JP2010536363A - Anti-idiotype antibody neutralizing inhibitory activity of inhibitory antibody against C1 domain of factor VIII - Google Patents

Abstract

The present invention relates to an anti-idiotype antibody against a factor VIII inhibitor that binds to the C1 domain of factor VIII, and uses the anti-idiotype monoclonal antibody and the anti-idiotype monoclonal antibody as pharmaceuticals. More specifically, it relates to its use in the manufacture of a medicament for the treatment of hemophilia A.
[Selection] Figure 1

Description

  The present invention relates to a factor VIII inhibitor monoclonal anti-idiotype antibody that binds to the C1 domain of factor VIII, a cell line that produces this monoclonal anti-idiotype antibody, and the use of this monoclonal anti-idiotype antibody as a pharmaceutical. More specifically, it relates to the use of the monoclonal anti-idiotype antibody for the manufacture of a medicament for the treatment of hemophilia A.

Hemophilia A is a genetic disease associated with an abnormality of chromosome X that inhibits blood clotting in a person suffering from the disease.
This disease is the result of a mutation in the gene of a protein involved in blood clotting, that is, factor VIII (also referred to as FVIII) protein, and is caused by the absence of factor VIII in the blood or a partial deficiency thereof. .

Hemophilia A is the most common failure affecting clotting, and in France, the disease occurs in 1 in 5,000 men, accounting for 80% of all hemophilia patients. Yes.
Hemophilia B, another type of hemophilia, accounts for 20% of hemophilia B and is caused by a deficiency in another coagulation factor known as Factor IX.

Currently, treatment for hemophilia (type A and type B) is performed by intravenous injection of a missing or absent factor.
In France, Factor VIII for the treatment of hemophilia is either in the form of blood products provided by Laboratoire Francais du Fractionment et des Biotechnologies (LFB) or international pharmaceutical research institutions, or prepared by genetic engineering methods It is provided in the form of genetically modified drugs.
Preferably, DNA encoding Factor VIII was isolated and expressed in mammalian cells (Wood et al., Nature (1984) 312: 330-337) and its amino acid sequence was deduced from cDNA.

Secreted factor VIII (FVIII) is a glycoprotein with a molecular weight of 300 Kda (consisting of 2332 amino acids) and plays a central role in the activation of the intrinsic clotting pathway.
Inactive factor VIII is divided into six regions, namely, A1 (residues 1-372), A2 (residues 373-740), B (residues 741-1648) from the N-terminus toward the C-terminus. It consists of A3 (residues 1690-2019), C1 (residues 2020-2173), and C2 (residues 2173-2332).
After secretion, Factor VIII reacts with von Willebrand factor (vWF), which protects Factor VIII from plasma proteolytic enzymes.
Factor VIII is separated from vWF when cleaved with thrombin.
This cleavage eliminates the B domain and forms a heterodimer. Factor VIII circulates in plasma in this way.
This dimer is composed of a heavy chain (A1, A2) and a light chain (A3, C1, C2).

When Factor VIII is injected into a hemophilia patient, it binds with von Willebrand factor in the course of the patient's blood circulation.
Activated factor VIII acts as a cofactor for activated factor IX and accelerates the conversion of factor X to activated factor X.
Activated factor X changes prothrombin to thrombin.
Thrombin then converts fibrinogen to fibrin, which causes blood clotting.

The biggest problem with the administration of Factor VIII is the appearance of antibodies against Factor VIII in the patient's body, which is called an “inhibitor”.
These factors neutralize the procoagulant action of Factor VIII, and Factor VIII is neutralized as soon as it is injected.
Thus, the administered clotting factor is destroyed before the bleeding stops, which complicates the situation and invalidates the treatment.
In addition, inhibitors of Factor VIII are formed in some genetically non-hemophilic patients, which is called acquired hemophilia.

Studies have shown that this anti-factor VIII immune response is mostly a polyclonal IgG type belonging to IgG4 and IgG1 subclasses, and rarely IgG2.
The IgG3 subclass is never shown.
This light chain is often referred to as the copper type.
Excessive IgG4 is often seen in hemophilia patients who have long-established inhibitors.
The C2 and A2 domains of the Factor VIII molecule are preferred targets for this immune response, but in some cases antibodies against the A3 domain are also detected.
All anti-factor VIII antibodies can be purified by passing the plasma of hemophilia patients through an immobilized immunosorbent column with factor VIII.
The recovered amount is often 100 μg or more per 10 mg of total IgG (Gilles JG et al. (1933) Blood; 82: 2452-2461).
Animal models have been developed to investigate the formation of factor VIII inhibitors, and rats immunized with human recombinant factor VIII show a rapid immune response of the polyclonal type (Jarvis et al., Thromb Hoemost. 1996 Fed; 75 (2): 318-25).
There are many mechanisms by which anti-factor VIII antibodies interfere with the function of factor VIII: interference with factor VIII proteolytic cleavage, von Willebrand factor (vWF), phospholipid (PL), factor IX, activated factor X ( FXa), or interference with factor VIII interactions with different partners such as APC (activated protein C).

  There are several measures that can mitigate the consequences of this immune response, such as treatment with desmopressin, an artificial hormone that promotes the production of Factor VIII, concentrates of prothrombin complexes and activated For example, a procoagulant such as a concentrated portion of a prothrombin complex, recombinant factor VIIa, plasma exchange, or treatment with a large or moderate amount of factor VIII. However, these treatments are expensive and less effective.

Due to the complexity of in vivo analysis of this immune response, monoclonal antibodies against certain domains of Factor VIII have been isolated by several research teams.
Under such circumstances, a human monoclonal antibody called IgG4 kappa type was isolated.
This antibody is directed against the C1 region of Factor VIII and inhibits the activity of Factor VIII and its binding to von Willebrand factor (Jacquemin et al., (2000) Blood 95: 156-163).
Similarly, a human monoclonal antibody against the C1 domain of factor VIII, called B02C11 (IgG4 kappa), made from a library of memory B cells from hemophilia patients with inhibitors has also been isolated (Jacquemin et al. (2000) Blood 1998 Jul 15; 92 (2): 495-502).
B02C11 identifies the C2 domain of Factor VIII and inhibits its binding to von Willebrand factor and phospholipids.
It completely inhibits the procoagulant activity of native and activated Factor VIII.
Yet another example of a monoclonal antibody is the BOIIB2 antibody directed against the A2 domain of Factor VIII.
This B0IB2 antibody antibody inhibits the activity of Factor VIII by 98%.
By binding to the A2 domain, this antibody interferes with and inhibits FIXa binding.
And since FIXa contains a low-affinity binding site in this region of Factor VIII, therefore, the enzymatic activity of FIXa is inhibited.
The second possible pathway of action is between the dimeric form of Factor VIII (A2: A1 and A3: C1: C2) and the dimeric form of Factor VIII (A2 and A1 and A3: C1: C2) Equilibrium interferes with accelerating the dissociation of the A2 domain of these complexes, causing them to lose their function (Ananyeva NM et al., (2004) Blood Coagul Fibrinolysis. Mar. 15 (2). : 109-24, Review).

With the help of these new tools, a more recent strategic approach to factor VIII inhibitor antibodies is that anti-idiotype antibodies that neutralize the inhibitor antibodies (interacting with variable regions of other antibodies) Have been studied (Sait-Remy JM et al., (1999) Vox Sang; 77 (suppl 1): 21-24).
The mouse anti-idiotype antibody known as 14C12, which is maintained in the document WO 2004/014955, has an inhibitory effect on the factor VIII target antibody (monoclonal antibody BO2C11) in a dose-dependent manner in vivo. To neutralize.
An anti-factor VIII immune response has also been developed using a polyclonal mouse anti-idiotype antibody directed against the A2 domain of factor VIII (also described in patent application FR 05 08320).
The A2 domain is a 43 kD domain whose function has not yet been fully elucidated, but inhibitory antibodies directed against the A2 domain of Factor VIII inhibit the conversion of complex FXase / FX in the transition state (Lollar et al., J Clin Invest. 1994 Jun: 93 (6): 2497-504, Fay et al., J Biol Chem. 1996; 271 (11 ): 6027-6032).

