JP2011011140A - Method for reducing sludge - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a sludge volume reduction agent which raises microorganism activity in activated sludge and which has low cost and further to provide a method for reducing the sludge in an activated sludge treatment method.SOLUTION: The method for reducing the sludge is characterized by that binos powder which is obtained by cultivating, recovering and drying Parachlorella sp. binos is added to the sludge, the Parachlorella sp. binos has the deposition number FERM ABP-10969, addition amount of the binos powder is 20 to 200 g per sludge 1 ton. An excess sludge volume reduction agent is characterized by that the Parachlorella sp. binos is cultivated, recovered and dried in an open system.

Description

  The present invention relates to a sludge reduction method for increasing microbial activity and reducing sludge in an activated sludge treatment method.

  Conventionally, it is used as a treatment method for water to be treated such as domestic wastewater and sewage discharged from various industries, such as microorganisms (various bacteria such as yeast, mold, cyanobacteria, actinomycetes, phytoplankton, zooplankton, etc.) The activated sludge treatment method according to the present invention has been used.

  As shown in FIG. 12, by forming a useful microflora such as a protozoa represented by a rotifer, activated sludge is activated, and it is possible to reduce sludge, suppress malodor, and improve the quality of treated water. ing.

  In order to activate microorganisms in activated sludge, a method of adding nutrients utilized by microorganisms, especially vitamins to activated sludge has been studied since the 1970s, and many papers (Non-Patent Documents 1 to 16) have been published. ing.

The actions and effects of vitamins described in Non-Patent Documents 1 to 16 are summarized in FIG. In Non-Patent Document 1, vitamins B ₁ and B ₁₂ act as suppression of the generation of filamentous bacteria, and as a growth factor of the useful protozoan Tritigmostoma culcurus that prey on type 021N, which is a typical filamentous bacterium. It has been reported that vitamins B ₁ and B ₁₂ are essential.

  In addition, microbial species that require vitamin B group in activated sludge have been investigated in various fields such as industrial effluent and domestic effluent (Non-patent Document 3), and in paper industry, petrochemical industry, and waste treatment plant. The existence of microorganisms that require many vitamin B groups has been reported (Non-patent Documents 2 and 9). FIG. 14 quotes Non-Patent Document 2 and shows the abundance ratio of microbial species that require vitamin B groups in industrial activated sludge.

  Furthermore, Non-Patent Documents 7 to 13 report that vitamin B group is essential for activated sludge. Non-patent documents 14 to 16 report that the activity of activated sludge increases when vitamin B group is added to activated sludge.

  However, the method of separately adding nutrients such as vitamins to the activated sludge is costly and not feasible.

  On the other hand, in Patent Document 1, for the purpose of reducing excess sludge without adversely affecting the treatment function of the wastewater treatment facility, microorganism-activating components such as tea leaves or a leachate thereof or amino acids contained in tea leaves are disclosed. And the sludge reduction method of the wastewater treatment facility characterized by making the composition which consists of sludge solubilization components, such as tannin, contact with biomass is disclosed.

  Patent Document 2 discloses a purification device for treating seawater and sludge on the bottom of fresh water on an industrial scale in a simple and efficient manner without imposing a burden on the environment. In particular, claim 1 is a device for purifying seawater or freshwater bottom sludge, which is at least filled with sludge containing seabed sludge and added with vitamins to perform a decomposition reaction. A reaction vessel is described.

