or oxidation) or, to a lesser extent, by enzymatic modification of aminoacylated suppressor tRNAs, such as in the case of selenocysteine. Nevertheless, polypeptides synthesized from these 20 simple building blocks perform all of the complex life phenomena.

Site-specific and random mutagenesis can replace specific amino acids of a protein with any of the other 19 common amino acids, making it an important tool for elucidating the relationship between protein structure and function. These methods make it possible to produce proteins with enhanced properties such as stability, catalytic activity, and binding specificity. However, protein substitution is mostly limited to 20 common amino acids with simple functional groups. Knowles, J. et al. R. Tinkeringwith enzymes: what we learning? Science , 236 (4806) 1252-1258 (1987); and Zoller, M .; J. et al. Smith, M .; See Oligonucleotide-directedmutageness of DNA fragments cloned into M13 vectors, Methods Enzymol, 154: 468-500 (1983). By extending the genetic code to include additional amino acids with new biological, chemical or physical properties, for example, a protein composed only of amino acids contained in 20 common amino acids such as natural proteins In comparison, protein properties (eg, size, acidity, nucleophilicity, hydrogen bonding, hydrophobicity) can be modified.

Several strategies have been used to introduce unnatural amino acids into proteins. The first experiment added reactive side chains such as Lys, Cys and Tyr to amino acids (eg lysine

Converted to acetyl-lysine). Chemical synthesis is also a simple method of introducing unnatural amino acids, but routine solid phase peptide synthesis is generally limited to small peptides or proteins of less than 100 residues. With the recent development of enzymatic ligation and natural chemical ligation of peptide fragments, it is possible to produce larger proteins, but it is not easy to scale up the method. For example, P.I. E. Dawson and S.W. B. H. Kent, Annu. Rev. Biochem. 69: 923 (2000). Add a suppressor tRNA chemically acylated with a desired unnatural amino acid to an in vitro extract useful for protein biosynthesis. Using a general in vitro biosynthesis method, more than 100 unnatural amino acids can be of any size. It is site-specifically incorporated into proteins. For example V. W. Cornish, D.C. Mendelland P.M. G. Schultz, Angew. Chem. Int. Ed. Engl. , 1995, 34: 621 (1995); J. et al. Noren, S.M. J. et al. Anthony-Chill, M .; C. Griffith, P.M. G. Schultz, General method for-specific incorporation of unnatural amino acids into proteins, Science 244 182-188 (1989); D. Bain, C.I. G. Glabe, T.A. A. Dix, A.M. R. Chamberlin, E .; S. Diala, Biosyntheticite-specific information of a non-naturalamino acid intoa polypeptide, J. Biol . Am. Chem. Soc. 111 8013-8014 (1989). A variety of functional groups have been introduced into proteins for the study of protein stability, protein folding, enzyme mechanisms and signal transduction. Although these studies demonstrate that protein biosynthetic mechanisms tolerate diverse amino acid side chains, the method is technically difficult and the mutant protein yield is low.

More than 50 years ago, many analogs of natural amino acids were found to inhibit bacterial growth. Analysis of the proteins produced in the presence of these amino acid analogs revealed that their natural counterparts were substituted to varying degrees. For example, M.M. H. Richmond, Bacteriol. Rev. 26: 398 (1962). This is because aminoacyl-tRNA synthetases, which are enzymes involved in binding the correct amino acid to its cognate tRNA, cannot strictly distinguish analogs from the corresponding natural amino acids. For example, norleucine is loaded by methionyl-tRNA synthetase and p-fluorophenylalanine is loaded by phenylalanine-tRNA synthetase. D. B. Cowie, G.C. N. Cohen, E .; T.A. Boltonand H.M. DeRrobinchon-Szulmajst, Biochim. Biophys. Acta , 1959, 34:39 (1959); Munier and G. N. Cohen, Biochim. Biophys. Acta , 1959, 31: 378 (1959).

Subsequently, an in vivo method called selective pressure integration was developed to utilize various wild type synthetases. For example, N.C. Budisa, C.I. Minks, S.M. Alefelder, W.M. Wenger, F.M. M.M. Dong, L.M. Moroderand R.M. Huber, FASEB J .; 13:41 (1999). In this method, an auxotrophic strain that blocks the metabolic pathway that supplies a specific natural amino acid to cells is used, and cultured in a minimal medium containing a limited concentration of the natural amino acid while suppressing transcription of the target gene. When the stationary growth phase begins, the supply of natural amino acids is stopped and replaced with non-natural amino acid analogs. Inducing expression of the recombinant protein accumulates proteins, including non-natural analogs. For example, using this strategy, o, m, and p-fluorophenylalanine are incorporated into proteins, showing two characteristic shoulders that are easily distinguishable in the ultraviolet spectrum (eg, C. Minks, R. Huber, L. Moroderand N. Budisa, Anal. Biochem., 284: 29 (2000)), and also using trifluoromethionine to displace the methionine of bacteriophage T4 lysozyme and its interaction with the chitooligosaccharide ligand ¹⁹ F NMR are tested by (e.g. H.Duewel, E.Darb, V.Robinsonand J.F.Honek, Biochemistry , 36: 3404 (1997)), leucine further inserted trifluoroacetic leucine instead of leucine Resulting in increased thermal and chemical stability of the zipper protein. For example, Y.M. Tang, G.M. Ghirlanda, W.M. A. Petka, T .; Nakajima, W .; F. DeGradoand D.D. A. Tirrrell, Angew. Chem. Int. Ed. Engl. 40: 1494 (2001). Furthermore, selenomethionine and telluromethionine are incorporated into various recombinant proteins to facilitate phase determination by X-ray crystallography. For example, W.W. A. Hendrickson, J.M. R. Hortonand D. M.M. Lemaster, EMBO J. et al. 9: 1665 (1990); O. Boles, K.M. Lewisinki, M .; Kunkle, J .; D. Odom, B.M. Dunlap, L.M. Lebiodaand M.M. Hatada, Nat. Struct. Biol. 1: 283 (1994); Budisa, B .; Steipe, P.M. Demage, C.I. Eckersorn, J.M. Kellermannand R.K. Huber, Eur. J. et al. Biochem. , 230: 788 (1995); Budisa, W .; Karnblock, S .; Steinbacher, A.M. Humm, L.M. Prade, T .; Neufeind, L.M. Moroderand R.M. Huber, J .; Mol. Biol. 270: 616 (1997). Methionine analogs with alkene or alkyne functional groups can also be efficiently inserted, allowing additional modification of proteins by chemical means. For example, J. et al. C. M.M. vanHest and D.W. A. Tirrrell, FEBS Lett. 424: 68 (1998); C. M.M. van Hest, K.M. L. Kiickand D. A. Tirrell, J. Am. Chem. Soc. 122: 1282 (2000); L. Kiick and D.C. A. See Tirrrell, Tetrahedron, 56: 9487 (2000).

The success of this method generally relies on the recognition of unnatural amino acid analogs by aminoacyl-tRNA synthetases that require high selectivity to ensure fidelity of protein translation. Therefore, the range of chemical functional groups accessible by this method is limited. For example, thiaproline can be quantitatively incorporated into proteins, but not oxaproline or selenoproline. N. Budisa, C.I. Minks, F.M. J. et al. Medrano, J. et al. Lutz, R.A. Huberand L. Moroder, Proc. Natl. Acad. Sci. US A. 95: 455 (1998). One way to expand the scope of this method is to alleviate the substrate specificity of aminoacyl-tRNA synthetase, which has been successful in a few examples. For example, replacing Ala ²⁹⁴ with Gly with E. coli phenylalanyl-tRNA synthetase (PheRS) increases the size of the substrate binding pocket, resulting in tRNAPhe being acylated with p-Cl-phenylalanine (p-Cl-Phe). The M.M. Ibba, P.M. Kastand H.C. See Hennecke, Biochemistry , 33: 7107 (1994). When this mutant PheRS is introduced into an E. coli strain, p-Cl-phenylalanine or p-Br-phenylalanine can be incorporated instead of phenylalanine. For example, M.M. Ibba and H.I. Hennecke, FEBSLett. 364: 272 (1995); Sharma, R .; Furter, P.A. Kastand D.C. A. Tirrrell, FEBS Lett. 467: 37 (2000). Similarly, a point mutation Phe130Ser near the amino acid binding site of E. coli tyrosyl-tRNA synthetase has shown that azatyrosine can be incorporated more efficiently than tyrosine. F. Hamano-Takaku, T .; Iwama, S .; Saito-Yano, K .; Takaku, Y. et al. Monden, M.M. Kitatatake, D.A. Solland S.M. Nishimura, J. et al . Biol. Chem. 275: 40324 (2000).

Aminoacylation fidelity is maintained at both the non-cognate intermediate and product substrate discrimination and proofreading levels. Thus, an alternative strategy for incorporating unnatural amino acids into proteins in vivo is the modification of synthetases with a proofreading mechanism. These synthetases cannot distinguish amino acids that are structurally similar to cognate natural amino acids and therefore cannot be activated. This error is corrected at another site to deacylate amino acids misloaded from the tRNA and maintain protein translation fidelity. If the proofreading activity of synthetase ceases to function, a mis-activated structural analog may fall out of the editing function and be incorporated. This approach has recently been demonstrated with valyl-tRNA synthetase (ValRS). V. Doring, H.C. D. Mootz, L.M. A. Nangle, T .; L. Hendrickson, V.M. deCrecy-Lagard, P.M. Schimmel and P.M. See Marliere, Science , 292: 501 (2001). If ValRS mistakenly aminoacylates tRNA Val with Cys, Thr or aminobutyric acid (Abu), these non-cognate amino acids are hydrolyzed by the editing domain. After random mutagenesis of the E. coli chromosome, mutant E. coli strains with mutations at the ValRS editing site were selected. This editing deficient ValRS erroneously loads Cys into tRNAVal. Since Abu is sterically similar to Cys (with Abu replacing the -SH group of Cys with -CH3), when this mutant E. coli strain is grown in the presence of Abu, mutant ValRS Incorporate into. According to mass spectrometry, about 24% of the valine in natural proteins is replaced with Abu at each valine position.

At least one significant drawback of the above method is the substitution of all sites corresponding to specific natural amino acids in the protein. Also, the degree of integration of natural and unnatural amino acids is not constant and it is difficult to completely deplete cognate natural amino acids inside the cell, so quantitative substitution is rarely achieved. These strategies also have the disadvantage that it is difficult to test mutant proteins in living cells, since multisite integration of analogs results in toxicity. Finally, this method is generally applicable only to approximate structural analogs of common amino acids because it must be able to substitute at every site in the genome.

Numerous small proteins containing novel amino acids have also been synthesized by solid phase synthesis and semisynthetic methods. For example, see the following publications and references cited therein. Crick, F.M. J. et al. C. Barrett, L .; Brenner, S.M. Watts-Tobin, R.W. General nature of the genetic code forproteins. Nature , 192: 1227-1232 (1961); Hofmann, K .; Bohn, H .; Studies polypeptides. XXXVI. The effect of pyrazole-imposition replacements on the S-protein activating potency of an S-peptide fragments, J. MoI . Am. Chem. , 5914-5919 (1966); Kaiser, E .; T.A. Syntheticapproaches to biologically active peptides and proteins including enzymes, Acc. Chem. Res. 47-54 (1989); Nakatsuka, T .; , Sasaki, T .; Kaiser, E .; T.A. Peptide segment coupling catalyzed by the semi-enzyme thiosubtilisin, J. MoI . Am. Chem. Soc. , 3808-3810 (1987); Schnolzer, M .; , Kent, SB H.M. Constructing proteinsby dovetailing unprotected synthetic peptides: backbone-engineered HIV protease, Science , 221-225 (1992); M.M. Semisynthetic peptides and proteins, CRCCrit. Rev. Biochem. , 255-301 (1981); E. Protein engineering by chemical means? ProteinEng. 151-157 (1987); and Jackson, D .; Y. , Burnier, J .; Quan, C .; Stanley, M .; Tom, J .; Wells, J .; A. Designed Peptide Ligation for Total Synthesis of Ribonuclease A with Unreal Catalytic Residues, Science , 243 (1994).

Chemical modifications have been used to introduce various non-natural side chains such as cofactors, spin labels and oligonucleotides into proteins in vitro. For example, Corey, D .; R. Schultz, P .; G. Generation of a hybrid sequence-specific single-stranded deoxyribonuclease, Science , 283 (4832): 1401-1403 (1987); T.A. Lawrence D. S. , Rokita, S .; E. The chemical modification of enzymatic specificity, Rev Biochem. 54: 565-595 (1985); Kaiser, E .; T.A. Lawrence, D .; S. Chemical mutation of enzyme active sites, Science , 226 (4674) 505-511 (1984); E. , NanciA, Koshland, D .; E. Properties of thiol-substilisin, J. et al . Biol. Chem. 243 (24): 6392-6401 (1968); Polgar, L .; B. , M.M. L. New enzyme containinginga synthetically formed site. Thiol-substilisin. J. et al. Am. Chem. Soc. 88: 3153-3154 (1966); and Pollac, S .; J. et al. Nakayama, G .; Schultz, P.M. G. See Introduction of nucleophiles and spectroscopic probes into antibody combining sites, Science , 242 (4881): 1038-1040 (1988).

Alternatively, biosynthetic methods utilizing chemically modified aminoacyl-tRNA have been used to incorporate several biophysical probes into in vitro synthesized proteins. See the following publications and cited references. Brunner, J. et al. New Photolabeling and crosslinking methods, Annu. Rev. Biochem , 62: 483-514 (1993); and Krieg, U., et al. C. , Walter, P .; Honson, A .; E. Photocrosslinking of the signal sequence of nascent prepropractin of the 54-kiloidon polypeptide of the signal recognition particle . Natl. Acad. Sci , 83 (22): 8604-8608 (1986).

It has previously been shown that unnatural amino acids can be incorporated into proteins in a site-specific manner by adding chemically aminoacylated suppressor tRNAs to protein synthesis reactions programmed with genes containing the desired amber nonsense mutation. Using these approaches, an auxotrophic strain of a particular amino acid can be used to replace many of the 20 common amino acids with approximate structural homologues (eg, phenylalanine to fluorophenylalanine). For example, Noren, C.I. J. et al. , Anthony-Chill, Griffith, M .; C. Schultz, P .; G. Ageneral method for-specific information of unnatural amino acids into proteins, Science , 244: 182-188 (1989); W. Nowak et al., Science 268: 439-42 (1995); Bain, J. et al. D. , Glabe, C.I. G. , Dix, T .; A. , Chamberlin, A .; R. , Diala, E .; S. Biosyntheticite-specific Information of a non-naturalamino acid intoa polypeptide, J. Bios . Am Chem Soc , 111: 8013-8014 (1989); Budisa et al . , FASEBJ. 13: 41-51 (1999); Ellman, J. et al. A. Mendel, D .; Anthony-Chill, S .; Noren, C .; J. et al. Schultz, P .; G. Biosynthetic method for introductive unnatural amino acid site-specifically into proteins. Methodsin Enz. , 301-336 (1992); and Mendel, D .; Cornish, V .; W. & Schultz, P.A. G. Site-Directed Mutagenesis an an Expanded Genetic Code, Annu. Rev. Biophys. Biomol. Struct. 24, 435-62 (1995).

For example, a suppressor tRNA that recognizes the stop codon UAG was generated and chemically aminoacylated with an unnatural amino acid. Conventional site-directed mutagenesis was used to introduce a stop codon TAG at the intended site of the protein gene. For example, Sayers, J. et al. R. , Schmidt, W.M. Eckstein, F.M. See 5 ', 3' Exonuclease in phosphorothioate-based oligonucleotide-directed mutagenesis, Nucleic Acids Res , 16 (3): 791-802 (1988). When the acylated suppressor tRNA and the mutant gene were combined in an in vitro transcription / translation system, an unnatural amino acid was incorporated in response to the UAG codon, and a protein containing this amino acid at a specific position was obtained. According to experiments using [ ³ H] -Phe and experiments using α-hydroxy acids, only the desired amino acid is incorporated at the position specified by the UAG codon and this amino acid is incorporated at any other position in the protein. Not found out. See, for example, Noren et al., Supra; and Ellman, J. et al. A. Mendel, D .; Schultz, P .; G. See Site-specific incorporation of novel backbone structures into proteins, Science , 197-200 (1992).

In general, these in vitro approaches are difficult to site-specifically incorporate amino acids, have to be simple derivatives of 20 common amino acids, or are inherent in the synthesis of large proteins or peptide fragments. There are limitations such as problems.

Microinjection methods have also been used to incorporate unnatural amino acids into proteins. For example, M.M. W. Nowak, P.M. C. Kearney, J .; R. Sampson, M .; E. Saks, C.I. G. Labarca, S .; K. Silverman, W.M. G. Zhong, J. et al. Thorson, J .; N. Abelson, N.A. Davidson, P.M. G. Schultz, D.M. A. Doughertyand H.M. A. Lester, Science , 268: 439 (1995); A. Dougherty, Cuur. Opin. Chem. Biol. 4: 645 (2000). Two in vitro-produced RNA species, namely mRNA encoding a target protein having a UAG stop codon at the desired amino acid position and an amber suppressor tRNA aminoacylated with a desired unnatural amino acid are simultaneously injected into Xenopus oocytes. . In this way, the translation mechanism of the oocyte inserts an unnatural amino acid at the position specified by UAG. This method allows in vivo structure-function studies of integral membrane proteins, but is generally not applicable to in vitro expression systems. For example, fluorescent amino acids are incorporated into the tachykinin neurokinin-2 receptor and distances are measured by fluorescence resonance energy transfer (eg, G. Turcatti, K. Nemeth, MD Edgerton, U. Meseth, F. Talabot, M. Peitsch, J. Knowles, H. Vogeland A. Chollet, J. Biol. Chem. , 271: 19991 (1996)) or by incorporating biotinylated amino acids to identify surface residues in ion channels (eg, J. P. Gallivan, H.A. Lesterand D.A. Dougherty, Chem. Biol. , 4: 739 (1997)), monitored confocal changes in ion channels in real time using caged tyrosine analogs. Or For example J.C.Miller, S.K.Silverman, P.M.England, D.A.Doughertyand H.A.Lester , Neuron, 20: 619 (1998) refer), ion channels using α-hydroxy amino acids And search for its opening and closing mechanism (eg, PM England, Y. Zhang, DA Doughertyand HA Lester, Cell , 96:89 (1999); and T. Lu, A Y. Ting, J. Mainland, LY Jan, PG Schultzand J. Yang, Nat. Neurosci. , 4: 239 (2001)).

However, the microinjection method has disadvantages such as that suppressor tRNA must be chemically in vitro aminoacylated with an unnatural amino acid, and that acylated tRNA is consumed as a stoichiometric reagent during translation and cannot be regenerated. is there. Due to this drawback, suppression efficiency is poor and protein yield is low, so it is necessary to quantify mutant proteins with sensitive techniques such as electrophysiological measurements. Furthermore, this method can only be applied to cells capable of microinjection.

If unnatural amino acids can be directly incorporated into a protein in vivo, the yield of mutant protein is increased and technically easy to test the mutant protein in cells and possibly living organisms. And has the advantage that these mutant proteins can be used for therapeutic treatment. If unnatural amino acids with various dimensions, acidity, nucleophilicity, hydrophobicity, etc. can be incorporated into proteins, the protein structure will be rationally and systematically manipulated to explore protein functions and new The possibility of creating new proteins or organisms with properties is greatly expanded. However, the method is difficult due to the complex nature of the tRNA-synthetase interaction required to increase the fidelity of protein translation.

Therefore, it is necessary to improve the method so that the biosynthetic mechanism of cells can be modified more efficiently and effectively. As is apparent from the disclosure below, the present invention addresses these and other needs.

The present invention provides a composition of components for use in protein biosynthesis machinery comprising an orthogonal tRNA-aminoacyl tRNA synthetase pair and the individual components of the pair. Also provided are methods for making and selecting orthogonal tRNAs, orthogonal aminoacyl tRNA synthetases and pairs thereof that can use unnatural amino acids. The compositions of the present invention comprise a novel orthogonal tRNA-aminoacyl tRNA synthetase pair (eg, mutRNATyr-mutTyrRS pair, mutRNALeu-mutLeuRS pair, mutRNAThr-mutThrRS pair, mutRNAGlu-mutGluRS pair, etc.). The novel orthogonal pair can be used to incorporate unnatural amino acids into a polypeptide in vivo. Another aspect of the invention involves the selection of orthogonal pairs.
The compositions of the present invention comprise an orthogonal aminoacyl tRNA synthetase (O-RS), which optionally aminoacylates the orthogonal tRNA (O-tRNA) with an unnatural amino acid, optionally in vivo. In one embodiment, the O-RS comprises a nucleic acid comprising a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 4-34 (see Table 5) and its complementary polynucleotide sequence. In another embodiment, the O-RS has improved or enhanced enzymatic properties relative to a non-natural amino acid over a natural amino acid (eg, one of the 20 known amino acids), eg, K _m is higher or lower and k _cat Is high or low, and k _cat / K _m is high or low.

The unnatural amino acids of the present invention include a variety of substances. For example, but not limited to, O-methyl-L-tyrosine, L-3- (2-naphthyl) alanine, 3-methylphenylalanine, O-4-allyl-L-tyrosine, 4-propyl-L- Tyrosine, tri-O-acetyl-GlcNAc β-serine, L-Dopa, fluorinated phenylalanine, isopropyl-L-phenylalanine, p-azido-L-phenylalanine, p-acyl-L-phenylalanine, p-benzoyl-L-phenylalanine, Examples include molecules such as L-phosphoserine, phosphonoserine, phosphonotyrosine, p-iodophenylalanine, p-bromophenylalanine, p-amino-L-phenylalanine, and isopropyl-L-phenylalanine. Further examples include (but are not limited to) non-natural analogs of tyrosine amino acids; non-natural analogs of glutamine amino acids; non-natural analogs of phenylalanine amino acids; non-natural analogs of serine amino acids; non-natural analogs of threonine amino acids Body; alkyl, aryl, acyl, azide, cyano, halo, hydrazine, hydrazide, hydroxyl, alkenyl, alkynyl, ether, thiol, sulfonyl, seleno, ester, thioacid, boric acid, boronic acid, phospho, phosphono, phosphine, heterocycle , Enones, imines, aldehydes, hydroxylamines, keto or amino substituted amino acids or any combination thereof; amino acids with photocrosslinking groups; amino acids with spin labels; fluorescent amino acids: amino acids with novel functional groups; shared or non-shared with another molecule Interacting amino acids Metal-binding amino acids; Metal-containing amino acids; Radioactive amino acids; Photo-caged amino acids; Photoisomerizable amino acids; Biotin or biotin analog-containing amino acids; Glycosylated or sugar chain-modified amino acids; Keto-containing amino acids; Amino acids containing ethers; heavy atom-substituted amino acids; chemically or photodegradable amino acids; amino acids having extended side chains; amino acids containing toxic groups; sugar-substituted amino acids (eg, sugar-substituted serines); Redox active amino acids; alpha-hydroxy containing acids; aminothioic acid containing amino acids; alpha, alpha disubstituted amino acids; beta amino acids; and cyclic amino acids other than proline.

The present invention relates to a coding polynucleotide sequence selected from SEQ ID NOs: 4-34 (see Table 5 for sequences), a coding polynucleotide sequence encoding a polypeptide selected from SEQ ID NOs: 35-66, a substance of said polynucleotide sequence Also specifically included are polynucleotide sequences that hybridize under high stringency conditions over their entire length, and polypeptides comprising an amino acid sequence encoded by a coding polynucleotide sequence selected from the complementary sequence of any of the foregoing sequences. Further, the polypeptide optionally encodes an amino acid sequence selected from orthogonal aminoacyl tRNA synthetases and / or SEQ ID NOs: 35-66.

The present invention comprises a polynucleotide sequence selected from SEQ ID NOs: 1 to 3 (or its complementary polynucleotide sequence) and a polynucleotide sequence that hybridizes under high stringency conditions over substantially the entire length of the polynucleotide sequence. Also included are nucleic acids comprising a polynucleotide sequence selected from the group consisting of: The nucleic acid also includes embodiments wherein the polynucleotide sequence comprises an orthogonal tRNA and / or the polynucleotide sequence forms a complementary pair with an orthogonal aminoacyl tRNA synthetase (optionally selected from those having the sequences of SEQ ID NOs: 35-66). .

The invention also includes compositions of orthogonal tRNA (O-tRNA), where the O-tRNA recognizes a selector codon and the O-tRNA is preferentially aminoacylated with an unnatural amino acid by an orthogonal aminoacyl tRNA synthetase. In one aspect, the O-tRNA comprises a nucleic acid comprising a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1-3 (see Table 5) and its complementary polynucleotide sequence.

The selector codon of the present invention extends the genetic codon frame of the protein biosynthesis machinery. For example, as a selector codon, for example, a unique 3-base codon (composed of natural or non-natural bases), a nonsense codon (for example, a stop codon such as an amber codon or an opal codon), a non-natural codon, a rare codon, a codon including at least 4 bases , Codons containing at least 5 bases, codons containing at least 6 bases, and the like.

In one embodiment, the O-tRNA can comprise an orthogonal aminoacyl tRNA synthetase (O-RS) (optionally in the composition), eg, the O-tRNA and the O-RS are complementary (eg, O-tRNA / O-RS pair). In one embodiment, the pair includes, for example, a mutRNATyr-mutTyrRS pair (eg, a mutRNATyr-SS12TyrRS pair), a mutRNALeu-mutLeuRS pair, a mutRNAThr-mutThrRS pair, a mutRNAGlu-mutGluRS pair, and the like. In another embodiment, the pair is other than E. coli-derived mutRNAGln-mutGlnRS, yeast-derived mutRNAAsp-mutAspRS or yeast-derived mutRNAPheCUA-mutPheRS, and these pairs do not have the characteristics of the pairs of the present invention.

O-tRNA and O-RS can be induced by mutation of natural tRNA and RS derived from various organisms. In one aspect, the O-tRNA and the O-RS are derived from at least one organism, for example, Methanococcus jannaschii, Methanobacterium thermoautotropicum, Halobacterium, Escherichia coli, A. et al. fulgidus, P.A. furiosus, P.M. horikoshii, A.H. pernix, T .; It is a prokaryotic organism such as thermophilus. In some cases, organisms are, for example, plants (eg complex plants such as monocotyledonous plants or dicotyledonous plants), algae, fungi (eg yeast), animals (eg mammals, insects, arthropods etc.), insects, protozoa It is a eukaryote such as a living organism. In some cases, the O-tRNA is induced by mutation of a natural tRNA derived from a first organism and the O-RS is induced by a mutation of a natural RS derived from a second organism. In one aspect, O-tRNA and O-RS can be derived from mutant tRNA and mutant RS.

O-tRNA and O-RS can optionally be isolated from various organisms. In one aspect, the O-tRNA and O-RS are isolated from at least one organism, such as Methanococcus jannaschii, Methanobacterium thermoautotropicum, Halobacterium, Escherichia coli, A. et al. fulgidus, P.A. furiosus, P.M. horikoshii, A.H. pernix, T .; It is a prokaryotic organism such as thermophilus. In some cases, organisms are, for example, plants (eg complex plants such as monocotyledonous plants or dicotyledonous plants), algae, fungi (eg yeast), animals (eg mammals, insects, arthropods etc.), insects, protozoa It is a eukaryote such as a living organism. Optionally, the O-tRNA is isolated from a natural tRNA derived from a first organism and the O-RS is isolated from a natural RS derived from a second organism. In one embodiment, the O-tRNA and O-RS optionally comprise one or more O-tRNA and / or O-RS derived from one or more organisms (including prokaryotes and / or eukaryotes). ) Can be isolated from one or more libraries.

In another aspect, the compositions of the present invention can be incorporated into cells. In some cases, the compositions of the invention can be incorporated into in vitro translation systems.

The present invention also provides methods for making components of protein biosynthetic machinery (eg, O-RS, O-tRNA and orthogonal O-tRNA / O-RS pairs) that can be used to incorporate unnatural amino acids. Also provided are methods for selecting orthogonal tRNA-tRNA synthetase pairs for use in an in vivo translation system of an organism. The unnatural amino acids and selector codons used in the method are described above and below.

A method for producing at least one recombinant orthogonal aminoacyl-tRNA synthetase (O-RS) is described in (a) a first organism (eg, Methanococcus jannaschii, Methanobacterium thermoautotrophicum, Halobacterium, ur. Ur. Creating a library of RSs (optionally mutated) derived from at least one aminoacyl-tRNA synthetase (RS) from A. pernix, T. thermophilus, etc. (b) non- A member that aminoacylates an orthogonal tRNA (O-tRNA) in the presence of the natural amino acid and the natural amino acid is RS ( Providing a pool of active (optionally mutant) RS by optionally selecting (and / or screening) from a library of mutant RS) and / or (c) in the absence of unnatural amino acids. Selecting a pool of active RSs (eg, mutant RS) that preferentially aminoacylate the O-tRNA (optionally by negative selection) to at least preferentially aminoacylate the O-tRNA with an unnatural amino acid. Providing one recombinant O-RS. Recombinant O-RS produced by the above method is also included in the present invention.

In one aspect, the RS is an inactive RS. Inactive RSs can be generated by mutating active RSs. For example, an inactive RS mutates at least about 1, at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, or at least about 10 or more amino acids to another amino acid (eg, alanine). Can be produced.

A library of mutant RSs can be generated using various mutagenesis techniques known in the art. For example, mutant RSs can be made by site-specific mutations, random mutations, recombinant mutations that produce diversity, chimeric constructs, and other methods described herein or known in the art. it can.

In one embodiment, an active member (eg, a member that aminoacylates an orthogonal tRNA (O-tRNA)) in the presence of an unnatural amino acid and a natural amino acid is selected from a library of RS (and optionally mutant RS) (and / or Or screening) a library of RS with a positive selection or screening marker (such as an antibiotic resistance gene) including at least one selector codon (such as an amber, ocher or opal codon) and (optionally a mutant). Introduce into multiple cells, grow multiple cells in the presence of a selection agent, and survive in the presence of selection and / or screening agent by suppressing at least one selector codon in a positive selection or screening marker Cells (or show a specific response) And includes providing a subset of positively selected cells that contains the pool of RS (optionally mutant) activity. In some cases, the selection and / or screening agent concentration may be varied.

In one aspect, the positive selectable marker is a chloramphenicol acetyltransferase (CAT) gene and at least one selector codon is an amber stop codon within the CAT gene. In some cases, the positive selectable marker is a β-lactamase gene and at least one selector codon is an amber stop codon within the β-lactamase gene. In another aspect, positive screening markers include fluorescent or luminescent screening markers or affinity-based screening markers (eg, cell surface markers).

In one embodiment, negatively selecting or screening a pool of active RS (optionally mutant) that preferentially aminoacylates an O-tRNA in the absence of an unnatural amino acid comprises a negative comprising at least one selector codon. Selective or screening markers (eg, antibiotic resistance genes such as chloramphenicol acetyltransferase (CAT) gene) multiple cells of a second organism with a pool of activities (optionally mutants) RS from positive selection or screening In a first medium that has been introduced into and added with a non-natural amino acid and a selection or screening substance, or exhibits a specific screening response, but survives in a second medium without the addition of a non-natural amino acid and a selection or screening substance. Or show a specific response The identification of cells that can not, thereby providing surviving cells or screened cells with the at least one recombinant O-RS. For example, an appropriate recombinant O-RS is determined, optionally using a CAT identification protocol as a positive selection and / or negative screen. For example, a pool of clones is replicated on a growth plate supplemented with CAT (including at least one selector codon), optionally in the presence or absence of one or more unnatural amino acids. Thus, colonies that grow only on plates supplemented with unnatural amino acids are considered to contain recombinant O-RS. In one aspect, the selected (and / or screening) substance concentration is varied. In certain aspects, the first organism and the second organism are different. That is, the first and / or second organisms optionally include prokaryotes, eukaryotes, mammals, E. coli, fungi, yeasts, protozoa, eubacteria, plants, insects, protists, and the like. In another aspect, the screening marker comprises a fluorescent or luminescent screening marker or an affinity based screening marker.

