JP2011019512A - Comparative quantitative method for human papillomavirus - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for efficiently discriminating a predominant type of human papillomavirus (HPV) in specimens. <P>SOLUTION: In the comparative quantitative method for HPV, 5-10 integer areas of plane areas divided by every area of heat cycle numbers are prepared in a two dimensional chart plane expressing relation between the amount of a gene amplification product and the heat cycle number and used for detecting HPV by a real time PCR method. The divided areas are prepared by equally dividing the plane area, locating between the areas expressing a minimum heat cycle number and a maximum heat cycle number, in 3-8 integer areas. In the case when different genotype HPVs are present in a test specimen, and when the 5-10 divided areas to which the genotype HPV giving the minimum Cp value belongs and the 5-10 divided areas to which the genotype HPV giving the maximum Cp value belongs are not mutually adjacent, at least one species of genotype HPV belonging to the divided area to which the minimum Cp value belongs are determined to be a predominant type to other genotype HPVs. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to a virus detection method, and more particularly, to a relative quantification method of the virus for determining a dominant type of human papillomavirus in a test sample derived from the cervix or the like.

  Human papillomavirus (HPV) is one of the most important causative factors in cervical cancer. To date, over 100 genotypes have been identified, and at least 40 genotypes infect the cervix. HPV is classified into a high-risk type and a low-risk type because of its relationship with the progression of cervical cancer, and at least 14 genotypes (16, 18, 31, 33, 35, 39, 45, 51, 52, 56). , 58, 59, 67 and 68) are classified as high risk types. Early identification of high-risk HPV leads to a reduction in the risk of cancer formation and provides important information on the treatment strategy. Until now, the detection of HPV has been performed by PCR using a consensus primer, hybrid capture assay using a hybridization probe, and the like. In the PCR method, three types of consensus primers are well known (PGMY11 / 09, GP5 + / GP6 +, L1C1 / 2). In addition, HPV genotypes have been determined by PCR-RFLP using restriction enzymes, hybridization using genotype-specific probes, line probe assays or PCR product sequence analysis using consensus primers. However, in any case, many genotypes can be distinguished, but complicated processes and expensive reagent costs are required. Therefore, simple new genotyping methods using multiplex PCR methods and real-time PCR methods are beginning to be reported.

  Although human papillomavirus (HPV) has a high co-infection rate due to multiple genotypes, the relationship between co-infection of high-risk HPV and cervical carcinogenesis remains unclear. However, it is not easy to quantify the number of copies of each genotype that is superinfected in order to clarify this association, and so far it has not been reported so much. One of the causes that makes this analysis difficult is that a calibration curve necessary for quantification must be created for each genotype. As the number of genotypes to be measured increases, the number of controls increases accordingly, resulting in an increase in test costs. In addition, when quantifying the number of HPV copies in clinical cervical scrapings, it is necessary to consider the influence of the collection method, that is, the difference in the mixing rate of normal cells for each collected sample. An object of the present invention is to solve the problems associated with quantification of the HPV copy number.

  The present inventors considered that it would be advantageous to make a clinical diagnosis useful in cases of HPV superinfection based on information obtained from the relative ratio rather than the absolute number of viruses. In that case, when detecting HPV by the real-time PCR method, a two-dimensional chart plane showing the relationship between the amount of gene amplification products and the number of thermal cycles is provided with divided regions divided by the number of thermal cycles, and ranking of the divided regions is performed. Thus, it was conceived that it is preferable in terms of examination efficiency to analyze HPV superinfection according to which rank the amplification curve of the HPV gene for each genotype by real-time PCR in the sample belongs. However, when determining the degree of infection by genotype of HPV, it is important to determine which genotype is dominant, that is, how to determine “dominant type” efficiently and accurately. This is one of the most important factors related to frequency, and is the key to actually performing this gene detection operation.

  In response to this further problem, the present inventors combined the region division format in the above-described two-dimensional chart plane with the HPV dominant type determination method associated with the format in this real-time PCR method. The present invention has been completed by finding that the determination of the dominant type of HPV can be made efficiently and accurately.

  That is, the present invention is a two-dimensional chart plane showing the relationship between the amount of gene amplification product and the number of thermal cycles used for detection of human papillomavirus (HPV) by the real-time PCR method. 5 to 10 integer region, preferably 6 to 8 integer region, most preferably 6 integer region, and the divided region includes a region having a minimum thermal cycle number and a maximum thermal cycle number. The planar region sandwiched between the regions indicating the range is equally divided into 3 to 8 integer regions, preferably 4 to 6 integer regions, and most preferably 4 integer regions. In the case where the divided region of 5 to 10 etc. to which the genotype HPV giving the minimum Cp value belongs and the divided region of 5 to 10 etc. giving the maximum Cp value are not adjacent to each other Furthermore, the invention provides a relative quantification method for HPV, in which one or more HPVs of genotypes belonging to the divided region to which the minimum Cp value belongs is determined to be dominant over HPVs of other genotypes. It is. The “equal division” in the present invention includes not only strictly dividing the region equally but also includes a deviation of ± 5% of the boundary value of the number of thermal cycles derived by strict equal division.

  The “dominant type” means a specific genotype of HPV that is in a relatively dominant state with respect to HPVs of other genotypes. Specifically, when it is determined that a specific HPV genotype is dominant over other genotypes, the dominant HPV gene is five times higher than the HPV gene showing the lowest level of presence. As described above, it is preferable to use 10 times or more as a standard. In the above two-dimensional chart, since the number of thermal cycles represents the number of gene copies, when a real-time PCR analysis of HPV of different genotypes is performed, the region to which the HPV gene with the minimum Cp value belongs and the maximum Cp When the regions to which the HPV genes of the values belong are not adjacent to each other, the region division is performed so that a difference of at least 5 times, preferably 10 times or more is recognized as the copy number of the genes belonging to these regions. Is called.