Japanese Patent Laid-Open No. 10-15568 JP 2003-47996 A

Y. Inamori, Y. Kuniyasu, R. Sudo, and M. Koga Control of the growth of filamentous microorganisms using predacous ciliated protozoa. Water Science Technology. 1991; 23 963-971 J.E.Burgess, J.Quarmby, and T.Stephenson Role of micronutrients in activated sludge-basedbiotreatment of industrial effluents.Biotechnology Advances 17 (1999) 49-47 LindG, Schade M, Metzner G, Lemmer H Use of vitamins in biological waste watertreatment.GWF-Wasser / Abwasser 1994; 135: 595-600. Singleton J. Microbial metabolism of xenobiotics: Fundamental and applied research. J ChemTechnol Biotechnol 1994; 59: 9-23. WoodDK, Tchobanoglous G. Trace elements in biological waste treatment.J Wat PollutControl Fed 1975; 47: 1933-45. GostickN.A study of the effect of substrate composition on the settlement ofactivated sludge PhD Thesis, Cranfield University, U.K. 1991. BeardsleyML, Coffey JM Bioaugmentation: optimizing biological wastewater treatment.Pollution Engineering 1985; December: 30-3. JEBurgess, J Quarmby and T Stephenson Vitamin addition: an option for sustainableactivated sludge process effluent quality.Journal of Industrial Microbiology & Biotechnology (2000) 24, 267-274 HildeLemmer, George Lind, Gerhard Metzner, Lutz Nitschke and Margit Schade Vitaminaddition in biological wastewater treatment Water Science and Technology Volume 37, Issues 4-5, 1998, Pages 395-398 KidderGW, Dewey VC. Studies on the biochemistry of Tetrahymena XIII. B vitamin requirements. Arch Biochem 1949; 21: 66-73. Schormuller J. Vitamins as growth material for bacteria.A comprehensive review.Z LebensmUntersuchung undForschung 1948; 88: 408-36. VoigtMN, Eitenmiller RR, Ware GO.Vitamin analysis by microbial and protozoanorganisms: response to vitaminconcentration, incubation time and assay vessel size.J Food Sci1979; 43: 1418-23. YamadaK, Kawasaki T. Properties of the thiamine transport system in Escherichia coli. J Bact 1980; 141: 254-61. LemmerH, Nitschke L. Vitamin content of four sludge fractions in the activated sludgewaste water treatment process.Water Res 1994; 28: 737-9 LemmerH. Biological additives for waste water treatment-Theory and practice.Munchener Beitrage zur Abwasser-, Fischerei- und Flusbiologie 1992; 46: 254-82. SarfertF, Eikelboom DH, Klein B, Kowalsky H, Lemmer H, Matsche N, Popp W, Reinnarth G, Wagner F. Biological additives in waste watertreatment-bacteria-enzymes-vitamins-algal preparations.Korrespondez Abwasser1990; 7: 793-9.

  Therefore, the present invention provides a low-cost sludge volume reducing agent that enhances microbial activity in the activated sludge in the activated sludge treatment method, and further provides a sludge reduction method that reduces sludge.

  In order to solve the above-described problems, the present invention provides Parachlorella sp. The composition of the sludge reduction method is characterized by adding binos powder that has been cultivated, recovered and dried to sludge, and the Parachlorella sp. Binos secretes alginic acid to the outside of the cell. The sludge reduction method is used, and the Parachlorella sp. The sludge reduction method is characterized in that bios is deposit number FERM ABP-10969. The culture is purely cultured and then concentrated, and the concentrated solution is adjusted to pH 10 and released for 1 to 5 days. The sludge reduction method according to any one of the above, wherein the sludge reduction method is left in a state.

  Moreover, it was set as the structure of the said sludge reduction method characterized by the addition amount of the said binos powder being 20-200g with respect to 1 ton of sludge. In addition, when the amount is less than 20 g per 1 ton of sludge, the effect is lean. On the other hand, even when the amount is more than 200 g, the sludge reduction effect is exerted, but it reaches a peak and the cost increases, which is not preferable.

  In addition, the sludge reduction method according to any one of the above, wherein the alginic acid is an alginic acid oligomer. The alginic acid oligomer has a structure of the sludge reduction method, wherein the total of β-D-mannuronic acid (M) and α-L-guluronic acid (G) is 3 to 10 residues.

  Furthermore, Parachlorella sp. Binos was cultured in an open system, collected, and dried to form a surplus sludge volume reducing agent.

  Since this invention is the said structure, the following effects are exhibited. By using dried and powdered binos grown by photosynthesis, the microflora in the sludge can be optimized, providing a source of vitamins that can activate the activated sludge at a low cost, thereby reducing the activated sludge. become.