In another aspect, screening or selecting (eg, negative selection) a pool of active (optionally mutant) RSs isolates the pool of active mutant RSs from positive selection step (b) and at least 1 A pool of negative selection or screening markers containing one selector codon (eg, a toxic marker gene containing at least one selector codon, eg, a ribonuclease barnase gene) and an active (optionally mutant) RS of a second organism In a first medium that does not contain an unnatural amino acid and survives or exhibits a specific screening response, but survives or exhibits a specific screening response in a second medium with an unnatural amino acid. Identify cells that cannot and at least be specific for unnatural amino acids Thereby providing surviving or screened cells with the seeds of the recombinant O-RS. In one aspect, the at least one selector codon includes about 2 or more selector codons. In such an embodiment, optionally, at least one selector codon includes two or more selector codons, and the first and second organisms are different (eg, each organism is optionally a prokaryote, eukaryote, Mammals, E. coli, fungi, yeast, protozoa, eubacteria, plants, insects, protists, etc.). Further, in certain aspects, the negative selectable marker comprises a ribonuclease barnase gene (including at least one selector codon). In other aspects, screening markers optionally include fluorescent or luminescent screening markers or affinity based screening markers. In the embodiments described herein, screening and / or selection optionally includes variation of screening and / or selection stringency.

In one aspect, the method of producing at least one recombinant orthogonal aminoacyl-tRNA synthetase (O-RS) further comprises (d) isolating at least one recombinant O-RS; and (e) at least one Generating a second set of (optionally mutated) O-RSs derived from the recombinant O-RS of (f), and (f) a mutant O- capable of preferentially aminoacylating the O-tRNA. Repeating steps (b) and (c) until RS is obtained. Optionally, steps (d)-(f) are repeated, for example at least about 2 times. In one aspect, a second set of mutant O-RS derived from at least one recombinant O-RS is mutagenized (eg, random mutagenesis, site-directed mutagenesis, recombination or any combination thereof). ).

The selection / screening step (eg positive selection / screening step (b), negative selection / screening step (c) or both positive and negative selection / screening steps (b) and (c)) in the above method is optionally selected / Includes variation in screening stringency. In another embodiment, the positive selection / screening step (b), negative selection / screening step (c) or both positive and negative selection / screening steps (b) and (c) comprise the use of a reporter, the reporter comprising fluorescent activity Detected by cell sorting (FACS) or the reporter is detected by luminescence. Optionally, the reporter is displayed on the cell surface, phage display, etc., and is selected based on affinity or catalytic activity for the unnatural amino acid or analog. In one embodiment, the mutant synthase is displayed on the cell surface, phage display, and the like.

In the methods described herein, optionally the unnatural amino acid is O-methyl-L-tyrosine, L-3- (2-naphthyl) alanine, 3-methylphenylalanine, O-4-allyl-L-tyrosine, 4- Propyl-L-tyrosine, tri-O-acetyl-GlcNAcβ-serine, L-Dopa, fluorinated phenylalanine, isopropyl-L-phenylalanine, p-azido-L-phenylalanine, p-acyl-L-phenylalanine, p-benzoyl- Including embodiments selected from L-phenylalanine, L-phosphoserine, phosphonoserine, phosphonotyrosine, p-iodophenylalanine, p-bromophenylalanine, p-amino-L-phenylalanine, and isopropyl-L-phenylalanine. Also included in the present invention are recombinant O-RSs produced by the methods described herein.

A method for producing recombinant orthogonal tRNA (O-tRNA) comprises: (a) creating a library of mutant tRNAs derived from at least one tRNA (eg, suppressor tRNA) derived from a first organism; (B) selecting a library of tRNAs that are aminoacylated (optionally mutant) by aminoacyl tRNA synthetase (RS) from a second organism in the absence of RS from the first organism (eg, negative) Selection) or screening to provide a pool of tRNAs (optionally mutants), and (c) tRNAs (optionally mutants) that are aminoacylated by the introduced orthogonal RS (O-RS). At least one selector code by selecting or screening from a pool of It recognizes, comprising the step of providing at least one recombinant O-tRNA is not efficiency recognized by the RS from the second organism and is preferentially aminoacylated by the O-RS. In certain embodiments, the at least one tRNA is a suppressor tRNA and / or a unique 3 base codon of natural or unnatural base, nonsense codon, rare codon, non-natural codon, codon comprising at least 4 bases, amber codon, ocher codon Or an opal stop codon. In one aspect, the recombinant O-tRNA has improved orthogonality. Of course, in certain embodiments, the O-tRNA is optionally introduced from the first organism into the second organism without the need for modification. In various embodiments, the first organism and the second organism are the same or different and optionally a prokaryote (e.g., Methanococcus jannaschii, Methanobacterium thermoautotropicum, Escherichia coli, Halobacterium, eukaryote, eubacteria, fungus, yeast, Selected from bacteria, plants, insects, protists, etc. Furthermore, the recombinant tRNA is optionally aminoacylated with an unnatural amino acid, which is naturally or genetically engineered in vivo. The unnatural amino acid is optionally added to the growth medium of at least the first or second organism.

In one aspect, selecting (eg, negative selection) or screening a library of tRNAs that are aminoacylated (optionally mutant) by an aminoacyl tRNA synthetase (step (b)) comprises at least one selector codon. A library of tRNAs with a toxic marker gene (or a gene that induces the production of toxic or static substances or a gene that is essential to an organism and contains at least one selector codon) and (optionally a mutant) Introducing into a plurality of cells from two organisms and selecting viable cells comprising a pool of tRNAs comprising at least one orthogonal or non-functional tRNA (optionally mutant). For example, viable cells can be selected by using a comparative specific cell density assay.

In another aspect, the toxicity marker gene can include two or more selector codons. In another embodiment of the method, the toxicity marker gene is a ribonuclease barnase gene, and the ribonuclease barnase gene comprises at least one amber codon. Optionally, the ribonuclease barnase gene can include more than one amber codon.

In one aspect, selecting or screening a member (optionally mutant) tRNA from a pool of tRNAs that is aminoacylated by an introduced orthogonal RS (O-RS) comprises a drug resistance gene (eg, at least one selector codon ( A positive selection or screening marker gene comprising, for example, a β-lactamase gene comprising at least one amber codon) or a gene essential for an organism or a gene that induces detoxification of a toxic substance, O-RS, and optionally a mutant ) Aminoacyl by O-RS by introducing a pool of tRNAs into a plurality of cells from a second organism and identifying viable or screened cells that have grown in the presence of a selection or screening agent (eg, antibiotic) Responds to at least one selector codon And it includes providing a cell pools with at least one recombinant tRNA inserts an amino acid into a translation product encoded by the positive marker gene. In another aspect, the selection and / or screening agent concentration is varied. Recombinant O-tRNA produced by the method of the present invention is also included in the present invention.

Also provided are methods for producing specific O-tRNA / O-RS pairs. The method comprises (a) generating a library of tRNAs derived from at least one tRNA derived from a first organism, and (b) a second in the absence of RS derived from the first organism. Providing a pool of (optionally mutant) tRNAs by negatively selecting or screening a library of (optionally mutant) tRNAs that are aminoacylated by aminoacyl tRNA synthetase (RS) from And (c) providing at least one recombinant O-tRNA by selecting or screening a member (optionally a mutant) that is aminoacylated by the introduced orthogonal RS (O-RS) from a pool of tRNAs Including the steps of: At least one recombinant O-tRNA recognizes the selector codon, is not efficiently recognized by the RS from the second organism, and is preferentially aminoacylated by the O-RS. The method further comprises (d) creating a library of (optionally mutant) RSs derived from at least one aminoacyl-tRNA synthetase (RS) from a third organism; Activity (optionally mutant) by selecting or screening from a library of mutant RSs a member that preferentially aminoacylates at least one recombinant O-tRNA in the presence of the natural amino acid and the natural amino acid Providing a pool of RS, and (f) negatively selecting a pool of activities (optionally mutant) RS that preferentially aminoacylates at least one recombinant O-tRNA in the absence of unnatural amino acids or By screening, at least one recombinant O-RS specific for the unnatural amino acid and at least one Comprising providing at least one specific O-tRNA / O-RS pairs containing recombinant O-tRNA. Specific O-tRNA / O-RS pairs produced by the method are also included in the present invention. For example, specific O-tRNA / O-RS pairs include, for example, mutRNATyr-mutTyrRS pairs (for example, mutRNATyr-SS12TyrRS pairs), mutRNALeu-mutLeuRS pairs, mutRNAThr-mutThrRS pairs, mutRNAGlu-mutGluRS pairs, and the like. Further, the method includes the case where the first organism and the third organism are the same (eg, Methanococcus jannaschii).

A method of selecting an orthogonal tRNA-tRNA synthetase pair for use in an in vivo translation system of a second organism is also included in the present invention. The method comprises introducing a marker gene, a tRNA, and an aminoacyl-tRNA synthetase (RS) isolated or derived from a first organism into a first set of cells derived from a second organism, the marker gene and the tRNA. In a replicating set of cells derived from a second organism, and the first set and replicating set of cells are grown in the presence of a selection or screening agent, surviving in the first set but surviving in the replicating set. Select cells that cannot be selected, or select cells that show a specific screening response in the first set but cannot show a specific screening response in the replication set, and use them in the in vivo translation system of the second organism Providing a live or screened cell comprising an orthogonal tRNA-tRNA synthetase pair for In one aspect, the comparison and selection or screening includes an in vivo complementation assay. The selection or screening substance concentration may be varied.

The organism of the present invention includes various organisms and various combinations. For example, the first organism and the second organism of the method of the present invention may be the same or different. In one embodiment, the first organism is optionally a prokaryote (eg, Methanococcus jannaschii, Methanobacterium thermoautotropicum, Halobacterium, Escherichia coli, A. fulgius, P. furiosus, P. horiosus, P. horiosus, P. Alternatively, the first organism is optionally a plant (eg, a complex plant such as a monocotyledonous or dicotyledonous plant), algae, protists, fungi (eg, yeast), animals (eg, mammals, insects, arthropods). Eukaryotic organisms such as animals) may be used. In another aspect, the second organism is Methanococcus jannaschii, Methanobacterium thermoautotropicum, Halobacterium, Escherichia coli, A. et al. fulgidus, Halobacterium, P. et al. furiosus, P.M. horikoshii, A.H. pernix, T .; It is a prokaryotic organism such as thermophilus. Alternatively, the second organism may be a eukaryote such as a yeast, animal cell, plant cell, fungus, mammal or the like. In various embodiments, the first organism and the second organism are different.

Various methods (above) of the present invention optionally include embodiments in which the selection or screening includes one or more positive or negative selections or screening (eg, changes in amino acid permeability, changes in translation efficiency, and changes in translation fidelity). Furthermore, the one or more changes are based on mutations in one or more genes in the organism, optionally using orthogonal tRNA-tRNA synthetase pairs to produce the protein. The selection and / or screening of the present invention optionally includes embodiments using at least two selector codons within one or more selection genes or within one or more screening genes. Such multiple selector codons are optionally included in the same gene or in different screening / selection genes. Further, the multiple selector codons optionally used are optionally different selector codons or include the same type of selector codon.

An additional feature of the present invention is a kit. For example, the kit comprises one or more of the above translation systems (eg, cells), one or more unnatural amino acids, eg, suitable packaging material, a container for holding the components of the kit, and a method of the invention. Instructions for implementation and / or other ingredients may be included. Similarly, translation system products (eg, containing unnatural amino acids) in the form of a kit containing, for example, a container for holding the components of the kit and instructions and / or other components for performing the methods of the invention. Proteins such as EPO analogs) can also be provided.

FIG. 1 schematically illustrates site-specific in vivo protein incorporation of unnatural amino acids. Orthogonal aminoacyl tRNA synthetases aminoacylate orthogonal tRNAs with unnatural amino acids. The acylated orthogonal tRNA inserts an unnatural amino acid at a position specified by a selector codon (for example, a unique codon) introduced into the gene encoding the desired protein.

2A and B schematically show an example of a method for selecting an active synthetase that is aminoacylated with an unnatural amino acid. FIG. 2A outlines the selection / screening of aminoacyl-tRNA synthetases with unnatural amino acid specificity. Positive selection identifies active synthetases with natural or non-natural amino acid specificity, and negative selection excludes synthetases with natural amino acid specificity. Only synthetases that load orthogonal tRNAs with unnatural amino acids can survive after selection / screening. FIG. 2B schematically illustrates one embodiment of synthetase selection / screening that preferentially aminoacylates O-tRNA with unnatural amino acids. For example, a vector containing an orthogonal suppressor tRNA, a member of a library of mutant RSs, and an expression vector containing a positive selection marker (eg, β-lactamase) having a selector codon (eg, amber codon) are introduced into an organism, and a selection substance (eg, ampicillin) is introduced. ) In the presence of When the positive selectable marker is expressed, the cells can survive in the selection agent. Viable cells encode a synthetase capable of loading the O-tRNA with a natural or unnatural amino acid (aa). Transform active synthetase into a second strain of expression vector and an expression vector that has one or more selector codons (eg, TAG) and contains a negative selectable marker (eg, a toxic gene such as barnase) that kills cells when expressed. . Cells are grown in the absence of unnatural amino acids. If a given synthetase aminoacylates an O-tRNA with a natural amino acid, a negative selectable marker is expressed and the cell is killed. If the synthetase preferentially aminoacylates the O-tRNA, there will be no unnatural amino acid and the cell will survive and no negative selectable marker will be expressed. This provides at least one orthogonal synthetase that preferentially aminoacylates the O-tRNA with the desired non-natural codon.

FIG. 3 shows site-specific mutations to create a specific library of tyrosine analogs.

FIG. 4 shows the pentafluorophenylalanine selection consensus sequence for creating a specific library of said analogs.

FIG. 5 schematically shows a method of transplanting one domain (for example, CPI domain) derived from one organism (for example, E. coli) to a synthetase (for example, Methanococcus jannaschii TyrRS) of another organism.

FIG. 6 schematically shows the construction of a chimeric Methanococcus jannaschii / E. Coli synthetase.

FIG. 7 schematically illustrates the generation of a library of chimeric synthetases (eg, Methanococcus jannaschii / E. Coli synthetase).

FIG. 8 schematically shows an example of selection of suppressor tRNA that is a weak substrate for endogenous synthetase (eg, E. coli synthetase) and is efficiently loaded by the desired cognate synthetase. An expression vector containing a member of the mutant tRNA library and another vector containing a negative selectable marker (eg, a toxic gene such as barnase) having one or more selector codons are introduced into the cells of the organism. Negatively selected viable cells encode a mutant tRNA that is orthogonal to the organism or non-functional. Vectors from viable cells are isolated and transformed into other cells with a positive selectable marker (eg, β-lactamase gene) that contains a selector codon. Cells are grown in the presence of RS from an organism of the same origin as the selection agent (eg, ampicillin) and tRNA (eg, Methanococcus jannaschii). Surviving cells of this selection are orthogonal to the cellular synthetase (eg, E. coli synthetase) and encode a mutant tRNA that is aminoacylated by RS from the same origin as the tRNA.

9A and B schematically show a mutant anticodon loop tRNA library. FIG. 9A shows a mutant whole loop library and FIG. 9B shows a library of Methanococcus _jannaschii tRNA _TyrCUA . Randomly mutated nucleotides (N) are shown in white.

FIG. 10 schematically shows an example of the structure of an unnatural base pair (PICS: PICS, 3MN: 3MN, 7AI: 7AI, Dipic: Py) that is paired by a force other than hydrogen bonding.

FIG. 11 is a graph of the results of the negative selection method of suppressor tRNA, showing the percentage of viable cells containing one of the three constructs at a given time, in the barnase gene introduced by the vector (eg, plasmid pSCB2). Of the two ambers. This plasmid encodes a barnase gene containing two amber codons. Selection is done in GMML liquid medium and barnase expression is induced using 20 mM arabinose. The three constructs are as follows: (1) ○ indicates a control plasmid containing no suppressor tRNA. (2) Δ represents suppressor tRNA on plasmid pAC-YYG1. (3) □ indicates suppressor tRNA on plasmid pAC-JY.

FIG. 12 is a proliferation histogram showing positive selection based on suppression of amber codons in the β-lactamase gene. A vector (eg, pAC plasmid) encoding a suppressor tRNA and a vector (eg, pBLAM-JYRS) encoding a synthetase are cotransformed into an organism (eg, E. coli DH10B cells). The results of growing cells containing synthetase and various pAC plasmids in liquid 2 × YT medium supplemented with ampicillin at various concentrations (0, 100 and 500 μg / ml) are shown in A. In the figure, pAC does not contain suppressor tRNA. A control plasmid, pAC-YYG1 is a plasmid containing a suppressor tRNA, and pAC-JY is a plasmid containing a suppressor tRNA. B shows positive selection of the same construct using 2 × YT agar plates supplemented with 500 μg / ml ampicillin. The three constructs are as follows: (1) ○ indicates a control plasmid containing no suppressor tRNA. (2) Δ represents suppressor tRNA on plasmid pAC-YYG1. (3) □ indicates suppressor tRNA on plasmid pAC-JY.

FIG. 13 shows the DNA sequence of the mutant suppressor tRNA selected from the anticodon loop and the entire loop library. JY represents wild type Methanococcus jannaschii tRNACUATyrCUA.

FIG. 14 schematically shows a three-dimensional view of the active site of TyrRS. B. Residues derived from stearothermophilusTyrRS are indicated. The corresponding residues from Methanococcus jannaschii TyrRS are Tyr ³² (Tyr ³⁴ ), Glu ¹⁰⁷ (Asn ¹²³ ), Asp ¹⁵⁸ (Asp ¹⁷⁶ ), Ile ¹⁵⁹ (Phe ¹⁷⁷ ) and Leu ¹⁶² (Leu ¹⁸⁰ ). B. represents stearothermophilus TyrRS residue).

FIG. 15 schematically shows the active site of TyrRS. B. Residues derived from stearothermophilusTyrRS are also shown. The corresponding residues from Methanococcus jannaschii TyrRS are Tyr ³² (Tyr ³⁴ ), Asp ¹⁵⁸ (Asp ¹⁷⁶ ), Ile ¹⁵⁹ (Phe ¹⁷⁷ ), Leu ¹⁶² (Leu ¹⁸⁰ ) and Ala ¹⁶⁷ (Gln ¹⁸⁹ ). B. represents stearothermophilus TyrRS residue).

FIGS. 16A and B schematically illustrate one example of a FACS selection and screening method used to make components of the invention (eg, orthogonal synthetase). FIG. 16A shows an orthogonal synthetase library, an O-tRNA expression vector (library plasmid), and a T7 RNA polymerase / GFP reporter system (reporter plasmid) vector (eg, plasmid) containing one or more selector codons (eg, TAG). This is shown schematically. FIG. 16B schematically shows a positive selection / negative screening scheme in which cells are grown in the presence and absence of unnatural amino acids and in the presence and absence of selected substances, and fluorescent cells screen for non-fluorescent cells during the screening process. “+” And ◯ correspond to fluorescent cells and non-fluorescent cells, respectively.

17A, B, C and D show an amplifying fluorescent reporter system. FIG. 17A schematically shows a vector (for example, a plasmid such as pREP) that can be used for screening. T7 RNA polymerase transcription is controlled by an ara promoter, and protein expression depends on suppression of amber codons at various positions in the gene. . Reporter expression (eg GFPuv expression) is controlled by T7 RNA polymerase. Reporter vectors (eg, plasmid pREP) can be adapted for use with orthogonal synthetase / tRNA pair expression vectors (eg, the ColE1 plasmid). FIG. 17B shows the composition and fluorescence increase of the T7 RNA polymerase gene construct in pREP (1-12). The construct number is shown on the left side of each construct. The increase in fluorescence is shown on the right side of each construct, and the fluorescence of cells containing pREP (1-12) and pQ or pQD was measured by fluorometry and calculated as the cell concentration correction ratio. The position of the amber mutation within the gene is indicated. FIG. 17C shows cytometric analysis of cells containing pREP (10) and pQD (top) or pQ (bottom). FIG. 17D shows fluorometric analysis of cells containing pREP (10) and expressing various E. coli suppressor tRNAs. “None” indicates that the cell contains no suppressor tRNA.

FIG. 18 schematically illustrates phage selection for incorporation of unnatural amino acids into surface epitopes. For example, E. coli introduced with a mutant synthetase library is infected with a phage having a stop codon in a gene encoding a surface protein. Phages containing active synthetase display unnatural amino acids on the phage surface and are selected by immobilized monoclonal antibodies.

FIG. 19 shows a molecule (eg, an immobilized aminoalkyl adenylate analog of an aminoacyl adenylate intermediate) used to screen a displayed synthetase with unnatural amino acid specificity (eg, a synthetase displayed on a phage). An example is shown schematically.

FIG. 20 is a graph showing ampicillin resistance of various orthogonal pairs derived from various organisms. This figure shows an example of detection of orthogonal pairs using reporter constructs each containing a reporter gene (eg, β-lactamase gene) containing a selector codon (eg, amber codon) and a suppressor tRNA (containing a selector anticodon). (E.g. A. fulgidus, Halobacterium NRC-1, P. furiosus, P. horikoshii and Methanococcus jannaschii). Reporter constructs and synthases transformed into cells from various organisms (eg M. thermoautotropicum, Methanococcus jannaschii, P. horikoshii, A. pernix, A. fulgidus, Halobacterium NRC-1 and Escherichia coli). Cells are grown in various concentrations of a selective substance (eg ampicillin). For example, cells with orthogonal tRNA / RS pairs are selected using an in vivo complementation assay. As is apparent from the figure, the two systems showed significantly higher levels of suppression than observed with E. coli synthetase. They are M.M. thermoautotropicum and Methanococcus jannaschii.

21A and B mutate the anticodon loop of leucyl tRNA (eg, random mutation) and use a selector codon (eg, a reporter gene) using, for example, a combination of selection steps (eg, β-lactamase-based selection and barnase-based selection). The Halobacterium NRC-1 derived mutant amber suppressor tRNA produced by selecting for more efficient suppression of (amber codon in the middle) (FIG. 21B). FIG. 21B shows the IC50 value of the β-lactamase amber suppression system when the three mutant tRNA constructs of the original amber mutant, optimized anticodon loop and optimized acceptor stem are used alone or in combination with RS (eg MtLRS). (Μg / ml ampicillin). The optimized anticodon and optimized acceptor stem showed the highest value in the β-lactamase selection stage.

FIG. 22 shows the tRNA suppressor of the basic codon. The tRNA suppressor shown in this figure was isolated from a library derived from Halobacterium NRC-1 TTG tRNA, mutated an 8 nucleotide random of the anticodon loop, and ampicillin using a reporter construct containing a β-lactamase gene with an AGGA codon at the A184 site. Selected.

Figures 23A-D show the activity of dominant synthetase variants from each successful evolution experiment. FIG. 23A is a photograph of a cell containing pREP / YC-JYCUA and a designated synthetase mutant grown in the presence (+) or absence (-) of the corresponding unnatural amino acid and irradiated with long-wave ultraviolet light. FIG. 23B shows a fluorometric analysis when cells containing pREP / YC-JYCUA and the designated synthetase variant are grown in the presence (left) or absence (right) of the corresponding unnatural amino acid. FIG. 23C is a table showing CmIC ₅₀ analysis when cells containing pREP / YC-JYCUA and designated synthetase variants are grown in the presence or absence of the corresponding unnatural amino acid. FIG. 23D shows protein expression analysis when cells containing pBAD / JYAMB-4TAG and the designated synthetase variant are grown in the presence (+) or absence (−) of the corresponding unnatural amino acid.

FIG. 24 shows an activity comparison of OAS-RS mutants obtained using negative FACS screening (OAY-RS (1, 3, 5)) or negative barnase selection (OAY-RS (B)). Cells containing pREP / YC-JYCUA and designated synthetase variants were grown in the presence (stereobar, left) or absence (stereobar, right) of the corresponding unnatural amino acid and analyzed fluorometrically. The increase in fluorescence (back bar) was calculated as the cell concentration correction ratio of the fluorescence of cells grown in the presence relative to the absence of unnatural amino acids.

25A-B are shown in FIG. The components of the multipurpose reporter plasmid system for inducing the evolution of jannaschii TyrRS are shown. FIG. 25A shows the plasmid pREP / YC-JYCUA. Plasmid pREP / YC-JYCUA is compatible with plasmid pBK and mutants. FIG. The structure of an unnatural amino acid used as a target for the evolution of jannaschiiTyrRS is shown.

FIG. 26 shows a strategy for evolving aminoacyl tRNA synthetases using the plasmid pREP / YC-JYCUA. Fluorescent and non-fluorescent cells are shown in black and gray, respectively.

FIG. 27 shows a threonyl tRNA synthetase from Thermus thermophilus.

FIG. Figure 4 shows the creation of an orthogonal tRNA for a thermophilus orthogonal threonyl tRNA / RS.

FIG. 29 shows typical unnatural amino acids utilized in the present invention.

FIG. 30 shows typical unnatural amino acids utilized in the present invention.

FIG. 31 shows typical unnatural amino acids utilized in the present invention.

preface

Proteins are at the crossroads of almost all biological processes from photosynthesis and vision to signal transduction and immune responses. These complex functions are derived from polyamide-based polymers composed of 20 relatively simple structural units arranged in a defined primary sequence.

The present invention includes methods and compositions used to incorporate unnatural amino acids directly into a protein in a site-specific direct manner. The important point is that the unnatural amino acid is not replaced by one of the 20 common amino acids but is added to the gene repertoire. The present invention provides methods for making and identifying components used by biosynthetic mechanisms to incorporate unnatural amino acids into proteins and compositions containing these components. The present invention, for example, (i) can site-selectively insert one or more unnatural amino acids at any desired position of any protein, (ii) is applicable to both prokaryotic and eukaryotic cells, (Iii) In addition to the production of large quantities of purified mutant proteins, mutant proteins can be tested in vivo, and (iv) any of a variety of unnatural amino acids can be applied to incorporate the protein in vivo. Thus, a number of different site-selective insertions of unnatural amino acids are possible in one specific polypeptide sequence. Such insertions may optionally be all of the same type (eg, inserting multiple unnatural amino acids of the same species at multiple points of a polypeptide), or may be of various types (eg, multiple points of a polypeptide). Insert a different non-natural amino acid species).

Definition

Before describing the present invention in detail, it should be understood that the present invention is not limited to a particular composition or biological system, but can of course be applied in various ways. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not limiting. The singular forms used in the specification and claims include the plural unless specifically stated otherwise. Thus, for example, reference to “a molecule” includes a combination of two or more such molecules.

Unless otherwise noted, all scientific and technical terms shall have the same meaning as commonly used in the field to which the present invention belongs. For the purposes of the present invention, the following terms are defined as follows:

As used herein, proteins and / or protein sequences are “homologous” when naturally or artificially derived from a common ancestor protein or protein sequence. Similarly, nucleic acids and / or nucleic acid sequences are homologous when derived naturally or artificially from a common ancestral nucleic acid or nucleic acid sequence. For example, any natural nucleic acid can be modified by any available mutagenesis method and one or more selector codons can be added. The mutated nucleic acid, when expressed, encodes a polypeptide that includes one or more unnatural amino acids. Of course, the mutation method can also mutate one or more standard codons and also mutate one or more standard amino acids of the resulting mutant protein. Homology is generally deduced from sequence similarity between two or more nucleic acids or proteins (or their sequences). The exact percentage of similarity between sequences useful for determining homology depends on the nucleic acid and protein of interest, but homology is usually determined using a sequence similarity as low as 25%. Higher levels of sequence similarity, such as 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more can also be used to determine homology. Methods for determining percent sequence similarity (eg, BLASTP and BLASTIN using default parameters) are described herein and are generally available.

The term “preferentially aminoacylating” means that the efficiency with which O-RS aminoacylates an O-tRNA with an unnatural amino acid is, for example, about 70 compared to the starting material used to make the natural tRNA or O-tRNA. %, About 75%, about 85%, about 90%, about 95%, or about 99% or more. The unnatural amino acid is then incorporated into the growing polypeptide chain with high fidelity, eg, about 75% or more for a given selector codon, about 80% or more for a given selector codon, about 90% or more for a given selector codon. An efficiency of about 95% or more for a given selector codon or 99% or more for a given selector codon.

The term “selector codon” refers to a codon that is recognized by the O-tRNA in the translation process but not by the endogenous tRNA. The O-tRNA anticodon loop recognizes a selector codon on the mRNA and incorporates its amino acid (eg, an unnatural amino acid) at this site in the polypeptide. Examples of the selector codon include nonsense codons (for example, stop codons such as amber, ocher and opal codons), codons having 4 or more bases, and codons derived from natural or unnatural base pairs. In a given system, the selector codon can further include one of the natural 3-base codons, the endogenous system does not use the natural 3-base codon, such as a tRNA that recognizes the natural 3-base codon. Examples include a deletion system and a system in which a natural 3-base codon is a rare codon.

As used herein, the term “orthogonal” refers to molecules (eg, orthogonal tRNA (O-tRNA) and / or orthogonal aminoacyl tRNA synthetase (O-RS)) that are used with low efficiency by the intended system (eg, translation system, eg, cell). ). Orthogonal means that orthogonal tRNA and / or orthogonal RS cannot function or have low efficiency in the intended translation system, eg, less than 20%, less than 10%, less than 5%, or such as less than 1%. For example, the efficiency with which an orthogonal tRNA aminoacylates any endogenous RS of the intended translation system in the intended translation system is reduced or zero compared to aminoacylation of the endogenous tRNA by the endogenous RS. In another example, the efficiency with which an orthogonal RS aminoacylates any endogenous tRNA in the intended translation system is reduced or zero compared to the aminoacylation of the endogenous tRNA by the endogenous RS. “Improved orthogonality” means increased orthogonality compared to the starting material or native tRNA or RS.

The term “complementary” means that O-tRNA and O-RS, which are orthogonal pairs of components, can function together (eg, O-RS aminoacylates O-tRNA).

The term “derived from” refers to a component isolated from an organism, an isolated and modified component, or a component created (eg, chemically synthesized) using component information from the organism.

The term “translation system” refers to the components necessary to incorporate a natural amino acid into a growing polypeptide chain (protein). For example, examples of the component include ribosome, tRNA, synthetase, and mRNA. The components of the present invention can be added to the translation system either in vivo or in vitro.

The term “inactive RS” refers to a synthetase that has been mutated so that the cognate tRNA cannot be aminoacylated with an amino acid.

The term “selective substance” means a substance (for example, an antibiotic, a light wavelength, an antibody, a nutrient, etc.) that can select a predetermined component from a population when such a substance is present. For example, the concentration and strength of the selected substance can be varied.

The term “positive selection marker” refers to a marker that, when such a substance is present (eg, expressed, activated, etc.), distinguishes an organism having a positive selection marker from an organism that does not have a positive selection marker.