  FIG. 1 (FIGS. 1A and 1B) is a schematic diagram based on the data of the Examples, which explains the outline of the relative quantification method of HPV of the present invention. FIG. 1A is a two-dimensional chart plane showing the relationship between the amount of gene amplification product and the number of thermal cycles used in performing a real-time PCR method to be used as a comparative example. In the two-dimensional chart, the horizontal axis indicates the number of thermal cycles, and the vertical axis indicates the fluorescence intensity reflecting the gene amplification product amount (the greater the gene amplification product amount, the greater the fluorescence amount). NC is a negative control and reflects an amplification curve of a gene amplification product using a sample containing no detection model DNA. 1.0E + 05 reflects the amplification curve of “low positive control” using detection model DNA of 10 5 of the first plasmid. 1.0E + 08 reflects the amplification curve of the “high positive control” using 10 8 8 starting plasmid detection model DNA. The two-dimensional chart plane of FIG. 1A is segmented by integers of plane areas +1 to +4 segmented by the number of thermal cycles. As can be seen from this figure, the planar regions that mainly divide the amplification curves of the “low positive control” and “high positive control” are adjacent, and the genotype reflected by the detection curve located between these positive controls is reflected. It is difficult to clearly distinguish the dominant type and non-dominant type of HPV. On the other hand, the example of the two-dimensional chart plane according to the present invention shown in FIG. 1B is 10 cubed plasmids that are “low positive control” and 10 8 that are “high positive control”. The planar region sandwiched between the amplification curves of the 10th or 7th power of the first plasmid is equally divided into 4 regions of +2 to +5, and 10 4th to 8th power amplification curves are present in these equally divided regions. positioned. This means that the width in the horizontal axis direction of one divided region is set to approximately 10 times as the number of gene copies. Therefore, the distinction between the dominant type and non-dominant type of HPV of the genotype reflected by the detection curve located between these positive controls is the genotype having a Cp value in the separated region beyond the adjacent region, When there is an HPV genotype that is more than 10 times as the gene copy number, the HPV genotype of the region to which the smallest Cp value belongs is determined as the dominant type, and other genotypes are determined as non-dominant types It becomes easy by doing. In addition, according to this example, it is understood that 10 7 7 initial plasmids are sufficient for “high positive control”.

Q-Invader method, Cyber Green method (literature Szuhai K, Sandhaus E, Kolkman-Uljee SM, Lemaitre M, Truffert JC, Dirks RW, Tanke HJ, Fleuren GJ, Schuuring E, Raap AK A novel strategy for human papillomavirus detection and genotyping with SybrGreen and molecular beacon polymerase chain reaction. Am J Pathol. 2001 Nov; 159 (5): 1651-60.), Scorpion probe method, molecular beacon probe method (literature Takacs, T ., Jeney, C., Kovacs, L., Mozes, J., Benczik, M., Sebe, A. 2008. Molecular beacon-based real-time PCR method for detection of 15 high-risk and 5 low-risk HPV types. J. Virol. Methods. 149, 153-162.). The Q-Invader method listed here is one of the preferred methods. Also, the present invention can be carried out by appropriately modifying these exemplified methods. In the Q-Invader method, a quantitative method for performing a real-time PCR method by monitoring a signal by an invader assay method has been developed. The feature of this method is that many different targets can be detected with a common fluorescent probe, which can realize simplification and cost reduction. In the examples of the present specification, relative quantitative analysis of 14 HPV genotypes is performed using the Q-Invader method. In one aspect of the invention, the Q-Invader method is set to detect two HPV genotypes in the same well using two type-specific primers and an invader probe using two wavelengths of fluorescence. Yes. This method has the following three major features. FIG. 2 shows the measurement principle of the Q-Invader method.
(1) A multiplex reaction in which two types of HPV genotypes are detected in one well can be performed.
(2) No type-specific fluorescent probe is required.
(3) There are only two types of control for relative quantitative analysis, high / low concentration for each genotype.

  Thus, in the present invention, the real-time PCR method performed in the relative quantification method is a real-time PCR method (Q-Invader method) in which the Cp value is calculated using the signal from the invader assay method as an index. It is preferred to do so.

  In the present invention, the Cp value for each genotype of human papillomavirus in the test sample is applied to each divided region on the two-dimensional chart plane showing the relationship between the amount of gene amplification product based on the real-time PCR method and the number of thermal cycles. The means for determining the presence of the dominant gene based on the fit value determined in this way can be performed in algorithmized software. FIG. 3 (FIGS. 3A, B, and C) shows an example of a flow sheet of a computer program that constitutes the software. The flow sheet of FIG. 3A shows the entire process of assigning Cp values to rank values (the symbols assigned to the divided planar regions described above) and determining the dominant genotype using this. is there. The flow sheet of FIG. 3B is a part of the flow sheet of FIG. 3A, and shows an example of the region dividing process in the above two-dimensional graph for each genotype HPV (x is the genotype number). It is shown. The flow sheet of FIG. 3C is also a part of the flow sheet of FIG. 3A, and in the sample, the above divided regions whose correspondence is determined for Cp obtained for each genotype HPV are regarded as rank values. In the sample, the highest rank value in the sample (HPV of the genotype that is present most in the sample by the Cp value) and the lowest rank value (the least in the sample by the Cp value) When the genotype HPV) difference is greater than 1, that is, when the corresponding divided planar regions are not adjacent, the genotype HPV that has obtained the maximum rank value is the dominant HPV in the test sample. It is a flow sheet that derives that. The flow sheet shown in FIG. 3 is a specific example of a flow sheet that is a basis of a computer program that can be created according to the divided two-dimensional chart obtained by the real-time PCR method shown in FIG. 1B. It is an example.