It is a transmission electron microscope image (10,000 times) of binos (A) and chlorella (B). It is a comparison table of content of vitamin B group of binos and various samples. It is a differential interference microscope image (400 times) of a binos culture solution. It is a FT-IR (Fourier transform infrared spectrophotometer) measurement result (spectrum) of the cell lysate of a binos culture and sodium alginate (standard goods). It is a result of sludge activation confirmation experiment. It is a microscope image (100 time) of the aeration tank liquid after sludge activation. It is a result of the sludge reduction experiment by binos powder addition. It is a component analysis result of the residual sludge after sludge reduction experiment. It is a DGGE analysis result of an aeration tank. It is a microscope picture of activated sludge at the time of DGGE analysis. It is the result of having investigated the influence with respect to microbial growth of an alginate oligomer. It is explanatory drawing of a sludge reduction mechanism. It is the table | surface which put together the effect | action with respect to the microorganisms of a vitamin B group. It is the ratio of microorganisms that require vitamin B group in activated sludge.

  FIG. 1 is a transmission electron microscope image (10,000 times) of binos (A) and chlorella (B). The term “binos” refers to the photosynthetic green alga Parachlorella sp. Microalgae Parachlorella sp. Binos (hereinafter referred to as “Binos”).

  One of them has already been newly isolated from a factory wastewater treatment plant in Gifu Prefecture by the inventors, and deposited at the National Institute of Advanced Industrial Science and Technology Patent Biological Deposit Center on February 28, 2008. And deposit number FERM ABP-10969. Now available.

  The photosynthetic green algae includes chlorella used as a supplement shown in FIG. 1 (B), botryococcus producing heavy oil, hematococcus known to produce astaxanthin, and the like.

  The FERM ABP-10969 strain isolated by the inventors has an early division time of about 7.8 hours and a very high photosynthetic ability. Moreover, the amount of chlorophyll is contained twice or more per 100 g of dry weight as compared with general chlorella.

  In particular, chlorophyll b is much more (about 8 times) than chlorella, and blue can be used efficiently even in deep water environments and photosynthesis is possible. In addition, a large amount of vitamin B group is metabolized as a metabolite (FIG. 2). In addition, general chlorella has a thick cell wall in the cell outermost layer, but binos is characterized by a very thin cell wall.

FIG. 2 is a comparative table of the contents of vitamin B groups in binos and various samples. Table A is vitamin B ₁ , B is vitamin B ₂ , C is vitamin B ₆ , and D is vitamin B ₁₂ . For binos, an open culture is lyophilized.

  As shown in FIG. 2, the content of the vitamin B group in the dried binos (hereinafter referred to as binos powder) is as follows. The data in FIG. 2 is for the FERM ABP-10969 strain.

Vitamin B ₁ is 585.00 mg / 100 g dried (about 321 times the wheat germ), Vitamin B ₂ is 30.0 mg / 100 g dried (about 17 times that of pork and liver), and Vitamin B ₆ is 475.00 mg / 100 g dried ( about 317 times that of garlic), vitamin _{B 12} is 10,000 [/ dry 100 g (approximately 130 times the Porphyra). Binos has a much higher content of vitamin B group than other samples, and can be said to be extremely effective as a vitamin source.

  FIG. 3 is a differential interference microscopic image (400 ×) of the binos culture solution. As a sample, a culture solution obtained by expanding a pure culture solution of Binos FERM ABP-10969 strain in an open system was used.

The binos culture solution was prepared as follows. Liquid medium: KNO ₃ (2.5 g / L), MgSO ₄ .7H ₂ O (7.5 g / L), KH ₂ PO ₄ (17.5 / L), CaCl ₂ (2.5 g / L), NaCl (2.5 g / L) and NH ₄ H ₂ PO ₄ (20 g / L) in 10 mL portions were added to 940 mL distilled water, 1 drop of 1% (w / v) FeCl ₃ and 2 mL of Arnons A5 solution. After adding and adjusting the pH to 6.5, autoclaving was performed at 121 ° C. for 15 minutes.

