JP2010263887A - Process for production of succinic acid - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a process for producing succinic acid, using a microorganism, increased in succinic acid production efficiency and decreased in production cost, by using a predetermined sucrose as the raw material saccharide. <P>SOLUTION: The process for producing succinic acid comprises reacting a microorganism capable of producing succinic acid on sucrose, wherein the sucrose contains a predetermined amount of a substance (an impurity X) that can be detected by means of high performance liquid chromatography under predetermined conditions. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to a method for producing succinic acid using a microorganism.

  As a method for producing a dicarboxylic acid such as succinic acid using a microorganism, a method using an anaerobic bacterium or a method using a coryneform bacterium is known (see Patent Documents 1 to 4). When an aerobic bacterium such as Corynebacterium is used, a method is often used in which cells are grown under aerobic conditions to obtain microbial cells and used as stationary microbial cells to act on organic raw materials. In such a method, as a method for increasing the production amount of dicarboxylic acid such as succinic acid, in addition to a method using a suitable microorganism obtained by breeding a microorganism by genetic recombination, succinic acid can be added by adding biotin. It is disclosed that the generation amount increases (see Non-Patent Document 1). However, the method using the additive to the medium is not a preferable method because of the high production cost.

  On the other hand, refined sucrose derived from plants is concentrated by removing and purifying the sugar solution obtained by crushing and compressing the plant body into a crude purified sucrose, and then performing a decolorization step on the crude purified sugar. -Manufactured by crystallization. Sugar as a raw material used in the disclosed production method of succinic acid is molasses (sweet sugar molasses, sugar beet molasses, high test molasses, etc.) that is sucrose obtained during the production process of the purified sucrose (See Patent Documents 1 to 7, Non-Patent Documents 2 and 3). However, sufficient studies have not been made on the relationship between the content of impurities contained in roughly purified sucrose and molasses and the amount of succinic acid produced.

US Pat. No. 5,143,834 US Pat. No. 5,504,004 Japanese Unexamined Patent Publication No. 11-206385 Japanese Patent Laid-Open No. 11-196888 International Publication No. 2005/026349 Japanese Unexamined Patent Publication No. 2008-237101 Japanese Unexamined Patent Publication No. 2008-245537

Agricultural Volume 36, No. 2, p. 172-176 (1962) L. Agarwal et al., Journal of Applied Microbiology 100 (2006) 1348-1354. Yu-Peng Liu et al., Bioresource Technology 99 (2008) 1736-1742.

  An object of the present invention is to provide a method for producing succinic acid in which the production efficiency of succinic acid is improved and the production cost is reduced by using predetermined sucrose as a raw material sugar in the method for producing succinic acid using microorganisms. The issue is to provide.

  As a result of intensive studies to solve the above-mentioned problems, the present inventors have determined that succinic acid is produced by a sucrose containing a specific amount of a specific impurity as a raw material by a microorganism having succinic acid-producing ability such as coryneform bacteria. As a result, it was found that the production efficiency of succinic acid was improved as compared with the use of purified sucrose as a raw material, and the present invention was completed.

That is, the present invention is as follows.
1. A method for producing succinic acid, wherein a microorganism having succinic acid-producing ability is allowed to act on sucrose, wherein the sucrose is as follows.
Containing a substance that is detected at a retention time of 6.7 to 6.95 minutes when an aqueous solution prepared at a sucrose concentration of 1% by weight is measured using high performance liquid chromatography under the following measurement conditions; Sucrose whose content of a substance is 0.02 g / L-100 g / L as a succinic acid conversion value.
(Measurement condition)
Separation column; ULTRON PS-80H (manufactured by Shinwa Chemical)
Solvent: 60 wt% perchloric acid 1.8 mL / 1 L distilled water Flow rate: 1.0 mL / min Column temperature: 60 ° C
Detection wavelength: 210 nm UV
Injection volume: 10 μL

2. A method for producing succinic acid, wherein a microorganism having succinic acid producing ability is allowed to act on sucrose, wherein the sucrose is as follows.
Containing a substance that is detected at a retention time of 6.7 to 6.95 minutes when an aqueous solution prepared at a sucrose concentration of 1% by weight is measured using high performance liquid chromatography under the following measurement conditions; Sucrose whose content of a substance is 0.02 g / L-100 g / L as a succinic acid conversion value.
(Measurement condition)
Separation column; based on a substrate-crosslinked styrene divinylbenzene copolymer having a particle diameter of 7 to 11 μm and a degree of crosslinking of 7 to 9%, an inner diameter of 7.8 to 8.2 mm and a length of 260 to 340 mm Some separation column Solvent; 60 wt% perchloric acid 1.8 mL / 1 L distilled water Flow rate; 1.0 mL / min Column temperature; 60 ° C
Detection wavelength: 210 nm UV
Injection volume: 10 μL