<FIG. 3A>
The flow sheet 0 shown in FIG. 3A shows the entire process of the computer program. Step 1 indicating the start terminal indicates the start of the program performed according to the flow sheet 0. Step 1 is to give the start function of the program in the computer hardware.

  Step 2 showing data shows the entry stage of the data to be processed for the computer program executed according to the flow sheet 0. The data to be processed indicates output data from the execution device of the real-time PCR method, that is, a measurement value obtained from the device. Here, the “measured value” is a Cp value obtained by performing a real-time PCR method for each genotype of HPV to be detected, which is the basis of the quantification method of the present invention.

  Step 3 showing the predefined process shows a series of processes for conversion to the rank value (Srank) of the genotype x, and the specific contents thereof are shown in FIG. 3B and will be described later. Here, x indicating the genotype is usually a natural number, but is not necessarily the actual number of the HPV genotype. Rather, it is preferable to select a typical HPV genotype in Japanese and correct the jump number to a serial number to obtain an x value. In this example, 14 types of HPV genotypes (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 67 and 68 types) are selected, and each one It is assigned as a continuous natural number to be “x value”. The “rank value” is obtained by performing a real-time PCR method on the HPV of the genotype corresponding to this x value, and the Cp value obtained from the specimen belongs to the “number of thermal cycles in the two-dimensional chart plane of the real-time PCR method”. The number assigned to the plane area divided into two. Referring to FIG. 1B, the numbers +1, +2, +3, +4, +5 and +6 correspond to rank values. However, as will be described later, in the case of this example, the + symbol is excluded from the rank value for convenience. According to the step 3, the computer program is executed on the computer hardware, thereby realizing the function of converting the rank value (Srank) of the genotype x in the computer.

  Step 4 indicating the predefined process is a process of determining the dominant HPV genotype in the specimen from the content of the rank value determined for the genotype x obtained by the predefined process 3 above. The specific contents are shown in FIG. 3C and will be described later. According to Step 4, the computer program is executed on the computer hardware, thereby realizing the function of determining the dominant HPV genotype in the specimen.

  Step 5 showing data indicates a stage of outputting the result of the genotype detected from the specimen and the presence / absence or type of the dominant type obtained from the predefined process. The output of the result may be on a monitor screen of a computer or on a launch paper. Further, it is not always necessary to sequentially perform this output process, and it can be stored in an appropriate storage medium such as a hard disk of a computer and output when desired. According to the step 5, the computer program is executed on the computer hardware, thereby realizing the function of outputting the result of the genotype detected from the specimen and the presence / absence or type of the dominant type to the computer.

  In this output stage, it is preferable to return the genotype x to a number expression (genotype name) indicating the original HPV genotype. Therefore, it is preferable to provide a step of assigning the genotype x in correspondence with the original HPV genotype name as a step before the step 5. According to the step of assigning to the genotype name, the computer program is executed on the computer hardware, thereby realizing the function of assigning the genotype x to the original genotype name of the HPV.

  Step 6 indicating the end terminal indicates the end of the program performed in accordance with the flow sheet 0. The step 6 is to give the end function of the program in the computer hardware.

<FIG. 3B>
In FIG. 3B, the start terminal 31 indicates the start of the above defined process 3. The process 32 is a process of designating the initial value 1 of x, that is, the HPV genotype for which the predefined process 3 is performed first.

Step 33 indicating preparation is a step of defining and assigning elements necessary for calculating the rank value. Specifically, P3cp_Gx is the Cp value of the 10 ³ positive control of genotype x, and P7cp_Gx is the Cp value of the 10 ⁷ positive control of genotype x. In the present example, it sets the Cp value of 10 ⁷ positive control as a threshold value of the "rank value (+) 6". That is, as can be seen from FIG. 1B, the fluorescence intensity giving the Cp value in this example is set to about 25% of the full intensity. This is a standard and preferable setting for obtaining the Cp value. Further, Cp value of 10 ³ positive control is set as the threshold "rank value (+) 1". Further, P3_7cp_Gx is a value obtained by subtracting P7cp_Gx from P3cp_Gx, and Scp_Gx is a Cp measurement value of HPV genotype x in the specimen.

  Step 34 indicating the determination is a process of determining which rank value the Scp_Gx that is the measurement value is. An arrow 340 indicating “Scp_Gx = Null” and indicating that the process proceeds to step 35 indicating the process of setting the x value to x + 1 is when the HPV of the genotype corresponding to the x value is not found in the sample In this case, naturally, the assignment of the rank value in the x value is not performed, and the shift is made to the assignment of the rank value in the next x + 1 value.

The tip of the arrow to which “Scp_Gx <P7cp_Gx” is attached is a step 341 that indicates a process of setting the rank value to 6 (Srank_Gx = 6), and indicates a determination process that shifts to this. When the measured Cp value is smaller than the Cp value of the 10 ⁷ positive control, the value is smaller than the threshold value indicated by the 10 ⁷ positive control, which means that the rank value is set to the maximum “6”.

The tip of the arrow to which “Scp_Gx <P7cp_Gx + 1/4 * P3_7cp_Gx” is attached is a step 342 indicating a process of setting the rank value to 5 (Srank_Gx = 5), which indicates a determination process to be shifted to here. . The measured Cp value is equal to the threshold value indicated by the 10 ⁷ positive control, which is 1/4 of the difference between P3cp_Gx and P7cp_Gx described above (ie, the Cp value between the 10 ³ and 10 ⁷ positive controls described above). If the absolute value is smaller than the value obtained by adding the first four equal values counted from the smaller absolute value, the Cp value is equal to or greater than the Cp value belonging to the rank value 6 described above (steps already showing the above processing) 341), there is no possibility of taking the rank value 6), and the value obtained by adding the first four equal values to the Cp value belonging to the rank value 6 is larger than the maximum possible Cp value. This means that the rank value is “5”, which is one less than 6 because it is within the range of the small case.