  Plate medium: The solid medium was adjusted in the same manner as described above by adding 1.5% (w / v) agar before adjusting the pH of the liquid medium. In addition, various volumes of liquid medium can be appropriately prepared at the above ratio. In addition, LB culture medium is used for the determination of a single colony, it inoculates and it determines by the presence or absence of contamination.

  Culture conditions: For the culture of binos, a pure culture solution of binos or a culture solution in an open system is added as a seed fungus to the above culture solution, and room temperature to 30 ° C., light conditions (minimum 700 Lux, preferably about 2,000-20) About 3,000 Lux, most preferably about 3,000 to 8,000 Lux) under aerobic conditions (such as shaking culture).

  Binos can grow under aerobic conditions in a common medium such as fresh water or LB medium.

  A spherical object surrounded by a circle in FIG. 3 is binos. The part surrounded by a dotted line is a secretion of binos, which is alginic acid (FIG. 4). Innumerable microbial groups (symbiotic microbial groups) can be confirmed in the extract.

  FIG. 4 is a FT-IR (Fourier transform infrared spectrophotometer) measurement result (spectrum) of a cell lysate of a Binos culture and sodium alginate (standard product).

Na ₂ CO ₃ was added at a final concentration of 2% (w / v) to binos (2 g / L) purely cultured in the above liquid medium to lyse the cells. The lysate was centrifuged at 3,000 rpm for 10 minutes, and the supernatant was collected and filtered through a 0.4 μm filter. The residue on the filter was washed with 1N HCl and 1N NaOH and subjected to FT-IR measurement.

  When the spectrum of the binos extract was compared with the spectrum of sodium alginate (standard product), it was revealed that the secretion secreted out of the cell by the binos FERM ABP-10969 strain was alginic acid.

  Alginic acid is a polysaccharide having a molecular weight of 200,000 to 300,000 contained in brown algae and the like, and is a kind of dietary fiber. In addition, red alga coral and some bacteria (such as Azotobacter) are said to produce partially acetated alginic acid, but industrial production by these is still unsuccessful.

  Pure alginic acid is white to pale yellow and takes the form of fibers, granules or powders. Although it is insoluble in water, it is extracted as a soluble salt such as sodium alginate and used for food additives and other purposes.

β-D-mannuronic acid
(M) and its C-5 epimer α-L-guluronic acid
Both of the two types (G) are linear polymers in which monosaccharide blocks having a carboxyl group are (1-4) -linked. The quantity ratio of M and G blocks varies depending on the origin.

A block in which M and G are alternately connected is the most flexible and easily dissolves at a pH close to neutrality. The block composed of G is hard, and the block composed of 6 residues or more forms a three-dimensional gel of a complex complex with a divalent cation (Ca ^2+, etc.).

  The inventors have discovered that alginic acid is biosynthesized for the first time as a green algae in the isolated Binosus FERM ABP-10969 strain, and have already filed a patent application.

  Embodiments of the present invention will be described below in detail with reference to the accompanying drawings.

  FIG. 5 shows the results of a sludge activation confirmation experiment. Weigh 500 mL of activated sludge in the aeration tank, add 10 mg of dry binos powder, and stir at 800 rpm until the DO value (mg / L) is saturated, then change the DO value to 200 rpm. Measurements were taken every 30 minutes. The DO value is a dissolved oxygen concentration.

  As a result, as shown in FIG. 5, by adding binos powder (●), the DO value is drastically reduced 30 minutes after the start of the experiment compared to the control without adding binos powder (■), It can be seen that the respiration rate of microorganisms has doubled. Therefore, it became clear that the microorganism group in activated sludge was activated by the addition of binos powder.

  FIG. 6 is a microscopic image (100 times) of the aeration tank liquid after sludge activation. It is well known that the microorganism group in the sludge is optimized by adding the vitamin B group to the activated sludge (Non-Patent Documents 7 to 13). Therefore, the experimental sample to which the binos powder used in FIG. 5 was added was allowed to stand for 7 days, and changes in the microorganism group were observed.