The term “negative selectable marker” refers to a marker that can distinguish an organism that does not have a desired property (eg, from an organism that has the desired property) when such a substance is present (eg, expressed, activated, etc.). .

The term “reporter” refers to a component that can be used to select components described in the present invention. Examples of the reporter include genes such as green fluorescent protein, firefly luciferase protein, β-gal / lacZ (β-galactosidase), Adh (alcohol dehydrogenase), and the like.

The term “not efficiently recognized” means that the RS from an organism aminoacylates an O-tRNA, for example, less than about 10%, less than about 5%, or less than about 1%.

The term “eukaryotic organism” means an organism belonging to the eukaryotic organism of the phylogenetic classification, such as animals (eg mammals, insects, reptiles, birds, etc.), ciliates, plants, fungi (eg yeasts, etc.), Flagellates, microsporidia, protists, etc. Further, the term “prokaryote” refers to eubacteria (eg, Escherichia coli, Thermus thermophilus, etc.) and protozoa (eg, Methanococcus jannaschii, Methanobacterium thermobacterium, Halobacterium thermophilo, .Furiosus, P.horikoshii, A.pernix and the like).

A “suppressor tRNA” is a tRNA that modifies the reading of messenger RNA (mRNA) in a given translation system. The suppressor tRNA can be read, for example, via a stop codon, a 4 base codon or a rare codon.

Detailed description

The present invention relates to methods and compositions for novel components of biosynthetic translation machinery for incorporating unnatural amino acids into proteins in vivo. Specifically, a composition comprising an orthogonal tRNA, an orthogonal RS, and an orthogonal tRNA / orthogonal RS pair and a production method thereof are provided. These components, when introduced into a host cell, can be used in a cellular translation system to incorporate unnatural amino acids into the desired polypeptide (protein) in vivo. For example, site-specific unnatural amino acid mutagenesis or, optionally, random unnatural amino acid mutagenesis can be performed. An orthogonal tRNA delivers an unnatural amino acid in response to a selector codon, and an orthogonal synthetase preferentially aminoacylates the orthogonal tRNA with the unnatural amino acid. O-RS does not efficiently aminoacylate orthogonal tRNAs with 20 common amino acids. Also provided are methods for making and identifying orthogonal pairs.

Site-specific in vivo protein incorporation of unnatural amino acids is shown in FIG. A selector codon (eg, a unique codon) is introduced into the desired gene. The gene is transcribed into mRNA and normal translation begins in the ribosome. Endogenous synthetase aminoacylates the endogenous tRNA with the natural amino acid (aa) in the presence of ATP. An orthogonal tRNA is enzymatically aminoacylated with an unnatural amino acid by an orthogonal synthetase in the presence of ATP. When the ribosome hits the selector codon, the orthogonal tRNA modified to contain a selector anticodon (eg, a unique anticodon) can decode the mutation as an unnatural amino acid and translate to a full-length product incorporating the unnatural amino acid. proceed.

Orthogonal aminoacyl-tRNA synthetase, O-RS

In order to specifically incorporate an unnatural amino acid in vivo, the substrate specificity of the synthetase is modified so that only the desired unnatural amino acid is loaded into the tRNA instead of the 20 common amino acids. If the orthogonal synthetase is indiscriminate, it will be a mutant protein containing a mixture of natural and non-natural amino acids at the target position. For example, as one of the attempts to incorporate p-F-Phe site-specifically, the yeast amber suppressor tRNAPheCUA / phenylalanyl-tRNA synthetase pair was used in a p-F-Phe resistant Phe auxotrophic E. coli strain. For example, R.A. Furter, ProteinSci. 7: 419 (1998). Since yeast PheRS does not have high substrate specificity for p-F-Phe, even if an excess of p-F-Phe is added to the growth medium, the mutagenesis site is 64 to 75 p-F-Phe. % And the rest were translated as Phe and Lys. Furthermore, 7% of p-F-Phe was detected at the Phe codon position, and it was considered that endogenous E. coli PheRS also incorporated p-F-Phe in addition to Phe. This approach is generally not applicable to other unnatural amino acids due to low translation fidelity. Since natural synthetases have high intrinsic fidelity and unnatural amino acids are not required for cellular function, it was expected that modifying the substrate specificity of synthetase would be difficult. The present invention solves this problem and provides a composition of a synthetase having a modified substrate specificity such as an unnatural amino acid and a method for producing the same. Using the components of the present invention, the incorporation efficiency of the unnatural amino acid is about 75% or more, about 85% or more, about 95% or more, or about 99% or more.

The compositions of the invention comprise an orthogonal aminoacyl tRNA synthetase (O-RS), which optionally aminoacylates the orthogonal tRNA (O-tRNA) with an unnatural amino acid, optionally in vivo. In one embodiment, the O-RS comprises a nucleic acid comprising a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 4-34 (see Table 5) and its complementary polynucleotide sequence. In another embodiment, the O-RS has improved or enhanced enzymatic properties over unnatural amino acids over natural amino acids (eg, one of the 20 known amino acids), eg, low K _m , high k _cat K _cat / K _m is high. The sequences of typical O-tRNA and O-RS molecules are described in Example 10.

The O-RS production method is based on creating a pool of mutant synthetases from the skeleton of wild-type synthetase and then selecting the mutant RS based on the specificity for unnatural amino acids compared to the 20 common amino acids. And In order to isolate such a synthetase, the selection method of the present invention is highly sensitive because (i) the activity of the desired synthetase from the first selection can be reduced, and the population can be made small, (ii) ) It is “tunable” because it is desirable to change the selection stringency at each selection, and (iii) it is versatile and can be used for a variety of unnatural amino acids.

In the present invention, for example, an active site of synthetase, an editing mechanism site of synthetase, various domains of synthetase are combined to mutate the synthetase at various sites, etc., and an orthogonal aminoacyl-tRNA synthetase is produced by applying a selection method Provide a way. FIG. 2A schematically illustrates an in vivo selection / screening strategy based on a combination of negative selection followed by positive selection. In the positive selection, the selector codon introduced at a non-essential position of the positive marker is suppressed, and the cells are allowed to survive under the positive selection pressure. Thus, cells that survive in the presence of both natural and unnatural amino acids encode active synthetases that load the orthogonal suppressor tRNA with natural or unnatural amino acids. In the negative selection, the selector codon introduced at the non-essential position of the negative marker is suppressed, and the synthetase having the natural amino acid specificity is removed. Cells that survive the negative selection and positive selection encode a synthetase that aminoacylates (loads) the orthogonal suppressor tRNA with only the unnatural amino acid. These synthetases can then be further mutagenized, for example, by DNA shuffling or other recursive mutagenesis methods. Of course, in other embodiments, the present invention optionally alters the order of steps to identify, for example, O-RS, O-tRNA, peers, etc., and performs positive selection / screening after negative selection / screening, or Any combination is possible on the contrary.

For example, see FIG. 2B. In FIG. 2B, a selector codon (for example, amber codon) is arranged in a reporter gene having a selector codon (for example, TAG) (for example, an antibiotic resistance gene such as β-lactamase). This reporter gene is placed in an expression vector containing members of a library of mutant RSs. A vector containing this expression vector and an orthogonal tRNA (for example, an orthogonal suppressor tRNA) is introduced into cells and grown in the presence of a selective substance (for example, an antibiotic medium such as ampicillin). Only when the synthetase can aminoacylate (load) the suppressor tRNA with a given amino acid, the selector codon is decoded and the cells survive in antibiotic medium.

This selection is applied in the presence of an unnatural amino acid, and a synthetase gene encoding a synthetase having some aminoacylation ability is selected from inactive synthetase genes. The resulting synthetase pool may be loaded with 20 natural or non-natural amino acids. To further select synthetases that load only unnatural amino acids, a second selection (eg, negative selection) is applied. In this case, an expression vector containing a negative selection marker and an O-tRNA and an expression vector containing a member of a mutant RS library are used. This negative selectable marker includes at least one selector codon (eg, TAG). These expression vectors are introduced into another cell and grown in the absence of an unnatural amino acid, optionally in the presence of a selection agent (eg, tetracycline). In the negative selection, a synthetase having specificity for the natural amino acid loads the orthogonal tRNA, so that the negative marker selector codon is suppressed, leading to cell death. Since no unnatural amino acid is added, synthetases with specificity for the unnatural amino acid survive. For example, a selector codon (eg, a stop codon) is introduced into a reporter gene (eg, a gene encoding a toxic protein such as barnase). If the synthetase can be loaded into the suppressor tRNA in the absence of the unnatural amino acid, the cell will die by translating the toxic gene product. Viable cells that pass both selections / screens encode a synthetase that specifically charges the orthogonal tRNA with an unnatural amino acid.

In one aspect, the method of producing at least one recombinant orthogonal aminoacyl-tRNA synthetase (O-RS) comprises (a) a mutation derived from at least one aminoacyl-tRNA synthetase (RS) derived from a first organism. Active by selecting from the library of mutant RS a member that aminoacylates an orthogonal tRNA (O-tRNA) in the presence of an unnatural amino acid and a natural amino acid; Providing a pool of mutant RS, and (c) negatively selecting a pool of active mutant RS that preferentially aminoacylates the O-tRNA in the absence of unnatural amino acids. Providing at least one recombinant O-RS that is preferentially aminoacylated with an unnatural amino acid. . In some cases, the selected synthetase gene is further mutagenized by mutagenesis (eg, random mutagenesis, recombination, etc.) to generate a second generation synthetase library, which is used to have the desired activity. Further selections are made until mutant synthetase is obtained. Recombinant O-RS produced by the above method is also included in the present invention. As explained below, the orthogonal tRNA / synthetase pairs of the present invention are also made by optionally introducing a component from a first organism into a second organism.

In one aspect, the RS is an inactive RS. Inactive RSs can be generated by mutating active RSs. For example, an inactive RS can be made by mutating at least about 5 amino acids to another amino acid (eg, alanine).

A library of mutant RSs can be generated using various mutagenesis techniques known in the art. For example, the mutant RS can be generated by site-directed mutagenesis, random point mutation, in vitro homologous recombination, chimera construct, and the like. In one embodiment, mutations are introduced into the editing site of the synthetase to interfere with the editing mechanism and / or alter substrate specificity. See, for example, FIGS. FIG. 3 shows site-specific mutations to create a specific library of tyrosine analogs. FIG. 4 shows a pentafluorophenylalanine selection consensus sequence for creating a specific library of said analogs. Mutant RS libraries also include chimeric synthetase libraries (eg, chimeric Methanococcus jannaschii / E. Coli synthetase libraries). A domain from one synthetase can be added or exchanged with a domain from another synthetase. FIG. 5 schematically shows a method for transplanting one domain (for example, CPI domain) derived from one organism (for example, E. coli) to a synthetase (for example, Methanococcus jannaschii TyrRS) of another organism. CPI can be transplanted from E. coli TyrRS into human TyrRS. See, for example, Wakasugi, K .; Et al., EMBOJ. 17: 297-305 (1998). FIG. 6 schematically shows the construction of a chimeric Methanococcus jannaschii / E. Coli synthetase, and FIG. 7 schematically shows the construction of a library of chimeric synthetases (eg, Methanococcus jannaschii / E. Coli synthetase). See, eg, Sieber et al., Nature Biotechnology, 19: 456-460 (2001). The chimeric library is screened for various properties, eg, expressed in-frame members, members without the desired synthetase activity, and / or members exhibiting the desired synthetase activity.

In one embodiment, the positive selection step introduces a library of mutant RS with a positive selection marker (eg, antibiotic resistance gene) comprising at least one selector codon (eg, amber codon) and selection. Select a cell that survives in the presence of a selective substance by growing a plurality of cells in the presence of the substance and suppressing at least one selector codon in a positive selectable marker, comprising a pool of active mutant RS Providing a subset of positively selected cells. In some cases, the concentration of the selected substance may be varied.

In one embodiment, the negative selection step includes the negative selection marker comprising at least one selector codon (eg, an antibiotic resistance gene such as a chloramphenicol acetyltransferase (CAT) gene) of the active mutant RS from the positive selection. It is introduced into a plurality of cells of the second organism together with the pool and survives in the first medium to which the unnatural amino acid and the selective substance are added, but can survive in the second medium to which the unnatural amino acid and the selective substance are not added. Providing viable cells with at least one recombinant O-RS by selecting cells that are not capable. In some cases, the concentration of the selected substance is varied.

Examples of the first medium and the second medium include a direct replica plate method. For example, after passing positive selection, cells are grown in the absence of unnatural amino acids in the presence of ampicillin or chloramphenicol. Isolate non-viable cells from replica plates supplemented with unnatural amino acids. Transformation into the second negative selection strain is unnecessary and the phenotype is known. Compared to other potential selectable markers, positive selection based on antibiotic resistance can regulate selection stringency by changing antibiotic concentration and suppressed by monitoring the highest antibiotic concentration at which cells can survive The efficiency can be compared. Furthermore, the growth method is an accumulation method. Therefore, the desired phenotype can be quickly accumulated.

In another aspect, the step of negatively selecting the pool of active mutant RSs comprises isolating the pool of active mutant RSs from positive selection step (b) and comprising at least one selector codon ( For example, a virulence marker gene such as a ribonuclease barnase gene) and a pool of active mutant RS are introduced into a plurality of cells of the second organism and survived in the first medium without the addition of the unnatural amino acid. Providing viable cells with at least one recombinant O-RS specific for the unnatural amino acid by selecting cells that cannot survive in the second medium supplemented with. In some cases, the negative selectable marker comprises two or more selector codons.

In one aspect, positive selection is based on suppression of a positive selection marker (eg, a chloramphenicol acetyltransferase (CAT) gene that includes a selector codon (eg, an amber stop codon) within the CAT gene), so chloramphenicol is positively selected. Can be applied as pressure. Furthermore, the CAT gene can be used as both a positive marker and a negative marker as described herein in the presence and absence of unnatural amino acids. In some cases, a CAT gene containing a selector codon is used for positive selection and a negative selection marker (eg, a toxic marker such as a barnase gene containing at least one selector codon) is used for negative selection.

In another aspect, positive selection uses negative selection using ribonuclease barnase as a negative marker based on repressing a selector codon in a non-essential position of the β-lactamase gene that renders cells resistant to ampicillin. In contrast to β-lactamase secreted into the periplasm, CAT is localized in the cytoplasm, ampicillin is bactericidal, while chloramphenicol is bacteriostatic.

Recombinant O-RS can be further mutated and selected. In one aspect, the method of producing at least one recombinant orthogonal aminoacyl-tRNA synthetase (O-RS) further comprises (d) isolating at least one recombinant O-RS, and (e) at least one Creating a second set of mutant O-RSs derived from recombinant O-RS and (f) until a mutant O-RS is obtained that is capable of preferentially aminoacylating the O-tRNA. It may include repeating (b) and (c). Optionally, steps (d)-(f) are repeated, for example at least about 2 times. In one aspect, the second set of mutant O-RSs can be generated by mutagenesis (eg, random mutagenesis, site-directed mutagenesis, recombination or a combination thereof).

The stringency of the selection step (eg, positive selection step (b), negative selection step (c), or both positive selection step (b) and negative selection step (c)) in the above method optionally includes variations in selection stringency. . For example, since barnase is a highly toxic protein, the stringency of the negative selector can be controlled by changing the number of selector codons introduced into the barnase gene. In one aspect of the invention, stringency can be varied because the desired activity can be reduced by initial selection. That is, low stringency selection criteria are applied for early selection, and more stringent criteria are applied for late selection.

Other types of selection may be used in the present invention, for example for O-RS, O-tRNA and O-tRNA / O-RS pairs. For example, the positive selection step (b), the negative selection step (c) or both the positive selection step (b) and the negative selection step (c) can use a reporter, which is a fluorescence activated cell sorting (FACS) Is detected. For example, a positive selection marker (for example, a chloramphenicol acetyltransferase (CAT) gene containing a selector codon (for example, an amber stop codon) in the CAT gene) is first subjected to positive selection and then negative selection screening is performed. Those that cannot suppress the selector codon (for example, 2 or more) at a position within the marker (for example, T7 RNA polymerase gene) can be selected. In one embodiment, the positive selection marker and the negative selection marker can be placed on the same vector (eg, a plasmid). Negative marker expression induces expression of a reporter (eg, green fluorescent protein (GFP)). The stringency of selection and screening can be varied, for example, the light intensity required to fluoresce the reporter. In another embodiment, a positive selection is performed using a reporter as a positive selection marker to be screened by FAC followed by a negative selection screen and a selector codon (eg, 2 or more) at a position within the negative marker (eg, barnase gene). Can be selected.

Optionally, the reporter is presented on the cell surface, phage display, etc. Cell surface display (eg, OmpA cell surface display system) relies on the expression of specific epitopes (eg, poliovirus C peptide fused to outer membrane porin OmpA) on the E. coli cell surface. The epitope is presented on the cell surface only when the selector codon in the protein message is suppressed during translation. Thus, the presented peptides contain amino acids recognized by one of the mutant aminoacyl-tRNA synthetases in the library, and the cells containing the corresponding synthetase genes are isolated using antibodies against peptides containing specific unnatural amino acids. can do. The OmpA cell surface display system was developed and improved by Georgio et al. As a substitute for phage display. Francisco, J.A. A. Campbell, R .; Iverson, B .; L. & Georgeou, G. Production and fluorescence-activated cell sorting of Escherichia coli expressing a functional antifragment on the external surface. Proc. Natl. Acad. Sci. See US A 90: 10444-8 (1993).

Other aspects of the invention include performing one or more of the selection steps in vitro. The selected components (eg, synthetase and / or tRNA) can then be introduced into cells that are used for in vivo incorporation of unnatural amino acids.

Orthogonal tRNA

Orthogonal tRNA (O-tRNA) compositions are also a feature of the invention, for example, O-tRNA recognizes a selector codon and the O-tRNA is preferentially aminoacylated with an unnatural amino acid by an orthogonal aminoacyl tRNA synthetase. In one aspect, the O-tRNA comprises a nucleic acid comprising a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 4-34 (see Table 5) and its complementary polynucleotide sequence.

The present invention also provides a method for producing recombinant orthogonal tRNA (O-tRNA). For example, in order to improve the tRNA orthogonality while maintaining its affinity for the desired RS, the method uses negative selection and positive with a mutant suppressor tRNA library in the absence and presence of cognate synthetase, respectively. Combine selections. See FIG. In negative selection, a selector codon is introduced into a non-essential position of a marker gene (for example, a toxic gene such as barnase gene). For example, if a member of a mutant tRNA library from Methanococcus jannaschii is aminoacylated by an endogenous host (eg, E. coli) synthetase (ie, non-orthogonal to the host, eg, E. coli synthetase), a selector codon (eg, an amber codon) Is suppressed, toxic gene products are produced, leading to cell death. Cells with orthogonal tRNAs or nonfunctional tRNAs survive. Next, viable cells are selected by positive selection in which a selector codon (for example, amber codon) is arranged in a positive marker gene (for example, a drug resistance gene such as β-lactamase gene). These cells also contain an expression vector with cognate RS. These cells are grown in the presence of a selective substance (eg ampicillin). Next, a tRNA that is aminoacylated by co-expressed cognate synthetase and can insert an amino acid in response to this selector codon is selected. Cells containing non-functional tRNA or tRNA that cannot be recognized by the intended synthetase are sensitive to antibiotics. Thus, (i) it can be aminoacylated with the intended synthetase rather than a substrate of an endogenous host (eg, E. coli) synthetase, and (iii) a translatable tRNA will survive either selection.

A method for producing a recombinant O-tRNA includes the steps of: (a) creating a library of mutant tRNAs derived from at least one tRNA derived from a first organism (eg, a suppressor tRNA); A pool of mutant tRNAs is selected by negatively selecting a library of mutant tRNAs that are aminoacylated by aminoacyl tRNA synthetase (RS) from a second organism in the absence of RS from the first organism. And (c) recognizing the selector codon by selecting from the pool of mutant tRNAs a member that is aminoacylated by the introduced orthogonal RS (O-RS), and RS derived from the second organism At least one recombination that is not efficiently recognized by O-RS and is preferentially aminoacylated by O-RS Comprising providing a O-tRNA. In one aspect, the recombinant O-tRNA has improved orthogonality.

A library of mutant tRNAs is constructed. For example, see FIG. Mutation is introduced at a specific position (eg, non-conserved position or conserved position), random position, or a combination of both of the desired loop (eg, anticodon loop (D arm, V loop, TΨC arm) or loop combination or all loops) of tRNA be able to. A tRNA chimeric library is also included in the present invention. Optionally, a library of tRNA synthetases (eg, a library containing natural diversity) derived from various organisms (eg, microorganisms such as eubacteria or protozoa) (eg, Short et al. US Pat. No. 6,238,884, Schallenberger et al. See US Pat. No. 5,756,316, US Pat. No. 5,783,431 to Petersen et al., US Pat. No. 5,824,485 to Thompson et al., And US Pat. No. 5,958,672 to Short et al. Note) to construct orthogonal screens.

In one embodiment, negatively selecting a library of mutant RNAs that are aminoacylated by an aminoacyl-tRNA synthetase (step (b)) comprises the step of Introducing a rally into a plurality of cells derived from a second organism and selecting viable cells comprising a pool of mutant tRNAs comprising at least one orthogonal or non-functional tRNA. For example, the toxic marker gene is optionally a ribonuclease barnase gene, which includes at least one amber codon. Optionally, the ribonuclease barnase gene can include more than one amber codon. Viable cells can be selected, for example, by using a comparative specific cell density assay.

In one aspect, selecting a member that is aminoacylated by an introduced orthogonal RS (O-RS) from a pool of mutant tRNAs comprises a drug resistance gene comprising at least one selector codon (eg, a β-lactamase gene, eg, A positive selection marker gene comprising a β-lactamase gene comprising at least one amber codon), an O-RS, and a pool of mutant tRNAs are introduced into a plurality of cells derived from a second organism and a selection agent (eg, By selecting viable cells grown in the presence of (antibiotics), at least one amino acid is inserted into the translation product aminoacylated by O-RS and encoded by the positive marker gene in response to at least one selector codon. Providing a cell pool with one recombinant tRNA Including. In another embodiment, the selected substance concentration is varied. Recombinant O-tRNA produced by this method is also included in the present invention.

As described above for the production of O-RS, the stringency of the selection stage can vary. In addition, other selection / screening methods described herein (eg, FACS, cell and phage display) can be used.

Selector codon

The selector codon of the present invention extends the genetic codon frame of the protein biosynthesis machinery. For example, examples of the selector codon include a unique 3-base codon, a nonsense codon (for example, a stop codon such as an amber codon or an opal codon), a non-natural codon, and a 4-base (or more) codon. For example, a large number of selector codons such as one or more, two or more, three or more can be introduced into a desired gene. Furthermore, it will be appreciated that a plurality of different (or similar or identical) non-natural amino acids can thus be accurately incorporated into amino acids (ie through the use of multiple selector codons).

The 64 genetic codons encode 20 amino acids and 3 stop codons. Since only one stop codon is required for translation termination, the other two can be used primarily to encode non-proteinogenic amino acids. UAG, an amber stop codon, has been successfully incorporated into unnatural amino acids using in vitro biosynthetic systems and Xenopus oocytes. Of the three stop codons, UAG is the least frequently used stop codon in E. coli. Some E. coli strains contain a natural suppressor tRNA that recognizes UAG and inserts a natural amino acid. In addition, these amber suppressor tRNAs are also used in conventional protein mutagenesis. Since each type preferentially uses each codon of its natural amino acid, such preference is sometimes used in the design / selection of the selector codon of the present invention.

Although unnatural amino acids are described herein, it will be appreciated that similar strategies can be used to incorporate natural amino acids in response to specific selector codons. That is, a synthetase can be modified to load a natural amino acid into an orthogonal tRNA that recognizes a selector codon, similar to the loading of unnatural amino acids described throughout this specification.

In one aspect, the method uses a selector codon that is a stop codon for in vivo incorporation of an unnatural amino acid. For example, an O-tRNA that recognizes a stop codon (eg, UAG) is generated and aminoacylated with the desired unnatural amino acid by O-RS. This O-tRNA is not recognized by the natural aminoacyl-tRNA synthetase. Conventional site-directed mutagenesis can be used to introduce a stop codon (eg, TAG) at a desired site within a protein gene. For example, Sayers, J. et al. R. , Schmidt, W.M. Eckstein, F.M. 5 ', 3' Exonuclease in phosphorothioate-based oligonucleotide-directed mutation. See Nucleic Acids Res, 791-802 (1988). When the O-RS, O-tRNA and mutant gene are fused in vivo, an unnatural amino acid is incorporated in response to the UAG codon, and a protein containing the unnatural amino acid at a specific position is obtained.

In vivo incorporation of unnatural amino acids can be done without significantly affecting the host (eg, E. coli). For example, the suppression efficiency of the UAG codon depends on the competition between O-tRNA (eg, amber suppressor tRNA) and release factor 1 (RF1) (which binds to the UAG codon and initiates release of proliferating peptide from the ribosome). Can be regulated, for example, by increasing the expression level of O-tRNA (eg suppressor tRNA) or by using an RF1-deficient strain. In addition, random mutagenesis can be performed on an organism or a portion of the organism's genome, for example, by performing appropriate selection using one of the reporter systems described herein to reduce repression efficiency and unnatural amino acid incorporation. Can be adjusted.

Unnatural amino acids can also be encoded with rare codons. For example, when the arginine concentration is lowered in an in vitro protein synthesis reaction, it has been found that the rare arginine codon AGG is effective for insertion of Ala by a synthetic tRNA acylated with alanine. For example, C.I. H. Ma, W .; Kudlicki, O .; W. Odom, G.M. Kramerand B. See Hardesty, Biochemistry, 32: 7939 (1993). In this case, the synthetic tRNA competes with the natural tRNA ^Arg present as a minor species in E. coli. Some organisms do not use all triplet codons. The codon AGA, which is not assigned in Micrococcus luteus, has been used for the insertion of amino acids into in vitro transcription / translation extracts. For example, A. K. Kowal and J.W. S. Oliver, Nucl. Acid. Res. 25: 4685 (1997). The components of the present invention can be made to use these rare codons in vivo.

The selector codon further includes a codon of 4 bases or more (for example, a codon of 4, 5, 6 or 7 bases or more). Examples of 4-base codons include AGGA, CUAG, UAGA, CCCU and the like. Examples of 5-base codons include AGGAC, CCCCU, CCCUC, CUAGA, CUACU, UAGGC and the like. For example, in the presence of a mutant O-tRNA (eg, a special frameshift suppressor tRNA) and an anticodon loop (eg, at least 8-10 nt anticodon loop), a codon of 4 bases or more is read as a single amino acid. In other embodiments, the anticodon loop can decode, for example, at least 4 base codons, at least 5 base codons, or at least 6 base codons or more. Since there are 256 possible 4-base codons, multiple unnatural amino acids can be encoded in the same cell using codons of 4 or more bases. J. et al. Christopher Anderson et al., Exploring the Limits of Codon and Anticodon Size, Chemistry and Biology , Vol. 9, 237-244 (2002); Thomas J. et al. MAGLIARY, Expandingthe Genetic Code: Selection of Efficient Suppressor of the Four Coords and Identification of the Society of Four Affiliations in Japan . Mol. Biol. 307: 755-769 (2001).

The method of the present invention uses extended codons based on frameshift suppression. A codon of 4 or more bases can insert, for example, one or many unnatural amino acids into the same protein. For example, four base codons have been used to incorporate unnatural amino acids into proteins using in vitro biosynthetic methods. For example, C.I. H. Ma, W .; Kudlicki, O .; W. Odom, G.M. Kramerand B. Hardesty, Biochemistry , 1993, 32, 7939 (1993); Hohsaka, D.H. Kajihara, Y. et al. Ashizuka, H .; Murakamiand M. et al. Sisido, J. et al . Am. Chem. Soc. 121: 34 (1999). CGGG and AGGU have been used to incorporate 2-naphthylalanine and NBD derivatives of lysine simultaneously into streptavidin in vitro using two chemically acylated frameshift suppressor tRNAs. For example, T.W. Hohsaka, Y .; Ashizuka, H .; Sasaki, H .; Murakamiand M. et al. Sisido, J. et al. Am. Chem. Soc. 121: 12194 (1999). In an in vivo study, Moore et al. tested whether tRNALeu derivatives with NCUA anticodons can suppress UAGN codons (N can be U, A, G or C), and quartet UAGA is induced by tRNALeu with UCUA anticodon. It was found that decoding can be performed with an efficiency of 13 to 26%, but almost no decoding is possible with 0 or -1 frame. B. Moore, B.M. C. Persson, C.I. C. Nelson, R.A. F. Gestelandand J.M. F. Atkins, J.M. Mol. Biol. 298: 195 (2000). In one aspect, the present invention can use extended codons based on rare or nonsense codons to reduce missense skipping and frameshift suppression at other undesirable sites.

Translational bypass systems can also be used to incorporate unnatural amino acids into the desired polypeptide. In one translation bypass system, large sequences are inserted into genes but not translated into proteins. This sequence contains a structure that functions as a cue to cause the ribosome to jump over the sequence and resume translation downstream of the insertion.

Transtranslation systems can be used in place of or in combination with other above methods for incorporating unnatural amino acids into polypeptides. This system utilizes a molecule called tmRNA present in E. coli. This RNA molecule is structurally related to alanyl tRNA and is aminoacylated by alanyl synthetase. The difference between tmRNA and tRNA is that the anticodon loop is replaced with a special large sequence. This sequence allows the ribosome to resume translation with the sequence stopped using the open reading frame encoded within tmRNA as a template. In the present invention, an orthogonal tmRNA that can be preferentially aminoacylated with an orthogonal synthetase and loaded with an unnatural amino acid can be produced. By transcribing a gene that uses this system, the ribosome stops at a specific site, unnatural amino acids are introduced at this site, and then translation resumes using the sequence encoded in the orthogonal tmRNA.

The selector codon optionally includes an unnatural base pair. These unnatural base pairs further extend the existing genetic alphabet. As the number of base pairs increases, the number of triplet codons increases from 64 to 125. The nature of the third base pair is stable and selective base pairing, high fidelity and efficient polymerase incorporation into DNA, and efficient continuous primer extension after synthesis of nascent unnatural base pairs. Is mentioned. Non-natural base pairs applicable to the methods and compositions are described, for example, in Hirao et al., Annual Base Pair Incorporating amino acid analogues protein, Nature Biotechnology , 20: 177-182 (2002). Other relevant literature is listed below.