3. A method for producing succinic acid, wherein a microorganism having succinic acid producing ability is allowed to act on sucrose, wherein the sucrose is as follows.
At the peak when an aqueous solution prepared with a sucrose concentration of 1% by weight was measured using high performance liquid chromatography under the following measurement conditions, the peak top time [a] is the peak top time [b] of the succinic acid standard. In the ratio ([a] / [b]) to 0.81 to 0.91, and the content of the substance in the aqueous solution is 0.02 g / Sucrose which is L-100g / L.
(Measurement condition)
Separation column; Separation column based on a substrate-crosslinked styrene divinylbenzene copolymer having a particle size of 7 to 11 μm Solvent; 60 wt% perchloric acid 1.8 mL / 1 L distilled water Flow rate: 1.0 mL / min Column Temperature: 60 ° C
Detection wavelength: 210 nm UV
Injection volume: 10 μL

4). 4. The method for producing succinic acid according to any one of items 1 to 3, wherein the sucrose is as follows.
Sucrose having an absorbance at 350 nm of an aqueous solution having a sucrose concentration of 10% by weight of 0.50 to 100.
5). The microorganism having the ability to produce succinic acid is a microorganism selected from the group consisting of coryneform bacteria, Escherichia coli, Anaerobiospirillum genus, Actinobacillus genus, filamentous fungi and yeast 5. The method for producing succinic acid according to any one of items 1 to 4.
6). Any one of the preceding items 1 to 5, wherein the sucrose is a method for concentrating and purifying a sugar solution extracted from a plant, which is produced by a production method without performing a decolorization step. A method for producing succinic acid according to 1.

7). The microorganism is at least one genetically modified so that lactate dehydrogenase activity is reduced compared to the unmodified form and genetically modified so that pyruvate carboxylase activity is enhanced compared to the unmodified form. 7. The method for producing succinic acid according to any one of items 1 to 6 above.
8). 8. The production of succinic acid according to any one of 5 to 7 above, wherein the coryneform bacterium is selected from Corynebacterium glutamicum, Brevibacterium flavum, and Brevibacterium lactofermentum. Method.
9. 9. The method for producing succinic acid according to any one of 1 to 8 above, wherein a succinic acid is produced by causing a microorganism having succinic acid producing ability to act on sucrose in an anaerobic atmosphere.

10. A seed culturing step for proliferating a microorganism having succinic acid-producing ability in advance, and a succinic acid producing step for producing succinic acid by allowing the microorganism obtained in the seed culturing step to act on sucrose containing impurities X. 10. The method for producing succinic acid according to any one of 1 to 9 above.
11. A method for producing 1,4-butanediol, comprising a step of producing succinic acid by the method according to any one of items 1 to 10 and a step of hydrogenating the succinic acid obtained in the step.
12 A method for producing a succinic acid-containing polymer, comprising a step of producing succinic acid by the method according to any one of items 1 to 10 and a step of performing a polymerization reaction using the succinic acid obtained in the step as a raw material.

  According to the method of the present invention, succinic acid can be efficiently produced at low cost.

The figure which showed the relationship between the succinic-acid accumulation density | concentration in the microorganisms when making microorganisms act in the presence of sodium hydrogencarbonate using various sucrose as a raw material, and the 350 nm light absorbency of 10 weight% of refined | purified sucrose aqueous solution. is there. It is the figure which showed the relationship between the succinic-acid accumulation density | concentration in this microorganism when the microorganisms were made to act in the presence of magnesium carbonate using various sucrose as a raw material, and the 350 nm light absorbency of a crudely purified sucrose 10 wt% aqueous solution. . It is a high performance liquid chromatography chart of reagent special grade sucrose (made by Wako Pure Chemical Industries) and this millet red sugar (made by Nissin sugar) at the time of analyzing using a UV detector with a wavelength of 210 nm. It is a high performance liquid chromatography chart at the time of analyzing this millet red sugar (product made from Nissin sugar) using UV detector of wavelength 210nm and 280nm, and RI detector. It is the figure which showed the relationship between the content of the impurity X contained in the used sucrose, and the succinic acid accumulation density | concentration in this microorganism when making microorganisms act in the presence of sodium hydrogencarbonate using various sucrose as a raw material . It is the figure which showed the relationship between the content of the impurity X contained in the used sucrose, and the succinic acid accumulation density | concentration in this microorganism when making microorganisms act in the presence of magnesium carbonate from various sucrose. It is a high-performance liquid chromatography chart using a MCI GEL CK08EH column of reagent-grade sucrose (manufactured by Wako Pure Chemical Industries) and raw sugar (manufactured by Dainippon Meiji Sugar Co., Ltd.) when analyzed using a UV detector with a wavelength of 210 nm. .