However, since the immune response to Factor VIII is polyclonal, it is therefore suggested that the inhibitory antibody is against a domain different from the A2 and D2 domains.
Indeed, studies of the epitope properties of anti-factor VIII antibodies recognize a limited range of factor VIII molecules, most of these inhibitors are located on the heavy chain A2 domain and / or the light chain C2 domain. However, other epitopes are often recognized.
In fact, some of the plasma from patients contains antibodies that can bind to the C1 domain of the light chain of Factor VIII (Moreau et a., 2000; 95 (11): 3435-441; Jacquemin et al. 2000; 95 (1): 156-162).

  Therefore, there is always a need for further means that allow for neutralization of other inhibitory antibodies of factor VIII in order to more fully neutralize the anti-factor VIII polyclonal response of hemophilia patients. Yes.

  Accordingly, Applicants have sought to develop new means to treat hemophilia A that allows neutralization of inhibitory antibodies directed against the C1 domain of Factor VIII.

  Accordingly, a first object of the present invention is a monoclonal anti-idiotype antibody against a factor VIII human inhibitory antibody, wherein the inhibitory antibody is against the C1 domain of factor VIII, and at least one CDR region of each light chain of the antibody. (Complementarity determining region) is sequence SEQ ID No. 12, Sequence SEQ ID No. 13, and sequence SEQ ID No. 14 comprising a peptide sequence having at least 70% identity to a sequence selected from 14, and at least one CDR region of each heavy chain of the antibody comprises the sequence SEQ ID No. 9, sequence SEQ ID No. 10 and the sequence SEQ ID No. 11. Monoclonal anti-idiotype antibody characterized by having at least 70% identity to a sequence selected from 11.

  The relevant CDR regions are CDR1 and / or CDR2 and / or CDR3.

  Sequence SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12, SEQ ID No. 13, and SEQ ID No. 14 is defined by Kobat [Kobat et al. "Sequence of Proteins of Immunological Interrest", NIH Publication, 91-3242 (1991)].

In one particularly preferred embodiment, the degree of identity of each of the sequences described above is at least 80%, preferably 95%, 95%, 99%, and more preferably 100%.
The percent identity is calculated by aligning the two sequences being compared and counting the number of positions having the same amino acid and dividing this number by the total number of amino acids in that sequence.
In any case, these sequence differences have no effect on the affinity of the monoclonal antibody for its target or its functionality.

“Inhibitory antibody” or “inhibitory factor” of factor VIII is a factor that inhibits all of the clotting activity of factor VIII by binding to it, or part of it, and in particular, its epitope exists on factor VIII. Means anti-factor VIII antibody.
Preferably, the antibody according to the invention is at least 20%, preferably at least 30%, preferably at least 40% of the anticoagulant activity of the inhibitor against the C1 domain of Factor VIII that is the target of the anti-idiotype antibody of the invention, Preferably it has the ability to neutralize at least 50%, preferably at least 60%, and more preferably at least 70%, 80%, 90%, 99%, or 100%.

  The ability of an inhibitory antibody to neutralize clotting inhibitory activity is determined by measuring the activity of Factor VIII in the presence of the inhibitory antibody and anti-idiotype antibody in an assay such as the “Factor VIII Chromogen Test”. . (Jacquemin et al., (1998) Blood 92.494-506).

The expression “anti-idiotype antibody” means an antibody against the variable region of the target inhibitory antibody.
In one particular embodiment of the invention, the anti-idiotype antibody according to the invention is directed to an inhibitory antibody, and the heavy chain variable domain of said antibody is related to germline DP-10.
Such inhibitory antibodies can be derived from humans (eg, sera of patients having inhibitory antibodies), or from mice, horses, goats, non-human primates, etc., factor VIII or fragments obtained from factor VIII, and more specifically C1. It can be obtained by immunization with a fragment containing all or part of the domain.

Preferably, the anti-idiotype antibody target-inhibiting antibody according to the invention recognizes the C1 domain in its native configuration.
Preferably, the anti-idiotype antibody target inhibitory antibody according to the invention does not recognize the same domain of the mutant R2150H.

The monoclonal anti-idiotype antibody according to the present invention may be from humans or from animals.
Furthermore, it can be obtained using various methods.
For example, cells that produce anti-idiotype antibodies can be obtained from peripheral blood lymphocytes of patients with anti-factor VIII inhibitory antibodies or from healthy individuals.
These cells can be immortalized using techniques well known to those skilled in the art and can be selected for their ability to neutralize inhibitory antibodies against factor VIII of the produced anti-idiotype antibody.
Yet another method of making a monoclonal anti-idiotype antibody according to the invention is to inject a factor VIII inhibitory antibody against the C1 domain of factor VIII from an animal, preferably a mouse, and spleen lymphocytes into a myeloma cell line, preferably In this method, a cell culture that is melted together with a mouse myeloma cell line to produce an anti-idiotype antibody against a factor VIII inhibitory antibody is confirmed and cloned.

  In one preferred embodiment of the present invention, each CDR region of the light chain of the anti-idiotype antibody of the present invention has the sequence SEQ ID No. 12, SEQ ID No. 13, and SEQ ID No. Each of the CDR regions of each heavy chain of the antibody is SEQ ID NO. 9, SEQ ID No. 10 and SEQ ID No. 11 and a peptide sequence having a degree of identity of at least 70%.

Therefore, the CDR1 region of each light chain of the antibody of the present invention is Arg Ala Ser Ser Ser Val Tyr Met Asn.
The sequence SEQ ID No. having the amino acid sequence of And the CDR2 region of each light chain of the antibody of the present invention is Ala Thr Ser Asn Leu Ala Ser
SEQ ID NO. The CDR3 region of each light chain of the antibody of the present invention is Gln Gln Trp Ser Ser Pro Pro Met Leu Thr.
The sequence SEQ ID No. having the amino acid sequence of And the CDR1 region of each heavy chain of the antibody of the present invention is Gly Tyr Thr Phe Thr Tyr Tyr Trp Met His
The sequence SEQ ID No. having the amino acid sequence of And the CDR2 region of each heavy chain of the antibody of the present invention is Tyr Ile Asn Pro Thr Ser Gly Tyr Thr Glu Tyr Asn Gln Asn Phe Lys Asp
The sequence SEQ ID No. having the amino acid sequence of And the CDR3 region of each heavy chain of the antibody of the present invention is Ser Gly Ala Tyr Tyr Arg Tyr Asp Asp Ala Met Asp Ser
The sequence SEQ ID No. having the amino acid sequence of 11 and a peptide sequence having a degree of identity of at least 70%.
In one preferred method, the degree of identity of each sequence described above is at least 80%, preferably 90%, 95%, 99%, and more preferably 100%.

Preferably, the variable region of the light chain of a monoclonal anti-idiotypic antibody according to the invention caaattgttc tctcccagtc tccagcaatc ctgtctgcat ctccagggga gaaggtcaca atgacttgca gggccagctc aagtgtaagt tacatgaact ggtatcagca gaagccagga tcctccccca aaccctggat ttatgccaca tccaacctgg cttctggagt ccctgctcgc ttcagtggca gtgggtctgg gacctcttat tctctcacaa tcagcagagt ggaggctgaa gatgctgcca cttattactg ccagcagtgg agtagtaacc cacccatg ct cacgtttcggt gctgggacca agctggagct gaaac
The nucleic acid sequence SEQ ID No. 16 and is encoded expressed by a nucleic acid sequence having at least 70% degree of coincidence, and the variable region of the heavy chain of the monoclonal anti-idiotypic antibody caggtccagc ttcagcagtc tggggctgaa ctggcaaaac ctggggcctc agtgaagatg tcctgcaagg cttctggcta cacctttact acctactgga tgcactggat aaaacagagg cctggacagg atctggaatg gattggatac attaatccta cctctggtta tactgagtac aatcagaact tcaaggacaa ggccacattg actgcagaca aatcctccag cacagcctatac atgcaactga acagccctg ac atctgaggac tctgcagtct atttctgtgtgc aagatcgggg gcctactata ggtacgacga tgctatggac tcctggggtc aaggaacctcccgtccccctg
The nucleic acid sequence SEQ ID No. 15 is encoded by a nucleic acid sequence having at least 70% identity.