For in vivo use, the unnatural nucleoside is membrane permeable and is phosphorylated to form the corresponding triphosphate. Furthermore, the increased genetic information is stable and not destroyed by cellular enzymes. Previous work by Benner et al. Utilizes a different hydrogen bonding pattern than the canonical Watson-Crick pair, of which the most notable example is the isoC: isoG pair. For example, C.I. Switzerland, S.A. E. Moroneyand S.M. A. Benner, J. Am. chem. Soc. 111: 8322 (1989); A. Piccirilli, T, Krauch, S .; E. Moroneyand S.M. A. Benner, Nature , 1990, 343: 33 (1990); T.A. Kool, Curr. Opin. Chem. Biol. 4: 602 (2000). These bases are generally somewhat mispaired with natural bases and cannot be replicated by enzymes. Kool et al. Have shown that base pairing can be induced by hydrophobic packing interactions between bases instead of hydrogen bonds. E. T.A. Kool, Curr. Opin. Chem. Biol. 4: 602 (2000); M.M. Guckian and E. T.A. Kool, Angew. Chem. Int. Ed. Engl. 36, 2825 (1998). In an attempt to develop unnatural base pairs that satisfy all of the above requirements, Schultz, Rommerberg et al. Systematically synthesize and test a series of unnatural hydrophobic bases. The PICS: PICS self-pair (see FIG. 10) was found to be more stable than the natural base pair and can be efficiently incorporated into DNA by the Klenow fragment (KF) of E. coli DNA polymerase I. For example, D.C. L. McMinn, A.M. K. Ogawa, Y .; Q. Wu, J .; Q. Liu, P.A. G. Schultzand F.M. E. Romersberg, J. Am. Chem. Soc. 121: 11586 (1999); K. Ogawa, Y .; Q. Wu, K .; L. McMinn, J.M. Q. Liu, P.A. G. Schultzand F.M. E. Romersberg, J. Am. Chem. Soc. 122: 3274 (2000). A 3MN: 3MN self-pair can be synthesized by KF with sufficient efficiency and selectivity for biological function. For example, A. K. Ogawa, Y .; Q. Wu, M .; Berger, P.A. G. Schultzand F.M. E. Romersberg, J. Am. Chem. Soc. 122: 8803 (2000). However, both bases only function as chain terminators for late replication. Mutant DNA polymerases have recently been developed that can be used to replicate PICS self-pairs. In addition, 7AI self-pairs can be replicated. For example, E.I. J. et al. L. Tae, Y .; Q. Wu, G .; Xia, P .; G. Schultzand F.M. E. Romersberg, J. Am. Chem. Soc. 123: 7439 (2001). A novel metallobase pair Dipic: Py has also been developed that forms a stable pair when bound to Cu (II). E. Meggers, P.M. L. Holland, W.M. B. Tolman, F.M. E. Romersbergand P.M. G. Schultz, J.M. Am. Chem. Soc. 122: 10714 (2000). Since extended codons and non-natural codons are essentially orthogonal to natural codons, the method of the present invention can take advantage of this property to create its orthogonal tRNA.

Orthogonal tRNA and orthogonal aminoacyl tRNA synthetase pair

The orthogonal pair is composed of O-tRNA (for example, suppressor tRNA, frameshift tRNA, etc.) and O-RS. O-tRNA is not acylated by endogenous synthetase as described above and can decode the selector codon. O-RS recognizes O-tRNA, for example, in an extended anticodon loop and preferentially aminoacylates the O-tRNA with an unnatural amino acid. A method for producing an orthogonal pair and an orthogonal pair composition is also included in the present invention. The development of multiple orthogonal tRNA / synthetase pairs has made it possible to simultaneously incorporate multiple unnatural amino acids into the same polypeptide / protein using various codons.

In the present invention, the methods and related compositions relate to the generation of orthogonal pairs (O-tRNA / O-RS) that can incorporate unnatural amino acids into proteins in vivo. For example, an O-tRNA composition of the invention can comprise an orthogonal aminoacyl tRNA synthetase (O-RS). In one embodiment, the O-tRNA and O-RS can be complementary (eg, an orthogonal O-tRNA / O-RS pair). Examples of pairs include mutRNATyr-mutTyrRS pair (for example, mutRNATyr-SS12TyrRS pair), mutRNALeu-mutLeuRS pair, mutRNAThr-mutThrRS pair, mutRNAGlu-mutGluRS pair, and the like. In another embodiment, the orthogonal pair of the present invention comprises the desired properties of an orthogonal tRNA-aminoacyl tRNA synthetase pair, and does not have the properties of the pair of the present invention, mutRNAGln-mutGlnRS derived from E. coli, Other than mutPheRS.

O-tRNA and O-RS can be derived by mutating native tRNA and / or RS from various organisms described by origin and host name. In one embodiment, the O-tRNA and O-RS are derived from at least one organism. In another aspect, the O-tRNA is derived by mutating a naturally occurring or mutated natural tRNA from a first organism and the O-RS is naturally derived from a second organism. Induced by mutating existing or mutated native RS.

The present invention also provides a method for producing a specific O-tRNA / O-RS pair. These methods solve the problems discussed below for other strategies that have been attempted to create orthogonal tRNA / RS pairs. Specifically, the method of the present invention comprises (a) creating a library of tRNAs derived from at least one tRNA derived from a first organism, and (b) originating from the first organism. Providing a pool of mutant tRNAs by negatively selecting a library of mutant tRNAs that are aminoacylated by an aminoacyl tRNA synthetase (RS) from a second organism in the absence of RS; c) providing at least one recombinant O-tRNA by selecting from the pool of mutant tRNAs a member that is aminoacylated by the introduced orthogonal RS (O-RS). At least one recombinant O-tRNA recognizes the selector codon, is not efficiently recognized by the RS from the second organism, and is preferentially aminoacylated by the O-RS. The method further comprises (d) creating a library of at least one recombinant O-tRNARS derived from at least one aminoacyl-tRNA synthetase (RS) from a third organism; (e) Providing a pool of active mutant RSs by selecting from the library of mutant RSs members that preferentially aminoacylate at least one recombinant O-tRNA in the presence of the unnatural amino acid and the natural amino acid And (f) specific for unnatural amino acids by negatively selecting a pool of active mutant RSs that preferentially aminoacylate at least one recombinant O-tRNA in the absence of unnatural amino acids. At least one specific O-t comprising at least one recombinant O-RS and at least one recombinant O-tRNA Comprising providing a NA / O-RS pair. Pairs produced by the method of the present invention are also included in the present invention.

Attempts have been made in the past to produce orthogonal tRNA / synthetase pairs from existing E. coli tRNA / synthetase pairs. This method loses the affinity of a tRNA for its cognate synthetase by mutating the nucleotide at the tRNA-synthetase interface while maintaining orthogonality and translational ability to other synthetases. Using a cognate wild type synthetase as a starting template, a mutant synthetase that recognizes only recombinant orthogonal tRNA is obtained. X-ray crystallographic analysis of E. coli glutaminyl-tRNA synthetase (GlnRS) complexed with tRNAGln2 identified three sites (“knobs”) that specifically contact GlnRS with tRNAGln2. For example, D.C. R. Liu, T .; J. et al. Magrieryand P.M. G. Schultz, Chem. Biol. 4: 685 (1997); R. Liu, T .; J. et al. Magliay, M .; Pastrakand P.M. G. Schultz, Proc. Natl. Acac. Sci. USA A , 94: 10092 (1997). These sites were mutated with tRNA to generate mutant suppressor tRNAs containing all possible combinations of knobs 1, 2 and 3, in vitro aminoacylation by GlnRS and in vitro suppression of amber mutants of chorismate mutase Individually tested. Mutant tRNA with all three knob mutations (O-tRNA) was found to be orthogonal to all endogenous E. coli synthetases and capable of translation. Next, DNA shuffling and oligonucleotide-induced mutagenesis were performed multiple times to generate a library of mutant GlnRS. E. coli strain BT235 was used to select for the ability of these mutant enzymes to in vivo acylate O-tRNA. The mutant GlnRS can suppress the genomic amber codon of lacZ only when the O-tRNA is loaded with glutamine, and BT235 cells can grow in lactose minimal medium. Several mutant synthetases surviving after each selection were purified and assayed in vitro. The ratio of wild-type (wt) tRNAGln acylation to O-tRNA acylation by mutant synthetases was significantly reduced after multiple selections. On the other hand, mutant E. coli GlnRS that loads O-tRNA more efficiently than wild type E. coli tRNAGln2 was not obtained. The best mutant obtained after 7 rounds of DNA shuffling and selection only acylates O-tRNA at a rate 9 times lower than wild-type tRNAGln. However, since wild-type tRNAs can be lethal phenotypes when accidentally acylated with unnatural amino acids, these experiments are candidates for synthetases with the desired properties (eg, synthetases that do not acylate wild-type tRNAs). Could not be produced. Furthermore, mutations in tRNA interact in a complex and non-additive manner with respect to both aminoacylation and translation. D. R. Liu, T .; J. et al. Magrieryand P.M. G. Schultz, Chem. Biol. 4: 685 (1997). Therefore, alternative methods are generally used to provide functional pairs with desired characteristics.

A second strategy for creating an orthogonal tRNA / synthetase pair introduces a tRNA / synthetase pair from another organism into E. coli. Examples of the property of the heterologous synthetase candidate include not loading E. coli tRNA, and examples of the property of the heterologous tRNA candidate include that the heterologous tRNA candidate is not acylated by, for example, E. coli synthetase. Furthermore, suppressor tRNAs derived from heterologous tRNAs are orthogonal to total E. coli synthetase. Schimmel et al. Reported that E. coli GlnRS (EcGlnRS) does not acylate Saccharomyces cerevisiae tRNAGln (EcGlnRS also has an N-terminal RNS binding domain with Saccharomyces cerevisiae GlnRS (ScGlnRS)). E. F. Welihan and P.W. Schimmel, EMBOJ. 16: 2968 (1997). Thereafter, Saccharomyces cerevisiae amber suppressor tRNAGln (SctRNAGlnCUA) was analyzed to determine whether it was also a substrate of EcGlnRS. This is true according to the in vitro aminoacylation assay, and according to the in vitro suppression test, SctRNAGlnCUA is capable of translation. For example, D.C. R. Liu and P.M. G. Schultz, Proc. Natl. Acad. Sci. USA A , 96: 4780 (1999). It has also been found that ScGlnRS does not acylate E. coli tRNA in vitro, but only ScTRNAGlnCUA. The extent to which ScGlNRS aminoacylated SctRNAGlnCUA in E. coli was also assessed by in vivo complementation assay. An amber nonsense mutation was introduced into the permissive site of the β-lactamase gene. Suppression of the mutation by the amber suppressor tRNA should result in full-length β-lactamase, conferring ampicillin resistance to the cell. When only SctRNAGlnCUA is expressed, the cell shows an IC ₅₀ of 20 μg / mL ampicillin, indicating little acylation by endogenous E. coli synthetase, and when SctRNAGlnCUA is co-expressed with ScGlnRS, the cell is about 500 μg / mL An ampicillin IC ₅₀ was obtained, indicating that ScGlnRS efficiently acylates ScTRNAGlnCUA in E. coli. D. R. Liu and P.M. G. Schultz, Proc. Natl. Acad. Sci. USA A , 96: 4780 (1999). Saccharomyces cerevisiae tRNAGlnCUA / GlnRS is orthogonal to E. coli.

This strategy was then applied to the tRNA ^Asp / AspRS system. Saccharomyces cerevisiae tRNA ^Asp is known to be orthogonal to E. coli synthetase. For example, B. P. Doctor and J.M. A. Mudd, J.M. Biol. Chem. 238: 3677 (1963); Kwok and J.W. T.A. Wong, Can. J. et al. Biochem. 58: 213 (1980). According to the above in vivo β-lactamase assay, it was found that the amber suppressor tRNA derived from this (SctRNAAspCUA) is also orthogonal in E. coli. On the other hand, the anticodon of tRNA ^Asp is an essential recognition element of AspRS (see, for example, R. Giege, C. Fluorentz, D. Kern, J. Gangloff, G. Erianian D. Moras, Biochimie , 78: 605 (1996)). Mutating this anticodon to CUA loses the affinity of the suppressor for AspRS. The E. coli AspRSE93K mutant was found to recognize the E. coli amber suppressor tRNAAspCUA almost an order of magnitude better than wild type AspRS. For example, F.R. See Martin, 'Thesis', University Louis Pasteur, Strasbourg, France, 1995. It was expected that introduction of related mutations into Saccharomyces cerevisiae AspRS (E188K) would restore its affinity for SctRNAAspCUA. In vitro aminoacylation experiments showed that the Saccharomyces cerevisiae AspRS (E188K) mutant did not acylate E. coli tRNA but loaded SctRNAAspCUA with moderate efficiency. For example, M.M. Pastrnak, T .; J. et al. Magrieryand P.M. G. Schultz, Helv. Chim. Acta , 83: 2277 (2000). SctRNAAspCUA / ScAspRS (E188K) can function as another orthogonal pair in E. coli but is less active.

A similar approach is to use a heterologous synthetase as the orthogonal synthetase, but the orthogonal tRNA uses a mutant initiator tRNA from the same or a related organism. RajBhandary et al. Found that the amber mutant of human initiator tRNAfMet was acylated by E. coli GlnRS only when co-expressing EcGlNRS and functioned as an amber suppressor in yeast cells. A. K. Kowal, C.I. Kohlerand U. L. RajBhandary, Proc. Natl. Acad. Sci. USA A , 98: 2268 (2001). That is, this pair is an orthogonal pair used in yeast. An E. coli initiator tRNAfMet amber mutant that was inactive against E. coli synthetase was also discovered. Mutant yeast TyrRS loaded to this mutant tRNA was selected and an orthogonal pair was obtained in E. coli. A. K. See Kowal et al. (2001) supra.

There is a significant difference between prokaryotic and eukaryotic tRNATyr / TyrRS pairs, the identity element of prokaryotic tRNATyr contains a long variable arm, but the arm of eukaryotic tRNATyr is short. Furthermore, eukaryotic tRNATyr contains a C1: G72 positive recognition element, whereas prokaryotic tRNATyr does not have such a consensus base pair. In vitro studies have also shown that Saccharomyces cerevisiae and human tRNATyr cannot be aminoacylated by bacterial synthetases, and that TyrRS does not aminoacylate bacterial tRNA. For example, K.K. Wakasugi, C.I. L. Quinn, N .; Taoand P. Schimmel, EMBO J. et al. 17: 297 (1998); A. Kleeman, D .; Wei, K .; L. Simpsonand E.M. A. First, J. et al. Biol. Chem. 272: 14420 (1997). However, despite all these promising features of orthogonality, the in vivo β-lactamase complementation assay revealed that the amber suppressor tRNATyrCUA from either Saccharomyces cerevisiae or human was not orthogonal in E. coli. For example, L.M. Wang, T .; J. et al. Magliay, D.M. R. Liuand P. G. Schultz, J.M. Am. Chem. Soc. 122: 5010 (2000). Whether the suppressor tRNA can be acylated by E. coli synthetase depends on a single nucleotide mutation (G34 → C34) of the anticodon.

The method of the present invention is used to evolve the desired pair and the components of the pair to create an orthogonal tRNA / synthetase pair with the desired properties, such as the ability to preferentially aminoacylate O-tRNA with unnatural amino acids.

Resources and host organisms

For example, orthogonal tRNA-RS pairs from at least a first organism or at least two organisms that may be the same or different can be used in various host organisms (eg, a second organism). The first organism and the second organism of the method of the present invention may be the same or different. In one embodiment, the first organism is, for example, Methanococcus jannaschii, Methanobacterium thermoautotropicum, Halobacterium, Escherichia coli, A. et al. fulgidus, Halobacterium, P. et al. furiosus, P.M. horikoshii, A.H. pernix, T .; It is a prokaryotic organism such as thermophilus. Alternatively, the first organism is, for example, a plant (eg, a complex plant such as a monocotyledonous plant or a dicotyledonous plant), an algae, a protozoan, a fungus (eg, a yeast), an animal (eg, a mammal, an insect, an arthropod, etc.) Eukaryotic organisms such as In another aspect, the second organism is Methanococcus jannaschii, Methanobacterium thermoautotropicum, Halobacterium, Escherichia coli, A. et al. fulgidus, Halobacterium, P. et al. furiosus, P.M. horikoshii, A.H. pernix, T .; It is a prokaryotic organism such as thermophilus. Alternatively, the second organism may be a eukaryote such as a plant, fungus, animal or the like.

As mentioned above, each component of the pair may be from the same organism or from different organisms. For example, tRNA is derived from prokaryotes such as protozoa (eg, Methanococcus jannaschii and Halobacterium NRC-1) or eubacteria (eg, E. coli), and synthetases are the same or different prokaryotes (eg, , P. horikoshii, A. pernix, T. thermophilus, Halobacterium, Escherichia coli, etc.). For example, eukaryotic sources such as plants (for example, complex plants such as monocotyledonous plants or dicotyledonous plants), algae, protozoa, fungi (for example, yeast), animals (for example, mammals, insects, arthropods, etc.) Can be used.

A method of selecting an orthogonal tRNA-tRNA synthetase pair for use in an in vivo translation system of a second organism is also included in the present invention. The method comprises introducing a marker gene, a tRNA, and an aminoacyl-tRNA synthetase (RS) isolated or derived from the first organism into a first set of cells derived from the second organism, the marker gene, introducing a tRNA into a replicating set of cells derived from a second organism, and allowing the first and replicating set of cells to grow in the presence of a selective agent, surviving in the first set but surviving in the replicating set. Selecting cells that are not capable of providing and providing viable cells comprising an orthogonal tRNA-tRNA synthetase pair for use in an in vivo translation system of a second organism. In one aspect, the comparison and selection includes an in vivo complementation assay. In another embodiment, the selected substance concentration is varied.

For example, a tRNA / synthetase pair can be selected based on where an identity element that is a tRNA recognition site for synthetase is present. For example, a tRNA / synthetase pair is selected when the identity element is outside the anticodon (eg, a tRNATyr / TyrRS pair from the protozoan Methanococcus jannaschii). Although this TyrRS lacks most of the non-conserved domain that binds to the anticodon loop of its tRNATyr, it can distinguish tRNAs with C1: G72 from tRNAs with G1: C72. Furthermore, Methanococcus jannaschiiTyrRS (MjTyrRS) aminoacylates Saccharomyces cerevisiae but does not aminoacylate E. coli native tRNA. For example, B. A. Steer and P.M. Schimmel, J.M. Biol. Chem. 274: 35601 (1999). Cells expressing only Methanococcus jannaschitRNATyrCUA (MjtRNATyrCUA) survive to IC ₅₀ = 55 μg / mL ampicillin according to an in vivo complementation assay using an expression vector comprising a reporter gene (eg, β-lactamase gene) with at least one selector codon However, cells that co-express MjtRNATyrCUA and its TyrRS survive to IC ₅₀ = 1220 μg / mL ampicillin. MjtRNATyrCUA is less orthogonal than SctRNAGlnCUA (IC ₅₀ = 20 μg / mL) in E. coli, but MjTyrRS has higher aminoacylation activity against its cognate amber suppressor tRNA. For example, L.M. Wang, T .; J. et al. Magliay, D.M. R. Liuand P. G. Schultz, J. et al. Am. Chem. Soc. 122: 5010 (2000). As a result, Methanococcus jannaschii / TyrRS is considered to be an orthogonal pair in E. coli and can be selected for use in an in vivo translation system.

Unnatural amino acid

A variety of unnatural amino acids can be used in the methods of the invention. Unnatural amino acids can be selected based on the desired properties of the unnatural amino acid (eg, the function of the unnatural amino acid), eg, toxicity, biodistribution or half-life, structural properties, spectroscopic properties, chemistry and / or photochemistry Functions that modify the biological properties of a protein, such as chemical properties, catalytic properties, and reactivity with other molecules (eg, covalently or non-covalently).

As used herein, unnatural amino acid refers to selenocysteine and 20 genetically encoded α-amino acids (ie, alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, lysine, It means any amino acid, modified amino acid or amino acid analog other than methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine). The general structure of α-amino acids is of the formula I:

Is represented by Unnatural amino acids are generally arbitrary structures having the formula I, wherein the R group is an optional substituent other than those used in the 20 natural amino acids. For the structure of the 20 natural amino acids, see, for example, L.I. See Stryer, Biochemistry, 3rd edition, 1988, Freemanand Company, New York. It should be noted that the non-natural amino acid of the present invention may be a natural compound other than the above 20 α-amino acids. Since the non-natural amino acids of the present invention generally differ from natural amino acids only in the side chain, the non-natural amino acids of the present invention form amide bonds with other amino acids (eg, natural or non-natural amino acids) in the same way as they are formed with natural proteins. To do. On the other hand, unnatural amino acids have side chain groups different from natural amino acids. For example, R in formula I is optionally alkyl, aryl, acyl, keto, azide, hydroxyl, hydrazine, cyano, halo, hydrazide, alkenyl, alkynyl, ether, thiol, seleno, sulfonyl, boric acid, boronic acid, phospho, phosphono , Phosphine, heterocycle, enone, imine, aldehyde, ester, thioacid, hydroxylamine, amino group and the like or any combination thereof. Other relevant non-natural amino acids include amino acids containing photocrosslinkable groups, spin-labeled amino acids, fluorescent amino acids, metal-binding amino acids, metal-containing amino acids, radioactive amino acids, amino acids with novel functional groups, shared or non-shared with other molecules. Covalently interacting amino acids, photocaged and / or photoisomerizable amino acids, biotin or biotin analog-containing amino acids, glycosylated amino acids (eg glycosylated serines), other sugar-modified amino acids, keto-containing amino acids, Amino acids including polyethylene glycols or polyethers, heavy atom substituted amino acids, chemically or photodegradable amino acids, extended side chains compared to natural amino acids (eg polyethers or long chains having a carbon length of for example about 5 or more than about 10) Amino acids with hydrocarbons), amino acids containing carbon-bonded sugars, redox activity Amino acids, amino thioacid containing amino acids, and amino acids containing one or more toxic moiety include, but are not limited to.

In addition to unnatural amino acids containing new side chains, unnatural amino acids are optionally selected, for example, from Formulas II and III:

Wherein Z generally includes OH, NH ₂ , SH, NH—R ′ or S—R ′, and X and Y may be the same or different. Often, it is generally S or O, and R and R 'are optionally the same or different and are generally selected from the same groups and hydrogens as described above for the unnatural amino acids having Formula I. For example, the unnatural amino acids of the present invention optionally contain substitutions in the amino or carboxyl groups as represented by Formulas II and II. Examples of this type of unnatural amino acid include α-hydroxy acids, α-thioacids, α-aminothiocarboxylates having side chains corresponding to 20 types of common natural amino acids or unnatural side chains. It is not limited to. Further, the α-carbon substitution optionally includes L, D or α, α-disubstituted amino acids (eg, D-glutamic acid, D-alanine, D-methyl-O-tyrosine, aminobutyric acid, etc.). Other structures include cyclic amino acids (eg proline analogues, 3, 4, 6, 7, 8 and 9 membered ring proline analogues), β and γ amino acids (eg substituted β-alanine and γ-aminobutyric acid). It is done.

For example, many unnatural amino acids are derived from natural amino acids (eg, tyrosine, glutamine, phenylalanine, etc.). Tyrosine analogs include para-substituted tyrosine, ortho-substituted tyrosine, and meta-substituted tyrosine, where substituted tyrosine is acetyl, benzoyl, amino, hydrazine, hydroxylamine, thiol, carboxy, isopropyl, methyl, C ₆ -C ₂₀ straight chain or branched chain hydrocarbon, saturated or unsaturated hydrocarbon, O-methyl group, polyether group, nitro group and the like are included. In addition, multiple substituted aryl rings are also contemplated. The glutamine analogs of the present invention include, but are not limited to, α-hydroxy derivatives, γ-substituted derivatives, cyclic derivatives and amide-substituted glutamine derivatives. Examples of phenylalanine analogs include, but are not limited to, meta-substituted phenylalanine containing a hydroxy group, methoxy group, methyl group, allyl group, acetyl group or the like as a substituent. Specific examples of unnatural amino acids include O-methyl-L-tyrosine, L-3- (2-naphthyl) alanine, 3-methylphenylalanine, O-4-allyl-L-tyrosine, 4-propyl-L-tyrosine, Tri-O-acetyl-GlcNAcβ-serine, L-Dopa, fluorinated phenylalanine, isopropyl-L-phenylalanine, p-azido-L-phenylalanine, p-acyl-L-phenylalanine, p-benzoyl-L-phenylalanine, L- Examples include, but are not limited to, phosphoserine, phosphonoserine, phosphonotyrosine, p-iodophenylalanine, p-bromophenylalanine, p-amino-L-phenylalanine, and isopropyl-L-phenylalanine. The structures of various unnatural amino acids are shown in the figures (for example, FIGS. 29, 30 and 31).

In general, the unnatural amino acids of the present invention are selected or designed to provide additional properties not available with the 20 natural amino acids. For example, unnatural amino acids are optionally designed or selected to modify the biological properties of the protein (eg, incorporating these amino acids). For example, by incorporating unnatural amino acids into proteins, in some cases, toxicity, biodistribution, solubility, stability (eg, heat, hydrolysis, oxidation, enzyme resistance, degradation, etc.), ease of purification and processing, structural properties, Alter properties such as spectroscopic properties, chemical and / or photochemical properties, catalytic activity, redox potential, half-life, reactivity with other molecules (eg, covalent or non-covalent).

A more detailed description of the unnatural amino acids is incorporated herein by reference as of April 19, 2002, which is incorporated herein by reference (Title of Invention “In vivo Information of Universal Amino Acids”).
, Agent reference number 54-000120PC / US).

Use of mutant tRNA and O-RS and O-tRNA / O-RS pairs

The compositions of the invention and the compositions produced by the methods of the invention are optionally incorporated into cells. The O-tRNA / O-RS pairs or individual components of the present invention can then be used in the host system's translation machinery to incorporate unnatural amino acids into the protein. A corresponding patent application (invention title “In vivo Information of Universal Amino Acids”, Attorney Docket No. 54-000120PC / US, Inventor Schultz et al.) Describes this method and is incorporated herein by reference. For example, when an O-tRNA / O-RS pair is introduced into a host (for example, E. coli), the pair converts an unnatural amino acid (for example, a synthetic amino acid such as O-methyl-L-tyrosine) that can be externally added to the growth medium into a selector codon. In response to (eg, an amber nonsense codon), it can be incorporated into a protein (eg, a therapeutic protein such as dihydrofolate reductase or EPO) in vivo. In some cases, the compositions of the present invention can be incorporated into in vitro translation systems or in vivo systems.

Nucleic acid and polypeptide sequence variants

As described above and below, the present invention provides nucleic acid polynucleotide sequences and polypeptide amino acid sequences (eg, O-tRNA and O-RS), and compositions and methods comprising, for example, the sequences. Examples of such sequences (eg, O-tRNA and O-RS) are disclosed herein. However, as will be apparent to those skilled in the art, the present invention is not limited to the sequences disclosed herein (eg, the Examples). As will be appreciated by those skilled in the art, the present invention also provides a number of unrelated sequences having the functions described herein (eg, encoding O-tRNA or O-RS).

Similarly, those skilled in the art will appreciate that numerous variants of the disclosed sequences are also included in the present invention. For example, conservative variations of the disclosed sequences that are functionally identical sequences are also included in the present invention. Variants of nucleic acid polynucleotide sequences that hybridize to at least one disclosed sequence are also intended to be included in the present invention. For example, sequences that are considered to be unique subsequences of the sequences disclosed herein by standard sequence comparison methods are also included in the invention.

Conservation mutation

Due to the degeneracy of the genetic code, “silent substitution” (ie, replacement of a nucleic acid sequence that does not change the encoded polypeptide) is an implicit feature of the entire nucleic acid sequence encoding the amino acid. Similarly, a “conservative amino acid substitution” is one in which one or several amino acids in an amino acid sequence are replaced with another amino acid having highly similar properties, and such a substitution is also highly similar to the disclosed construct. It is self-explanatory. Such conservative variations of each disclosed sequence are a feature of the invention.

A “conservative mutation” of a specific nucleic acid sequence refers to a nucleic acid that encodes the same or essentially the same amino acid sequence, and refers to an essentially identical sequence if the nucleic acid does not encode an amino acid sequence. As will be apparent to those skilled in the art, a single amino acid or a low percentage (generally less than 5%, more usually less than 4%, 2% or 1%) of amino acids in the encoded sequence are substituted, added or deleted. If one amino acid is deleted as a result of substitution, deletion or addition, one amino acid is added, or one amino acid is replaced with one chemically similar amino acid, these modifications Is a “conservatively modified mutation”. Thus, a “conservative variation” of a polypeptide sequence as shown in the present invention is a low percentage amino acid of the polypeptide sequence, generally less than 5%, more generally less than 2% or 1% selected to conservably conserve the same conserved substituent. Includes substitutions that are replaced with. Finally, the addition of sequences that do not alter the encoded activity of the nucleic acid molecule, such as the addition of non-functional sequences, is also a conservative variation of the basic nucleic acid.

Table 1-Conservative substituents

Nucleic acid hybridization

Comparative hybridization can be used to identify nucleic acids of the present invention (including conservative variations of the nucleic acids of the present invention), and this comparative hybridization method is a preferred method for identifying nucleic acids of the present invention. Furthermore, target nucleic acids that hybridize to the nucleic acids shown in SEQ ID NOs: 1-3 or SEQ ID NOs: 4-34 (see Table 5) under high, ultra-high and ultra-high stringency conditions are also a feature of the invention. Examples of such nucleic acids include those having one or several silent or conserved nucleic acid substitutions compared to a given nucleic acid sequence.

At least about 5 of the signal to noise ratio observed when hybridizing to a probe at a rate of at least 1/2 compared to a perfectly matched complementary target, i.e., hybridization to any of the unmatched target nucleic acids. A test nucleic acid has a signal-to-noise ratio of at least ½ compared to probe-target hybridization under conditions where a probe that perfectly matches 10 to 10 times binds to a perfectly matched complementary target It is said to specifically hybridize to the probe nucleic acid.

Nucleic acids generally “hybridize” when they associate in solution. Nucleic acids hybridize by various well-characterized physicochemical forces such as hydrogen bonding, solvent exclusion, base stacking, and the like. Detailed guide to the hybridization of nucleic acids is Tijssen (1993) LaboratoryTechniques in Biochemistryand Molecular Biology- Hybridization withNucleic Acid Probespart I, chapter 2, "Overview of principles of hybridizationand the strategyof nucleic acid probe assays,"
(Elsevier, New York) and Ausubel, supra.
Hames and Higgins (1995) Gene Probes 1 IRLPpress at Oxford University Press, Oxford, UK (Hames and Higgins 1 U), Hames and Higgins (1995) Gene Probes 2 IR It describes in detail the synthesis, labeling, detection and quantification of DNA and RNA (including oligonucleotides).

An example of stringent hybridization conditions for hybridizing complementary nucleic acids with more than 100 complementary residues on a filter by Southern or Northern blots is the addition of 1 mg of heparin to 50% formalin and one at 42 ° C. An evening hybridization. An example of stringent wash conditions is 65 ° C. and 0.2 × SSC for 15 minutes (see Sambrook, supra for an explanation of SSC buffer). In many cases, the background probe signal is removed with a low stringency wash prior to a high stringency wash. An example of a low stringency wash is 40 ° C., 2 × SSC for 15 minutes. In general, it is considered that specific hybridization has been detected when the signal to noise ratio is five times (or greater) than observed for unrelated probes in a particular hybridization assay.

For nucleic acid hybridization experiments such as Southern and Northern hybridizations, “stringent hybridization wash conditions” are sequence dependent and vary with various environmental parameters. Detailed guidance on nucleic acid hybridization is described in Tijsssen (1993), supra, and Hames and Higgins 1 and 2. Stringent hybridization and wash conditions can be readily determined empirically for any test nucleic acid. For example, to determine high stringency hybridization and wash conditions, organic solvents such as increased temperature, reduced salt concentration, increased surfactant concentration, and / or formalin, for example, until hybridization or washing conditions are met. Increase hybridization and wash conditions (by increasing concentration). For example, the hybridization and wash conditions are gradually increased until the probe binds to a perfectly matched complementary target at least about 5 times the signal to noise ratio observed for unmatched target-probe hybridization.