  Hereinafter, embodiments of the present invention will be described in detail.

  The present invention relates to a method for producing succinic acid (hereinafter referred to as succinic acid production method), characterized in that a succinic acid-producing microorganism is allowed to act on sucrose containing specific impurities to produce succinic acid and collect the product (hereinafter referred to as succinic acid). This is sometimes referred to as “the production method of the present invention” or “the production method of succinic acid”). Here, “acting a microorganism on sucrose” means that a microorganism or a preparation thereof is allowed to act on sucrose in a reaction solution to produce succinic acid.

(1) Sucrose In the production method of the present invention, sucrose used for production of succinic acid by a microorganism having succinic acid-producing ability is sucrose having at least one of the following characteristics (A) to (C): , Sometimes referred to as “sucrose containing impurities X”).

(A) A substance (hereinafter, referred to as “impurity X”) that is at least one of the following (i) to (iii) detected by high performance liquid chromatography performed on an aqueous solution prepared to a sucrose concentration of 1% by weight: ) And the content of the substance in the aqueous solution is 0.02 g / L to 100 g / L in terms of succinic acid.
On the other hand, in this specification, “purified sucrose” means that the content of impurity X obtained by performing high performance liquid chromatography under the same measurement conditions as in the detection of impurity X is 0.02 g in terms of succinic acid. / L Less than sucrose.

(I) A substance detected at a retention time of 6.70 to 6.95 minutes in high performance liquid chromatography performed under the following measurement conditions i.
(Measurement condition i)
Separation column; ULTRON PS-80H (manufactured by Shinwa Chemical)
Solvent: 60 wt% perchloric acid 1.8 mL / 1 L distilled water Flow rate: 1.0 mL / min Column temperature: 60 ° C
Detection wavelength: 210 nm UV
Injection volume: 10 μL

(Ii) A substance that is detected at a retention time of 6.70 to 6.95 minutes in high performance liquid chromatography performed under the following measurement conditions ii.
(Measurement conditions ii)
Separation column; based on a substrate-crosslinked styrene divinylbenzene copolymer having a particle size of 7 to 11 μm and a degree of crosslinking of 7 to 9%, an inner diameter of 7.8 to 8.2 mm and a length of 260 to 340 mm Some separation column Solvent; 60 wt% perchloric acid 1.8 mL / 1 L distilled water Flow rate; 1.0 mL / min Column temperature; 60 ° C
Detection wavelength: 210 nm UV
Injection volume: 10 μL

(Iii) In the peak measured using high performance liquid chromatography under the following measurement conditions iii, the ratio of the peak top time [a] to the peak top time [b] of the succinic acid sample ([a] / [B]) a substance detected in the range of 0.85 to 0.91.

(Measurement conditions iii)
Separation column; Separation column based on a substrate-crosslinked styrene divinylbenzene copolymer having a particle size of 7 to 11 μm Solvent; 60 wt% perchloric acid 1.8 mL / 1 L distilled water Flow rate: 1.0 mL / min Column Temperature: 60 ° C
Detection wavelength: 210 nm UV
Injection volume: 10 μL

  The content of the impurity X is determined as a succinic acid equivalent value by performing high performance liquid chromatography under the same measurement conditions as in the detection of the impurity X and analyzing at a wavelength of 210 nm using a UV detector. In other words, succinic acid preparation (succinic acid solution whose concentration has already been measured) is subjected to high performance liquid chromatography under the same conditions as those for the detection of impurity X, and analyzed at a wavelength of 210 nm using a UV detector. The content of the impurity X is determined from the ratio of the peak area value of the succinic acid detected in the succinic acid sample and the peak area value of the impurity X. As the succinic acid sample to be used, for example, one having a concentration of 10 g / L can be used.