  In order to achieve the object of the present invention, for example, the sequence SEQ ID No. 1 and the sequence SEQ ID No. In order to create 2 respectively, the sequence SEQ ID No. 15 and the sequence SEQ ID No. A signal peptide can be added to 16, in which case the signal peptide does not adversely affect the activity or selectivity of the antibody of the present invention.

Nucleic acid sequence SEQ ID No. 1 corresponds to the following nucleic acid sequences:
atgggatgga gctggatctt tctcttcctg ttttcagtaa ctgcaggtgt ccactcccag gtccagcttc agcagtctgg ggctgaactg gcaaaacctg gggcctcagt gaagatgtcc tgcaaggctt ctggctacac ctttactacc tactggatgc actggataaa acagaggcct ggacaggatc tggaatggat tggatacatt aatcctacct ctggttatac tgagtacaat cagaacttca aggacaaggc cacattgact gcagacaaat cctccagcac agcctacatg caactgaaca gcctgacatc tg ggactct gcagtctatt tctgtgcaag atcgggggcc tactataggt acgacgatgc tatggactcc tggggtcaag gaacctcagt caccgtctcc tcag.

Nucleic acid sequence SEQ ID No. 2 corresponds to the following nucleic acid sequences:
atggattttc aggtgcagat tttcagcttc ctgctattca gtgcctcagt cataatgtcc agaggacaaa ttgttctctc ccagtctcca gcaatcctgt ctgcatctcc aggggagaag gtcacaatga cttgcagggc cagctcaagt gtaagttaca tgaactggta tcagcagaag ccaggatcct cccccaaacc ctggatttat gccacatcca acctggcttc tggagtccct gctcgcttca gtggcagtgg gtctgggacc tcttattctc tcacaatcag cagagtggag gctgaagatg ctgccactta tt ctgccag cagtggagta gtaacccacc catgctcacg ttcggtgctg ggaccaagct ggagctgaaa c

In one particularly preferred form, the sequence identity is at least 80%, preferably at least 95% to 99%.
The percent identity is determined by aligning the two sequences to be compared, counting the number of positions containing the same nucleotide, and dividing this number by the total number of nucleotides in that sequence.
The alteration of the genetic code leads to the fact that several triplets of different nucleotides can code for the same amino acid.
In any case, the affinity of the monoclonal anti-idiotype antibody for the target and the ability to neutralize the inhibitory activity of the target inhibitory antibody are not affected at all by the difference in these sequences.

  In one preferred form of the invention, the variable region of each light chain of the monoclonal anti-idiotype antibody comprises the nucleic acid sequence SEQ ID No. 16 and the variable region of each heavy chain of the monoclonal anti-idiotype antibody is SEQ ID NO. 15 is represented by a code.

In one preferred embodiment, the peptide sequence of each variable region of the light chain of the antibody of the invention is
Gln Ile Val Leu Ser Gln Ser Pro Ala Ile Leu Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys Pro Gly Ser Ser Pro Lys Pro Trp Ile Tyr Ala Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Pro Met Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys
SEQ ID No. 2 having the amino acid sequence of A sequence having at least 70%, preferably at least 80% or 90%, and more preferably at least 99% identity to 18.

  In order to achieve the object of the present invention, for example, the sequence SEQ ID No. 3 and the sequence SEQ ID No. 4 is created, the sequence SEQ ID No. 17 and the sequence SEQ ID No. A signal peptide can be added to 18, in which case neither the activity nor the specificity of the antibody of the invention is impaired by such signal peptide.

Preferably, the peptide sequence of each variable region of the heavy chain of the antibody of the present invention is:
Met Gly Trp Ser Trp Ile Phe Leu Phe Leu Phe Ser Val Thr Ala Gly Val His Ser Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Lys Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Thr Tyr Trp Met His Trp Ile Lys Gln Arg Pro Gly Gln Asp Leu Glu Trp Ile Gly Tyr Ile Asn Pro Thr Ser Gly Tyr Thr Glu Tyr Asn Gln Asn Phe Lys Asp Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Asn Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys Ala Arg Ser Gly Ala Tyr Tyr Arg Tyr Asp Ala Met
SEQ ID No. 2 having the amino acid sequence of A sequence having a degree of identity of at least 70%, preferably at least 80% or 90%, and more preferably at least 99% to 3.

The peptide sequence of each light chain of the antibody of the present invention is as follows: Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Phe Ser Ala Ser Val Ile Met Ser Arg Gly Ile S Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys Pro Gly Ser Ser Pro Lys Pro Trp Ile Tyr Ala Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Th r Ile Ser Arg Val Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Pro Met Leu Thr Phe Gly A L The peptide sequence of each heavy chain of the antibody of the present invention is the sequence SEQ ID NO: 4, with at least 70%, preferably at least 80% or 90%, and more preferably at least 99% identity to 4 ID No. A sequence having a degree of identity of at least 70% to 3, and preferably at least 80% or 90%, and more preferably at least 99%.

  Preferably, the peptide sequence of each light chain of the antibody of the invention is SEQ ID NO. 4.

  Preferably, the peptide sequence of each light chain of the antibody of the invention is SEQ ID NO. 3.

Sequence SEQ ID No. The peptide sequence deduced from 16 is the sequence SEQ ID No. 18 and the sequence SEQ ID No. Peptide sequence deduced from 15 Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Lys Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Thr Tyr Trp Met His Trp Ile Lys Gln Arg Pro Gly Gln Asp Leu Glu Trp Ile Gly Tyr Ile Asn Pro Thr Ser Gly Tyr Thr Glu Tyr Asn Gln Asn Phe Lys Asp Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Asn Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe ys Ala Arg Ser Gly Ala Tyr Tyr Arg Tyr Asp Asp Ala Met Asp Ser Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser
SEQ ID No. 2 having the amino acid sequence of 17.
Preferably, each listed variable region of the monoclonal anti-idiotype antibody of the present invention has the peptide sequence SEQ ID No. 18 and the variable region of each heavy chain of the monoclonal anti-idiotype antibody of the present invention has the peptide sequence SEQ ID No. 17.

In a preferred embodiment, the anti-idiotypic antibody target-inhibiting antibody of the present invention was obtained in August 2004 from the University of Ghent, Belgium (address: Technologiepark 297, B-9052 Zwijnaarede, Belgium), Belgian Collaborative Microorganism. / Antibody RHD5 deposited by the Collen Research Foundation under the name LMBP 6165CB in the Plasmid Collection (BCCM / LMBP).
Antibody RHD5 is a human monoclonal IgG1 against factor VIII CI domain produced from lymphocytes originally obtained from hemophilia A, an acquired severe hemophilia patient with high levels of inhibitory factor. It is an antibody.
This antibody belongs to the subclass IgG1, and arises from the germline DP-10.
The epitope recognized by the antibody on Factor VIII is its native C1 domain, but not the same domain with the R2150H mutation.
Antibody RHD5 can inhibit factor VIII activity up to 98%.

The antibodies of the present invention include all modified antibodies having the features of the present invention in which one or more amino acids are substituted or deleted.
Such substitutions or deletions may be anywhere on the molecule.
Where some amino acids are substituted or deleted, any combination of substitutions or deletions can be envisaged.
Such sequence modifications of the variable regions of the antibodies of the invention can be made to increase the number of residues that may be contacted with the anti-idiotype antibodies or target inhibitory antibodies of the invention.

  In one embodiment of the invention, the anti-idiotype antibody is a mouse antibody.

  Preferably, this monoclonal anti-idiotype antibody is an IgG1 kappa.

Preferably, this monoclonal antibody of the present invention is a chimeric antibody.
The expression “chimeric antibody” means that the light and heavy chain variable regions belong to a different species than the light and heavy chain constant regions.
Accordingly, the antibodies of the present invention also include light and heavy chain constant regions belonging to non-mouse species.
In this respect, any non-mouse mammal family or species can be used, such as humans, monkeys, murines (other than mice), wild boars, snakes, horses, felines, canines, and birds Etc. can be used.