“Very stringent” conditions are selected to be equal to the thermal melting point (T _m ) of a particular probe. T _m is the temperature at which 50% of the test sequence hybridizes with a perfectly matched probe (under defined ionic strength and pH). For the purposes of the present invention, “high stringency” hybridization and wash conditions are generally selected to be about 5 ° C. lower than the T _m of the specific sequence at a defined ionic strength and pH.

"Ultra high stringency" hybridization and wash conditions are observed for hybridization between a perfectly matched complementary target nucleic acid and any target nucleic acid that does not match the signal to noise ratio when binding the probe. Conditions that increase stringency of hybridization and washing conditions until at least 10 times the noise ratio. A target nucleic acid is said to bind to a probe under ultra high stringency conditions when it hybridizes with the probe under the above conditions at a signal to noise ratio of at least 1/2 of a perfectly matched complementary target.

Similarly, even higher levels of stringency can be determined by gradually increasing the hybridization and / or wash conditions of the relevant hybridization assay. For example, at least 10 times, 20 times the signal-to-noise ratio observed in hybridization with any target nucleic acid that does not match the signal-to-noise ratio when binding the probe to a perfectly matched complementary target nucleic acid, Increase the stringency of hybridization and wash conditions until 50-fold, 100-fold, or 500-fold or greater. A target nucleic acid is said to bind to a probe under ultra-high stringency conditions when it hybridizes with the probe under the above conditions at a signal to noise ratio of at least one-half of a perfectly matched complementary target.

Nucleic acids that do not hybridize to each other under stringent conditions are substantially the same if the polypeptides encoded by these nucleic acids are substantially identical. This is the case, for example, when making a copy of a nucleic acid using the maximum codon degeneracy permitted by the genetic code.

Unique subarray

In one aspect, the invention provides a unique subsequence for a nucleic acid selected from the sequences of O-tRNA and O-RS disclosed herein (eg, SEQ ID NO: 1-3 or SEQ ID NO: 4-34 (see Table 5)). A nucleic acid comprising Unique subsequences are unique compared to nucleic acids corresponding to any known O-tRNA and O-RS nucleic acid sequences. For example, alignment can be performed using BLAST set to default parameters. Any unique subsequence is useful, for example, as a probe to identify the nucleic acids of the invention.

Similarly, the invention includes a polypeptide comprising a unique subsequence in a polypeptide selected from the sequences of O-RS disclosed herein (eg, SEQ ID NOs: 35-66 (see Table 5)). In this case, the unique subsequence is unique compared to a polypeptide corresponding to any of the known polypeptide sequences.

The invention also provides a target nucleic acid that hybridizes under stringent conditions with a unique coding oligonucleotide that encodes a unique subsequence in a polypeptide selected from a sequence of O-RS, wherein the unique subsequence is a control poly Unique compared to a polypeptide corresponding to any of the peptides (eg, the parent sequence mutated to obtain the synthetase of the invention, for example). The unique sequence is determined as described above.

Sequence comparison, identity and homology

The term “match” or “percent match” percentage for two or more nucleic acid or polypeptide sequences compares and aligns two or more sequences or sub-sequences to maximally correspond, and the sequence comparison algorithm described below Means that the percentages of amino acid residues or nucleotides that are identical to each other or the same when measured visually (or other algorithms available to those skilled in the art) are specified values. To do.

The term “substantially identical” with respect to two or more nucleic acids or polypeptides (eg, DNA encoding an O-tRNA or O-RS or O-RS amino acid sequence) maximizes two or more sequences or subsequences. And having a nucleotide or amino acid residue identity of at least about 60%, preferably 80%, most preferably 90-95% when measured using a sequence comparison algorithm or visually. It means that there is. Such “substantially identical” sequences are generally considered to be “homologous” even if no actual origin is described. Preferably there is a “substantial match” over a region of the sequence that is at least about 50 residues long, more preferably a region of the sequence that is at least about 100 residues long, over at least about 150 residues or the entire length of the two sequences to be compared. Most preferably, the sequences are substantially matched.

For sequence comparison and homology determination, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. In this way, the sequence comparison algorithm calculates the percent sequence identity for the test sequence relative to the reference sequence, based on the designated program parameters.

Optimal sequence alignments for comparison are described, for example, in Smith & waterman, Adv. Appl. Math. 2: 482 (1981), Local homology algorithm, Needleman & Wunsch, J. et al . Mol. Biol. 48: 443 (1970) homology alignment algorithm, Pearson & Lipman, Proc. Nat &apos;
l Acad. Sci. USA 85: 2444 (1988), similarity search method, computer software for these algorithms (Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI GAP, BESTFIT, FASTAu, General Et al., See below).

One example of an algorithm that is suitable for determining sequence identity and sequence similarity percentage is the Altschul et al . Mol. Biol. 215: 403-410 (1990). Software for performing BLAST analyzes is publicly available from National Center for Biotechnology Information (www.ncbi.nlm.nih.gov/). The algorithm first identifies the short word of length W in the query sequence that matches or satisfies a predetermined positive threshold score T when aligned with the same length of word in the database sequence. A score sequence pair (HSP) is identified. T is referred to as the neighborhood word score threshold (Altschul et al., Supra). A search is initiated using these initial neighborhood word hits as seeds, searching for longer HSPs containing these words. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. For nucleotide sequences, parameters M (reward score for a pair of matched residues, always> 0) and N (penalty score for mismatched residues, always <0) are used to calculate the cumulative score. For amino acid sequences, a scoring matrix is used to calculate the cumulative score. When the cumulative alignment score decreases by an amount X from its maximum reached value, or the cumulative score falls below zero due to the accumulation of one or more negative score residue alignments, or reaches the end of either sequence in each direction Stop extending word hits. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLASTIN program (for nucleotide sequences) uses word length (W) 11, expectation (E) 10, cutoff 100, M = 5, N = 4, and comparison of both strands as defaults. For amino acid sequences, the BLASTP program uses word length (W) 3, expected value (E) 10, and BLOSUM62 scoring matrix as defaults (Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89: 10915. reference).

In addition to calculating the percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (eg, Karlin & Altschul, Proc. Nat &apos;
l. Acad. Sci. USA 90: 5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the minimum total probability (P (N)) that indicates the probability that a match will occur by chance between two nucleotide or amino acid sequences. For example, a nucleic acid is similar to a reference nucleic acid when the minimum total probability when the test nucleic acid is compared to the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001. It is considered.

Polypeptide characterization by immunoreactivity

Polypeptides of the present invention include various novel polypeptides (for example, containing unnatural amino acids in the case of proteins synthesized in the translation system of the present invention, and including novel sequences of standard amino acids in the case of the novel synthetases of the present invention). Since peptides are provided, polypeptides also provide new structural features that can be recognized, for example, in immunoassays. Production of an antiserum that specifically binds to the polypeptide of the present invention and a polypeptide that binds to such an antiserum are also features of the present invention.

For example, the present invention specifically binds to or specifically immunizes antibodies or antisera raised against an immunogen comprising an amino acid sequence selected from one or more of SEQ ID NOs: 35-66 (see Table 5). Includes synthetase proteins that are reactive. In order to eliminate cross-reactivity with other homologs, antibodies or antisera can be obtained using an available synthetase (eg, a “control” polypeptide) such as wild-type Methanococcus jannaschii (M. janaschii) tyrosyl synthetase (TyrRS). Subtract. If wild-type Methanococcus jannaschii (M. janaschii) tyrosyl synthetase (TyrRS) corresponds to a nucleic acid, a polypeptide encoded by the nucleic acid is produced and used for antibody / antiserum subtraction purposes.

In one example of a typical format, the immunoassay is one or more of the sequences corresponding to one or more of SEQ ID NOs: 35-66 (see Table 5) or a substantial subsequence thereof (ie, at least about 30% of the full-length sequence described). Polyclonal antisera raised against one or more polypeptides including) are used. Potential polypeptide immunogens derived from SEQ ID NOs: 35-66 (see Table 5) are collectively referred to as “immunogenic polypeptides” in the following text. The resulting antiserum is optionally selected to have low cross-reactivity to the control synthetase homolog and this polyclonal antiserum is immunoadsorbed, for example, to one or more of the control synthetase homologs prior to use in the immunoassay. Such cross-reactivity is removed.

In order to generate antisera for use in immunoassays, one or more of the immunogenic polypeptides are generated and purified as described herein. For example, recombinant proteins can be produced in recombinant cells. According to a standard mouse immunization protocol, an inbred mouse (used in this assay because of the high reproducibility of the results due to virtual gene matching of mice) is immunized with a standard adjuvant (eg, Freund's adjuvant) together with an immunogenic protein (antibody production, immunoassay format) See, for example, Harlow and Lane (1988) Antibodies, Laboratory Manual , Cold Spring Harbor Publications, New York, for a standard description of conditions that can be used to measure specific immunoreactivity. Related literature can also be applied to characterize polypeptides by immunoreactivity in this case). Alternatively, one or more synthetic or recombinant polypeptides derived from the sequences disclosed herein may be conjugated to a carrier protein and used as an immunogen.

Polyclonal serum is collected and titered against the immunogenic polypeptide in an immunoassay (eg, a solid phase immunoassay using one or more of the immunogenic proteins immobilized on a solid support). Polyclonal antisera with a titer of 10 ⁶ or more are selected, pooled, and subtracted with a control synthetase polypeptide to create a high titer polyclonal antiserum subtraction pool.

High titer polyclonal antiserum subtraction pools are tested for cross-reactivity against a control homolog in a comparative immunoassay. In this comparative assay, the subtraction high titer is such that the signal to noise ratio when high titer polyclonal antiserum binds to an immunogenic synthetase is at least about 5-10 times that when bound to a control synthetase homolog. Determine differential binding conditions for polyclonal antiserum. That is, the stringency of the binding reaction is adjusted by adding non-specific competitors such as albumin or skim milk and / or adjusting salt conditions, temperature and / or others. These binding conditions are used in late-stage assays to determine whether a test polypeptide (a polypeptide that is compared to an immunogenic polypeptide and / or a control polypeptide) specifically binds to a subtraction polyclonal antiserum pool. . In particular, test polypeptides that exhibit a signal to noise ratio of at least 2 to 5 times that of a control synthetase homolog under differential binding conditions and a signal to noise ratio of at least about 1.5 times that of an immunogenic polypeptide are known synthetases. The polypeptide of the present invention has substantial structural similarity to the immunogenic polypeptide as compared with the polypeptide of the present invention.

In another example, a competitive binding format immunoassay is used to detect a test polypeptide. For example, as will be appreciated, cross-reactive antibodies are removed from the antiserum mixture pool by immunoadsorption to a control polypeptide. The immunogenic polypeptide is then immobilized on a solid support and the support is exposed to the subtraction antiserum pool. Test protein is added to the assay to compete for binding with the subtraction antiserum pool. Compare the ability of the test protein to compete with the immobilized protein for binding to the subtraction antiserum pool and the ability of the immunogenic polypeptide added to the assay to compete for binding (the immunogenic polypeptide is antiserum). Effectively competes with the immobilized immunogenic polypeptide for binding to the pool). Calculate the percent cross-reactivity of the test protein using standard calculations.

In a parallel assay, the ability of the control protein to optionally compete for binding to the subtraction antiserum pool is measured relative to the ability of the immunogenic polypeptide to compete for binding to antiserum. Again, standard calculations are used to calculate the percent cross-reactivity of the control polypeptide. A test polypeptide is subtracted when the percent cross-reactivity of the test polypeptide is at least 5 to 10 times that of the control polypeptide or when the binding of the test polypeptide is approximately in the same range as the binding of the immunogenic polypeptide. Said to bind specifically to the serum pool.

In general, the competitive binding immunoassays described herein can use an immunosorbent anti-serum pool to compare any test polypeptide to an immunogenic and / or control polypeptide. To make this comparison, immunogenicity, test and control polypeptides are each assayed over a wide concentration range and inhibit 50% of binding between subtraction antisera and eg immobilized control, test or immunogenic proteins. The amount of each polypeptide required to do so is determined by standard techniques. A test polypeptide is immunogenic if the amount of test polypeptide required for binding in a competitive assay is less than twice the amount of immunogenic polypeptide required and at least about 5-10 times the control polypeptide. It is said to bind specifically to the antibody produced against the protein.

As an additional test of specificity, an antiserum pool (optionally for the control polypeptide) is optionally added until little or no binding of the resulting immunogenic polypeptide subtraction antiserum pool to the immunogenic polypeptide used for immunoadsorption can be detected. (Not) fully immunosorbed to the immunogenic polypeptide. This fully immunosorbed antiserum is then tested for reactivity with the test polypeptide. If little or no reactivity is observed (ie, less than twice the signal-to-noise ratio observed for binding of fully immunosorbed antiserum to the immunogenic polypeptide), the test polypeptide is an immunogenic protein. Specifically binds to antisera induced by.

General technology

General textbooks describing molecular biology techniques include Berger and Kimmel, Guideto Molecular Cloning Techniques, Methods in Enzymology Volume 152 Academic Press , Inc. San Diego, CA (Berger); Sambrook et al., Molecular Cloning-A Laboratory Manual (3rd edition), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 2000 (“Sambrook”); and Current Protocols in Molecular Biology , F .; M.M. Ausubel et al., Ed., Current Protocols, a joint venturebetween Greene Publishing Associates, Inc. and John Wiley & Sons, Inc. (2002 Addendum) ("Ausubel"). These textbooks describe mutagenesis, the use of vectors, promoters and many other related topics, such as the creation of orthogonal tRNAs, orthogonal synthetases and pairs thereof.

For example, various mutagenesis is used in the present invention to produce novel synthetases or tRNAs. These methods include site-specific, random point mutagenesis, homologous recombination (DNA shuffling), mutagenesis using uracil-containing templates, oligonucleotide-induced mutagenesis, phosphorothioate-modified DNA mutagenesis, gap duplex Examples include, but are not limited to, mutagenesis using DNA. Other available methods include point mismatch repair, mutagenesis using repair-deficient host strains, restriction-selection and restriction-purification, deletion mutagenesis, mutagenesis by complete gene synthesis, double-strand break repair Etc. For example, mutagenesis using a chimeric construct is also included in the present invention. In one embodiment, mutagenesis can be performed by known information (eg, sequence, sequence comparison, physical properties, crystal structure, etc.) of a natural molecule or a modified or mutated natural molecule.

The textbooks and examples described herein describe these procedures. Information can also be found in the following publications and references cited therein. Sieber et al., Nature Biotechnology, 19: 456-460 (2001); Ling et al., Approaches to DNA mutation: nanoview, Anal Biochem. 254 (2): 157-178 (1997); Dale et al., Oligonucleotide-directed random mutation usage using the phosphorioate method, Methods Mol. Biol. 57: 369-374 (1996); A. Lorimer, I .; Pastan, Nucleic Acids Res. 23, 3067-8 (1995); P. C. Stemmer, Nature 370,389-91 (1994); Arnold, Protein engineeringfor unusual environments, CurrentOpinion in Biotechnology 4: 450-451 (1993); Bass et al., Mutant Trp repressors with new DNA- bindingspecificities, Science 242: 240-245 ( 1988); Fritz et al., Oligonucleotide-directed construction of mutations: agapped duplex DNA procedure without enzymatic reactions in vitro, Nucl. Acids Res. 16: 6987-6999 (1988); Kramer et al., Improvedenzymatic in vitro reactions in the gapted duplex DNAapproached-directed construction , . AcidsRes 16: 7207 (1988); Sakamar & Khorana, Total synthesisand expression of a gene for the a-subunitof bovine rod outer segment guaninenucleotide-binding protein (transducin), Nucl. Acids Res. 14: 6361-6372 (1988); Sayers et al., Y-TExonucleases in phosphorothioate-basedoligonucleotide -directed mutagenesis, Nucl. Acids Res. 16: 791-802 (1988); Sayers et al., Strand cleavable cleavage of phosphoroate-containing DNA by reaction with restriction endemu depletion in the prescription . Acids Res. 16: 803-814; Carter, Improvedoligotide-directed mutagenesis M13 vectors, Methods Enzymol. 154: 382-403 (1987); Kramer & Fritz Oligonucleotide-directed construction of mutations via conjugated duplex DNA, Methods in Enzymol. 154: 350-367 (1987); Kunkel, The efficiency of oligodirected mutagenesis, in Nucleic Acids & Molecular Biology (Eckstein, F. and L. J., L.). Et al, Rapid effectiveness site-specific quantification, with phenotypic selection, Methods in Enzymol. 154, 367-382 (1987); Zoller & Smith, Oligonucleotide-directed mutagenesis: a simple method of measuring oligodegraded molecules and a single-stranded molecule. 154: 329-350 (1987); Carter, Site-directed mutagenesis, Biochem. J. et al. 237: 1-7 (1986); Eghtedarzadeh & Henikoff, Use of oligonucleotides to generate large deletions, Nucl. Acids Res. 14: 5115 (1986); Mandecki, Oligonucleotide-directed double-strand break repairs of Escherichia coli: a method for site-specificity . Natl. Acad. Sci. USA , 83: 7177-7181 (1986); Nakamaye and Eckstein, Inhibition of restriction enciclease NciI cleaved by phosphorodiolto group production and secretions application . Acids Res. 14: 9679-9698 (1986); Wells et al., Importance of hydrogen-bond formation in stabilization the transformation state of subtilisin, Phil. Trans. R. Soc. London. A317: 415-423 (1986); Botstein & Shortle, Strategies and applications of in vitro mutations, Science 229: 1193-1201 (1985); Carter et al . Acids Res. 13: 4431-4443 (1985); Grundstrom et al., Oligonucleotide-directed mutationage by microscale '
shot-gun 'gene synthesis, Nucl. Acids Res. 13: 3305-3316 (1985); Kunkel, Rapid and effective site-specific quantitation with phenotypic selection, Proc. Natl. Acad. Sci. USA 82: 488-492 (1985); Smith, In vivo mutationage, Ann. Rev. Genet. 19: 423-462 (1985); Taylor et al., Theuse of phosphoroate-modified DNA in restriction enzyme reactions to pre-prepared nicked DNA, Nucl. Acids Res. 13: 8749-8864 (1985); Taylor et al., Ther generation of oligonucleotide-directed mutations at high frequency using phosphorylated-modified DNA, Nucl. Acids Res. 13: 8765-8787 (1985); Wells et al., Cassette mutagenesis: anefficient method forgeneration of multiple mutations at defined sites, Gene 34: 315-323 (1985); Kramer et al., The gapped duplex DNAapproach to oligonucleotide- directedmutation construction, Nucl. Acids Res. 12: 9441-9456 (1984); Kramer et al., PointMismatch Repair, Cell 38: 879-887 (1984); Nambiar et al., Total synthesis and cloning of a gene coding for the ribonucleaseS protein, Science 223: 1299-1301 (1984) Zoller & Smith, Oligonucleotide-directed mutagenesis of DNA fragments cloned into M13vectors, Methods in Enzymol. 100: 468-500 (1983); and Zoller & Smith, Oligonucleotide-directed mutagenesis using M13-directed detectors: an effective and general production infectious production . 10: 6487-6500 (1982). A more detailed description of many of the above methods can be found in Methods Enzymology Volume 154, which also describes useful solutions to troubleshooting problems associated with various mutagenesis methods.

For example, oligonucleotides used in the mutagenesis of the present invention (eg, mutation of a synthetase library or tRNA modification) are generally described in Beaucage and Caruthers, Tetrahedron Letts. 22 (20): 1859-1862 (1981), following the solid phase phosphoramidite triester method, for example, Needham-Van Devanta et al., Nucleic Acids Res. 12: 6159-6168 (1984), and is chemically synthesized using an automatic synthesizer.

Furthermore, The Midland Certified Reagent Company (mcrc@oligos.com), TheGreat American GeneCompany (www.genco.com), ExpressGen Inc. (Www.expressgen.com), Operon Technologies Inc. (Alameda, Calif.) And many other various sales companies can order almost any nucleic acid (and almost any labeled nucleic acid regardless of standard or non-standard) or make a standard order.

The invention also relates to host cells and organisms used for in vivo incorporation of unnatural amino acids via orthogonal tRNA / RS pairs. For example, a host cell is genetically modified (eg, transformed, transduced or transfected) with the vector of the present invention, which can be a cloning vector or an expression vector. The vector can be, for example, in the form of a plasmid, bacteria, virus, naked polynucleotide or polynucleotide conjugate. Vectors are electroporated (From et al., Proc. Natl. Acad. Sci. USA 82, 5824 (1985)), infected with viral vectors, nucleic acids embedded in a small bead or particle matrix, or attached to a surface and small. High-speed injection in particle form (introduced into cells and / or microorganisms by standard methods such as Klein et al., Nature 327, 70-73 (1987) etc. Various suitable transformation methods are described in Berger, Sambrook and Ausubel. Has been.

Recombinant host cells can be cultured in a conventional nutrient medium that is appropriately modified to suit procedures such as screening, promoter activation, or transformed cell selection. These cells can optionally be cultured in transgenic organisms.

Other useful references (eg for late nucleic acid isolation) such as cell isolation and culture include Freshney (1994) Culture of Animal Cells, a Manual of Basic Technique , 3rd edition, Wiley-Liss, New York and references cited therein. ; Payne et al. (1992) Plant Cell and Tissue Culture in Liquid Systems John Wiley & Sons, Inc, New York, NY; Gamborg and Phillips (eds.) (1995) PlantCell, Tissue and Organ Culture; Fundamental Method Springer LabManual, Springer-Verlag ( Ber in Heidelberg New York; and Atlas and Parks (eds.) TheHandbook of Microbiological Media (1993) CRC Press, Boca Raton, FL , and the like.

As a method for introducing a target nucleic acid into a host cell, several well-known methods are available, and any of them can be used in the present invention. These methods include fusion of bacterial protoplasts containing DNA and recipient cells, electroporation, gene guns and infection with viral vectors. Bacterial cells can be used to amplify the number of plasmids containing the DNA construct of the present invention. When bacterial cells are grown to log phase, plasmids in the bacteria can be isolated by various methods known in the art (see, for example, Sambrook). In addition, many kits are commercially available for purifying plasmids from bacteria (eg EasyPrep®, FlexiPrep® (both Pharmacia Biotech); StrataClean® (Stratagene); and QIAprep®) Trademark) (Qiagen)). The isolated and purified plasmid is further manipulated to generate other plasmids that can be used to transfect cells or be incorporated into related vectors to infect organisms. Typical vectors include transcription and translation terminators, transcription and translation initiation sequences, and promoters useful for the regulation of the expression of specific target nucleic acids. The vector optionally includes at least one independent terminator sequence, a sequence that allows for replication of the cassette in eukaryotes or prokaryotes or both (eg, shuttle vectors), and a selection marker for both prokaryotic and eukaryotic systems. Contains a comprehensive expression cassette. The vector is suitable for replication and integration in prokaryotes, eukaryotes, or preferably both. Giliman & Smith, Gene 8:81 (1979); Roberts et al., Nature , 328: 731 (1987); Schneider, B. et al. Et al . , ProteinExpr. Purif. 6435: 10 (1995); Ausubel, Sambrook, Berger (all above). Catalogs of bacteria and bacteriophages useful for cloning are available from, for example, ATCC, including TheATCC Catalogue Bacteria and Bacteriophage (1992) Gherna et al. (Eds.) Published by ATCC. The basic procedures and basic theories of other aspects of sequencing, cloning and molecular biology are also described in Watson et al. (1992) Recombinant DNA 2nd edition , Scientific American Books, NY.

EXAMPLES Hereinafter, although an Example demonstrates this invention, this invention is not limited by these Examples.

Example 1-Improvement of orthogonality of tRNA derived from Methanococcus jannaschii

  Rational design of orthogonal tRNA-synthetase pairs is difficult due to the complex nature of tRNA-synthetase interactions required to increase the fidelity of protein translation. This example relates to a method that combines the late in vivo evolution of a highly orthogonal tRNA using the weak cross-recognition of a given heterologous tRNA-synthetase pair. L. Wang and P.W. G. Schultz, Chem. Biol. 8: 883 (2001). Specifically, a library of amber suppressor tRNAs derived from Methanococcus jannaschii tRNATyr was prepared. Negative selection based on suppression of amber nonsense mutations in the barnase gene removed tRNATyrCUA, a substrate for endogenous E. coli aminoacyl tRNA synthetase, from the pool. Next, among the remaining tRNATyrCUAs, those capable of suppressing the amber nonsense codon of the β-lactamase gene in the presence of cognate Methanococcus jannaschii tyrosyl tRNA synthetase (TyrRS) were selected. Four mutant suppressor tRNAs were selected that were weaker substrates of E. coli synthetase than Methanococcus jannaschii tRNATyrCUA but could be efficiently loaded by Methanococcus jannaschii TyrRS. Mutant suppressor tRNATyrCUA, together with Methanococcus jannaschii TyrRS, provides an orthogonal tRNA-synthetase pair useful for in vivo protein incorporation of unnatural amino acids.

  The protozoan Methanococcus jannaschii tRNATyr has an identity element different from that of E. coli tRNATyr. In particular, E. coli tRNATyr has a G1C72 pair in the acceptor stem, whereas Methanococcus jannaschii tRNATyr has a C1G72 pair. An amber suppressor tRNA derived from Methanococcus jannaschii tRNATyr was not efficiently aminoacylated by E. coli synthetase, but was found to function efficiently for protein translation in E. coli. For example, L.M. Wang, T .; J. et al. Magliay, D.M. R. Liu, P.A. G. Schultz, A new functional suppressor tRNA / aminoacyl-tRNA synthetase pair for the in vivo informatical of amino acids into protein. J. et al. Am. Chem. Soc. 122: 5010-5011 (2000). Furthermore, Methanococcus jannaschii TyrRS, which has a minimal anticodon-loop binding domain, does not aminoacylate E. coli tRNA, but efficiently aminoacylates its own suppressor tRNATyrCUA. For example, B. A. Steer, P.M. Schimmel, Major anti-codon-binding region missing from anarchaebacterial tRNA synthetase, J. Am. Biol. Chem. 274 (1999) 35601-35606; and Wang et al. (2000), supra.

  In order to test the orthogonality of this suppressor tRNA in E. coli, an amber codon was introduced into the permissive site of β-lactamase (Ala184). For example, D.C. R. Liu, P.A. G. Schultz, Progress to the evolution of an organicism with an expanded genetic code. Proc. Natl. Acad. Sci. USA 96: 4780-4785 (1999). A tRNA that can be loaded by E. coli synthetase suppresses the amber codon and allows the cell to survive in the presence of ampicillin. Methanococcus jannaschii tRNATyrCUA suppresses the amber codon in the β-lactamase gene with an IC 50 value of 56 μg / ml ampicillin. See Wang et al. (2000), supra. In contrast, when orthogonal tRNAGlnCUA derived from Saccharomyces cerevisiae tRNAGln2 is tested in the same assay, the IC 50 is 21 μg / ml ampicillin. See Liu & Schultz, (1999), supra. The IC50 of E. coli in the absence of suppressor tRNA is 10 μg / ml ampicillin. This result indicates that Methanococcus jannaschii tRNATyrCUA is a better substrate for E. coli synthetase than tRNAGlnCUA. Thus, if Methanococcus jannaschii tRNATyrCUA is used in vivo to deliver unnatural amino acids to proteins in E. coli, the natural amino acids can also be misloaded by E. coli synthetase and can result in heterologous amino acid incorporation .

  In order to prevent recognition by endogenous Escherichia coli synthetase, the orthogonality of Methanococcus jannaschii tRNATyrCUA was improved by introducing a “negative recognition determinant”. These mutations must not strongly interfere with the interaction of the tRNA with its cognate Methanococcus jannaschii TyrRS or ribosome. Since Methanococcus jannaschii TyrRS lacks most of the anticodon binding domain (e.g., BA Steer, P. Schimmel, Major anticodon-binding region mischia tanchaetacter. Et al. 35606 (1999)), mutations introduced into the anticodon loop of tRNA are expected to have minimal effect on TyrRS recognition. An anticodon loop library with 4 randomly mutated nucleotides was constructed. See FIG. Since the combinations and positions of the identity elements of various E. coli tRNAs are diverse, introduction of mutations at additional positions can increase the probability of finding mutant tRNAs having the desired characteristics. Therefore, a second library containing all mutations at non-conserved positions of all tRNA loops (all loop library) was also constructed. See FIG. The conserved nucleotides were not randomly mutated and maintained a tertiary interaction that stabilized the “L” shaped structure of the tRNA. For example, G. Dirheimer, G .; Keith, P .; Dumas, E .; Westoff, Primary, secondary, and tertiary structures of tRNAs, in: D.C. Soll, U.D. L. RajBhandary (eds.), TRNA Structure, Biosynthesis, and Function, ASM Press, Washington, DC, 1995, pp. 93-126; Giege, M .; Sissler, C.I. Florentz, Universal rules and idiosyncratic features in tRNA identity, Nucleic Acids Res. 26: 5017-5035 (1998). Since a compensation mutation is required to replace one stem nucleotide, the stem nucleotide was not mutated. Eleven nucleotides (C16, C17, U17a, U20, C32, G37, A38, U45, U47, A59 and U60) were randomly mutated. See FIG. The theoretical size of this library is about 4.19 × 10 6 and a library with a size of about 1.93 × 10 8 colony forming units was constructed to completely cover the mutant library.

  In this method, an E. coli strain (eg, DH10B) obtained from Gibco / BRL was used. The suppressor tRNA expression plasmid was derived from a plasmid (eg, pAC123). For example, D.C. R. Liu, T .; J. et al. Magliay, M .; Pastrnak, P.A. G. Schultz, Engineering a tRNA and aminoacyl-tRNA synthetase for the site-specific information of unnatural amino acids into protein in vivo. Natl. Acad. Sci. USA 94: 10091-10097 (1997). Negative selection plasmids were derived from plasmids as described below (for example, pBATS, pYsupA38B2 and pYsupA38B3). For example, K.K. Gabriel, W.M. H. McClain, A set of plasmids, producing producing differential RNA levels in Escherichia coli, J. Biol. Mol. Biol. 290 (1999) 385-389; and Liu & Shultz, (1999), supra.

  A combination of negative and positive selection in the absence and presence of cognate synthetase was used to select members of the Methanococcus jannaschii tRNA library with increased orthogonality. See FIG. In negative selection, a selector codon (eg, amber nonsense) is introduced into, for example, a non-essential position of a negative marker gene (eg, a toxic gene). If a member of a mutated (eg suppressor) tRNA library is aminoacylated (ie not orthogonal to E. coli synthetase) by an endogenous (eg E. coli) synthetase, the selector codon is suppressed and a toxic gene product is produced, It leads to cell death. Only cells with orthogonal tRNAs or nonfunctional tRNAs can survive. Thereafter, all viable cells are positively selected and a selector codon (eg, amber codon) is inserted, eg, at a non-essential position of a positive selection marker (eg, drug resistance gene). Thereafter, a tRNA that is aminoacylated by co-expressed cognate synthetase and can insert an amino acid in response to the selector codon is selected. Cells containing non-functional tRNA or tRNA that cannot be recognized by the intended synthetase are sensitive to antibiotics. Therefore, (1) it can be aminoacylated with the intended synthetase instead of a substrate for endogenous E. coli synthetase, and (3) only a tRNA capable of translation survives after both selections.