The tip of the arrow to which “Scp_Gx <P7cp_Gx + 1/2 * P3_7cp_Gx” is attached is step 343 indicating a process for setting the rank value to 4 (Srank_Gx = 4), and indicates a determination process to be shifted to here. . The measured Cp value is equal to the threshold value indicated by the 10 ⁷ positive control, which is half of the difference between P3cp_Gx and P7cp_Gx described above (that is, the Cp value between the above 10 ³ and 10 ⁷ positive control Cp value threshold values). When the value is smaller than the value obtained by adding the second quadrant value counted from the smaller absolute value, the Cp value is equal to or higher than the Cp values belonging to the rank values 6 and 5 described above (already described above). Steps 341 and 342 indicating processing are performed, so there is no possibility of taking rank values 6 and 5), and the second quadrant value is added to the Cp value belonging to rank value 6 This means that the rank value is set to “4”, which is one less than 5, because the value is in the range where the value is smaller than the maximum possible Cp value.

The tip of the arrow to which “Scp_Gx <P7cp_Gx + 3/4 * P3_7cp_Gx” is attached is a step 344 indicating a process for setting the rank value to 3 (Srank_Gx = 3), which indicates a judgment process to be shifted to here. . The measured Cp value is equal to the threshold value indicated by the 10 ⁷ positive control, which is 3/4 of the difference between P3cp_Gx and P7cp_Gx described above (ie, the Cp value sandwiched between the above C ³ and 10 ⁷ positive control threshold values). When the value is smaller than the value obtained by adding the third quadrant value counted from the smallest absolute value, the Cp value is equal to or higher than the Cp value belonging to the rank values 6 to 4 (already described above). Steps 341, 342, and 343 indicating the processing are performed, so there is no possibility of taking rank values 6, 5, and 4), and the Cp value that belongs to rank value 6 is divided into the third quadrant. This means that the rank value is set to “3”, which is one less than 4, because the value is smaller than the maximum possible Cp value.

The tip of the arrow to which “Scp_Gx <P3cp_Gx” is attached is step 345 indicating a process for setting the rank value to 2 (Srank_Gx = 2), and indicates a determination process for shifting to this. The measured Cp value is smaller than the threshold value indicated by the 10 ³ positive control (that is, counted from the smaller absolute value of the Cp value sandwiched between the above C ³ and 10 ⁷ positive control threshold values). If the value is smaller than the value obtained by adding the fourth quadrant, the Cp value is equal to or greater than the Cp value belonging to the rank values 6 to 3 described above (steps 341, 342, and 343 indicating the above processing) 344), there is no possibility of taking rank values 6, 5, 4, and 3), and a value obtained by adding the fourth quaternary value to the Cp value belonging to rank value 6 is This means that the rank value is “2”, which is one less than 3, because it is in the range in which the value is smaller than the maximum possible Cp value.

Otherwise steps 341, 342, 343, 344 and 345 shows the above-described processing, i.e., when the large Cp value than the range of 4 equal portions value (threshold indicating the 10 ³ positive control), a rank value Step 346 indicating the process of setting 1 (Srank_Gx = 1) is performed.

  Steps 341 to 346 indicating these processes are performed, and rank values 1 to 6 given to the HPV genotype x are applied, and the process proceeds to the next step 35.

  Next, step 35 showing the process of setting the above x value to x + 1 is performed. Step 36 indicating determination is processing for determining whether or not the x value is smaller than 15. In the case of this example, since there are 14 types of HPV genotypes, the number of times of performing the steps from Step 34 indicating the above determination to Step 35 indicating the processing is 14 times. Therefore, if x is less than 15 (substantially 14 or less), the process loops back to the step 33 indicating preparation, and if x is not less than 15 (15 or more), the predefined processing is performed. The indicated step 3 ends (step 37 indicating the end terminal).

<FIG. 3C>
In FIG. 3C, step 41 indicating the start terminal indicates the start of step 4 indicating the above defined process. Step 42 indicating preparation is a step of defining and assigning elements necessary for determining the presence or absence of the dominant type or the genotype of HPV corresponding to the dominant type. The maximum value of the rank value (Srank) of each genotype obtained in step 3 indicating the defined process is set as Max_rank, and the minimum value is set as Min_rank.

  Step 43 indicating determination represents determination processing for determining whether or not the difference between Max_rank and Min_rank is greater than 1 (substantially 2 or more). If the difference is not greater than 1 (substantially 1 or 0), a step 44 is performed that indicates a confirmation process of “no dominant genotype”, and the difference is greater than 1 (substantially In the case of 2 or more), the process proceeds to step 45 which shows a determination process for determining that “one or more HPV genotypes whose rank value is Max_rank” is “dominant type”. After steps 44 and 45 indicating these confirmation processes, step 4 indicating the defined process ends (step 46 indicating the end terminal).

  A computer program based on the algorithm of the flow sheet 0 or an algorithm having substantially the same content is executed by computer hardware as a whole or as a part of another computer program. The relative quantification method of the present invention can be performed. “As part of another computer program” is assumed to be a case where the above-mentioned computer program process is added to a program for performing a real-time PCR method, for example. More specifically, a step of assigning a Cp value obtained by executing a program for performing the real-time PCR method to the genotype of the HPV to be detected is provided in the computer program as the real-time PCR method is performed. The computer program according to the present invention is added as a part of the computer program for performing the real-time PCR method by adding the allocation step upstream of step 1 indicating the start or step 2 indicating the data. It can be included.