  The chimeric antibody of the present invention can be obtained using standard techniques of recombinant DNA well known to those skilled in the art, and more specifically, for example, Morrison et al. , Proc. Natl. Acad. Scie. U. S. A. 81. pp. 6851-55 (1984), and in this case, the alternating heavy chain and / or light chain constant regions derived from mammals other than humans. Recombinant DNA technology is used to replace the with the corresponding region of human immunoglobulin.

In one specific embodiment of the invention, the antibody of the invention is a human hybrid antibody, ie a chimeric antibody whose constant region is human.
This embodiment allows a reduction in the immunogenicity of antibodies in humans, thereby improving their effectiveness in therapeutic administration to humans.

Preferably, the antibody according to the invention is a humanized antibody.
Such an antibody contains one or more CDR regions (complementarity-determining regions) of a monoclonal antibody of a non-human species in a human framework region (a highly conserved portion of a variable region known as a framework). The manufacturing process is known in the prior art (Jones et al., Nature (1996) 321: 522; Reichmann et al., Nature (1988) 332: 323).
A humanized antibody directed to the variable region of an inhibitory antibody that recognizes the C1 region of Factor VIII comprises a human framework region and the sequence SEQ ID No. 9, sequence SEQ ID No. 10, sequence SEQ ID No. 11, sequence SEQ ID No. 12, Sequence SEQ ID No. 13, Sequence SEQ ID No. One or more of the 14 CDR regions may be included.
One of the humanized antibodies according to the present invention is a humanized antibody against the variable region of an inhibitory antibody that recognizes the C1 region of Factor VIII, the CDR region of which is SEQ ID NO. 9, sequence SEQ ID No. 10, sequence SEQ ID No. 11, sequence SEQ ID No. 12, Sequence SEQ ID No. 13, Sequence SEQ ID No. 14 regions.

In one preferred example, the monoclonal anti-idiotypic antibody of the present invention is antibody 18B6 produced by hybridoma 18B6, which is a collection of National Microbial Cultures Collection (NCCM: 25 rue du Doctour Rux, 2424). in Paris Cedex 15) under the registration number CNCM I-3559.
The variable region of each light chain of monoclonal anti-idiotype antibody 18B6 is represented by the nucleic acid sequence SEQ ID No. The variable region of each heavy chain of the monoclonal anti-idiotype antibody 18B6 is encoded by the nucleic acid sequence SEQ ID No. 15 is represented by a code.
Methods for obtaining hybridoma 18B6 are described in the Examples section of this specification.

The monoclonal anti-idiotype antibody of the present invention means all antibodies including a fragment of antibody 18B6, and more specifically includes the variable region of the light chain of antibody 18B6 and / or the variable region of the heavy chain of antibody 18B6. It also means all antibodies, as well as antibodies comprising fragments of either the light chain variable region and / or the heavy chain variable region of antibody 18B6.
The expression “fragment” means an F (ab ′) 12 fragment, an Fab ′ fragment, an Fab fragment, a CDR region, or a modified version of these fragments or regions.

In one specific embodiment of the present invention, the monoclonal anti-idiotype antibody of the present invention has an F (ab ′) 12 fragment, Fab ′ fragment, Fab fragment, CDR region, or modified fragments or regions thereof. Is.
Enzymatic digestion of immunoglobulins with papain gives two identical fragments, a fragment called “Fab fragment” (fragment antigen binding) and an Fc fragment (crystallizable portion). Fc fragments are the basis of immunoglobulin effector functions.

Pepsin digestion is used to generate an F (ab ′) 2 fragment in which both fragments remain linked by disulfide bonds and split this Fc fragment into several peptides.
The F (ab ′) 2 fragment is formed by two Fab ′ fragments (one Fab ′ fragment composed of Fab and hinge region), and F) is joined by an interstitial disulfide bond to form ab ′) 2. Is done.

These fragments, including antibody binding sites, may have lost some of the attributes of the original intact antibody from which they originate, such as the ability to activate complements or bind Fc gamma receptors. Absent.
However, these fragments have not lost the ability of the original antibody to neutralize the inhibitory antibody.
Accordingly, the present invention includes within its scope the F (ab ′) 12, Fab ′, Fab fragment of the antibody 18B6, or CDR regions and modified fragments or regions thereof.
In particular, these fragments retain the ability of the original antibody to neutralize the RHD5 antibody.

Yet another object of the present invention is to provide a stable cell line that produces antibodies as described above.
Such a stable cell line of the present invention may be derived from either human or animal origin.
The stable cell lines of the present invention can be generated from human immortalized cells.
In yet another embodiment of the invention, the cell line may have been created from immortalized cells from an animal such as a mouse.
One preferred example of a cell line obtained with this embodiment of the invention is strain 18B6, which has been deposited with the CNCM under the number I-3559.
In yet another embodiment, the stable cell line of the present invention is a strain in which a gene construct for expressing the antibody of the present invention is incorporated at a desired site of the gene.
The step to obtain such cells is stable transfection.
This step can be applied to any type of cell as long as it can be maintained in an in vitro culture.
In order to perform stable transfection, integration of the gene construct is necessary, which can be performed by homologous recombination or randomly.
The presence of a positive selection cassette in the gene construct containing the gene of interest that confers antibiotic resistance to the cell indicates, for example, the insertion of the transgene into the cell genome.
As a result of the sub-cloning step, a production cell that can be used for a long time can be obtained from the antibody of the present invention, such as 18B6, and this cell can be stored in vitro.

  This stable cell line expressing the antibody of the present invention may be a human cell line, a rodent, eg, a cell line such as a mouse, a human myeloma such as SP2 / 0, YB2 / 0, IR983F, Namalwa, or other For example, human-derived cell lines such as PERC6, and CHO cell lines, namely CHO-K-1, CHO-Lec10, CHO-Lec1, CHO-Lec13, CHO Pro-5, CHO dhfr- (CHO DX B11, CHO DG44). Or, in addition, select from cell lines selected from Wil-2, Jurkat, Vero, Molt-4, COS-7, 293-HEK, BHK, K6H6, NE0, SP2 / 0-Ag14, and P3X63AbB8-653 be able to.

Yet another embodiment of the present invention is the hybridoma 18B6 deposited at the National Collection of Cultures (NCCM) under the registration number CNCM I-3559.
The variable region of each light chain of the monoclonal anti-idiotype antibody produced by this hybridoma 18B6 has the nucleic acid sequence SEQ ID No. The variable region of each heavy chain of the monoclonal anti-idiotypic antibody encoded by 16 and produced by hybridoma 18B6 is represented by the nucleic acid sequence SEQ ID No. 15 is represented by a code.
The antibody produced by this hybridoma 18B6 is antibody 18B6, and the method for obtaining hybridoma 18B6 is described in the “Examples” section of this specification.

Yet another subject matter of the present invention is the sequence SEQ ID No. 4, which codes for the variable region of the heavy chain of the antibody of the present invention as described above. 15 DNA fragments.
This DNA fragment can preferably be introduced and retained in a vector that allows expression of the antibody polypeptide.
The variable region of the heavy chain of the antibody has the nucleic acid sequence SEQ ID No. The peptide sequence expressed and derived therefrom is SEQ ID NO. 17.
This vector allows the expression of this foreign nucleic acid fragment in a host cell because it contains the sequences necessary for this expression (promoter, polyadenyl or sequence, selection gene).
Such vectors are well known to those skilled in the art and may be adenoviruses, retroviruses, plasmids, or bacterial phages.
Furthermore, any mammalian cell can be used as a host cell, that is, a cell capable of expressing the above-described polypeptide or the antibody according to the present invention. Examples of these cells include SP2 / 0, YB2 / 0, IR983F, Human myeloma such as Mawarwa, other human-derived cells such as PERC6, cell line CHO, ie CHO-K-1, CHO-Lec10, CHO-Lec1, CHO-Lec13, CHO Pro-5, CHO dhfr-, Wil-2, Jurkat, Vero, Molt-4, COS-7, 293-HEK, BHK, K6H6, NS0, SP2 / 0-Ag14 and P3X63Ag8-653.