  Negative selection using the toxicity of barnase when produced in E. coli in the absence of its natural inhibitor, barster, was employed. For example, R.A. W. Hartley, Barnase and barstar. Expression of it cloned inhibitor permits expression of a cloned ribose, J. Exp. Mol. Biol. 202: 913-915 (1988). Based on the analysis of the three-dimensional structure of barnase, an amber codon was introduced at a non-essential position of the barnase gene. See, for example, Liu & Schultz, (1999), supra. Since barnase is very autotoxic, a low copy number pSC101 origin was introduced into the plasmid expressing barnase. In addition, the number of amber codons was varied to test the stringency of selection. Plasmid pSCB2 was used to express a barnase mutant with two amber stop codons in Gln2 and Asp44, and an amber stop codon was also added to plasmid pSCB3 in Gly65.

  For the negative selection, the following oligonucleotides LW115: 5′-ATGCATGCTGCATTAATGAATCGGCCAACG-3 ′ and LW116: 5′-TCCCCGCGGAGGTGGCACTTTTCGGGG-3 ′ were used to generate a PCR fragment containing the β-lactamase gene and pSC101 origin from pBATS. Digestion with SacII and SphI resulted in DNAs encoding barnase containing two (residues Gln2, Asp44 and Gly65) amber codons from pYsupA38B2 and pYsupA38B3, respectively. The above fragments were ligated to obtain plasmids pSCB2 and pSCB3. Barnase expression was induced with arabinose. A gene encoding various suppressor tRNAs for in vivo expression was constructed from two overlapping synthetic oligonucleotides (Operon, Alameda, CA, USA) by Klenow extension and inserted between the EcoRI-PstI sites of pAC123; pAC-YYG1 and pAC-JY that transcribe under the control of lpp promoter and rrnC terminator were prepared, respectively. pAC-Cm is a control plasmid without tRNA. To optimize negative selection conditions, competent DH10B cells containing pSCB2 or pSCB3 were separately transformed with pAC-Cm, pAC-YYG1 and pAC-JY by electroporation. Single colonies were picked and grown in 2 × YT supplemented with chloramphenocol (Cm, 34 μg / ml) and ampicillin (Amp, 100 μg / ml). The cell culture grown overnight was washed twice with minimal medium (GMML) supplemented with 1% glycerol and 0.3 mM leucine and resuspended in GMML supplemented with Cm and Amp until OD600 = 0.1. After regeneration at 30 ° C. for 10 minutes, 20 mM arabinose was added to the first culture solution (first set) to induce barnase expression, and no arabinose was added to the second culture solution (second set). At each time point, a small amount of the culture broth was diluted and plated on 2 × YT agar containing Cm and Amp, and the cell density was measured. For negative selection of the suppressor tRNA library, DH10B cells containing pSCB2 were transformed with the pAC plasmid containing the library. The cells were quenched by adding SOC medium, regenerated at 30 ° C. for 1 hour, washed with phosphate buffer and GMML, and cultured in 1 liter of GMML. After regeneration at 30 ° C. for 30 minutes, Cm, Amp and 20 mM arabinose were added. Cells were pelleted after 36 hours and the pAC plasmid was isolated and purified by agarose gel electrophoresis.

  In order to optimize the selection conditions, two suppressor tRNAs known to be correctly recognized by E. coli synthetase were used. Mutant suppressor tRNATyr derived from Saccharomyces cerevisiae (sc-tRNATyrCUA expressed in pAC-YYG1) suppresses the amber codon (Ala184TAG) of β-lactamase gene, and the IC50 of E. coli cells is 12 μg / ml ampicillin. The suppressor tRNATyr derived from (mj-tRNATyrCUA expressed in pAC-JY) has an IC50 of E. coli cells of 56 μg / ml. See, eg, Wang et al. (2000), supra. In contrast, when the suppressor tRNAGlnCUA derived from Saccharomyces cerevisiae tRNAGln2 was tested in the same assay, IC50 = 21 μg / ml ampicillin was found to be orthogonal to E. coli synthetase in vitro and in vivo. See, for example, Liu & Schultz, (1999), supra. Thus, a negative selection that eliminates cells expressing mj-tRNATyrCUA and allows growth of cells expressing sc-tRNATyrCUA eliminates non-orthogonal suppressor tRNAs. Cells were grown in liquid minimal medium (GMML) supplemented with 1% glycerol and 0.3 mM leucine with antibiotics suitable for maintaining plasmid pSCB2 and pAC plasmid. Arabinose was added to the first set of cells (first set) to induce barnase expression, and no arabinose was added to the second set. The fraction of cells surviving after selection was determined by the ratio of the cell density of the first and second sets. See FIG. Cells containing control plasmid pAC-Cm (without suppressor tRNA) and plasmid pAC-YYG1 survived, but most cells containing plasmid pAC-JY died. When plasmid pSCB3 was used, cells containing plasmid pAC-JY began to grow within 24 hours. Therefore, negative selection was performed using pSCB2 encoding a barnase gene containing two amber codons under the above library selection conditions.

  For positive selection, the oligonucleotide LW104: 5′-GGAATTCCATTAGGACGGAATTTTGAAATG-3 ′ and LW105: 5′-AAACTGCAGGTTAATCTCTTTCTATAATTGCTC-3 ′ is used to insert the gene from RSBco50 into RSBco50 from the NdeI-PstI site. A plasmid (for example, pBLAM-JYRS) was constructed. See, eg, Steer et al. (1999), supra, and Liu & Schultz, (1999), supra. To optimize the positive selection conditions, competent DH10B cells containing pBLAM-JYRS were separately transformed with pAC-Cm, pAC-YYG1 and pAC-JY. Single colonies were picked and grown in 2 × YT supplemented with Cm and tetracycline (Tet, 40 μg / ml). In the liquid phase selection, the cell culture solution was diluted overnight with 2 × YT to which Cm and Tet were added so that the starting OD600 was 0.1. Various concentrations of Amp were added and cell growth was monitored by OD600. In plate selection, about 103 to 105 cells were seeded on 2 sets of 2 × YT agar plates in which 500 μg / ml Amp was also added to one set of Cm and Tet. For selection of the mutant tRNA library, competent DH10B cells containing pBLAM-JYRS were transformed with the pAC plasmid isolated from cells from the negative selection. The cells were regenerated for 45 minutes at 37 ° C., and about 105 cells were plated on each 2 × YT agar plate supplemented with Cm, Tet and 500 μg / ml Amp. After 24 hours, colonies were picked and regrown in 6 ml of 2 × YT supplemented with Cm, Tet and 200 μg / ml Amp. DNA was isolated and purified by agarose gel electrophoresis.

  Positive selection is performed based on suppression of the amber stop codon introduced at position Ala184 of the TEM-1β lactamase gene. The plasmid pBLAM-JYRS encodes the gene for Methanococcus jannaschii tyrosyl-tRNA synthetase and β-lactamase with an amber mutation in Ala184. The pAC plasmid isolated from cells surviving after negative selection was cotransformed with pBLAM-JYRS into E. coli DH10B cells. Cells that contain non-functional tRNAs or tRNAs that are weak substrates of Methanococcus jannaschii synthetase die, and cells with tRNAs that can be loaded by the synthetase survive. In order to test the feasibility of positive selection, two model suppressor tRNAs were tested in the presence of Methanococcus jannaschii TyrRS. sc-tRNATyrCUA has G1: C72 base pairs and is not efficiently loaded by Methanococcus jannaschii TyrRS. When this was co-expressed in cells with the Ala184 amber β-lactamase mutant, the cells survived to an IC 50 = 18 μg / ml ampicillin. On the other hand, cells containing Methanococcus jannaschii tRNATyrCUA and cognate TyrRS survived to IC 50 = 1220 μg / ml ampicillin. See, eg, Wang et al. (2000), supra. Model positive selection was first tested in liquid 2 × YT medium. FIG. 12A shows the result of growing cells containing pBLAM-JYRS and various pAC plasmids in a liquid 2 × YT medium to which various concentrations of ampicillin were added. Cells transformed with mj-tRNATyrCUA proliferated at a high rate when ampicillin concentration was high. When cells were grown for more than 24 hours, cells transformed with pAC-Cm or pAC-YYG1 also grew to saturation. Therefore, positive selection was performed on plates with an initial cell density of 103-105 / plate. See FIG. 12B. Viability (number of colonies on plates with ampicillin added to plates without ampicillin) did not change significantly with changing initial cell density and was stable throughout the growth time. As a result of positive selection on an ampicillin plate, cells expressing mj-tRNATyrCUA proliferated preferentially. Therefore, for library selection, positive selection was performed on plates rather than liquid media.

  Two overlapping oligonucleotides used to construct the anticodon loop library (tRNA sequences are underlined): LW125: 5′-GGAATTC-3 ′ and LW126: 5′-AAAACTGCAG-3 ′ (in sequence) , N is equimolar A, C, T, or G) to create a library of mutant tRNAs. The oligonucleotide sequences of the entire loop library are LW145: 5′-GGAATTC-3 ′ and LW146: 5′-AAAACTGCAG-3 ′. These genes were inserted into pAC123 as described above to obtain a tRNA library.

  Negative and positive selections were performed in tandem as described above on both the anticodon loop and the entire loop library. Selected suppressor tRNAs were isolated, retransformed into E. coli DH10B containing pBLAM, and tested for tRNA orthogonality to E. coli synthetase. Next, tRNA was retransformed into E. coli containing pBLAM-JYRS, and the efficiency of tRNA loading by Methanococcus jannaschii TyrRS was tested. Sequencing of the clones obtained from a single negative and positive selection of the anticodon loop library revealed that three independent tRNAs were isolated. See FIG. When cotransformed with pBLAM, all IC50 values were lower than Methanococcus jannaschii tRNATyrCUA, indicating a weaker substrate for E. coli synthetase.

  Mutant AA2 also had very high affinity for Methanococcus jannaschii TyrRS. This mutant tRNA could be stably maintained in E. coli, but the growth rate decreased for unknown reasons. Perhaps this resulted in mutants AA3 and AA4, both with mutations outside the random mutation region. Cells containing AA3 or AA4 grew normally. However, AA3 and AA4 were relatively weak substrates for Methanococcus jannaschii TyrRS.

Four independent tRNAs were selected from two negative and positive selections using the entire loop library. See FIG. Both were weaker substrates for E. coli synthetase than the parental Methanococcus jannaschii tRNATyrCUA, but were still efficiently loaded by Methanococcus jannaschii TyrRS according to the in vivo β-lactamase assay. See Table 2. The IC50 value of the cell expressing the best mutant J17 was 12 μg / ml ampicillin, which was even lower than the cell expressing the orthogonal tRNAGlnCUA derived from Saccharomyces cerevisiae (21 μg / ml ampicillin). When J17 was co-expressed with Methanococcus jannaschii TyrRS, the cells survived to an IC50 value of 436 μg / ml ampicillin and the selection window (ratio of IC50 in the presence of TyrRS to IC50 in the absence of TyrRS) was 35 times. Furthermore, the expression of these mutant tRNAs did not affect the growth of E. coli cells.

Table 2. In vivo β-lactamase assay of selected suppressor tRNAs

Suppressor TyrRS IC50 (μg / mL ampicillin)
Simultaneously with pBLAM pBLAM-JYRS
Expression and co-expression

mj-tRNATyrCUA 56 1220
No tRNATyrCUA 10 10
Mutant tRNA selected from anticodon loop library
AA2 22 1420
AA3 10 110
AA4 12 135
Mutant tRNA selected from whole loop library
Mutant tRNA surviving after both selections
J15 30 845
J17 12 436
J18 20 632
J22 14 459
Mutant tRNA surviving only after negative selection
N11 11 16
N12 9 18
N13 10 12
N16 9 9

The plasmid pBLAM was used to express the β-lactamase gene having an amber codon in Ala184, and the plasmid pBLAM-JYRS was used to express the amber mutant and TyrRS of Methanococcus jannaschii. Suppressor tRNA was encoded by the pAC plasmid and co-transformed with pBLAM or pBLAM-JYRS in the assay.

  To confirm the properties of selected suppressor tRNAs, they were tested in a separate in vivo assay based on amber codon suppression of the chloramphenocol acetyltransferase (CAT) gene. In contrast to β-lactamase secreted into the periplasm, CAT is localized in the cytoplasm. Furthermore, ampicillin is bactericidal, while chloramphenicol is bacteriostatic. As shown in Table 3 below, the selected suppressor tRNAs were also found to be orthogonal in the CAT assay and suitable for CAT selection.

Table 3. In vivo chloramphenicol acetyltransferase assay of selected suppressor tRNAs

Suppressor TyrRS IC50 (μg / mL chloramphenicol)
pYC alone pYC + pBK-JYRS
mj-tRNATyrCUA 27 308
No tRNATyrCUA 3 3
J15 11 297
J17 4 240
J18 6 284
J22 5 271

The pYC plasmid encoded chloramphenol acetyltransferase having an amber codon at Asp112 and various suppressor tRNAs shown in the left column of the table. pBK-JYRS was used to express Methanococcus jannaschii TyrRS.

  An in vivo complementation assay based on amber codon suppression of the β-lactamase gene was performed as previously described. See, eg, Liu & Schultz, (1999), supra; and Wang et al., (2000), supra. In the chloramphenocol acetyltransferase (CAT) assay, Asp112 of the CAT gene of pACYC184 was replaced with an amber codon to obtain pACMD112TAG. For example, M.M. Pasternak, T .; J. et al. Magliay, P.M. G. Schultz, A new orthodontic suppressor tRNA / aminoacyl-tRNA synthetase pair for developing an organic gene, Helv. Chim. Acta 83: 2277-2286 (2000). Under the control of the lpp promoter and rrnC terminator, the gene encoding the suppressor tRNA was excised from the aPC plasmid with NcoI and AvaI, inserted into pACMD112TAG that had been previously digested, and plasmids pYC-JY, pYC-J15, pHC-J17, pYC-J18 and pYC-J22 were obtained. The plasmid pBK-JYRS, a derivative of pBR322, was used to express Methanococcus jannaschii TyrRS under the control of the E. coli GlnRS promoter and terminator. A wide concentration range of chloramphenocol was added to the growth medium and titrated, the survival of E. coli DH10B cells co-transformed with pYC plasmid alone or pYC with pBK-JYRS was examined, and IC50 values were interpolated from the curves.

  For comparison, 4 colonies that passed only negative selection were randomly picked and tested for tRNA using an in vivo complementation assay. When transformed with pBLAM, the IC50 value was very low in all cases, indicating that the negative selection functioned well. See Table 2. IC50 values were also very low when cotransformed with pBLAM-JYRS, indicating that positive selection functions to eliminate tRNA that cannot be loaded by Methanococcus jannaschii TyrRS.

  Analysis of the DNA sequence of the selected tRNA revealed a characteristic pattern of nucleotide substitutions. See FIG. In both tRNAs that passed both negative selection and positive selection, C32 and T60 were unchanged, G37 was mutated to A, and T17 was mutated to A or G. Semiconservative mutations included A38 to C or A mutations, T45 to T or A mutations, and T47 to G or T mutations. Other mutations had no obvious common pattern. Twenty tRNAs that passed only negative selection were also sequenced (four of which are shown in FIG. 13) and all were found to lack at least one of the common mutations.

  Preferred nucleotides in the selected mutant suppressor tRNA can play the following roles: (I) It can function as a negative determinant of recognition by E. coli synthetase. (Ii) The identity element of aminoacylation by Methanococcus jannaschii TyrRS can be identified. Alternatively, (iii) the interaction between the tRNA and the E. coli translation mechanism can be optimized so as to increase the suppression efficiency of the tRNA. Note that the G37A mutation was found in tRNAs selected from both the anticodon loop and the entire loop library. This mutation is consistent with previous reports showing that adenine at position 37 increases amber suppression efficiency. For example, M.M. Yarus, Translational efficiency of transfer RNA's: Use of an expanded anticodon, Science 218: 646-652 (1982); Bradley, J.M. V. Park, L .; Sol, tRNA2Gln Su + 2 mutants that increase amber preparation, J. MoI. Bacteriol. 145: 704-712 (1982); G. Kleina, J .; Masson, J .; Normanly, J.M. Aberlson, J.M. H. Miller, Construction of Escherichia coli amber uppressor tRNA genes. II. Synthesis of additional tRNA genes and improvement of suppressor efficiency, J. et al. Mol. Biol. 213: 705-717 (1990). Fechter et al. Recently reported that the complete identity set of Methanococcus jannaschii tRNATyr is 6 nucleotides (C1G72A73 and anticodon G34U35A36). P. Fechter, J .; Rudinger-Thion, M.M. Tukalo, R.A. Giege, Major tyrosine identity defectives in Methanococcus jannaschii and Saccharomyces cerevisiae tRNATyrare conserved butted expresser. J. et al. Biochem. 268: 761-767 (2001). Thus, the presence of C32 and T60 in all selected mutant suppressors is not required for recognition by Methanococcus jannaschii TyrRS. All E. coli tRNAs have a T at position 60 except that the four tRNAs are C. M.M. Sprinzl, C.I. Horn, M.M. Brown, A.M. Loudovic, S.M. Steinberg, Compilation of tRNA sequences and sequences of tRNA genes, Nucleic Acids Res. 26: 148-153 (1998). According to the crystal structure of yeast tRNAPhe, nucleotide 60 does not interact with other nucleotides. J. et al. L. Sussman, S.M. R. Holbrook, R.A. W. Warrant, G .; M.M. Church, S.M. H. Kim, Crystal structure of yeast phenylalanine transfer RNA. 1. Crystallographic refinement, J. Org. Mol. Biol. 123: 607-630 (1978). Thus, T60 appears to maintain the shape of the TC loop for productive interaction with the E. coli translation machinery. Changes in the TC loop structure may affect translation fidelity because glycine tRNA shifts the reading frame when nucleotides are inserted between TC and conserved C61. D. J. et al. O 'Mahony, B.M. H. Hims, S.M. Thompson, E .; J. et al. Murgola, J. et al. F. Atkins, Glycine tRNA mutants with normal anticode loop size cause 1 flameshifting, Proc. Natl. Acad. Sci. USA 86: 7979-7983 (1989). Although the role of C32 is not clear, position 32 of E. coli tRNA contains T, C and A, and two E. coli tRNATyr have C32. For position 17a, only tRNAThr has an A at this position.

  All selected suppressor tRNAs are weaker substrates for E. coli synthetase than Methanococcus jannaschii tRNA TyrCUA, so that the loading error is reduced when introduced into E. coli. These tRNAs can also be stably maintained in E. coli without adversely affecting host cell growth. Furthermore, it can be efficiently loaded by Methanococcus jannaschii TyrRS. All of these properties allow mutant suppressor tRNAs to form a robust orthogonal tRNA-synthetase pair for use with Methanococcus jannaschii TyrRS for selective in vivo protein incorporation of unnatural amino acids. Using J17 mutant suppressor tRNA and recombinant mutant TyrRS, O-methyl-L-tyrosine was delivered in response to a TAG codon with fidelity comparable to 20 common amino acids. L. Wang, A .; Block, B.M. Herberich, P.M. G. See Schultz, Expanding the genetic code of Escherichia coli, Science, 292: 498-500 (2001).

  Example 2 Mutating TyrRS to Load MutRNATyr / CUA with Unnatural Amino Acid O-Methyl-L-Tyrosine

  A unique transfer RNA (tRNA) -aminoacyl tRNA synthetase pair has been generated in E. coli that expands the number of genetically encoded amino acids. When this pair is introduced into Escherichia coli, the synthetic amino acid O-methyl-L-tyrosine added to the growth medium from the outside can be incorporated into the protein in vivo in response to the amber nonsense codon. According to analysis of dihydrofolate reductase containing unnatural amino acids, translation fidelity is over 99%. This approach provides a general way to increase the gene repertoire of living cells to introduce diverse amino acids with novel structural, chemical and physical properties that are not present in the 20 common amino acids.

  If cross-species aminoacylation is inefficient and, in some cases, the anticodon loop is not the main determinant of synthetase recognition, create an orthogonal tRNA / synthetase pair in E. coli by introducing a pair from another organism can do. An example of such a candidate pair is the Methanococcus jannaschii tyrosyl-tRNA / synthetase pair, which differs from E. coli tRNATyr in the tRNATyr identity element (especially the first base pair of the acceptor stem is GC in E. coli). Although it is CG in Methanococcus jannaschii), tyrosyl synthetase (TyrRS) is a protozoan that has only a minimal anticodon-loop binding domain. For example, B. A. Steer, & P.M. Schimmel, J. et al. Biol. Chem. 274: 35601-6 (1999). Furthermore, since Methanococcus jannaschii TyrRS has no editing mechanism (see, eg, Jakubowski & Goldman, Microbiol. Rev., 56: 412 (1992)), it does not appear to calibrate unnatural amino acids ligated to tRNA. Methanococcus jannaschii TyrRS efficiently aminoacylates the amber suppressor tRNA derived from its cognate tRNATyr (see, eg, Wang et al. (2000), J. Am. Chem. Soc., Supra), but does not aminoacylate E. coli tRNA. (For example, see Steer & Schimmel, (1999), supra). In addition, Methanococcus jannaschii tRNACUA Tyr is a weak substrate for E. coli synthetase, but functions efficiently in E. coli for protein translation. For example, Wang et al. (2000), J. MoI. Am. Chem. Soc. , See above.

  To further weaken the recognition of the orthogonal tRNA, Methanococcus jannaschii tRNACUA Tyr by E. coli synthetase, 11 nucleotides of tRNA that do not directly interact with Methanococcus jannaschii TyrRS (C16, C17, U17a, U20, C32, G37, U37, U38, U37, U38 , A59 and U60) were randomly mutated to generate a suppressor tRNA library. This tRNA library is subjected to negative selection (for example, suppression of amber mutation in a toxic reporter gene such as barnase gene), tRNA aminoacylated by E. coli synthetase is removed, and then tRNA efficiently aminoacylated by Methanococcus jannaschii TyrRS Was positively selected (for example, suppression of amber mutation in a reporter gene such as β-lactamase gene).

  The orthogonality of the resulting suppressor tRNA was tested by an in vivo complementation assay based on suppression of the amber stop codon at a non-essential position (eg Ala184) of a reporter on the vector (eg TEM-1β lactamase gene carried on plasmid pBLAM). When the transformed suppressor tRNA is aminoacylated by endogenous E. coli synthetase, the cells proliferate in the presence of ampicillin. E. coli transformed with Methanococcus jannaschii tRNACUA Tyr and reporter construct pBLAM survives in the presence of 55 μg / mL ampicillin. Expression of the best mutant suppressor tRNA (mtRNACUA Tyr) selected from the library will allow cells to survive with as little as 12 μg / mL ampicillin, with similar results in the absence of suppressor tRNA. The mutant suppressor tRNA contained nucleotide substitutions C17A, U17aG, U20C, G37A and U47G. When Methanococcus jannaschii TyrRS is co-expressed with this mtRNA CUATyr, the cells survive at 440 μg / mL ampicillin. Thus, mtRNACUA Tyr is a weaker substrate for endogenous synthetase than Methanococcus jannaschii tRNACUA Tyr, but is efficiently aminoacylated by Methanococcus jannaschii TyrRS.

  To modify the amino acid specificity of orthogonal TyrRS to load mtRNACUA Tyr with the desired unnatural amino acid, a library of TyrRS mutants was generated and screened. Based on the crystal structure of homologous TyrRS derived from Bacillus stearothermophilus (eg, P. Brick, TN Bhat, DM Blow, J. Mol. Biol., 208: 83 (1988)) Five residues in the active site of Methanococcus jannaschii TyrRS (Tyr32, Glu107, Asp158, Ile159 and Leu162) within 6.5 km of the para position of the ring were mutated. See FIG. All of these residues were first mutated to alanine, and the resulting inactive Ala5 TyrRS was used as a template to perform polymerase chain reaction (PCR) random mutagenesis with oligonucleotide primers.

  For example, the TyrRS gene was expressed in the plasmid pBK-JYRS, which is a pBR322-derived plasmid having kanamycin resistance, under the control of the E. coli GlnRS promoter and terminator. Residues Tyr32, Glu107, Asp158, Ile159 and Leu162 were replaced with Ala by site-directed mutagenesis, resulting in plasmid pBK-JYA5. Eight oligonucleotides with NNK (N = A + T + G + C, K = G + T, and M = C + A) at the mutation site (for example, oligonucleotide LW1575′-GGAATTCCATATGACGATTATTGATACTGATTACTTACTACTTGTTCATACTGTTCATACTG '-TAGGTTTTGAACCCAAGTGGTAAAAATAC-3', LW165 5 ' TG-3 ', LW167 5' -CATCCCTCCAACTGCAACATCAACGCCMNNATAATGMNNMNNATTAACCTGCATTATTGGATAGATAAC-3 ', LW163 5' -GCGTTGATGTTGCAGTTGGAGGGATG-3 ', and LW105 5' -AAACTGCAGTTATAATCTCTTTCTAATTGGCTC-3 '(Operon, CA)) using Ala5 TyrRS mutant (PBK- JYA5) was amplified by PCR and religated into pBK-JYA5 digested with NdeI-PstI to obtain a TyrRS library. The ligated vector was transformed into E. coli DH10B competent cells to obtain a library of 1.6 × 10 9 colony forming units (cfu). Sequencing the TyrRS gene from 40 randomly fished colonies confirmed that there was no base substitution at the randomly mutated NNK position and no other unexpected mutations. The library was amplified by maxiprep and the selected strain pYC-J17 was transformed using supercoiled DNA.

  Next, a library of mutant orthogonal TyrRS was subjected to positive selection based on suppression of the amber codon at a non-essential position of the chloramphenicol acetyltransferase (CAT) gene (eg Asp112). For example, M.M. Pastrnak, T .; J. et al. Magliay, P.M. G. Schultz, Helv. Chim. Acta, 83: 2277 (2000). Cells transformed with the mutant TyrRS library and the mtRNACUA Tyr gene were grown in a medium supplemented with unnatural amino acids, and those that survived in the presence of various concentrations of chloramphenicol were selected. If the mutant TyrRS loads the orthogonal mtRNACUA Tyr with a natural or unnatural amino acid, the cell produces CAT and survives. Viable cells were then grown in the presence of chloramphenicol in the absence of unnatural amino acids. Cells that did not survive (eg, cells encoding a mutant TyrRS that charges the orthogonal mtRNACUA Tyr with an unnatural amino acid) were isolated from replica plates supplemented with the unnatural amino acid. Mutant TyrRS gene was isolated from these cells, recombined in vitro by DNA shuffling, and retransformed into E. coli for late selection to increase chloramphenocol concentration.

  A tyrosine analog in which the parahydroxyl group was replaced with a methoxy group was used for selection. In some cases, other tyrosine analogs can be used for selection, for example, tyrosine analogs having various functional groups (acetyl, amino, carboxyl, isopropyl, methyl, O-methyl, nitro, etc.) in the para position of the aryl ring. Is mentioned. For example, a gene encoding mtRNACUA Tyr was expressed in E. coli DH10B cells under the control of lpp promoter and rrnC terminator in plasmid pYC-J17, which is a pACYC184 derivative that also encodes an Asp112 TAGCAT mutant. E. coli DH10B competent cells into which pYC-J17 had been introduced were transformed with supercoiled DNA encoding the TyrRS library, resulting in a library larger than 3 × 10 9 cfu that completely covered the original library. Next, 17 μg / mL tetracycline (Tet), 25 μg / mL kanamycin (Kan), 50 μg / mL chloramphenicol (Cm) and 1 mM non-naturally occurring on minimal medium (GMML) plate containing 1% glycerol and 0.3 mM leucine. Cells were cultured with the addition of amino acids. After colonization at 37 ° C. for 44 hours, colonies on the plate to which O-methyl-L-tyrosine was added were pooled, the plasmid was isolated, retransformed into E. coli DH10B competent cells into which pYC-J17 had been introduced, and transformed cells. Was positively selected on 50 μg / mL Cm. Colonies (96) were individually picked from the plate, diluted with 100 mL of liquid GMML medium, and streaked on two sets of Kan / Tet GMML plates with various concentrations of Cm added. The first set of plates did not add O-methyl-L-tyrosine, the Cm concentration was 10-25 μg / mL, and the second set of plates added 1 mM O-methyl-L-tyrosine and 50 μg / mL Cm. Replicas of colonies that did not grow on the first set of plates in the presence of 15 μg / mL Cm were picked from the second set of plates. The plasmid containing the TyrRS gene was purified and recombined in vitro by DNA shuffling using the Stemmer protocol except that Mg2 + in the fragmentation reaction was replaced with 10 mM Mn2 +. W. P. C. Stemmer, Nature 370, 389-91 (1994); A. Lorimer, I .; Pastan, Nucleic Acids Res. 23, 3067-8 (1995). Next, the library was re-ligated into the previously digested pBK-JYA5 vector to obtain a second generation TyrRS library with a typical size of 8 × 10 8 to 3 × 10 9 cfu. Thirty randomly selected from the library were sequenced. The mutagenesis rate introduced by DNA shuffling was 0.35%. This library was transformed into a selection strain for next selection and then shuffled. For the second set of plates, the positive selection Cm concentration was increased to 80 μg / mL for the second time and to 120 μg / mL for the third time, while the Cm concentration was not changed for the first set of plates. Colonies began to grow at a Cm concentration of 20-25 μg / mL on the first set of plates after 3 DNA shufflings, indicating that the TyrRS mutant accepts natural amino acids as substrates. Therefore, the best clone selected after two DNA shufflings was characterized in detail.

  Two rounds of selection and DNA shuffling were performed to obtain clones whose survival in chloramphenicol was dependent on the addition of 1 mM O-methyl-L-tyrosine to the growth medium. In the absence of O-methyl-L-tyrosine, cells transfected with mutant TyrRS can survive if 15 μg / mL chloramphenicol is added to a minimal medium (GMML) plate containing 1% glycerol, 0.3 mM leucine. There wasn't. The cells were able to grow on GMML plates supplemented with 125 μg / mL chloramphenicol in the presence of 1 mM O-methyl-L-tyrosine. Similar results were obtained with liquid GMML. As a control, cells transfected with mtRNACUA Tyr and inactive Ala5 TyrRS did not survive at the lowest chloramphenicol concentration used, with or without 1 mM O-methyl-L-tyrosine. See FIG. Even if 1 mM O-methyl-L-tyrosine itself is added, the growth rate of Escherichia coli does not change so much.

  Analysis of the sequence of mutant TyrRS that charges O-methyl-L-tyrosine to mtRNACUA Tyr revealed the following mutations. Tyr32 → Gln32, Asp158 → Ala158, Glu107 → Thr107 and Leu162 → Pro162. See FIG. Homologous B. According to the X-ray crystal structure of stearothermophilus TyrRS, the loss of the hydrogen bond network between Tyr32, Asp158 and substrate tyrosine appears to be detrimental to the binding of tyrosine and mutant TyrRS. In fact, B. Mutations of stearothermophilus TyrRS Asp176 (corresponding to Methanococcus jannaschii Asp158) result in an inactive enzyme. For example, G. D. P. Gray, H.C. W. Duckworth, A.D. R. See Fersht, FEBS 318: 167-71 (1993). At the same time, Asp158 → Ala158 and Leu162 → Pro162 mutations form a hydrophobic pocket that extends the methyl group of O-methyl-L-tyrosine further into the substrate binding cavity. Other important catalytic residues of the active site that bind to the ribose or phosphate groups of adenylate did not change after two rounds of DNA shuffling.