  All the above-described computer programs according to the present invention can be created by constructing a desired algorithm in a general computer program language.

  For example, low-level languages such as machine language and assembler language; Fortran, ALGOL, COBOL, C, BASIC, PL / I, Pascal, LISP, Prolog, APL, Ada, Smalltalk, C ++, Java (registered trademark) ) Or the like; a fourth generation language, an end user language, or the like can be selected and used. A special problem language can also be used as necessary.

  The present invention provides the computer program as described above, and also provides an electronic medium in which the software is stored based on the computer program.

  The electronic medium that can store the software is not particularly limited. For example, magnetic tape, magnetic disk, CD-ROM, CD-R, CD-RW, MO, DVD-R, DVD + R, DVD-RW, DVD + RW, DVD-ROM, USB chip, etc. can be used.

  The computer program according to the present invention is executed in a processing device. FIG. 4 shows an embodiment in which the processing apparatus is configured using a computer. FIG. 4 is a block diagram of the configuration of the processing apparatus.

  The processing device 70 constitutes computer hardware. Reference numeral 80 denotes a supply source of basic data, and specifically corresponds to a measurement device of the real-time PCR method and a database of basic data accumulated by the measurement device. Here, the basic data is basic data for executing the computer program according to the present invention and has the same meaning as the above-mentioned “measured value”. For the HPV to be detected, a real-time PCR method is performed for each genotype. It is the set information of the Cp value obtained by this and the said genotype.

  The basic configuration of the processing device 70 includes a first interface 71, an arithmetic processing unit 72, a temporary storage unit 73, a recording unit 74, an internal bus 75, a second interface 76, an operation unit 77, and a display unit 78. It has become. The first interface 71, the arithmetic processing unit 72, the temporary storage unit 73, the recording unit 74, and the second interface 76 can exchange data through an internal bus 75. The operation unit 77 is a means for inputting instructions and data to the arithmetic processing unit 72, and examples thereof include a computer keyboard, a mouse, and a touch panel. The display unit 78 is a means for displaying a processing result or the like by the arithmetic processing unit 72, and typically a computer display is exemplified. The arithmetic processing unit 72 can use a CPU, the temporary storage unit 73 can use a RAM, and the recording unit 74 can use a hard disk drive. The first interface 71 is typically a communication interface, and exchanges basic data from the basic data supply source 80 via a network such as a LAN, an intranet, the Internet, or a direct data connection means. Do. The second interface 76 is an input / output interface, and a serial or parallel interface corresponding to the type of the operation unit 77 can be used. The second interface 76 includes a video memory and a DA conversion unit, and outputs an analog signal corresponding to the video system of the display unit 78, thereby displaying an image for displaying information on the display unit 78. The Further, instead of the display on the display unit 78, it is possible to change to a paper output display by a printer.

  As the operation unit 77 is operated, the arithmetic processing unit 72 acquires basic data from the basic data supply source 80 via the first interface 71, records the basic data in the recording unit 74, and appropriately records from the recording unit 74. The data is read into the temporary storage unit 73, a predetermined process, typically, a computer program based on the flow sheet 0 of FIG. 3 (FIGS. 3A, 3B, 3C) is performed, and the result is stored in the recording unit 74. Record. The arithmetic processing unit 72 provides screen data for prompting the operation of the operation unit 77 and screen data for displaying the processing result, and displays these images on the display unit 78 via the video RAM of the second interface 76. To do.

  According to the present invention, there is provided a relative quantification method using a real-time PCR method capable of easily and accurately detecting a dominant HPV in a test sample.

2 is a two-dimensional chart plane to be used as a comparative example showing the relationship between the amount of gene amplification product and the number of thermal cycles when performing a real-time PCR method. 2 is a two-dimensional chart plane showing the relationship between the amount of gene amplification product and the number of thermal cycles according to the present invention. It is drawing which shows the measurement principle of Q-Invader method. It is an example (whole structure) of the flowchart of the computer program concerning this invention. It is a part of a flow sheet of a computer program according to the present invention, and shows a defined process in which a measured value of HPV genotype is a rank value. It is a part of a flow chart of a computer program according to the present invention, and shows a predefined process for determining a dominant genotype. It is a block diagram which shows the structure of the processing apparatus of this invention.

  In order to show the sensitivity and effect in HPV genotyping of the present invention, sequence analysis and comparative tests were performed using HPV positive specimens.

<Materials and methods>
(1) Control DNA
HPV 16 and HPV 18 genomic DNA were obtained from the American Type Culture collection. The DNA concentration was measured using a PicoGreen dsDNA Quantitation Kit (Invitrogen, Carlbad, CA, USA). Each copy number was calculated from the DNA concentration and genome size. HPV-DNA was diluted and used as a positive control for measurement.

(2) Clinical samples 182 liquid cytological specimens were obtained from Ibaraki Prefectural Institute of Public Health. Cervez-Brush (Rovers Medical Devices, OSS, The Netherlands) was used for sampling. Samples were handled according to the ethics committee regulations of the Ibaraki Prefectural Institute of Health.

(3) Extraction of HPV-DNA Silica membrane method from 500 μl of liquid cytological specimen (Reference: Riemann K, Adamzik M, Frauenrath S, Egensperger R, Schmid KW, Brockmeyer NH, Siffert W. Comparison of manual and automated nucleic acid extraction DNA was extracted using J Clin Lab Anal. 2007; 21 (4): 244-8.).