Yet another object of the present invention is to provide the sequence SEQ ID No. 1 encoding the light chain variable region of the antibody of the present invention as described above. There are 16 DNA fragments.
This DNA fragment is preferably inserted into a vector that allows expression of the peptide of the antibody and can be introduced and retained in the host cell.
The variable region of the light chain of the antibody has the nucleic acid sequence SEQ ID No. 16 and its deduced peptide sequence is SEQ ID NO. 18.
Since this vector contains sequences essential for its expression (promoter, polyadenylation sequence, selection gene), this foreign nucleic acid fragment can be expressed.
Such vectors are well known to those skilled in the art and include, but are not limited to, adenoviruses, retroviruses, plasmids, or bacteriophages.
Furthermore, any mammalian cell can be used as a host cell, that is, a cell that expresses the polypeptide of the present invention. Examples of these cells include SP2 / 0, YB2 / 0, IR983F, and Mawalwa. Human myeloma, other human-derived cells such as PERC6, cell line CHO, ie CHO-K-1, CHO-Lec10, CHO-Lec1, CHO-Lec13, CHO Pro-5, CHO dhfr-, Wil-2 Jurkat, Vero, Molt-4, COS-7, 293-HEK, BHK, K6H6, NS0, SP2 / 0-Ag14 and P3X63Ag8-653.

Yet another object of the present invention is to provide a pharmaceutical composition comprising an antibody of the present invention and at least one excipient and / or one inexpensively acceptable base.
Preferably, the monoclonal anti-idiotype antibody contained in the pharmaceutical composition of the present invention is a fragment of antibody 18B6, 18B6 or one region thereof, or contains the variable region or CDR of 18B6, and is used herein. This also applies to chimeric or humanized antibodies as described in.
The pharmaceutical composition of the present invention can be formulated in any excipient acceptable to the patient being treated.
Such excipients include water, saline solution, Ringer's solution, dextrose solution, and other suitable aqueous physiological fluids.
These excipients may contain minor amounts of additives to increase the isotonicity and stability of the composition.
Such excipients include phosphate buffer, bicarbonate buffer, and Tris buffer.
Such excipients are well known to those skilled in the art.
Standard formulations are either injectable liquids or solid formulations that can be resuspended in a suitable liquid prior to administration.
Substrates commonly used to make the pharmaceutical compositions of the present invention have functions to increase the half-life of the therapeutic composition in animals and patients and to control the release of active ingredients.
Such a base material may be organic or inorganic, and a compound or liposome capable of distributing a pharmaceutical ingredient at a certain ratio or distributing a pharmaceutical ingredient only in a certain environment. Can also be used for that purpose.

Preferably, the pharmaceutical composition of the present invention further comprises at least one anti-idiotype antibody to an inhibitory antibody that binds to a domain different from the C1 domain of Factor VIII.
This antibody may be an anti-idiotype antibody against an inhibitory antibody that binds to the A1, A3, or B, A2, or C2 domains of Factor VIII.
Indeed, patients suffering from hemophilia A and generating inhibitory antibodies most often exhibit several types of inhibitory antibodies.
Furthermore, the amount and nature of these different types of inhibitory antibodies are not constant and show changes throughout the life of the patient.
These different inhibitory antibodies found in the same patient are therefore directed to different domains of Factor VIII, thus treating patients with multiple types of anti-idiotype antibodies rather than just one directed against different inhibitory antibodies. It is very suitable for treatment.

Preferably, the pharmaceutical composition comprises a monoclonal anti-idiotype antibody directed against an inhibitory antibody that binds to the C2 domain of Factor VIII and / or an inhibitory antibody that binds to the A2 domain of Factor VIII, and a monoclonal antibody according to the invention. Contains.
Indeed, the A2 and C2 domains are major targets for anti-factor VIII immune responses.
Accordingly, a pharmaceutical composition comprising a mixture of an anti-idiotype antibody directed against an inhibitory antibody that binds to the C1 domain of Factor VIII and an anti-idiotype antibody directed against an inhibitory antibody that binds to the C2 domain is provided in a patient's body. Neutralize at least 70%, preferably at least 80% or 90% of all inhibitory antibodies present in
In a preferred embodiment of the invention, this pharmaceutical composition according to the invention comprises antibody 14C13 (deposited with the Belgian Collaborative Microbial Collection under the registration number LMBP5878CB) and / or antibody 30D1 (deposit with the CNCM under the registration number I-3450). Contains.
In yet another embodiment of the invention, the pharmaceutical composition is chimeric or humanized from the chimeric antibody 14C12 and / or antibody 30D1, deposited with the CNCM under the registered cancer number I-3510. Antibody, that is, an antibody containing the variable region of antibody 30D1.

  Yet another object of the present invention is to use the present invention as a medicament.

Yet another object of the present invention is to use the antibody of the present invention for the manufacture of a medicament.
Preferably, such medicaments are used to reduce, prevent or treat hemorrhage in hemophilia patients due to an inhibitory antibody against the C1 domain of Factor VIII.

  Yet another object of the present invention is to use the antibodies of the present invention for the manufacture of a medicament directed to the treatment of type A hemophilia.

Preferably, hemophilia A treated in this way is hemophilia caused by an inhibitory factor.
This type of hemophilia treated with the antibodies of the present invention can be congenital or acquired.
By neutralizing the inhibitory antibody, the antibodies of the invention enable treatment by infusion of Factor VIII to the patient.
This is because the activity of Factor VIII is not inhibited by the inhibitory antibody.

Yet another object of the present invention is the use of an antibody according to the present invention to neutralize the in vitro or in vivo inhibitory activity of an inhibitory antibody against the C1 domain of Factor VIII.
This process can be performed by depleting inhibitory antibodies against the C1 domain of Factor VIII from the patient's blood and reinjecting the blood into the patient.

  Yet another object of the present invention relates to a medicinal product with an antibody according to the present invention, preferably antibody 18B6.

  Yet another object of the present invention is to use the antibody to absorb the inhibitory antibody, eg, to produce a Factor VIII inhibitory antibody.

Finally, another object of the present invention is to use the antibodies according to the present invention for detecting and / or generating factor VIII inhibitory antibodies.
The general processes for carrying out such detection and purification methods are well known to those skilled in the art.
An example is the use of an immunopurification column comprising beads with the antibody of the present invention implanted on its surface.
Only molecules recognized by the antibody will stick to the bead. Other molecules pass through the column.
To recover the molecule, it is sufficient to increase the ionic strength of the solution.

  Further aspects and advantages of the invention are set forth in the following examples, which are intended to illustrate the invention and are not intended to limit the invention.

Therefore, the present invention eliminates the above-mentioned inconveniences.
In a monoclonal anti-idiotype antibody against a Factor VIII human inhibitory antibody,
The inhibitory antibody is directed against the C1 domain of Factor VIII,
At least one CDR region (complementarity determining region) of each light chain of the antibody is represented by the sequence SEQ ID No. 12, Sequence SEQ ID No. 13, and sequence SEQ ID No. A peptide sequence having at least 70% identity to a sequence selected from 14,
And
At least one CDR region of each heavy chain of the antibody is represented by the sequence SEQ ID No. 9, sequence SEQ ID No. 10 and the sequence SEQ ID No. It is characterized by having at least 70% identity to a sequence selected from 11.
Also,
In a monoclonal anti-idiotype antibody against a Factor VIII human inhibitory antibody,
The inhibitory antibody is directed to the C1 region of Factor VIII produced by hybridoma 18B6 deposited under the number CNCM I-3559 in the Collection Nationale de Cultures de Microorganisms (CNCM). Features.

  This invention relates to a monoclonal anti-idiotype antibody against a factor VIII human inhibitory antibody, wherein the inhibitory antibody is against the C1 domain of factor VIII, and at least one CDR region (complementarity determining region) of each light chain of the antibody is present. Sequence SEQ ID No. 12, Sequence SEQ ID No. 13, and sequence SEQ ID No. 14 comprising a peptide sequence having at least 70% identity to a sequence selected from 14, and at least one CDR region of each heavy chain of the antibody comprises the sequence SEQ ID No. 9, sequence SEQ ID No. 10 and the sequence SEQ ID No. It is to obtain a monoclonal anti-idiotype antibody having at least 70% identity to a sequence selected from 11.