  As a result, as shown in FIG. 6, only a few protozoa (Rotifer, Paramecium) were confirmed before the addition of binos powder (A), but after addition of Vinos powder (C), the protozoa (Rotifers, Paramecium) was confirmed. The population and type of the population increased. In the treated water, the transparency was improved as compared with the case of no addition of binos powder. Non-patent documents 3 to 5 also report that the quality of treated water is improved by optimizing the microorganism group.

Next, it was investigated whether sludge was reduced by the addition of binos powder. Add 0.3 mg of binos powder to 1 L of sludge in the sludge concentration tank (equivalent to adding 0.02 mg of binos powder to 1 g of sludge), stir with a magnetic stirrer (400 rpm), and measure MLSS every day. . MLSS was measured according to the measurement method of 1997 edition “Sewage test method”, Volume 6, Section 6 [Activated sludge suspended solids]. MLSS (Mixed
“Liquor Suspended Solid” is an activated sludge suspended substance in an aeration tank and is generally expressed by a weight method (mg / L). The results are shown in FIGS.

  FIG. 7 shows the result of sludge reduction experiment by adding binos powder. From the measurement result of MSSL in FIG. 7, it was confirmed that the amount of sludge generated was reduced by about 40% (6th day).

  FIG. 8 is a component analysis result of the remaining sludge after the sludge reduction experiment. The sample on the sixth day in FIG. 7 was subjected to an ignition loss test. The ignition loss test was performed according to JIS K0102 14.5 [ignition loss].

  As a result of the ignition loss test in FIG. 8, the organic material without addition was about 11,000 mg / L, but the organic material was about 5,000 by adding binos powder. It was confirmed that about 55% was decomposed.

Add BINOS powder to activated sludge to determine DGGE (Denaturing)
Gradient Gel Electrophoresis (Gradient Gel Electrophoresis).

(1) Binos culture method (mass culture)
In the above plate medium, a single colony of FERM ABP-10969 strain is picked and cultured on the plate medium under the above conditions. A small amount of the grown FERM ABP-10969 strain was subcultured and grown in 1 to 10 mL of the above-mentioned liquid medium in a test tube, and further subcultured in the same liquid medium (flask) 50 to 1000 times by shaking and cultured. Adjust the culture medium. It takes about 7 days from test tube culture to flask culture.

  Next, the primary culture solution (for example, 200 L) is transplanted into a bath of the above-mentioned liquid medium of about 10 times (2,000 L) and cultured for 7 days under static ground (or convection or aeration) to perform secondary culture. Adjust the liquid.

  Furthermore, the secondary culture solution (2,000 L) is planted in the above-mentioned culture solution tank of about 10 times (20,000 L) and cultured under static conditions (or convection or aeration) for 7 days to prepare a large-scale culture solution. To do.

  Then, the FERM ABP-10969 strain is obtained from the large-scale culture solution by aggregation precipitation. A cationic polymer flocculant was used for the aggregation precipitation. Subsequently, the concentrate is adjusted to pH 10 by adding a NaOH solution or the like to the concentrate. The pH is adjusted to 10 in order to secrete more alginic acid, which is an extracellular secreted polysaccharide.

  The concentrate is then left in an open system for 1 to 5 days, preferably 3 days to obtain a final culture. By culturing in an open system, the falling bacteria assimilate alginic acid, which is a secretion of FERM ABP-10969 strain. Symbiotic bacteria such as Shewanella and Rhizobium have been confirmed. Since the bacterial group that actively produces the above-mentioned vitamin B group is contained in the medium, the accumulated content of vitamin in the culture also increases.

(2) Preparation of binos powder The final culture obtained by culturing as described above is dried by vacuum drying, a spray dryer, a freeze-drying method or the like to obtain binos powder. The obtained binos powder is added to sludge as a sludge activator. Binos powder is effective as a vitamin B source and an alginate source because cells are damaged or crushed by the drying process and the bacterial accumulation is easily eluted.