(4) Preparation of control plasmid DNA by cloning of HPV-DNA Each genotype HPV-DNA obtained from a liquid cytological specimen for examination of relative quantitative analysis and detection sensitivity was converted into a consensus primer L1C1 / C2 primer (L1C1: 5′-CGTAAACGTTTTCCCTATTTTTTT-3 ′ (SEQ ID NO: 1), L1C2-1: 5′-TACCCTAAATACTCTGTATTG-3 ′ (SEQ ID NO: 2), L1C2-2: 5′-TACCCTAAATACCCTATATTG-3 ′ (SEQ ID NO: 3)) Amplified. The PCR product was cloned using a pCRII-TOPO vector (Life Technology), and sequence analysis was performed by the dideoxy method using a 3130 fluorescent DNA sequencer. The sequence of each control plasmid was confirmed by BLAST search of DNA Data Bank of Japan database.

(5) Design of Primer / Invader Probe Specific primers of each genotype were designed in the region incorporated in the control plasmid. Invader probes were designed in the amplification region using Invader technology creator (Tables 1 and 2).

  The primer and invader probe base sequences shown in Table 1 above were assigned SEQ ID NOs: 4 to 31 in order from the top, and are shown in the attached sequence listing.

  The primer and invader probe base sequences shown in Table 2 above were assigned SEQ ID NOs: 32-59 in order from the top, and are shown in the attached sequence listing.

In Table 1 and Table 2 above,
“F-primer” means Forward primer, “R-primer” means Reverse primer, “P-probe” means primary probe, “I-primer” “-oligo” means Invader oligo.

  The underlined sequence indicates the 5 'flap of probe. Furthermore, the bold sequence indicates the cleavage site of the primary probe. The 3 'end of all primary probes is protected with an amino group (Amino-blocked). For reference, the accession number in GenBank of the sequence of genomic DNA of each HPV is described.

HPV 16; GenBank accession no.NC_001526 ,
HPV 18; GenBank accession no.NC_001357 ,
HPV 31; GenBank accession no.J04353 ,
HPV 33; GenBank accession no.M12732 ,
HPV 35; GenBank accession no.M74117 ,
HPV 39; GenBank accession no.M62849 ,
HPV 45; GenBank accession no.X74479 ,
HPV 51; GenBank accession no.M62877 ,
HPV 52; GenBank accession no.X74481 ,
HPV 56; GenBank accession no.X74483 ,
HPV 58; GenBank accession no.D90400 ,
HPV 59; GenBank accession no.X77858 ,
HPV 67; GenBank accession no.D21208 ,
HPV 68; GenBank accession no.DQ080079

As an endogenous control, a primer and an invader probe for detecting beta globin were designed with the following contents.
forward primer: 5′- CAACTTCATCCACGTTCACC -3 ′ (SEQ ID NO: 60)
reverse primer: 5′- GAAGAGCCAAGGACAGGTAC -3 ′ (SEQ ID NO: 61)
primary probe: 5′- ACGGACGCGGAG GTGTTCACTAGCAACCT <amino> -3 ′ (SEQ ID NO: 62)
Invader oligo: 5′-CAGAGCCATCTATTGCTTACATTTGCTTCTGACACAACTC-3 ′ (SEQ ID NO: 63)
The underlined portion of the primary probe represents the flap probe in the invader reaction.

(6) Relative quantitative analysis using Q-Invader method Relative quantitative analysis of 14 HPV genotypes was performed using a modified Q-Invader method. Two-color fluorescence detection for one reaction can be performed by using a Cleavease XI Invader core reagent kit containing two types of common fluorescent probes. For the most efficient measurement, 14 genotypes were measured simultaneously in 7 wells. The genotype combinations are as follows: Well 1: 51 and 16, Well 2: 56 and 35, Well 3: 18 and 58, Well 4: 39 and 59, Well 5: 45 and 31, Well 6: 52 and 37 Well 7:68 and 67.

  5-100 ng of template DNA, primers for amplifying two types of genotypes, 50 μM d-NTP, 700 nM each primary probe, 70-nM each invader oligo, 2 U DNA polymerase (AmpliTaq gold) and Cleavease XI In addition to 12 μl of reaction reagent containing Invader core reagent kit, the reaction is performed using a 384 well PCR plate. Light Cycler 480 was used as a measuring instrument, and the reaction conditions were heat treatment at 95 ° C. for 10 minutes, followed by 35 cycles of 95 ° C. for 30 seconds, 65 ° C. for 60 seconds, 50 ° C. for 30 seconds, 72 ° C. for 30 seconds. It was. FAM (Carboxyfluorescein) (wavelength / bandwidth: excitation, 485/20 nm; emission, 530/25 nm) and RED (REDmond RED) (excitation, 560/20 nm; Read at the end of the 65 ° C step of every PCR cycle as in a typical real-time PCR. Analysis was performed by the fit point method using Light Cycler 480 software, and the Cp value of each genotype was determined.

(7) Sequencing using L1C1 / 2 primer and type-specific primer For clinical samples in which single genotype HPV was detected by Q-Invader method, the genotype was confirmed by sequence analysis using L1C1 / 2 primer . On the other hand, for specimens in which a plurality of genotypes were detected, the genotypes were confirmed by sequence analysis using a type-specific forward primer and a PGMY 09 primer designed in the L1 region.

(8) Examination of detection sensitivity and reproducibility The detection sensitivity of this method was examined using plasmids of each genotype. Regarding the lower limit of detection, each plasmid was prepared with 10 3 to 10 7 copies. Further, each genotype plasmid of 10 3 copies and 10 7 copies was measured three times at n = 5, and reproducibility was examined. Relative quantitative analysis in superinfection was studied by mixing different genotype plasmids. When mixing, the number of genotype copies with a small relative ratio was set to 5000 copies.