FIG. 1 is a graph showing increased binding (mean value) of anti-idiotype antibodies to RHD5 in 4 mice. (Example) FIG. 2 is a view showing a state in which the anti-idiotype antibody is directly bound to the insolubilized alternation RHD5. (Example) FIG. 3 shows inhibition of binding of antibody RHD5 to insolubilized recombinant factor VIII. (Example) FIG. 4 is a diagram showing neutralization of RHD5 by 18B6. (Example)

  Embodiments of the present invention will be described below in detail with reference to the drawings.

Example 1: Preparation of human monoclonal antibody <anti-C1 antibody> against C1 region of Factor VIII

  Document Jacquemin et al. (1998), Blood 92, 496-506 and patent WO2005 / 016455, by immortalizing B lymphocytes of patients suffering from hemophilia A showing an immune response to factor VIII by Human lymphoblastoid cells described in 1) were obtained.

  A cell line producing monoclonal anti-C1 RHD5 antibody was obtained in August 2004 from the University of Ghent, Belgium (Address: Technologiepark 297, B-9052 Zwijnaarede, Belgium), the Belgian Collaborative Microorganism / Plasmid Collection ( The Collen Research Foundation was deposited with BCCM / LMBP) under the registration number LMBP 6165CB.

RHD5 nucleic acid sequence of the variable region of an antibody heavy chain atggactgga cctggaggtt cctctttgtg gtggcagcag ctgcaggtgt ccagtcccag gtgcagctgg tgcagtctgg ggctgaggtg aagaagcccg ggtcgtcggt gatggtctcc tgcaaggctt ctggaggcac cttcagcagc tttggtatca gctgggtgcg acaggcccct ggacaagggc ttgagtgggt gggagggatc atccctatct ttggtacagc aaacaccgca cggaacttcc agaatagagt caccattacc gcggacgaat tcacgagcac agcctacata cga tgagga gcctgagatc tgaagatacg gccgtgtatt actgtgtcgg cggtcgagat gcctacagct ttgatggttt tgatgtctgg ggccaaggga caatggtcac cgtctcttca g
SEQ ID No. having the nucleic acid sequence of 5, the nucleic acid sequence of the variable region of the light chain of RHD5 antibody atggcatgga tccctctctt cctcggcgtc cttgtttact gcacaggatc cgtggcctcc tctgggctga ctcagccaca ctcagtgtcc gtgtccccag gacagacagc caacatcacc tgctctagag ataagttggg tcataaattt gcttcctggt atcaacagaa gccaggccag tcccctgctc ttctcatcta tcaagacagc aagcggccct cagggatccc tgagcgattc tctggctcca actctgggaa cacagccact ctgaccatca gcgggaccca ggctatggat aggctgact attactgtca ggcgtgggac aacaccactg ccgtattcgg cggagggacc aagttgacag tcctaagtca gccca
SEQ ID No. having the nucleic acid sequence of 6.
Sequence SEQ ID No. The peptide sequence corresponding to 5 is Met Asp Trp Thr Trp Arg Phe Leu Phe Val Val Ala Ala Ala Ala Gly Val Gin Ser Gln Val Gln Leu Val Gln Ser Ser Gly Gly Thr Phe Ser Ser Phe Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Val Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Thr Ala Arg Asn Phe Gln Asn Arg Val Thr Ile Thr Ala Asp Glu Phe Thr Ser hr Ala Tyr Ile Arg Leu Arg Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Val Gly Gly Arg Asp Ala Tyr Ser Phe Asp Gly Phe Asp Val Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser
SEQ ID No. having the nucleic acid sequence of 7 and the sequence SEQ ID No. Peptide sequence corresponding to 6 is Met Ala Trp Ile Pro Leu Phe Leu Gly Val Leu Val Tyr Cys Thr Gly Ser Val Al Ala Ser Ser Gly LeV Thr Gr Asp Lys Leu Gly His Lys Phe Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Ala Leu Leu Ile Tyr Gln Asp Ser Lys Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly Thr ln Ala Met Asp Glu Ala Asp Tyr Tyr Cys Gln Ala Trp Asp Asn Thr Thr Ala Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Ser Gln Pro
SEQ ID No. having the nucleic acid sequence of 8.

Optionally, antibodies that exhibit the required attributes can be produced by immortalizing animal cells.
In this case, human factor VIII is injected into the mouse together with the adjuvant.
Monoclonal anti-human antibodies can be obtained by melting spleen lymphocytes with a mouse myeloma cell line.
The cell supernatant that produces this anti-factor VIII antibody is identified and cloned at limited dilution.
A general description of these methods can be found in Current Protocols in Immunology, Chapter 2, John Wiley & Sons, Inc. Seen in 1994.
Further selection of inhibitors that exhibit desirable attributes is described below.

Example 2: Preparation of anti-idiotype antibody 18B6

I. Immortalization of mouse cells

  Four 6 week old Balb / c female mice were suspended in Freund's adjuvant (ACF) with the human anti-C1 domain of Factor VIII RHD5 antibody (primary immunization) and then incomplete Freund's adjuvant (AIF) 10 μg of the suspension suspended in (3) was injected subcutaneously into the leg pad three times.

Prior to immunization, the first round of phlebotomy (0 phlebotomy) was performed (0 day of phlebotomy (D0)), and then injection and phlebotomy were performed as follows.
D1: Injection No1 (10 μg RDH5 in the presence of complete Freund's adjuvant)
D15: phlebotomy No1
D16: Injection No2 (10 μg RDH5 in the presence of incomplete Freund's adjuvant)
D28: phlebotomy No2
D29: Injection No3 (10 μg RDH5 in the presence of incomplete Freund's adjuvant)
D44: Hemorrhagic No3

II. Evaluation of immune responses in mice

To assess the presence of anti-RHD5 antibodies at different phlebotomy, a direct binding ELISA assay was performed.
For this purpose, RHD5 antibody or 13 μg of IgG dissolved in 1 ml for comparison was insoluble, and cultured at a temperature of 4 ° C. overnight in glycine buffer at a rate of 50 μl per well (glycine buffer = 0 .1M glycine, 0.17M NaCl, pH 9.2).
Thereafter, the phlebotomized blood was diluted 1/10, 1/100, 1/1000, and 1/10000 in magic buffer and cultured at room temperature for 2 hours (50 μl per well).
Then, 3 washes were performed in PBS / Tween solution.
Thereafter, the reaction system was treated with 1 μg / ml solution of goat polyclonal mouse anti-igG antibody (Bio-Rad) labeled with HRP (horseradish peroxidase) at room temperature for 2 hours (50 μl per well) (magic buffer). Diluted with liquid) and cultured.
Then, the reaction system was washed three times with PBS / Tween solution, revealed with a chromogen (ortho-phenyl diamine), and the obtained coloring degree was obtained with a filter corresponding to a wavelength of 490/650 nm. Read with a reader (leader: Emax Molecular Devices, Sunnyvale, CA).

The obtained results are shown in FIG.
Conclusion: Each mouse responded correctly to the RHD5 Fab fragment injection and showed a similar response.
Mouse No. 4 was selected and melted.

III. Melting and screening

Mouse No. Four spleen lymphocytes and myeloma SP2 / 0 cells were melted.
Melting is a method well known to those skilled in the art (J. G. Gilles et al., Blood (2004) 103: 2617-23; P. Corneis, << Lesanticorps monoclonalux >>, Revue IRE, vol. 7, N "4. 1983).

  These cells were continuously expanded in DMEM broth containing hypoxanthine and thymidine (Dulbecco's modified Eagle broth) according to the principle of limiting dilution and tested positive in a direct binding ELISA assay as described in II. A clone was detected.

  Specificity of binding was confirmed by insolubilizing human IgG1 made in a laboratory with inappropriate properties.

  In order to determine the stability of the hybridoma, an epitope screening test (test 1-3) was performed in different volumes of medium from 200 μl to 5 ml during clonal expansion.