  The calculation method of the peak area of the impurity X is not particularly limited, but a calculation method that can be used by those skilled in the art can be used. For example, in the above measurement conditions, the point obtained by vertically dividing the peak in the valley between the fructose and impurity X peaks is the start point (near 6.6 minutes), and the impurity X peak end point (near 7.2 minutes) from the start point. Can be performed by integrating and calculating the area value. The base line is a horizontal line from the rising edge of the first peak (near 3.8 minutes) to the impurity X peak end point.

  The content of the impurity X is 0.02 g / L or more, preferably 0.50 g / L or more. Moreover, it is 100 g / L or less, it is preferable that it is 50 g / L or less, and it is more preferable that it is 20 g / L.

  The inner diameter of the separation column under the measurement conditions i to iii is preferably 7.8 to 8.2 mm, and more preferably 7.9 to 8.1 mm. Further, the length of the column is preferably 260 to 340 mm, and more preferably 280 to 320 mm.

The particle size of the substrate used for the separation column in the measurement conditions ii and iii is 7 to 11 μm, and preferably 8 to 10 μm. The substrate of the separation column under the measurement conditions ii and iii is not particularly limited as long as it is a substrate-crosslinked styrene divinylbenzene copolymer that is one of cation exchange resins having protonic sulfonic acid groups. It is preferable that it is 7-9.

As the separation column under the measurement conditions ii and iii, a column included in the category L17 of USP (United States Pharmacopeia) can be used. Specifically, for example, ULTRON PS-80H (manufactured by Shinwa Kako) and MCI GEL CK08EH (manufactured by Mitsubishi Chemical)
Etc.

  The present inventors have found that sucrose containing the impurity X enhances succinic acid fermentation, and that there is a certain correlation between the succinic acid production rate and the content of the impurity X. Impurity X is assumed to be a mixture of plant-derived anaerobic metabolism promoting substances, although details of the mechanism of action and the like are unknown. In the process of aerobically culturing microorganisms, no difference was observed between sucrose containing impurity X and purified sucrose, so impurity X acts on the activation of anaerobic metabolism. It is assumed that the component is likely to be a component.

  In order to adapt to various environmental changes, microorganisms can select the most efficient metabolic pathway under each condition. For example, the metabolic pathway that is necessary and most energy efficient depending on the type of nutrient source is activated or utilized. In succinic acid fermentation, it is common to carry out a process of producing succinic acid mainly under an anaerobic atmosphere after culturing (growing) the microorganism mainly under an aerobic atmosphere.

  However, there are several ideal metabolic routes in anaerobic fermentation, and it is not clear which route is actually used or effective. Impurity X is not only a component that promotes anaerobic metabolism when succinic acid is used as the final product, but also an inhibitory component for the production of by-products such as lactic acid, acetic acid, amino acids, and glycerol (other end products of anaerobic metabolism). is expected. It is important to influence various metabolic pathways because of the mixture, and it is predicted that an effect that cannot be obtained by a single product has occurred.

  In addition, biotin is known as a trace component that promotes succinic acid fermentation, but the present inventors have confirmed that impurity X is not biotin. In addition, in the examples and comparative examples of the present specification, a sufficient amount of biotin is separately added to the culture medium. Therefore, it is clear that the promoting effect is not due to biotin. There is a possibility that a novel substance exists as at least one of an acid production enhancing substance and a by-product production inhibiting substance.

(B) Sucrose manufactured by the manufacturing method which has not performed the decoloring process in the method of concentrating and refine | purifying the sugar liquid extracted from the plant.
On the other hand, “purified sucrose” in the present specification refers to sucrose obtained by further decolorizing the sucrose containing the impurity X of the present invention.

  In this specification, “sugar solution extracted from plants” means a sugar solution obtained by pressing or leaching a sugar cane, sugar beet, sugar maple or the like that is generally used as a raw material for sucrose, and lime washing the sugar solution. What you did. As a kind of plant, since many impurities X are contained, sugarcane is preferable.

  In addition, the “decolorization step” specifically means that after washing and dissolving a sugar solution squeezed from a plant or a crystal of the sugar solution, impurities are precipitated by an acid saturation treatment, and the impurities are removed. It refers to a step of filtering with activated carbon, a filter, centrifugation, etc., and a step of desalting with an ion exchange resin or the like.

  As a method for precipitating impurities other than purified sucrose, in addition to the acid saturation treatment, a method by addition of a polymer flocculant, coagulation precipitation by lime milk, or the like is also used. These decolorization steps are already known as methods for producing purified sucrose, and examples thereof include the method described in Japanese Patent Application Laid-Open No. 10-42899.