<Result>
(1) Detection sensitivity and reproducibility Concentration-dependent measurement was possible from 10 3 to 10 7 copies. The measurement sensitivity of this measurement system was 1000 copies per reaction. Table 3 shows the average Cp value and standard deviation in the reproduction test of 10 genotype copies and 10 7th copy of each genotype plasmid. C. of each Cp value. V. Was 0.7% to 4.6%.

(2) Relative quantitative analysis Relative quantitative analysis was attempted in order to obtain the relative ratio of genotype of each genotype in the case of double infection. For each genotype, the relative quantitative values were divided into 6 areas based on the Cp values of the high and low concentration controls (+6; Cp value> high concentration control, + 5- + 2; high concentration control> Cp value> low). Concentration control, +1; low concentration control> Cp value). +5 to +2 were equally divided on the basis of the Cp value. The fluorescence intensity used as a reference for the Cp value was 25% of the full intensity.

  The relative quantitative analysis was examined using plasmids of different genotypes. Even when equal amounts of plasmids of different genotypes were contained in the reaction solution, the same relative quantitative value was obtained. However, in templates prepared with plasmids of different genotypes at a mixing ratio of 10 times or more, a difference in relative quantitative values proportional to the mixing ratio occurred.

(3) Determination of HPV genotype in clinical specimen (1)
182 cervical scrapes were measured by this system. 131 cases were HPV positive, of which 104 cases were detected as a single genotype, and 27 cases were detected as a plurality of genotypes. The largest number of genotypes in the same specimen was 4. For single genotype infection cases, the genotype was confirmed by sequence analysis using L1C1 / C2 primers. The agreement rate between this measurement system and sequence analysis was 81 cases (77.9%). The remaining 23 cases could not be confirmed because sequences other than the 14 genotypes that can be determined by this system appeared in the sequence analysis, or the sequences of a plurality of genotypes overlapped and the sequence could not be read. Therefore, 23 cases that could not be confirmed were subjected to sequence analysis again using genotype-specific primers, and confirmed to match the results of this measurement system. The results of the relative quantitative analysis of this measurement system in 27 cases containing multiple genotypes are shown in Table 4.

  According to Table 4, sample IDs in which the presence of the dominant type was confirmed are No. 95 (type 16 is the dominant type), No. 122 (type 16 is the dominant type), No. 148 (type 16 is the dominant type), No. 71 ( 18 type is dominant), 55 (52 type is dominant), 27 (52 type is dominant), 49 (67 type is dominant), and 118 (68 type is dominant) there were.

(4) HPV genotype determination in clinical specimens (2)
Separately from the determination test (1), cytodiagnosis was performed on 428 cases of cervical scrapes, and in parallel with this, measurement by this system was performed. As a result of measurement by this system, 230 cases were determined to be HPV positive, of which 164 cases were detected as a single genotype and 66 cases were detected as a plurality of genotypes. The details are shown in Table 5 together with the results of cytodiagnosis. In Table 5,
“Normal” indicates a negative case, which is limited to inflammation and has non-neoplastic findings. No abnormality (regular inspection level). “ASC-US” is a case of atypical squamous cells of unknown significance, which is a relaxed work-up level. “ASC-H” indicates a case in which atypical squamous epithelial cells in which suspicion of advanced squamous intraepithelial lesion is observed are observed. It is a strict precision inspection level. “LSIL” indicates a case in which mild squamous intraepithelial dysplasia is observed. It is a strict precision inspection level. “HSIL” indicates a case where severe squamous intraepithelial lesion is observed. It is a strict precision inspection level. “SCC” indicates a case in which squamous cell carcinoma is observed. It is a strict precision inspection level. “AGC” is an example in which atypical glandular cells are observed, which is a strict work-up level. “Adenocarcinoma” is an example of invasive adenocarcinoma, which is a strict work-up level.

From Table 5, it became clear that the infection rate of HPV increases rapidly when cell atypia (malignancy) progresses beyond the ASC-US stage in the cytodiagnosis evaluation. In addition, it was revealed that HPV complex infection is particularly observed with epithelial cell variants.
In addition, Table 6 shows the number of infected persons (% in parentheses) by HPV genotype (HPV genotype) in specimens that were positive for HPV infection, according to the above cytological evaluation.

  From the results shown in Table 6, it was confirmed that the type 16 and type 52 in particular showed higher malignancy of cytodiagnosis and higher positive rates.

  Further, Table 7 discloses the breakdown of examples in which HPV complex infection was observed. In the table, group 1 is a group consisting of Normal, ASC-US and ASC-H, and group 2 is a group consisting of LSIL, HSIL and SCC. “D” indicates the genotype of HPV detected as the “dominant type” in this system in the combination of the complex infections. For example, in the complex infection of ASC-US, “33D 67” means that “HPV type 33 and type 67 complex infection was recognized and type 33 was detected as the dominant type by this system” Is shown.

From the contents of Table 7, the ratio (%) of “complex infection with dominant type” per total number of samples for each malignancy of cytodiagnosis is as follows.
<Group 1>
(1) Normal: 0/147 → 0%
(2) ASC-US: 5/89 → 5.6%
(3) ASC-H: 1/16 → 6.3%
<Group 2>
(4) LSIL: 18/70 → 25.7%
(5) HSIL: 14/81 → 17.3%
(6) SCC: 1/10 → 10%

  From this result, it can be seen that, as the malignancy of cytodiagnosis increases, the frequency of HPV combined infection with dominant type increases particularly in LSIL and HSIL. Thus, by detecting whether or not the dominant type is accompanied by the present invention, the ratio of the suspicious group is lowered, and it is determined that the risk of cervical cancer is higher, and that it is group 2 (dysplasia progression group) It has become clear that the efficiency can be increased.