  The kinetics of adenylate formation of O-methyl-L-tyrosine and tyrosine with adenosine triphosphate (ATP) catalyzed by mutant TyrRS was analyzed in vitro by a pyrophosphate exchange assay at 37 ° C. For example, a mutant TyrRS with 6 histidines at its C-terminus was cloned into plasmid pQE-60 (Qiagen, CA) to create plasmid pQE-mJYRS. The protein was purified by immobilized metal affinity chromatography according to the manufacturer's protocol (Qiagen, CA). 100 mM TrisHCl (pH 7.5), 10 mM KF, 5 mM MgCl2, 2 mM ATP, 2 mM NaPPi, 0.1 mg. Pyrophosphate (PPi) exchange was performed at 37 ° C. in reaction mixtures containing mL bovine serum albumin, about 0.01 μCi / mL [32 P] NaPPi and various concentrations of tyrosine or O-methyl-L-tyrosine. Purified mutant TyrRS was added to initiate the reaction, and aliquots were periodically taken and quenched with 0.2 M NaPPi, 7% perchloric acid and 2% activated carbon. After the activated carbon was filtered and washed with 10 mM NaPPi (pH 2), the 32P concentration of the activated carbon adsorbed ATP was measured by scintillation counting. Kcat and Km values were calculated by direct fitting of the Michaelis-Menten equation using nonlinear regression analysis.

  The Michaelis constant (Km) (5833 ± 902 μM) of tyrosine is about 13 times that of O-methyl-L-tyrosine (443 ± 93 μM), and the catalytic rate constant (kcat) of tyrosine (1.8 ± 0.2 × 10 -3s-1) is one-eighth of O-methyl-L-tyrosine (14 ± 1x10-3s-1). Therefore, the kcat / Km value of mutant TyrRS for O-methyl-L-tyrosine is about 100 times that of tyrosine. The physiological concentration of tyrosine in E. coli is about 80 μM, which is much lower than the Km value for the tyrosine of the mutant TyrRS (5833 μM). The concentration of O-methyl-L-tyrosine in the cell is expected to be equal to or greater than Km (443 μM).

  This example demonstrates that the protein biosynthesis mechanism of E. coli can be augmented to accept genetically encoded additional amino acids. The ability to introduce new amino acids directly into proteins in living cells can be a new tool for protein and cell function studies and can produce proteins with enhanced properties compared to natural proteins. The methods described herein can be applied to other amino acids having novel spectroscopic, chemical, structural, and other properties. E. coli ribosomes have been shown to be able to incorporate amino acids with diverse side chains into proteins using in vitro protein biosynthesis. For example, C.I. J. et al. Noren, S.M. J. et al. Anthony-Chill, M .; C. Griffith, P.M. G. See Schultz, Science 244, 182-8 (1989). Additional orthogonal tRNA / synthetase pairs (eg, DR Liu, PG Schultz, Proc. Natl. Acad. Sci. USA 96, 4780-5 (1999); and AK Kowal, C. Kohler, U.L., RajBhandary, Proc.Natl.Acad.Sci.U.S.A., 98: 2268 (2001)), 4 base codons (e.g., TJ Magmary, JC Anderson, P. et al.). G. Schultz, J. Mol. Biol. 307: 755 (2001); and B. Moore, BC Persson, CC Nelson, RF Gestelland, JF Atkins, J. Mol. Biol., 298: 195 (2000)) and others described herein. Rector codons can further expand the number and range of embeddable amino acids. Orthogonal pairs of eukaryotic cells can also be produced by the methods described herein.

  See also the corresponding patent application (Title of the Invention "In vivo Information of Universal Amino Acids", Attorney Docket No. 54-000120PC / US) which is incorporated herein by reference as reference material. The application describes an example of making an O-methyl-L-tyrosine mutant of dihydrofolate reductase (DHFR) using the above system.

  Example 3-Mutating TyrRS to load mutRNATyr / CUA with unnatural amino acid L-3- (2-naphthyl) alanine

This example relates to another orthogonal pair that can be used to incorporate the second unnatural amino acid L-3- (2-naphthyl) alanine into a protein in an organism (eg, E. coli). The method used to create an orthogonal pair that incorporates this unnatural amino acid into a protein is described below. For a more detailed description of protein incorporation of this unnatural amino acid, refer to the corresponding patent application (invention name “In vivo information of unnatural amino acids”, representative docket number 54-000120PC / US) incorporated herein by reference. Please refer.

  The amber stop codon and its corresponding orthogonal amber suppressor tRNA, mutRNACUA Tyr, were selected to encode the unnatural amino acid. As described above and in Wang & Schultz, Chem. Biol. 8: 883-890 (2001), Methanococcus jannaschii tyrosyl tRNA synthetase (TyrRS) was used as a starting point for producing orthogonal synthetases with unnatural amino acid specificity. This TyrRS does not aminoacylate endogenous E. coli tRNA (see, eg, Steer & Schimmel, Biol. Chem., 274: 35601-35606 (1999)), but aminoacylates mutRNACUA Tyr with tyrosine (eg, Wang, Maglyry, Liu, Schultz). , J. Am. Chem. Soc., 122: 5010-5011 (2000)). L-3- (2-naphthyl) alanine was selected for this test because it is significantly different in structure from tyrosine and may have new packing properties. Create a library of Methanococcus jannaschii TyrRS mutants to modify the amino acid specificity of TyrRS to load mutRNACUA Tyr with 20 common amino acids but not L-3- (2-naphthyl) alanine And screened. Based on analysis of the crystal structure of homologous TyrRS from Bacillus stearothermophilus (see Brick, Bhat, Blow, J. Mol. Biol., 208: 83-98 (1989)) within 7 cm from the rose position of the tyrosine aryl ring M.M. Five residues (Tyr32, Asp158, Ile159, Leu162 and Ala167) in the active site of jannaschii TyrRS were mutated. See FIG. A synthetase specific for L-3- (2-naphthyl) alanine was not selected from the mutant TyrRS library reported in Wang, Block, Herberich, Schultz, Science, 292: 498-500 (2001). . In order to reduce wild-type synthetase contamination in late selection, all of these residues (except Ala167) were first mutated to alanine. The obtained inactive Ala5 TyrRS gene was used as a template, and random mutagenesis was performed by polymerase chain reaction (PCR) using an oligonucleotide having a random mutation at the corresponding site.

  The mutant TyrRS library was first subjected to positive selection based on suppression of the amber stop codon at a nonessential position (Asp112) of the chloramphenicol acetyltransferase (CAT) gene. Cells transformed with the mutant TyrRS library and mutRNACUA Tyr were grown in a minimal medium supplemented with 1 mM L-3- (2-naphthyl) alanine and 80 μg / mL chloramphenicol. Cells can survive only when the mutant TyrRS aminoacylates mutRNACUA Tyr with the natural amino acid or L-3- (2-naphthyl) alanine. Next, viable cells were grown in the presence of chloramphenicol in the absence of unnatural amino acids. The cells that did not survive appeared to encode a mutant loading mutRNACUA Tyr with L-3- (2-naphthyl) alanine, and were picked from a replica plate with an unnatural amino acid added. After negative screening after 3 positive selections, 4 mutant TyrRS were characterized using an in vivo assay based on suppression of the Asp112 TAG codon of the CAT gene.

Table 4. In vivo chloramphenicol acetyltransferase assay of mutant TyrRS a

Mutant TyrRS IC50 (μg / mL chloramphenicol)
L-3- (2-Naph L-3- (2-Naph
No chill) -Ala No chill) -Ala added TyrRS 4 4
Wild type TyrRS 240 240
After selection
S1-TyrRS 30 120
S2-TyrRS 30 120
S3-TyrRS 25 110
S4-TyrRS 35 100
After DNA shuffling
SS12-TyrRS 9 150

a The pYC-J17 plasmid was used to express the mutRNACUA Tyr gene and the chloramphenicol acetyltransferase gene with an amber stop codon at Asp112. The pBK plasmid was used to express TyrRS and cotransformed with pYC-J17 into E. coli DH10B. Cell viability on GMML plates was tested by titration with various concentrations of chloramphenicol.

  In the absence of L-3- (2-naphthyl) alanine, the selected TyrRS and mutRNACUA Tyr expressing cells are 25-35 μg / mL in a minimal medium plate (GMML plate) containing 1% glycerol and 0.3 mM leucine. Cells survived in the presence of lamphenicol, and in the presence of L-3- (2-naphthyl) alanine, cells survived in the presence of 100-120 μg / mL chloramphenicol on GMML plates. Compared to IC50 values in the absence of TyrRS (4 μg / mL chloramphenicol), these results indicate that the selected TyrRS accepts L-3- (2-naphthyl) alanine but also loads the natural amino acid to some extent It is shown that. See Table 4 above.

In order to further weaken the activity of mutant TyrRS against natural amino acids, DNA shuffling was performed once using the above four mutant genes as templates. The resulting mutant TyrRS library was further subjected to positive selection and negative screening twice. One with significantly reduced activity against natural amino acids (IC 50 = 9 μg / mL chloramphenicol) and increased activity against L-3- (2-naphthyl) alanine (IC 50 = 150 μg / mL chloramphenicol) Mutant TyrRS (SS12-TyrRS) was obtained. See Table 4.

  The resulting evolved SS12-TyrRS has the following mutations: Tyr32 → Leu32, Asp158 → Pro158, Ile159 → Ala159, Leu162 → Gln162, and Ala167 → Val167. See FIG. Homologous B. According to the crystal structure of stearothermophilus TyrRS, the mutation of Tyr32 → Leu32 and Asp158 → Pro158 may be detrimental to the binding of tyrosine and SS12-TyrRS because it may cause loss of hydrogen bond between Tyr32, Asp158 and the natural substrate tyrosine. Conceivable. Most residues are mutated to amino acids with hydrophobic side chains that are predicted to facilitate the binding of L-3- (2-naphthyl) alanine. The crystal structures of wild-type Methanococcus jannaschii TyrRS and evolved SS12-TyrRS can be determined by available methods.

  According to the examples of cell growth, protein expression and mass spectrometry described in this specification and the corresponding application (invention name “In vivo information of unnatural amino acids”, agent docket number 54-000120PC / US), mutRNACUA Tyr / SS12 The -TyrRS pair was able to selectively insert L-3- (2-naphthyl) alanine into the protein in response to amber codons with fidelity comparable to natural amino acids. Wang, Block, and Schultz, Adding L-3- (2-Naphthyl) alanine to the genetic code of E.M. coli. J. et al. Am. Chem. Soc. (2002) 124 (9): 1836-7. The above results for amino acids that are structurally different from tyrosine support the applicability of the methods described herein to a variety of unnatural amino acids.

  Example 4-Mutating TyrRS to load mutRNATyr / CUA and screening mutant TyrRS with desired properties by other methods (eg FACS and phage display panning)

  Orthogonal pairs can also be selected using the reporter gene and protein as described above in combination with in vivo FACS screening, antibody detection, in vitro phage display panning, and the like. See, eg, Wang & Schultz, Expanding the genetic code. Chem. Commun. , 1: 1-11 (2002).

  For example, in order to screen synthetases, for example, screening by general-purpose fluorescence activated cell sorting (FACS) using green fluorescent protein (GFP) as a reporter has been developed. See FIGS. 16A and B. Synthetase activity is reported by suppression of a selector codon (eg, an amber stop codon (TAG)) in T7 RNA polymerase that induces GFP expression. See, for example, FIG. 26 which shows another example of the selection / screening method of the present invention. Only when the amber codon is suppressed, the cell will produce functional T7 RNA polymerase and can express GFP, so the cell will fluoresce. In positive screening, fluorescent cells that encode active synthetases that load the orthogonal tRNA with natural or unnatural amino acids are recovered. Thereafter, the selected cells are diluted and grown in the absence of the unnatural amino acid, and then non-fluorescent cells expressing, for example, a synthetase having specificity only for the unnatural amino acid are selected by FACS. FIGS. 17A, B, C and D show suppression of selector codons (eg, amber codons) using glutamine synthetase. By setting a threshold value for measuring the fluorescence intensity, the stringency of both positive and negative screening can be easily controlled.

  As a direct positive selection method specific to a specific unnatural amino acid, a method utilizing the high affinity of a monoclonal antibody for the unnatural amino acid displayed on the phage surface has also been developed. See FIG. M.M. Pastrnak and P.A. G. Schultz, Bioorg. Med. Chem. 9: 2373 (2001). For example, a C3 peptide with an amber mutation is fused to the N-terminus of VSCM13 phage coat protein pIII so that phage production requires suppression of the amber stop codon. Cells containing a phagemid expressing an orthogonal suppressor tRNA and a synthetase library are infected with C3TAG phage. C3TAG is suppressed by the active synthetase, and its cognate amino acid is displayed on the phage surface. The phage pool is then incubated with an immobilized monoclonal antibody against the unnatural amino acid and only those phages with synthetases specific for the unnatural amino acid are isolated. In mock selection, antibodies against Asp-containing epitopes were used to accumulate Asp-displayed phage from the pool of phage displaying Asn more than 300 times.

  Several in vitro screening methods can also be used. In one example of such a method, a library of mutant synthetases is presented to the phage and the phage particles are panned against the immobilized aminoalkyl adenylate analog of the aminoacyl adenylate intermediate. See FIG. For example, Methanococcus jannaschii TyrRS was fused to the pIII coat protein of M13 phage. This phage accumulated 1000-fold over control phage displaying unrelated antibodies after panning against an aminoalkyl adenylate analog of tyrosyl adenylate. Since only 0.1-1% of the starting TyrRS phage population displays TyrRS protein, the actual accumulation factor can be 10 5 -10 6.

  Example 5-Production of a protozoan leucyl-tRNA synthetase pair

  As a leucyl-tRNA synthetase derived from the protozoan Methanococcus jannaschii, a leucyl-tRNA synthetase was identified that can aminoacylate amber and frameshift suppressor tRNAs derived from the protozoan leucyl-tRNA but does not aminoacylate tRNA present in Escherichia coli. The selection strategy described herein was used to identify highly active tRNA substrates that are selectively loaded by this synthetase. Mutant synthetase libraries can be generated to select mutant synthetases that can be selectively loaded with unnatural amino acids.

  A β-lactamase reporter gene having an amber codon derived from 5 different protozoan leucyl tRNAs and a suppressor tRNA was synthesized by replacing the anticodon with a CUA anticodon to form an amber suppressor tRNA. Seven different leucyl tRNAs were cloned and co-transformed with the reporter construct. Three synthetases were more resistant to ampicillin in the presence of synthetase than controls without synthetase, and these systems were further tested. See FIG.

  In the next step, the synthetase loaded into the suppressor tRNA without interacting with the host tRNA was determined. Two strains, Methanobacterium thermoautotropicum and Methanococcus jannaschii, were selected and expressed, and in vitro aminoacylation was performed with purified tRNA derived from Halobacterium and total E. coli tRNA as positive controls. Methanococcus jannaschii synthetase was able to effectively load E. coli tRNA, but Methanobacterium thermoautotropicum synthetase was found to be specific for Halobacterium tRNA.

  Further improvements were made to increase the efficiency of the suppression system. A37 of the anticodon loop was G37 in leucyl tRNA synthetase. This mutation was found to be a negative determinant for aminoacylation by non-cognate synthetases in various eukaryotic cells and Halobacterium and a positive determinant for aminoacylation in yeast (although not in Halobacterium). A37 was also found to be an important requirement for efficient suppression. Anti-codon loops were randomly mutagenized and selected for more efficient suppression. Mutating G37 to A resulted in a more efficient suppressor and was able to suppress 20 times the concentration of ampicillin compared to the unmutated one. See FIG.

  In order to improve tRNA so that it was not preferentially loaded by other synthetases in E. coli, the acceptor stem of tRNA was randomly mutagenized. Positive / negative selection was used to identify tRNAs that were not loaded in the absence of Methanobacterium thermoautotropicum RS.

  Upon observing the selected mutant tRNA, the identifier base A37, which was found in all previous systems to be an essential positive determinant of leucylaminoacylation, was conserved in all observed mutant tRNAs. All mutant tRNAs with improved orthogonality also conserved C3: C70 base pairs. The best mutant tRNA observed reduced aminoacylation in the absence of synthetase by about a third, and actually increased suppression in the presence of Methanobacterium thermoautotropicum RS.

  For example, a mutant capable of suppressing a 4-base codon instead of a 3-base codon was also prepared. The 4-base codon can decode the genetic code of 4 bases at a time instead of 3 bases at a time, and can encode 256 types when only 64 types of amino acids can be encoded. The problem with the use of 4-base codons is that the anticodon loop of the tRNA needs to be extended and most systems can be disturbed. However, the first leucyl-based AGGA suppressor was identified. This was generated by random mutagenesis of an 8 base anticodon loop and selection in an AGGA-β lactamase reporter system. See FIG.

  The editing mechanism of the synthetase was also mutated to remove the editing function. The leucyl system has (at least) two active sites like several other synthetases. One site activates the amino acid with ATP, forms an enzyme-linked aminoacyl adenylate with synthetase, and then transfers the amino acid to the 3 ′ end of the tRNA. On the other hand, the second site cannot hydrolyze amino acids other than leucine from tRNA. The leucine system is known to exert this post-transfer editing function on methionine and isoleucine, and may function on unnatural amino acids as well.

  First, the edit domain was removed. The editing domain was replaced with a library of 6 tandem random amino acids. Positive selection based on suppression of stop codons in β-lactamase was used. A number of functional synthetases were obtained, but attempts were made to purify these synthetases, but in any case none could be detected, all these synthetases displayed a temperature sensitive phenotype and It was suggested that the deletion resulted in an unstable protein.

  Next, point mutations were made in the editing domain. The catalytic core of the editing domain is well conserved among species, and is conserved even with different amino acids, at least in the class of branched chain amino acids. Several of these conserved sites have been conventionally mutated (eg, T → P) and are known to lack editing functions. In addition to constructing mutants of Methanobacterium thermoautotropicum RS similar to several known mutants, a 20-member NNK library derived from T214 was also created. The protein was expressed and tested in vitro for aminoacylation with leucine and methionine. None of the previously identified mutations were transferable to the system of the present invention, but desirable mutations were identified from the T214 library. Two mutants T214S and T214Q capable of loading leucine were identified. Of these mutants, only T214Q was able to load methionine. T214S clearly maintains the function of deleting methionine, but the Gln mutant has lost this function.

  Next, a library was designed based on the crystal structure elucidated for Thermus thermophilus leucyl synthetase. The leucine side chain of the leucine aminoalkyl adenylate analog adenosine inhibitor was attached to the active site. Six sites around the leucine side chain binding pocket were replaced with random amino acids to create a larger library. Subsequent screening of synthetases from this library, for example by performing a positive / negative two-step selection, can identify synthetases capable of selectively loading unnatural amino acids.

  Example 6-4 Identification of tRNA that efficiently suppresses base codons

  A combinatorial approach was used to identify mutant tRNAs that efficiently suppress 4-base codons. T.A. J. et al. Magliay, J .; C. Anderson and P.M. G. Schultz, J. et al. Mol. Biol. 307: 755 (2001). A reporter library was constructed in which the serine codon of the β-lactamase gene was replaced with 4 random nucleotides. Next, a mutant tRNA (for example, suppressor tRNA) suppressor library composed of E. coli derivatives in which the anticodon loop (7 nt) was replaced with 8 or 9 random nucleotides was prepared. When these two libraries were crossed, an appropriate frameshift suppressor tRNA that decodes the 4 base sequence as a single codon translated full-length β-lactamase, and the cells became ampicillin resistant. Survival at higher ampicillin concentrations means that the corresponding tRNA has a higher suppression efficiency for 4-base codons. Using this selection, we identified four quartet codons AGGA, CUAG, UAGA, and CCCU and their cognate suppressor tRNAs that decode only canonical four base codons with efficiencies similar to natural triplet codon suppressors. New 5 and 6 base codon suppressors were also selected using this strategy. See Anderson, Maglyry, Schultz, Exploring the Limits of Codon and Anticodon Size, Chemistry & Biology, 9: 237-244 (2002). These extended codons, including those newly identified, appear to be useful for in vitro integration of multiple unnatural amino acids and in vivo protein mutagenesis.

  Example 7-Preparation of p-aminophenylalanine orthogonal tRNA synthetase

  To create an orthogonal synthetase of p-aminophenylalanine (pAF), a pair of Methanococcus jannaschii tyrosyl-tRNA synthetase (TyrRS) and mutant tyrosine amber suppressor tRNA (TyrCUAmutRNA) was used as a starting point. Wang, L.W. , Magliay, T .; J. et al. Liu, D .; R. & Schultz, P.A. G. A new functional suppressor tRNA / aminoacyl-tRNA synthetase pair for the in vivo information of unintentional amino acids into proteins. J. et al. Am. Chem. Soc. 122: 5010-5011 (2000); and Wang, L .; & Schultz, P.A. G. Chem. and Biol. 8: 883 (2001). A pAF-specific synthetase (pAFRS) was generated by modifying the amino acid specificity of Methanococcus jannaschii TyrRS to accept pAF and not any of the 20 common amino acids. Using a combination of positive selection and negative screening, a pAFRS enzyme was identified from a library of TyrRS variant 12 containing random amino acids in five locations (Tyr32, Glu107, Asp158, Ile159 and Leu162). Wang, L.W. , Block, A .; Herberch, B .; & Schultz, P.A. G. Expanding the genetic code of Escherichia coli. Science 292: 498-500 (2001). A single reporter plasmid was used for both selection and screening. For example, the reporter plasmid is pREP (2) / YC-JYCUA containing the genes for CAT, T7 RNA polymerase, GFP and TyrCUAmutRNA and a Tet resistance selection marker. The CAT gene contains a TAG codon substitution at position D112. The T7 RNA polymerase gene contains a 7 amino acid N-terminal leader peptide and contains TAG substitutions at M1 and Q107.

  Positive selection is based on suppression of TAG codons at permissive positions in the chloramphenicol acetyltransferase (CAT) gene by pAF or endogenous amino acids. For example, Wang, L .; Et al. (2001) supra; and Pasternak, M .; , Magliay, T .; J. et al. & Schultz, P.A. G. A new orthologous suppressor tRNA / aminoacyl-tRNA synthetase pair for developing an organic gene with an expanded genetic code. See Helvetica Chema Acta 83: 2277 (2000). Cells containing the TyrRS library and the reporter plasmid were grown in a liquid medium containing pAF, and cells that survived in the presence of chloramphenicol (Cm) were selected. For example, for positive selection, cells were grown in GMML minimal medium supplemented with 35 μg / ml Kn, 25 μg / ml Tet, 75 μg / ml Cm and 1 mM pAF (Sigma).

  Negative screening is performed based on the inability to suppress two TAG stop codons at permissive positions in the T7 RNA polymerase gene in the absence of pAF. Expression of full-length T7 RNA polymerase induces the expression of green fluorescent protein (GFP). Cells from positive selections are grown in the absence of pAF and Cm and then screened for lack of fluorescence using fluorescence activated cell sorting (FACS). For example, in negative screening, cells were grown in GMML medium supplemented with 35 μg / ml Kn, 25 μg / ml Tet and 0.002% arabinose. FACS was performed using a BDIS FACVantage TSO cell sorter with a Coherent Enterprise II ion laser. The excitation wavelength was 351 nm, and emission was detected with a 575/25 nm band filter. Cells were collected and diluted with at least 10 volumes of LB plus Tet and Kn and grown to saturation.

  Desired pAFRS was identified after two positive selections in liquid medium, one negative screening, one positive selection in liquid medium, and one positive selection on the plate. The pAFRS enzyme contains 5 mutations relative to wild type TyrRS (Y32T, E107T, D158P, I159L and L162A). In the absence of pAF, the IC50 of cells expressing the selected pAFRS and reporter plasmid was 10 μg / ml Cm on the GMML minimal medium plate. In the presence of 1 mM pAF, the IC50 was 120 μg / ml Cm. Therefore, pAF selectively suppresses the UAG codon.

  Example 8-Evolution of aminoacyl tRNA synthetases using fluorescence activated cell sorting

  A FAC-based screening system was used to rapidly evolve three highly selective synthetase variants that accept amino, isopropyl or allyl containing tyrosine analogs. In this system, a multipurpose reporter plasmid was used to apply both positive and negative selection pressures to easily and quantitatively evaluate synthetase activity. With the chloramphenicol acetyltransferase (CAT) marker Positive selection of the activity of jannaschii tyrosyl-tRNA synthetase (TyrRS) was performed. Synthetase activity in cells grown in the presence and absence of unnatural amino acids was assessed by the T7 polymerase / GFP reporter system. Synthetase variants that accept natural amino acids were screened using fluorescence activated cell sorting (FACS), and synthetase activity was assessed qualitatively and quantitatively by visual and fluorometric analysis, respectively.

  Design of an amplifiable fluorescent reporter system. Attempts to develop a universal screening system for assessing synthetase activity in living cells originated from the desire to more precisely control the selection pressure, particularly the negative selection pressure, applied to the synthetase mutant population. Since the system must be used to assess the activity of numerous synthetase variants, reporters capable of high throughput screening were sought. In addition, a reporter was needed that could easily qualitatively and quantitatively evaluate synthetase activity. To meet these requirements, fluorescent screening was devised. This system was devised based on the synthetase-dependent production of GFPuv, a mutant of green fluorescent protein optimized for expression in E. coli (Crameri, A., Whitehorn, EA, Tate, E. & Stemmer, WP, Nature Biotechnol. 1996, 14, 315-319). This phosphor can be used in FACS and fluorometry, and can also be used visually in solid and liquid media. This system was designed to generate a fluorescent signal by synthetase-dependent suppression of a selector (eg, an amber nonsense codon). Amplified by placing an amber codon in the T7 RNA polymerase gene configured to induce expression of the GFPuv reporter gene, similar to other amplifiable intracellular reporter systems, to maximize reporter sensitivity (Lorincz, M., Roederer, M., Diwu, Z., Herzenberg, LA, Nolan, GP Cytometry, 1996, 24, 321-329; and Zlokarnik, G., Negulescu, P A., Knapp, TE, Mere, L., Burres, N., Feng, L., Whitney, M., Roemer, K. & Tsien, RY, Science, 1998, 279, 84. -88). The T7 RNA polymerase gene was placed under the control of the arabinose promoter so that the production of RNA transcripts could be easily optimized to fit a T7 RNA polymerase containing an amber codon.

  Optimization of the T7 RNA polymerase / GFPuv reporter system. The medium copy reporter plasmid pREP was designed to express a T7 RNA polymerase mutant containing an amber codon under the control of the arabinose promoter and to express the GFPuv gene under the control of the T7 promoter (FIG. 17a). A series of 12 T7 RNA polymerase mutants (FIG. 17b) designed to optimize synthetase-dependent fluorescence increase were inserted into pREP to create plasmid pREP (1-12). All mutants contained a 7 amino acid (MTMITVH) N-terminal leader sequence and 1-3 amber stop codons (TAG). Mutants 1-3 had replaced the original methionine (M1) at position 1 immediately downstream of the leader sequence with 1, 2, and 3 amber stop codons, respectively. Mutants 4-9 had D10, R96, Q107, A159, Q169 or Q232, which are expected to be located in the loop region of the structure, replaced with amber codons, respectively (Jeruzalmi, D. & Steiz, TA, EMBO). J., 1998, 17, 4101-4113). In the mutants 10 to 12, the M1 position and the Q107, A159 or Q232 position were each replaced with an amber stop codon. Orthogonal glutaminyl-tRNA synthetase and S. cerevisiae The increase in fluorescence of the plasmid construct was examined by fluorometry and flow cytometry of living cells using a compatible plasmid containing cerevisiae-derived glutamine tRNACUA. Plasmid pREP (1-12) was found to produce various levels of synthetase-dependent fluorescence increase, and the best construct, pREP (10), was 220 by fluorometry in cells containing wild type synthetase compared to the inactive mutant. Double fluorescence (Figure 17c) was shown, and ~ 400-fold median fluorescence (Figure 17d) was shown by cytometry. When various functional groups at positions corresponding to the amber codon in pREP (10) were substituted, it was found that the tolerance at position 107 in T7 RNA polymerase was high.

  Construction of a multipurpose reporter plasmid. M.M. To construct a multipurpose plasmid used to select and screen for variants of jannaschii TyrRS, plasmid pREP (10) was transformed into plasmid pYC-J17 (Wang, L., Block, A., Herberich, B. & Schultz, PG, Science, 2001, 292, 498-500) to obtain pREP / YC-JUCUA (FIG. 25a). M. selective for O-methyl-L-tyrosine (OMY) incorporation. A compatible plasmid (pBK-mJYRS; Wang, L., Block, A., Herberich, B. & Schultz, PG, Science, 2001, 292, 498-500) expressing a variant of jannaschii TyrRS Used to assay the function of plasmid pREP / YC-JYCUA. When cells transfected with pREP / YC-JYCUA and pBK-mJYRS were grown in the presence of OMY, the same chloramphenicol (Cm) IC50 value of 120 μg / ml obtained using plasmid pYC-J17 The fluorescence intensity of cells grown in the presence of OMY as measured by fluorometry was 330 times that in the absence.

  M.M. Evolution of substrate specificity of jannaschii tyrosyl-tRNA synthetase. M. so as to selectively accept chemical groups other than the phenol side chain of tyrosine. It has been reported that the amino acid side chain binding pocket of jannaschii TyrRS can be evolved (Wang, L., Block, A., Herberich, B. & Schultz, PG, Science, 2001, 292, 498-). 500; see Wang, L., Block, A., & Schultz, PG, J. Am. Chem. Soc. 2002, 124, 1836-1837). The present inventors used four kinds of new functional groups (FIG. 25b) of p-isopropylphenylalanine (pIF), p-aminophenylalanine (pAF), p-carboxylphenylalanine (pCF), or O-allyltyrosine (OAT) as enzymes. By accepting M.M. An attempt was made to further examine the generality of unnatural amino acid incorporation by jannaschii TyrRS. M. cerevisiae having random mutations at positions Y32, E107, D158, I159 and L162, which are residues thought to form a binding pocket at the para position of the tyrosyl ring. a library of jannaschii TyrRS variants (Wang, L., Block, A., Herberich, B. & Schultz, PG, Science, 2001, 292, 498-500), including plasmid pREP / YC-JYCUA Introduced into cells. Using these cells with a library diversity of 10 9, four evolutionary experiments were started to identify synthetase variants selective for pIF, pAF, pCF or OAT (FIG. 25b). Two cycles of positive selection were performed by growing the cell culture to saturation in the presence of Cm and one of the four unnatural amino acids. A cell aliquot was removed after the second cycle of positive selection and used to inoculate a new culture without the addition of amino acids or Cm, and the culture was again grown to saturation. Cells that fluoresce at this point appear to contain a synthetase variant that can accept one of the 20 natural amino acids. Approximately 10 8 cells from each strain were subjected to negative screening by FACS to exclude synthetase variants that accept natural amino acids. Cells that did not fluoresce were collected and amplified by growing to saturation. These amplified cells were used to inoculate new cultures and subjected to a final cycle positive selection in liquid medium supplemented with unnatural amino acids and Cm. Each cell population was seeded in a medium supplemented with 0, 30, 60 or 100 μg / mL Cm and the appropriate unnatural amino acid 0 or 1 mM after growth to saturation.

  Identification and characterization of evolutionary synthetase variants. The Cm plate to which pIF, pAF and OAT were added produced 10 to 100 times as many fluorescent colonies as the plate to which no amino acid was added. In contrast, the plate of the pCF population produced the same number of fluorescent colonies with or without pCF addition. The 10 largest fluorescent colonies were picked for each of the pIF, pAF, and OAT populations from the plate with the unnatural amino acid added and grown to saturation in liquid medium in the presence or absence of the unnatural amino acid. A qualitative evaluation of fluorescence generation was visually performed using a portable long wavelength ultraviolet lamp (FIG. 23a).