(3) Addition method to activated sludge In an indoor laboratory, 1 L of aerated tank inflow water (activated sludge) is weighed into a simulated aerated tank with a capacity of 2 L, and aeration is performed so that the DO in the aerated tank is about 1 to 3 mg / L. I went for 7 days. Every 24 hours, 0.02% (w / w) of the binos powder prepared in the above (2) was added to the total activated sludge amount.

Activated sludge fill
The batch and the draw method were used as appropriate. TOC, MLSS, ignition loss, oxygen utilization rate (1997 edition "Sewage test method", first volume, section 10 [Oxygen utilization rate]), and sludge dewaterability were measured.

(4) DGGE analysis DGGE analysis was performed as follows. Take 1 mL of the activated sludge on the fourth day prepared in (3) above into a 1.5 mL centrifuge tube and centrifuge at 1350 rpm for 1 minute to aggregate the sludge. For extraction of DNA from the sludge, ISOPLANT (manufactured by Nippon Gene) was used, and DNA was extracted according to the attached protocol. Thereafter, the DNA solution was adjusted to 0.1 μg / μL, and this was used for the PCR reaction of DGGE analysis. In the PCR reaction, a part of the 16srRNA gene was amplified. The primer sequences used in the PCR reaction are shown below.

Forward (F): cgcccgccgcgcgcggcgggcggggcgggggcacggggggcctacggggaggcagcag
Reverse (R): attaccgcggctggtgg

PCR is Takara
Using ExTaq PCR kit, PCR reaction was performed using a thermal cycler 9700 manufactured by PerkinElmer as per the protocol. PCR cycle was 94 ° C. for 5 minutes → 30 cycles (94 ° C. for 0.5 minutes → 55 ° C. for 0.5 minutes → 72 ° C. for 0.5 minutes) → 72 ° C. for 5 minutes → 10 ° C.

  After confirming that the target gene was amplified by 1% agarose gel electrophoresis, the PCR reaction product was subjected to DGGE analysis using a Biocode Dcode system. The denaturing gel was prepared according to the attached protocol, and the concentration gradient of the denaturing agent was 35-60%. Electrophoresis was performed at 60 V for a minimum of about 10 hours, and then the gel was stained using Cyber Gold (manufactured by Funakoshi). The stained gel was photographed using GBOX (Funakoshi).

  FIG. 9 shows a DGGE analysis result when the binos powder adjusted in (1) is added to the activated sludge. Lane M is a size marker (Nippon Gene Co., Ltd., DGGE Marker I), and Lane 1 is a control, treated product (4) treated with activated sludge without the addition of binos powder. Lane 2 is a treated product (4) after adding binos powder to the same activated sludge as the control.

  The area (A) surrounded by the white line in FIG. 9 is a band of microorganisms specifically applied for by the addition of binos powder. Area (B) is a band of microorganisms in which the number of bacteria is increased by the addition of binos powder. Area (C) is a band of microorganisms in which the number of bacteria is reduced by the addition of binos powder.

  From the results shown in FIG. 9, the addition of binos powder to the sludge confirmed changes in the microflora in the sludge from the molecular biological viewpoint.

  FIG. 10 is a photomicrograph of activated sludge at the time of DGGE analysis (7th day). FIG. 10 (A) is a control without addition of binos powder, and FIGS. 10 (B) and (C) are photographs of the binos powder addition section. As shown in FIG. 10C, by adding binos powder to the sludge, it was possible to confirm the growth of protozoa (such as stag beetles) that prey on filamentous bacteria. In the test, the sludge in the experimental facility was reduced by about 24% (MSSL value).

  FIG. 11 shows the results of examining the influence of alginic acid oligomers on microbial growth. A filamentous cyanobacteria Oscillatoria (hereinafter referred to as “Osilatoria”) was used as a microorganism. The Osilatoria is a typical species that constitutes the blue-green algae that occur in large quantities in eutrophied lakes.