  In the risk diagnosis of cervical cancer, rapid detection and genotyping of HPV are important. Until now, it has not been possible to show the relative ratio of each genotype of high-risk HPV in cases of superinfection quickly, accurately and inexpensively. The analysis method of the present invention enables a relative quantitative analysis of high-risk HPV in cases of HPV superinfection. In the examples, when PCR primers and invader probes for each genotype were set in the L1 gene region, a measurement range from at least 10 3 to 10 7 copies could be obtained for all genotypes. The result of the reproducibility test using the control plasmid was good (CV value: 0.7-4.6). When HPV-DNA is extracted from cervical scrapes, a large amount of human-derived DNA is mixed. Therefore, in order to investigate the influence of human-derived DNA, 100 ng of human-derived DNA was added to the control plasmid. There was no change in value.

  HPV superinfection is common in the cervix. Therefore, in the present invention, a relative quantification method is provided to determine the relative ratio of each genotype in HPV superinfection. The relative quantitative value is calculated from the Cp value of each genotype. One feature of the method of the present invention is that it does not require much control. In studies using plasmids of each genotype, it was possible to obtain a relative quantitative value corresponding to the amount of template DNA. In the study using 104 clinical specimens containing high-risk HPV, the HPV genotype was determined by Q-Invader method, consensus and sequence analysis using type-specific primers. The results of Q-Invader method and sequence analysis were consistent for all samples. In 27 of 104 cases, double infection by high-risk HPV was confirmed. The number of overlapping genotypes varied from 2 to 4 types, with 2 types being the most, 81.5%.

  Moreover, in the Example, the relative ratio in various combinations of high risk type HPV was measured. The relationship between HPV superinfection in the cervix and cytological grade is not clear. However, monitoring the relative proportions in superinfection appears to be important for understanding the dynamics of HPV in the course of treatment. Many of the infected HPVs are transient and disappear spontaneously by immunity, but cervical cancer occurs due to persistent infection of high-risk HPV. In Europe and America, types 16, 18, 31, 33, and 45 are typical high-risk types of cervical cancer, but in Japan, types 52 and 58 are more frequently detected in cervical cancer. HPV genotyping using liquid cytological specimens has become common in the diagnosis of cervical cancer. In the future, research on co-infection will be important in risk diagnosis.

  Furthermore, in the Examples, it was revealed that the “dysplasia progression group” more suspected of cancer migration can be accurately screened by the present invention in the case of superinfection with the dominant type.

  As described above, according to the present invention, the severity of HPV infection related to cervical cancer can be determined more quickly, accurately, and inexpensively, and the industrial utility has been clarified.

Claims (9)

In the two-dimensional chart plane showing the relationship between the amount of gene amplification product and the number of thermal cycles used when detecting human papillomavirus by the real-time PCR method, a plane area divided for each range of the number of thermal cycles is created as an integer area of 5-10, In the divided region, a plane region sandwiched between a region indicating the range of the minimum number of thermal cycles and a region indicating the range of the maximum number of thermal cycles is equally divided into 3 to 8 integer regions, and differs depending on the test sample. When the genotype human papillomavirus exists, the 5-10 divided region to which the genotype human papillomavirus giving the minimum Cp value belongs and the 5-10 divided region giving the maximum Cp value are not adjacent to each other Furthermore, human papillomaviruses of one or more genotypes belonging to the divided region to which the minimum Cp value belongs are transferred to human genotypes of other genotypes. Papi judged to predominate type against papillomavirus, relative quantification method of human papilloma virus. The method for relative quantification of human papillomavirus according to claim 1, wherein the number of equally divided plane regions is 4 to 6 integer regions. The method for relative quantification of human papillomavirus according to claim 1, wherein the number of planar regions that are equally divided is four. The method for relative quantification of human papillomavirus according to any one of claims 1 to 3, wherein the minimum value of the difference in the copy number of the HPV gene corresponding to the Cp value belonging to the non-adjacent region that is equally divided is 5 times or more. . The method for relative quantification of human papillomavirus according to claim 2 or 3, wherein the minimum value of the difference in the copy number of the HPV gene corresponding to the Cp value belonging to the non-adjacent region that is equally divided is 10 times or more. 6. The method for relative quantification of human papillomavirus according to any one of claims 1 to 5, wherein the real-time PCR method is a real-time PCR method in which a Cp value is calculated using a signal from an invader assay method as an index. In the quantification method, the fitting of the Cp value for each human papillomavirus genotype in the test sample to each divided region of the two-dimensional chart plane showing the relationship between the amount of gene amplification product based on the real-time PCR method and the number of thermal cycles, The relative quantification of human papillomavirus according to any one of claims 1 to 6, wherein the means for determining the presence of a dominant-type gene based on the fit value determined by the step is performed in an algorithmized software. Method. The quantification method includes fitting a Cp value for each human papillomavirus genotype in a test sample to each divided region of a two-dimensional chart plane showing the relationship between the amount of gene amplification product based on the real-time PCR method and the number of thermal cycles. The human papilloma according to any one of claims 1 to 6, wherein means for determining the presence of a dominant-type gene based on the fit value determined by the step is performed by a processing device that executes software that is algorithmized Method for relative quantification of virus. Fitting of the Cp value for each genotype of human papillomavirus in the test sample to each divided region of the two-dimensional chart plane showing the relationship between the amount of gene amplification product based on the real-time PCR method and the number of thermal cycles, and the fit determined thereby Software in which a means for determining the presence of a dominant gene based on a value is algorithmized.

Images