Test 1 = measurement in 200 μl well Test 2 = measurement in 1 ml well Test 3 = measurement in 5 ml well

The results obtained during the different epitope screens are shown in the following table.

IV. Inhibition assay in culture supernatant

As shown in Table 3, inhibition tests were performed using culture supernatants.
This assay was performed to select anti-idiotypic antibodies from the clones that correctly recognize epitope determinants located at the paratope level of RHD5 Ab.

  These anti-idiotype antibodies were tested for inhibition of RHD5 binding to insolubilized Factor VIII in an ELISA assay.

Recombinant factor VIII (recFVIII) (Baxter) dissolved in glycine buffer at 2 μg / ml was put in an amount of 50 μl per well, insolubilized, and left at room temperature for 2 hours.
RHD5 antibody (or irrelevant IgG1) was adjusted to a final concentration of 0.6 μg / ml and diluted 1/1, 1/2, and 1/4 in Magic Buffer.
These wells were washed 3 times with PBS / Tween buffer, and then magic buffer was added at a rate of 100 μl per well to saturate (30 minutes at room temperature).
Thereafter, this culture supernatant was cultured with 50 μl of RHD5 (or irrelevant IgG1) (2 hours at room temperature using magic buffer) and washed three times.
An antibody solution labeled with mouse polyclonal human anti-IgG HRP (Southern Biotechnology), in which RHD5 antibody bound to insolubilized recFVIII was dissolved in magic buffer at a rate of 1 μg / ml, was in a volume of 50 μl per well. Detected by putting.
These successive washes were performed with PBS / Tween solution.
The color intensity obtained by using a reader (leader: Emax Molecular Devices, Sunnyvale, Calif.) Having a filter corresponding to a wavelength of 490/650 nm, which is manifested using a chromogen (OPD ortho-phenyl diamine). Was read.

Conclusion As shown in Table 3, the clones can specifically inhibit RHD5 from binding to insolubilized recFVIII.
(A negative number indicates the possibility of binding to the outer region of the paratope, or an insufficient Ab concentration in the culture supernatant. However, a positive number is negative from the following test. Wells were excluded.)

V. Functional test using supernatant culture solution: Measurement of neutralization of RHD5 antibody inhibitory activity (anti-factor VIII)

Using the supernatants of various clones selected during the inhibition test for RHD5 antibody (diluted 3-fold, 6-fold, 12-fold and 24-fold) in Magic buffer at a temperature of 37 ° C. The cells were cultured at a concentration of 1 μg / ml. After 30 minutes, FVIII cognate (Bayer) was added at a final concentration of 0.5 U / ml, and supplemental culture was performed at a temperature of 30 ° C. for 30 minutes.
These samples were diluted 30-fold in Magic Buffer and a chromogenic DADE test (Factor VIII chromogenic, Dade Bering GmbH, Marburg, Germany) was added according to the manufacturer's instructions.

As shown in Table 3, 10 clones were able to neutralize the inhibitory activity of the RHD5 antibody.
Antibody 18B6 was chosen and experimental results and neutralization curves are shown below.

VI. Mass production of selected 18B6 anti-RHD5 clones

Anti-idiotype antibody 18B6 was made in DMEM culture medium.
Thereafter, the protein was purified on a protein G affinity column (this column enables the purification and concentration of the antibody and at the same time the confirmation of the specificity of the obtained anti-idiotype antibody).

VII. Specificity evaluation

  Various formulations were evaluated in an ELISA test following the same procedure as described in II and IV.

  1. ELISA assay: direct binding of anti-idiotype antibody 18B6 to insolubilized antibody RHD5

The direct binding of anti-idiotype antibody 18B6 to insolubilized antibody RHD5 is shown in FIG.
The curve shows that the binding of antibody 18B6 to RHD6 is dose dependent.

  2. ELISA assay: Inhibition of antibody RHD5 binding to insolubilized recombinant FVIII

Inhibition of binding of RHD5 to insolubilized recombinant FVIII was measured according to the procedure described in IV.
The concentration of RHD5 used was 2 μg / ml.

The results are shown in FIG.
When the RHD5: 18B6 molar ratio was 2.5, RHD5 binding to FVIII was inhibited by 50%.

  3. Functional test: Measurement of neutralization of RHD5 antibody inhibitory activity (anti-FVIII)

  The procedure is as described in V. The final concentration of RHD5 is 0.4 μg / ml, and the purified anti-idiotype antibody with a final concentration in the range of 4 to 0.002 μg / ml is shown as a curve.

These results are shown in Table 5 below.

The results are shown in FIG.
When the molar concentrations of RHD5 and 18B6 were equal, the inhibitory activity of RHD5 was inhibited by 50%.

4). The binding kinetics of the anti-idiotype antibody 18B6 to the inhibitor RHD5 was evaluated by the “surface plasmon resonance biocore” method using Pharmacia Biosensor BIAcore (Pharmacia Biosensor AB, Uppsala, Sweden).
RHD5 antibody was immobilized on the activated surface of the CM5 probe. Anti-idiotype antibody 18B6 was injected into RHD5 of various dark roads immobilized on the probe.
Binding and dissociation constants were determined.

Ka (M-1S-1) = 4,26 × 103
Kd (S-1) = 1.45 x 10-5
KD: M.M. 3.4 x 10-9

  5. Characterization of anti-idiotype antibody 18B6 subclass

To determine the subclass of antibody 18B6, the Roche IsoStripe system was used (colorimetric strip).
As a result, it was confirmed that antibody 18B6 was an IgG1 kappa.

VIII. Sequence of antibody 18B6

For sequencing, the hybridoma mRNA that produced the anti-idiotype antibody 18B6 was isolated using the Quick Prep Micro mRNA Purification kit (Amersham Pharmacia Biotech, Uppsala, Sweden).
CDNA was synthesized using a First-strand cDNA Synthesis kit (Amersham Pharmacia Biotech).
CDNAs encoding heavy chain (Vh) and light chain (VL) were amplified by PCR (polymerase chain reaction) using primers corresponding to various families of genes that could be found in mice.
Products from PCR were isolated from 1.5% agarose gel using the QIA quick Gel Extraction kit (Qiagon, Hilden, Germany) and cloned using the pGEM-T Easy Vector system (Promega, Madison, WI) did.
Positive colony plasmid DNA was isolated using the High Pure Plasmid Isolation kit (Roche Diagnostics, Mannheim, Germany) and sequenced in both directions using Sequenase (US Biochemical, Cleveland, OH).

IX. Special attributes of 18B6 antibody

Antibody 18B6 completely inhibits the binding of RHD5 antibody to its antigen, factor VIII.
RHD5 antibody has an idiotype complementary to that of 18B6.

  The antibody's binding to its antigen involves a 6-12 Angstrom reciprocal recognition interface corresponding to a number of amino acids linked together by hydrogen bonds, ie, Vanderwals bridges linked together by hydrophobic or polar attraction and Is involved.

  At the functional level, if one antibody completely inhibits the binding of an antibody to its antigen, it will cause the inhibitory antibody to have an “internal image” of the antigen, a three-dimensional structure that mimics the three-dimensional structure of the antigen It is suggested that you have.

  The primary structure (amino acid sequence) of the 18B6 antibody has a low degree of coincidence with the C1 domain of Factor VIII, but is consistent with the secondary structure of the 18B6 antibody and the antigenic target of the RHD5 antibody and the C1 domain of Factor VIII. And 18B6 3D modeling suggests that the variable part of the 18B6 light chain (VL) shows an internal image of the C1 domain, overlapping with the 3D structure of the C1 domain.

These observations indicate that the 18B6 antibody has unique, new, and previously unforeseen attributes.
In other words, any attempt to create an antibody similar to 18B6 by immunization with an antibody such as RHD5 cannot produce the same real antibody as 18B6.