  In the test method, 20 L of sample water was weighed in a test tank (capacity 30 L), and an input test section and a non-input section (control) for binos secretion were provided. The test tank was stirred with a stirrer at 600 rpm, and the number of organisms was measured every day.

  The sample water used for the experiment was sampled from the landing well in Kasumigaura Water Treatment Plant, Ibaraki Prefectural Bureau of Public Works, Minami Waterworks Office. As a method for measuring the number of individuals, 5 μL of sample water was weighed on a Toma hemocytometer, and the number of osillatria and Phormidium was quantified from an average value of 10 repetitions of the entire visual field at a magnification of 200 using an optical microscope.

  (Circle) is a control, (circle) added the alginic acid oligomer secreted from Binos to the 3 mg / L culture medium every day to the culture medium of the same composition as control. Alginic acid secreted by binos contains oligomers.

  As a result of the experiment, in the control {circle around (3)}, the number of solids decreased from 0 to 4 days, and although growth was observed on the 5th day, the number of bacteria rapidly decreased thereafter. On the other hand, in the culture medium ◯ to which the alginic acid oligomer was added, although growth was not observed until the 0th to 5th days, the growth started.

  From this, it became clear that the alginic acid oligomer has an action of promoting microbial growth.

  Therefore, alginic acid secreted by binos such as binos FERM ABP-10969, especially algin oligomers, promotes the growth of symbiotic microorganisms, and biosynthesis of vitamin B group is also carried out in these symbiotic microorganisms, and binos pure culture It is considered that a larger amount of vitamin B group is accumulated in binos powder cultured in an open system than in vitamin B group accumulated in

  The expanded culture in the open system of Binos promotes the growth of microorganisms effective for degrading action in activated sludge by promoting the growth of alginic acid, which is a cell secretion, particularly the effects of alginic acid oligomers, and the effects of vitamin B group, and low cost. Therefore, the effect as an activator of sludge can be expected.

  The sludge reduction method of the present invention makes it possible to reduce sludge discharged from various industries such as sewage treatment plants, food, chemicals, and textile industries, reduce sludge treatment costs, energy, and prevent global warming. it can.

In order to solve the above-described problems, the present invention provides Parachlorella sp. The composition of the sludge reduction method is characterized by adding binos powder that has been cultivated, recovered and dried to sludge, and the Parachlorella sp. Binos secretes alginic acid to the outside of the cell. The sludge reduction method is used, and the Parachlorella sp. The sludge reduction method is characterized in that bios is deposit number FERM BP-10969. The culture is purely cultured and then concentrated, and the concentrated solution is adjusted to pH 10 and released for 1 to 5 days. The sludge reduction method according to any one of the above, wherein the sludge reduction method is left in a state.

One of them has already been newly isolated from a factory wastewater treatment plant in Gifu Prefecture by the inventors, and deposited at the National Institute of Advanced Industrial Science and Technology Patent Biological Deposit Center on February 28, 2008. And deposit number FERM BP-10969 . Now available.

Claims (8)

Parachlorella sp. A sludge reduction method comprising adding binos powder obtained by culturing, recovering and drying binos to sludge. The Parachlorella sp. 2. The sludge reduction method according to claim 1, wherein binos secretes alginic acid outside the cell. The Parachlorella sp. The sludge reduction method according to claim 2, wherein the biono is the deposit number FERM ABP-10969. The culture according to any one of claims 1 to 3, wherein the culture is concentrated after being purely cultured, the concentrated solution is adjusted to pH 10, and left in an open state for 1 to 5 days. Sludge reduction method. The sludge reduction method according to any one of claims 1 to 4, wherein an added amount of the binos powder is 20 to 200 g with respect to 1 ton of sludge. The sludge reduction method according to any one of claims 2 to 5, wherein the alginic acid is an alginic acid oligomer. The sludge reduction method according to claim 6, wherein the alginic acid oligomer has a total of 3 to 10 residues of β-D-mannuronic acid (M) and α-L-guluronic acid (G). Parachlorella sp. A surplus sludge volume reducing agent characterized in that binos are cultured in an open system, collected and dried.