  Synthetase variants corresponding to clones that produced a significant difference in fluorescence were sequenced. All 10 clones from the pIF and pAF populations were identical sequences, but 3 different clones were identified from the OAT population. All clones had amino acid substitutions at 5 random mutation sites, and the pIF-tRNA synthetase (pIF-RS) mutant had 2 further substitutions. The activity of each clone was quantitatively evaluated. The fluorescence of cells grown in liquid medium in the presence or absence of unnatural amino acids was measured by fluorometry (FIG. 23b). Cm IC50 was measured by plating the cells at various Cm concentrations in the presence or absence of unnatural amino acids (FIG. 23c).

  The production of proteins containing unnatural amino acids was evaluated using a myoglobulin gene containing an amber codon at position 4. Genes were expressed in cells using pIF-RS, pAF-RS or OMT-RS mutants respectively in the presence or absence of pIF, pAF or OAT (FIG. 23d). The protein yield was equivalent for all three variants, 1-2 mg of protein per liter of unnatural amino acid-containing cell culture. On the other hand, protein production was hardly detectable in the culture medium grown in the absence of unnatural amino acids. When the proteins were analyzed by electrospray mass spectrometry, the respective masses were pIF-containing protein 18457.40 ± 0.81 (predicted value 18457.28), pAF-containing protein 18430.30 ± 0.27 (predicted value 18430.21) Met. Activity measurements obtained using Cm IC50, fluorometry and protein expression analysis correlated well, but the activity of pIF-RS appears to be somewhat lower by fluorometry. A disproportionately low fluorometric measurement of the pIF-RS mutant compared to other assays shows that T7 RNA polymerase partially incorporated the pIF analog after incorporation of the amber position in the reporter. This indicates the possibility of instability (see FIG. 17c).

  Usefulness of multi-purpose reporter system. The reporter system described herein can use a single multipurpose plasmid for both positive and negative screening, eliminating the need for alternating plasmids between positive and negative selection. In total, only three positive selections and one negative screen could identify synthetase variants that selectively accept the desired unnatural amino acid. These features allow evolutionary experiments to be performed in just a few days. Using this screening system, active synthetase variants can be readily identified using agar plates supplemented with unnatural amino acids, and the amino acid specificity of the variants can be assayed individually.

  As mentioned above, the T7 RNA polymerase / GFP system can be used to quantitatively compare the activity of synthetase variants. Since each of the three OAT-RS clones described in this example can be obtained independently from the same library using positive / negative selection based on CAT and barnase, derived from each It is possible to compare two different evolutionary systems for synthetase variants. According to this analysis, the three clones obtained after positive selection and negative screening show a slightly lower fluorescence level in the presence of OAT, but a background level of 1/10 in the absence of unnatural amino acids. Thus, an increase in fluorescence of cells grown in the presence relative to the absence of unnatural amino acids is obtained after selection and screening compared to cells expressing OAT-RS clones obtained after positive / negative selection using barnase. The number of cells expressing OAT-RS (1) is about 6 times. Although it is not clear whether this example is a representative example, these data suggest that the T7 RNA polymerase / GFP system can increase stringency in selecting promiscuous synthetase variants against natural amino acid substrates. is doing. However, non-natural amino acids compete for binding with the evolved synthetase variant, and natural amino acid binding is reduced, so the fluorescence of cells grown in the presence is increased compared to the absence of non-natural amino acids. It is expected to mean a lower fidelity limit for unnatural amino acid incorporation. Furthermore, while high fidelity is clearly desirable, it appears that either fidelity or total synthetase activity must be taken depending on the desired application.

  Generality of aminoacyl tRNA synthetase evolution. As is apparent from the conventional reports and the results described in this example, The amino acid side chain binding pocket of jannaschii TyrRS is very adaptable. Enzymes can be evolved to accept various functional groups instead of the phenolic side chain of tyrosine, which is possible with high selectivity. In this application, it has been demonstrated that enzymes can be evolved to accept amine, isopropyl or allyl ether functional groups instead of hydroxyl at the para position of the tyrosine ring. It was not possible to identify enzyme variants that could accept pCF unnatural amino acids. The second attempt to evolve synthetase to accept pCF amino acids was also unsuccessful. Using LC / MS analysis, pCF cannot be detected after toluene treatment of E. coli cells grown in the presence of unnatural amino acids, suggesting that pCF is not transported into the cell or metabolized after introduction. ing.

  Of the three successful evolution experiments described in this example, only the evolution of OAT-RS was able to identify two or more active clones. OAT-RS evolution was also the experiment that produced the most active synthetase variants. These results suggest that a given amino acid specificity is easier to select than others. This may be due in part to the relative difficulty of selectively recognizing various unnatural amino acids in the context of 20 natural amino acids. For example, pAF appears to be less selectively recognized than OAT because it is structurally and electronically similar to tyrosine. For this reason, a greater number of OAT-RS clones were identified than the pAF-RS clone, and it is believed that the pAF-RS clone is less active than the best OAT-RS clone.

  Plasmid construction. Plasmid pREP (FIG. 17a) contains the BamHI / ApaLI overlapping PCR fragment containing the T7 RNA polymerase gene after insertion upstream of the rrnB transcription termination region and the araC gene and ara promoter region (Invitrogen; T7 RNA from the pBAD / Myc-HisA plasmid. An ApaLI / AhdI overlapping PCR fragment containing the polymerase gene transcription control) and the GFPuv gene (Clontech; upstream of the T7 terminator region and downstream of the T7 promoter) is inserted between the AhdI / BamHI sites of the plasmid pACYC177 (New England Biolabs). It was built by Plasmid pREP (1-12) was constructed by replacing the HpaI / ApaLI fragment of T7 RNA polymerase with an overlapping PCR fragment containing an amber mutation at the indicated position. Plasmid pREP / YC-JYCUA contains the AfeI / SacII fragment from pREP (10) and pYC-J17 (Wang, L., Block, A., Herbrich, B. & Schultz, PG, Science, 2001, 292, 498-500) by ligation of EarI (smoothed) / SacII fragment. The desired construct was identified after transformation into cells containing the fluorescent screening plasmid pQ.

  Plasmid pQ contains an AatII / SalI overlapping PCR fragment containing ScQRS downstream of the lac promoter region and upstream of the E. coli QRS termination region, and S. pneumoniae downstream of the lpp promoter region and upstream of the rrnC termination region. It was constructed by triple ligation of SalI / AvaI overlapping PCR fragment containing cerevisiae tRNA (CUA) Gln and the AvaI / AatII fragment of pBR322 (New England Biolabs). Plasmid pQD was constructed by replacing the pQ fragment between BamHI and BglII with the BamHI / BglII fragment of the ScQRS (D291A) mutant.

  The plasmid pBAD / JYAMB-4TAG is composed of the plasmid pYC-J17 (Wang, L., Block, A., Herberich, B. & Schultz, PG, Science, 2001, 292, 498-500) and the MjYtRNACUA gene. A pBAD / Myc-HisA (Invitrogen) hybrid pBAD / YC-JYCUA plasmid containing a pBAD promoter and a heterologous cloning region for insertion of an insert gene PCR fragment of a myoglobin S4 amber mutant containing a C-terminal 6His tag Constructed by inserting.

  Fluorometric and cytometric analysis. A single colony containing the desired plasmid was used and inoculated into 2 mL of GMML broth supplemented with the appropriate antibody, 0.002% arabinose and, if necessary, the appropriate unnatural amino acid. The culture was grown to saturation and the cells (200 μL) were pelleted and resuspended in 1 mL of phosphate buffered saline (PBS). Cell density was analyzed by absorbance at 600 nm, and fluorescence intensity was measured at an excitation wavelength of 396 nm and a measurement wavelength of 505 nm using a FluoroMax-2 fluorometer. Cells suspended in PBS were analyzed by cytometry. To assess the tolerance of the amber position within the T7 polymerase gene of pREP (10), the reporter plasmid was transformed into a series of suppressor strains and analyzed by fluorometry.

  Evolution of aminoacyl tRNA synthetase variants. M. mutated randomly at positions Y32, E107, D158, I159 and L162. jannaschii TyrRS mutant (Wang, L., Block, A., Herberich, B. & Schultz, PG, Science, 2001, 292, 498-500), DH10B E. coli cells containing pREP / YC-JYCUA ( Life Technologies), and a library with diversity of 10 9 was prepared. Transformed cells were regenerated in SOC medium for 60 minutes at 37 ° C. and grown to saturation in LB medium. To initiate the first positive selection, 2 mL of library culture is pelleted and resuspended in GMML medium and 25 μg / mL tetracycline (Tet), 35 μg / mL kanamycin (Kn) and 1 mM pIF, pAF, pCF or Inoculated into 500 mL of GMML with OAY. Cm was added to a final concentration of 75 μg / mL after 3 hours of incubation at 37 ° C., and the cells were allowed to grow to saturation (˜48 hours). In the second positive selection, 100 mL of GMML supplemented with Tet, Kn, 75 μg / mL Cm and 1 mM pIF, pAF, pCF or OAY is inoculated with cells (500 μL) from the first positive selection until saturation at 37 ° C. ( (24-36 hours). In preparation for negative screening, 25 mL of GMML medium supplemented with Tet, Kn and 0.02% arabinose (Ara) was inoculated with cells from the second positive selection (100 μL pelleted and resuspended in GMML) at 37 ° C. Grown to saturation (˜24 hours). Cells induced with Ara and grown in the absence of unnatural amino acids (1 mL) were pelleted and resuspended in 3 mL of phosphate buffered saline (PBS). Cells not expressing GFPuv were selected using a BDIS FACVantage TSO cell sorter by exciting a Coherent Enterprise II ion laser at 351 nm and detecting luminescence with a 575/25 nm bandpass filter. Cells were collected and diluted with at least 10 volumes of LB plus Tet and Kn and grown to saturation. To initiate the third positive selection, 100 μL of cells from the negative screen were pelleted, resuspended in GMML and inoculated into 25 mL of GMML supplemented with Tet, Kn and 1 mM pIF, pAF, pCF or OAY. Cm was added to a final concentration of 75 μg / mL after culturing at 37 ° C. for 3 hours, and the cells were grown to saturation (˜24 hours). After the third positive selection, cells are plated on GMML / agar supplemented with Tet, Kn, 0.002% Ara, 0, 75 or 100 μg / mL Cm, and 0 or 1 mM pIF, pAF, pCF or OAY at 37 ° C. Grow for 48 hours.

  Expression and characterization of proteins containing unnatural amino acids. DH10B cells co-transformed with pBAD / JYAMB-4TAG and the appropriate pBK plasmid were used to inoculate 100 mL of GMML starter culture with Kn and Tet added and allowed to grow to saturation. 50 mL of the starter culture was inoculated into 500 mL of the culture medium containing Kn, Tet, 0.002% Ara, 5 μM FeCl3 and the desired unnatural amino acid (or none) and allowed to grow to saturation (˜18 hours). The culture was pelleted, sonicated, and myoglobulin protein was isolated according to the protocol of the QiaExpressionist (Qiagen) His-tag purification kit. The protein was analyzed by 12 → 20% gradient SDS polyacrylamide gel electrophoresis and electrospray mass spectrometry.

  Example 9-Orthogonal tRNA / Threonyl tRNA Synthetase Pair

  This example illustrates the generation of an orthogonal tRNA / threonyl tRNA synthetase pair. FIG. 27 shows a threonyl-tRNA synthetase derived from Thermus thermophilus. This synthetase has two N-terminal editing domains, a catalytic domain, and a C-terminal anticodon binding domain (659 amino acids). T.A. To create an orthogonal synthetase derived from a thermophilus synthetase, the editing domain and N1 or N1 and N2 were removed from the synthetase and an N-shortened T. pylori. thermophilus ThrRS (475 amino acids) was made. This synthetase has the same catalytic activity but no proofreading activity. The activity of N shortening synthetase was screened. N-reduced synthetase did not aminoacylate E. coli tRNA.

  T.A. thermophilus tRNAThr was found to be a substrate for E. coli threonyl tRNA synthetase. thermophilus tRNAThr was mutated to create an orthogonal pair. FIG. 28 shows the mutations made to tRNA. Specifically, C2G71 was mutated to A2U71. According to in vitro loading experiments, this mutant is not a substrate for E. coli threonyl tRNA synthetase, but T. It is a good substrate for thermophilus threonyl tRNA synthetase. To create an amber suppressor tRNA, another mutant was also constructed containing mutations C2G71 → A2U71 and G34G35U36 → C34G35U36. In addition to C2G71 → A2U71, other mutant tRNAs in which the anticodon loop was also mutated were prepared to suppress 3 and 4 base codons such as TGA, ACCA, ACAA, AGGA, CCCT, TAGA and CTAG. These total tRNAs were not as good substrates as wild-type tRNAThr (with A2U71), but It can be improved by mutating the anticodon binding site of thermophilus threonyl-tRNA synthetase.

  Example 10-Typical O-tRNA and O-RS sequences

  An exemplary O-tRNA comprises a nucleic acid comprising a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1-3 and / or its complementary polynucleotide sequences. See Appendix 1, Table 5. Similarly, a typical O-RS is selected from the group consisting of a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 35-66, and SEQ ID NOs: 4-34 and its complementary polynucleotide sequences A polypeptide selected from the group consisting of a polypeptide encoded by a nucleic acid containing the polynucleotide sequence to be encoded.

  It should be understood that the examples and aspects described herein are for illustrative purposes only, and that various modifications and changes will occur to those skilled in the art in view of these descriptions, and such modifications or changes are not Included in the spirit and scope and claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

Figure 3 schematically illustrates site-specific in vivo protein incorporation of unnatural amino acids. An example of a method for selecting an active synthetase that is aminoacylated with an unnatural amino acid is schematically shown. FIG. 2A outlines the selection / screening of aminoacyl-tRNA synthetases with unnatural amino acid specificity. An example of a method for selecting an active synthetase that is aminoacylated with an unnatural amino acid is schematically shown. FIG. 2B schematically illustrates one embodiment of synthetase selection / screening that preferentially aminoacylates O-tRNA with unnatural amino acids. Shown are site-specific mutations to create a specific library of tyrosine analogs. Figure 2 shows a consensus sequence for selection of pentafluorophenylalanine to create a specific library of said analogs. A method for transplanting one domain (for example, CPI domain) derived from one organism (for example, E. coli) to a synthetase (for example, Methanococcus jannaschii TyrRS) of another organism is schematically shown. 1 schematically shows the construction of a chimeric Methanococcus jannaschii / E. Coli synthetase. FIG. 2 schematically shows the creation of a library of chimeric synthetases (eg, Methanococcus jannaschii / E. Coli synthetase). 1 schematically shows an example of selection of a suppressor tRNA that is a weak substrate for an endogenous synthetase (eg, E. coli synthetase) and is efficiently loaded by the desired cognate synthetase. 9A and B schematically show a mutant anticodon loop tRNA library. FIG. 9A shows a mutant whole loop library and FIG. 9B shows a library of Methanococcus jannaschii tRNATyrCUA. An example of the structure of a non-natural base pair (PICS: PICS, 3MN: 3MN, 7AI: 7AI, Dipic: Py) that is paired by a force other than hydrogen bonding is schematically shown. FIG. 6 is a graph of the results of negative suppressor tRNA selection methods showing the percentage of viable cells containing one of the three constructs at a given time. Proliferation histogram showing positive selection based on suppression of amber codons in the β-lactamase gene. The DNA sequence of the mutant suppressor tRNA selected from the anticodon loop and the entire loop library is shown. The stereogram of the active site of TyrRS is shown typically. The active site of TyrRS is shown typically. FIGS. 16A and B schematically illustrate an example of a FACS selection and screening method used to make the components of the invention (eg, orthogonal synthetase). FIG. 16A shows an orthogonal synthetase library, an O-tRNA expression vector (library plasmid), and a T7 RNA polymerase / GFP reporter system (reporter plasmid) vector (eg, plasmid) containing one or more selector codons (eg, TAG). This is shown schematically. FIG. 16B schematically shows a positive selection / negative screening scheme. An amplifying fluorescent reporter system is shown. FIG. 17A schematically shows a vector (for example, a plasmid such as pREP) that can be used for screening. An amplifying fluorescent reporter system is shown. FIG. 17B shows the composition and fluorescence increase of the T7 RNA polymerase gene construct in pREP (1-12). An amplifying fluorescent reporter system is shown. FIG. 17C shows cytometric analysis of cells containing pREP (10) and pQD (top) or pQ (bottom). An amplifying fluorescent reporter system is shown. FIG. 17D shows fluorometric analysis of cells containing pREP (10) and expressing various E. coli suppressor tRNAs. Figure 3 schematically shows phage selection of unnatural amino acid incorporation into a surface epitope. Schematic example of a molecule (eg, an immobilized aminoalkyl adenylate analog of an aminoacyl adenylate intermediate) used to screen for displayed synthetases with unnatural amino acid specificity (eg, synthetases displayed on phage) Indicate. The graph which shows the ampicillin resistance of various orthogonal pairs derived from various organisms. This figure shows an example of orthogonal pair detection using a reporter construct containing a reporter gene (eg, β-lactamase gene) containing a selector codon (eg, amber codon) and a suppressor tRNA (containing a selector anticodon). FIGS. 21A and B mutate the anticodon loop of leucyl tRNA (eg, random mutation) and use a selector codon (eg, in the reporter gene), eg, using a combination of selection steps (eg, selection based on β-lactamase and selection based on barnase). The mutant amber suppressor tRNA derived from Halobacterium NRC-1 produced by selecting for more efficient suppression (Fig. 21B). The tRNA suppressor of the basic codon is shown. Figures 23A-D show the activity of dominant synthetase variants from each successful evolution experiment. FIG. 23A is a photograph of a cell containing pREP / YC-JYCUA and a designated synthetase mutant grown in the presence (+) or absence (-) of the corresponding unnatural amino acid and irradiated with long-wave ultraviolet light. FIG. 23B shows a fluorometric analysis when cells containing pREP / YC-JYCUA and the designated synthetase variant are grown in the presence (left) or absence (right) of the corresponding unnatural amino acid. FIG. 23C is a table showing Cm IC50 analysis when cells containing pREP / YC-JYCUA and designated synthetase variants are grown in the presence or absence of the corresponding unnatural amino acid. FIG. 23D shows protein expression analysis when cells containing pBAD / JYAMB-4TAG and a designated synthetase variant are grown in the presence (+) or absence (−) of the corresponding unnatural amino acid. The activity comparison of the OAS-RS variants obtained using negative FACS screening (OAY-RS (1, 3, 5)) or negative barnase selection (OAY-RS (B)) is shown. FIGS. The components of the multipurpose reporter plasmid system for inducing the evolution of jannaschii TyrRS are shown. FIG. 25A shows the plasmid pREP / YC-JYCUA. FIG. The structure of an unnatural amino acid used as a target for evolution of jannaschii TyrRS is shown. A strategy for evolving aminoacyl-tRNA synthetases using the plasmid pREP / YC-JYCUA is shown. Figure 2 shows a threonyl tRNA synthetase derived from Thermus thermophilus. T.A. Figure 4 shows the creation of an orthogonal tRNA for a thermophilus orthogonal threonyl tRNA / RS. 2 shows typical unnatural amino acids utilized in the present invention. 2 shows typical unnatural amino acids utilized in the present invention. 2 shows typical unnatural amino acids utilized in the present invention.

Claims (42)

A composition comprising an aminoacyl-tRNA synthetase (RS), wherein the RS preferentially aminoacylates the tRNA with an unnatural amino acid and the RS is against an unnatural amino acid over any of the 20 natural common amino acids. Said composition exhibiting a low K _m and showing a higher K _cat for unnatural amino acids than for any of the 20 naturally occurring common amino acids.   The composition according to claim 1, wherein the RS comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 35-64.   2. The composition of claim 1, wherein the RS in vivo aminoacylates the tRNA with an unnatural amino acid.   Unnatural amino acids are O-methyl-L-tyrosine, L-3- (2-naphthyl) alanine, 3-methylphenylalanine, O-4-allyl-L-tyrosine, 4-propyl-L-tyrosine, tri-O- Acetyl-GlcNAcβ-serine, L-Dopa, fluorinated phenylalanine, isopropyl-L-phenylalanine, p-azido-L-phenylalanine, p-acyl-L-phenylalanine, p-benzoyl-L-phenylalanine, L-phosphoserine, phosphonoserine, The composition of claim 1 selected from the group consisting of phosphonotyrosine, p-iodophenylalanine, p-bromophenylalanine, p-amino-L-phenylalanine, and isopropyl-L-phenylalanine.   An unnatural amino acid is an unnatural analog of a tyrosine amino acid; an unnatural analog of a glutamine amino acid; an unnatural analog of a phenylalanine amino acid; an unnatural analog of a serine amino acid; an unnatural analog of a threonine amino acid; an alkyl, aryl, acyl, Azide, cyano, halo, hydrazine, hydrazide, hydroxyl, alkenyl, alkynyl, ether, thiol, sulfonyl, seleno, ester, thioacid, boric acid, boronic acid, phospho, phosphono, phosphine, heterocyclic, enone, imine, aldehyde, hydroxyl Amine, keto or amino substituted amino acids or any combination thereof; amino acids with photocrosslinkable groups; amino acids with spin labels; fluorescent amino acids: amino acids with novel functional groups; amino acids that interact covalently or non-covalently with another molecule; metal Binding amino acid Metal-containing amino acids; radioactive amino acids; photo-caged amino acids, photoisomerizable amino acids; biotin or biotin analog-containing amino acids; glycosylated or glycosylated amino acids; keto-containing amino acids; amino acids including polyethylene glycol; Heavy atom-substituted amino acids; chemically degradable or photodegradable amino acids; amino acids with extended side chains; amino acids containing toxic groups; sugar chain-substituted amino acids; sugar chain-substituted serines; carbon-linked sugar-containing amino acids; The composition according to claim 1, selected from the group consisting of: a contained acid; an aminothioacid-containing amino acid; an α, α-disubstituted amino acid; a β amino acid; The composition of claim 1, wherein RS exhibits a higher K _cat / K _m for unnatural amino acids than for any of the 20 natural common amino acids. A composition comprising an orthogonal tRNA (O-tRNA), wherein the O-tRNA recognizes a selector codon, the O-tRNA is preferentially aminoacylated with an unnatural amino acid by an orthogonal aminoacyl tRNA synthetase, and the composition is orthogonal includes aminoacyl-tRNA synthetase (O-RS), O- RS represents lower _{K m} also for the unnatural amino acid than to any of the twenty naturally occurring common amino acids, and the 20 naturally occurring common amino acids Said composition exhibiting a higher K _cat for unnatural amino acids than for any. The composition according to claim 7 , wherein the O-tRNA and the O-RS are complementary. 8. The composition of claim 7 , wherein the O-tRNA and O-RS are induced by mutation of natural tRNA and RS derived from at least one organism, and the at least one organism is a prokaryote. The composition according to claim 9 , wherein the at least one organism is selected from the group consisting of Methanococcus jannaschii, Methanobacterium thermoautotropicum and Halobacterium. 8. The composition of claim 7 , wherein the O-tRNA and O-RS are induced by mutation of natural tRNA and RS derived from at least one organism, and the at least one organism is eukaryotic. 12. The composition of claim 11 , wherein the at least one organism is selected from the group consisting of yeast, mammals, fungi, insects, plants and protists. 8. The composition of claim 7 , wherein the O-tRNA is induced by mutation of a natural tRNA derived from a first organism and the O-RS is induced by a mutation of a natural RS derived from a second organism. 8. The composition of claim 7 , wherein the O-tRNA and O-RS are isolated from at least one organism and the at least one organism is a prokaryote. 15. The composition of claim 14 , wherein the at least one organism is selected from the group consisting of Methanococcus jannaschii, Methanobacterium thermoautotropicum and Halobacterium. 8. The composition of claim 7 , wherein the O-tRNA and O-RS are isolated from at least one organism and the at least one organism is eukaryotic. The composition according to claim 16 , wherein the at least one organism is selected from the group consisting of yeast, mammal, fungus, insect, plant and protist. 8. The composition of claim 7 , wherein the O-tRNA is isolated from the first organism and the O-RS is isolated from the second organism. One or more O-tRNA and O-RS are isolated from one or more libraries, according to claim 1 or more of the library comprises an O-tRNA or O-RS derived from one or more biologically 7 A composition according to 1. 20. The composition of claim 19 , wherein the one or more organisms comprises prokaryotes or eukaryotes. The composition according to claim 7 , wherein the composition comprises a cell containing O-RS and O-tRNA.   The composition of claim 1, wherein the composition comprises an in vitro translation system. (A) creating a library of mutant RS molecules derived from at least one aminoacyl-tRNA synthetase (RS) derived from a first organism;
(B) providing a pool of active RSs by selecting or screening a member that aminoacylates an orthogonal tRNA (O-tRNA) in the presence of an unnatural amino acid or a natural amino acid from a library of mutant RSs;
(C) selecting or screening from a pool of active RSs to identify an active RS that preferentially aminoacylates an O-tRNA in the absence of the unnatural amino acid, thereby at least one of the pools specific for the unnatural amino acid Identifying a member and providing at least one recombinant O-RS, wherein at least one recombinant O-RS preferentially aminoacylates the O-tRNA with an unnatural amino acid, Exhibits a lower K _m for unnatural amino acids than for any of the 20 natural common amino acids and a higher K for unnatural amino acids than for any of the 20 natural common amino acids said step selected to indicate _cat ;
Recombinant O-RS produced by a method comprising 24. The recombinant O-RS of claim 23 , wherein the method comprises negatively selecting a pool member that preferentially aminoacylates the O-tRNA in the absence of an unnatural amino acid. 24. The recombinant O-RS of claim 23 , wherein the method comprises positively selecting a member of a pool that does not aminoacylate the O-tRNA in the absence of an unnatural amino acid.   Unnatural amino acids are O-allyl-L-tyrosine, para-substituted L-tyrosine (substitution includes saturated or unsaturated hydrocarbons), GlcNAc-serine, p-iodo-phenylalanine, p-bromo-phenylalanine, 3, The composition of claim 1 selected from the group consisting of 4-dihydroxy-L-phenylalanine, p-acetyl-phenylalanine, m-acetyl-phenylalanine, and 4- (2-oxo-propoxy) -L-phenylalanine. object. A cell containing an orthogonal tRNA synthetase (ORS) and an orthogonal tRNA (OtRNA) as a pair satisfying the following conditions (a) to (d).
(A) The ORS preferentially aminoacylates the OtRNA, which is preferentially aminoacylated, in which the ORS aminoacylates the cell's endogenous tRNA with lower efficiency than the aminoacylation of the endogenous tRNA synthetase of the cell's endogenous tRNA. Is defined by
(B) the ORS preferentially aminoacylates the OtRNA with an unnatural amino acid compared to any natural amino acid;
(C) the OtRNA is aminoacylated by a cellular endogenous tRNA synthetase with lower efficiency than aminoacylation of the endogenous tRNA by the endogenous tRNA synthetase;
(D) The OtRNA recognizes a selector codon of mRNA in the cell; and k _cat / K _m of aminoacylation of OtRNA by ORS using unnatural amino acid is the aminoacyl of OtRNA by ORS using natural amino acid. k _{cat /} K _m is greater than the reduction or the unnatural amino acid is incorporated into the growing polypeptide in a cell with greater fidelity than 75% in response to a selector codon. The unnatural amino acid is O-methyl-L-tyrosine, L-3- (2-naphthyl) alanine, p-benzoyl-L-phenylalanine, p-iodo-L-phenylalanine, p-bromo-L-phenylalanine, p- Is selected from the group consisting of amino-L-phenylalanine, 3,4-dihydroxy-L-phenylalanine, and isopropyl-L-phenylalanine;
Whether the unnatural amino acid is p-azido-L-phenylalanine;
Whether the unnatural amino acid is p-acetyl-L-phenylalanine;
28. The cell of claim 27 , wherein the unnatural amino acid is m-acetyl-L-phenylalanine; or the unnatural amino acid is 4- (2-oxo-propoxy) -L-phenylalanine. 28. The cell of claim 27 , wherein the cell is a prokaryotic cell or an E. coli cell. The cell according to claim 27 , wherein the selector codon is an amber codon or a 4-base codon. 28. The cell of claim 27 , wherein the orthogonal tRNA synthetase comprises the amino acid sequence set forth in SEQ ID NO: 62. 28. The cell of claim 27 , wherein the orthogonal tRNA is encoded by a nucleic acid comprising the sequence set forth in SEQ ID NO: 1. An isolated or cultured eukaryotic cell comprising an orthogonal tRNA synthetase (ORS) and an orthogonal tRNA (OtRNA) as a pair satisfying the following conditions (a.) To (d.).
(A.) The ORS preferentially aminoacylates the OtRNA, and preferential aminoacylation is achieved when the ORS aminoacylates the cell's endogenous tRNA with lower efficiency than the aminoacylation of the endogenous tRNA synthetase of the cell's endogenous tRNA. Defined by
(B.) The ORS preferentially aminoacylates the OtRNA with an unnatural amino acid relative to any natural amino acid;
(C.) The OtRNA is aminoacylated by a cellular endogenous tRNA synthetase with lower efficiency than the aminoacylation of the endogenous tRNA by the endogenous tRNA synthetase;
(D.) The OtRNA recognizes a selector codon of mRNA in the cell; k _cat / K _m of OtRNA aminoacylation by ORS using unnatural amino acid is aminoacylation of OtRNA by ORS using natural amino acid k _{cat /} K _m is greater than, or the unnatural amino acid is incorporated into the growing polypeptide in a cell with greater fidelity than 75% in response to a selector codon. The eukaryotic cell according to claim 33 , wherein the cell is a yeast cell. 34. The eukaryotic cell of claim 33 , wherein the orthogonal tRNA synthetase and the orthogonal tRNA are derived from a prokaryotic tRNA synthetase and a prokaryotic tRNA. 34. The eukaryotic cell of claim 33 , wherein the cell is in a cell culture medium.   A mutant aminoacyl tRNA synthetase that specifically aminoacylates a tRNA with an unnatural amino acid, wherein the aminoacyl tRNA synthetase is selective for the unnatural amino acid over any of the 20 common amino acids Aminoacyl tRNA synthetase. 38. The mutant aminoacyl-tRNA synthetase of claim 37 , wherein the synthetase in vivo aminoacylates the tRNA with an unnatural amino acid. Selected from the group consisting of K _m and K _cat, mutant aminoacyl-tRNA synthetase of claim 37 having one or more enzymes characteristic than natural amino acids have been improved or enhanced against unnatural amino acids. 38. The mutant aminoacyl-tRNA synthetase of claim 37 , wherein the fidelity of translation using a synthetase and tRNA pair is greater than 99% as determined by analysis of dihydrofolate reductase containing unnatural amino acids. 38. The mutant aminoacyl-tRNA synthetase according to claim 37 , wherein the non-natural amino acid is one of the non-natural amino acids shown in FIG. The synthetase is M.P. 38. The mutant aminoacyl-tRNA synthetase of claim 37 , which is a tyrosine synthetase comprising a mutant of an amino acid selected from Tyr32, Clu107, Asp158, Ile159 or Leu162 of the amino acid sequence of jannaschii Tyr synthetase.