Claims (29)

In a monoclonal anti-idiotype antibody against a Factor VIII human inhibitory antibody,
The inhibitory antibody is directed against the C1 domain of Factor VIII,
At least one CDR region (complementarity determining region) of each light chain of the antibody is represented by the sequence SEQ ID No. 12, Sequence SEQ ID No. 13, and sequence SEQ ID No. A peptide sequence having at least 70% identity to a sequence selected from 14,
And
At least one CDR region of each heavy chain of the antibody is represented by the sequence SEQ ID No. 9, sequence SEQ ID No. 10 and the sequence SEQ ID No. 11. An anti-idiotypic antibody that neutralizes the inhibitory activity of an inhibitory antibody against the C1 domain of Factor VIII, characterized in that it has at least 70% identity to a sequence selected from 11. The antibody of claim 1, wherein
Each CDR region of each light chain of the antibody is represented by the sequence SEQ ID No. 12, Sequence SEQ ID No. 13, and sequence SEQ ID No. Each comprising a peptide sequence having at least 70% identity to 14,
Each heavy chain of the above antibody has the sequence SEQ ID No. 9, sequence SEQ ID No. 10 and the sequence SEQ ID No. An anti-idiotype antibody that neutralizes the inhibitory activity of an inhibitory antibody against the C1 domain of Factor VIII, each having at least 70% identity to 11 The antibody according to claim 1 or 2,
The variable region of each light chain of the antibody is
Nucleic acid sequence SEQ ID No. Encoded by a nucleic acid sequence having at least 70% identity to 16;
The variable region of each heavy chain of the antibody is
Nucleic acid sequence SEQ ID No. An anti-idiotype antibody that neutralizes the inhibitory activity of an inhibitory antibody against the C1 domain of Factor VIII, characterized in that it is encoded by a nucleic acid sequence having at least 70% identity to 15. The antibody according to any one of the preceding claims,
The variable region of each light chain of the antibody is represented by the nucleic acid sequence SEQ ID No. 16 is expressed as a code,
The variable region of each heavy chain of the above antibody is represented by the nucleic acid sequence SEQ ID No. 15. An anti-idiotype antibody that neutralizes the inhibitory activity of an inhibitory antibody against the C1 domain of Factor VIII, characterized in that The antibody according to any one of the preceding claims,
The peptide sequence of the variable region of each light chain is represented by the sequence SEQ ID No. A sequence showing at least 70% identity with 18;
The peptide sequence of the variable region of each heavy chain is represented by the sequence SEQ ID No. An anti-idiotype antibody that neutralizes the inhibitory activity of an inhibitory antibody against the C1 domain of Factor VIII, characterized in that the sequence exhibits at least 70% identity to 17. The antibody according to any one of the preceding claims,
Nucleic acid sequence SEQ ID No. The peptide sequence deduced from 16 is shown in SEQ ID NO. 16,
Nucleic acid sequence SEQ ID No. The peptide sequence deduced from 15 is the sequence SEQ ID No. An anti-idiotype antibody that neutralizes the inhibitory activity of an inhibitory antibody against the C1 domain of Factor VIII, The antibody according to any one of the preceding claims,
An anti-idiotype antibody that neutralizes the inhibitory activity of the inhibitory antibody against the C1 domain of Factor VIII, characterized in that the inhibitory antibody is the antibody RHD5 (deposited in the collection BCCM / LMBP under the number LMBP 6165CB). The antibody according to any one of the preceding claims,
An anti-idiotype antibody that neutralizes the inhibitory activity of an inhibitory antibody against the C1 domain of Factor VIII, wherein the anti-idiotype antibody is a mouse antibody. The antibody of claim 8,
An anti-idiotype antibody that neutralizes the inhibitory activity of an inhibitory antibody against the C1 domain of Factor VIII, wherein the anti-idiotype antibody is IgG1 kappa. The antibody according to any one of the preceding claims,
An anti-idiotype antibody that neutralizes the inhibitory activity of an inhibitory antibody against the C1 domain of Factor VIII, wherein the antibody is a chimeric antibody. The antibody of claim 10,
An anti-idiotype antibody that neutralizes the inhibitory activity of an inhibitory antibody against the C1 domain of Factor VIII, wherein the antibody is a human hybrid antibody. The antibody according to any one of claims 1-9,
An anti-idiotype antibody that neutralizes the inhibitory activity of an inhibitory antibody against the C1 domain of Factor VIII, wherein the claim is humanized. The antibody according to any one of the preceding claims,
Factor VIII, wherein the antibody is selected from the group consisting of F (ab ′) 2 fragments, Fab ′ fragments, Fab fragments, CUR regions, and modified versions of any of these fragments or regions An anti-idiotype antibody that neutralizes the inhibitory activity of the inhibitory antibody against the C1 domain. The antibody according to any one of claims 1 to 9, wherein
Inhibitory antibody against the C1 domain of factor VIII, characterized in that the antibody can be produced by the hybridoma 18B6 deposited under the number CNCM I-3559 in the Collection of National Microorganisms (CNCM) An anti-idiotype antibody that neutralizes the inhibitory activity.   A stable cell line that produces an anti-idiotype antibody that neutralizes the inhibitory activity of an inhibitory antibody against the C1 domain of Factor VIII according to any of claims 1-13. The stable cell line of claim 15,
Other cells derived from humans such as SP2 / 0, YB2 / 0, IR983F, human myeloma Namalwa, PERC6, cell line CHO, that is, CHO-K-1, CHO-Lec10, CHO-Lec1, CHO-Lec13, CHO A group consisting of Pro-5, CHO dhfr-, Wil-2, Jurkat, Vero, Molt-4, COS-7, 293-HEK, BHK, K6H6, NS0, SP2 / 0-Ag14 and P3X63Ag8-653 A cell line selected from.   Hybridoma 18B6 deposited at the National Collection of Cultures de Microorganisms (CNCM) under the number CNCM I-3559. In a monoclonal anti-idiotype antibody against a Factor VIII human inhibitory antibody,
That the inhibitory antibody is directed to the C1 region of Factor VIII produced by hybridoma 18B6 deposited at the National Collection of Cultures de Microorganisms (CNCM) under the number CNCM I-3559. An anti-idiotype antibody that neutralizes the inhibitory activity of an inhibitory antibody against the C1 domain of the feature Factor VIII.   The sequence SEQ ID No. 15 encoding the variable region of the heavy chain of an antibody according to any one of claims 1-14. A DNA fragment representing 15.   The sequence SEQ ID No. 15 encoding the light chain variable region of an antibody according to any one of the preceding claims 1-14. A DNA fragment representing 16.   A pharmaceutical composition comprising an antibody according to any one of the preceding claims and at least one excipient and / or at least one pharmaceutically acceptable substrate. A composition according to claim 21 or 22,
The composition comprises at least one anti-idiotype antibody to an anti-FVIII antibody directed to a domain different from the C1 domain of Factor VIII. A composition according to any one of claims 21 or 22,
An anti-idiotype antibody directed against an anti-idiotype antibody directed against the factor VIII C2 domain and / or an antibody directed against the factor VIII A2 domain.   Use of an anti-idiotype antibody for neutralizing the inhibitory activity of an inhibitory antibody against the C1 domain of Factor VIII according to any one of claims 1-14 for the manufacture of a medicament.   An anti-idiotype antibody that neutralizes the inhibitory activity of an inhibitory antibody against the C1 domain of factor VIII according to any one of claims 1-14 for the manufacture of a medicament intended for the treatment of type A hemophilia Use.   The use of an anti-idiotype antibody that neutralizes the inhibitory activity of an inhibitory antibody against the C1 domain of Factor VIII according to claim 25, wherein the type A hemophilia is hemophilia with an inhibitory factor.   The neutralizing inhibitory activity of an inhibitory antibody against the C1 domain of Factor VIII according to any one of claims 1-14, in order to neutralize the inhibitory activity of the inhibitory antibody against the C1 domain of Factor VIII in vitro. Use of anti-idiotype antibodies.   An anti-idiotype antibody that neutralizes the inhibitory activity of the inhibitory antibody against the C1 domain of factor VIII according to any one of claims 1-14 for in vitro detection and / or purification of the factor VIII inhibitory antibody Use.   15. A pharmaceutical comprising an anti-idiotype antibody that neutralizes the inhibitory activity of the inhibitory antibody against the C1 domain of factor VIII according to any one of claims 1-14.

Images