The method of concentrating and purifying the sugar solution extracted from the plant is not specifically limited, but, for example, sugar cane, it is created from the “pressing process” for extracting sucrose from sugar cane. The lime washing process removes impurities from the squeezed juice by coagulation sedimentation with lime milk, the filtration and concentration process filters and concentrates the lime washing supernatant, and the syrup obtained in the filtration and concentration process is vacuumed “Crystal (decoction) process” for crystallization with a crystal can, etc., “Separation process” for separating crystals and molasses obtained in the crystal (decoction) process with a centrifuge, etc., obtained in the separation process A method of passing through a “sugar washing step” in which crystals and honey are added to wash the crystals.

  The sucrose used in the production method of the present invention is produced through at least a “squeezing step”, preferably through a “lime washing step” and a “filtration / concentration step”. Further, it is more preferably produced through a “crystal (decoction) process”, and particularly preferably produced through a “separation process”. Sucrose obtained in the separation step is separated into crystallized sucrose (sometimes referred to as “crude sucrose”) and molasses. Crude refined sucrose is more preferable in that it has good storage stability and can reduce logistics costs such as transportation.

  Also, control of impurity removal in the “lime washing process”, control of filtration conditions and sucrose concentration in the “filtration / concentration process”, control of crystallization conditions in the “crystal (decoction) process” and separation in the “separation process” By performing at least one control of the conditions, the content of the impurity X in sucrose can be controlled within a predetermined range. Furthermore, it is possible to reduce succinic acid production-inhibiting substances such as plant-derived antibacterial substances and substances that impose a load on purification of succinic acid produced from plant-derived lipids and inorganic ions.

  The “decolorization step” mainly includes an “impurity precipitation step” in which at least one of agglomeration and precipitation with lime milk and a carbonic acid saturation treatment is performed on a sugar solution obtained by dissolving the crystals obtained in the sugar washing step with warm water. “Impurity removal step” in which impurities are removed with activated carbon, a filter, etc., and “desalting treatment step” with an ion exchange resin or the like. Since the impurity X according to the present invention is almost completely removed together with the sugar and substances other than the impurity X through the “decolorization step”, the sucrose after the “decolorization step” is used for the succinic acid production reaction. Tend to be unfavorable.

(C) It is manufactured by concentrating and purifying a sugar solution extracted from a plant, and the absorbance at 350 nm of a 10% by weight sucrose concentration solution is usually 0.50 or more, preferably 3.0 or more, more preferably Sucrose which is 4.0 or more. The upper limit of the absorbance at 350 nm of this 10% sucrose concentration solution is usually 100, preferably 50.

  As sucrose containing the impurities X described in the above (A) to (C), commercially available products can be used. Specifically, for example, raw sugar (manufactured by Dainippon Meiji Sugar Co., Ltd.), acne Examples thereof include sugar (manufactured by Nissin Sugar Co., Ltd.), powdered brown sugar (manufactured by Nissin Sugar Co., Ltd.), powder jet black brown sugar (manufactured by Nissin Sugar Co., Ltd.), and main millet red sugar (manufactured by Mitsui Sugar Co., Ltd.).

  Examples of sucrose containing the impurity X include molasses containing the impurity X. Among them, sugarcane-derived molasses is preferable. As the molasses containing the impurity X, commercially available ones can be used. Specifically, for example, Neomoracesto (manufactured by EM Laboratories Co., Ltd.), Okinawa black molasses (manufactured by Kurose Honpo Kakinohana Co., Ltd.), etc. Is mentioned.

  The sucrose containing the impurity X may contain fermentable carbohydrates. Examples of fermentable carbohydrates include carbohydrates such as galactose, lactose, glucose, fructose, glycerol, saccharose, starch and cellulose; polyalcohols such as glycerin, mannitol, xylitol and ribitol.

(2) Microorganism The microorganism used in the production method of the present invention is not limited as long as it is a microorganism having succinic acid-producing ability. As used herein, “succinic acid producing ability” refers to the ability to accumulate succinic acid in a medium when a microorganism is cultured.

  The microorganism used in the production method of the present invention is not particularly limited, and examples thereof include coryneform bacteria, Escherichia coli, Anaerobiospirillum genus, Acinobacillus genus, filamentous fungi and yeast. (Hereinafter, this may be referred to as “microorganism used in the production method of the present invention”).

Among the microorganisms, coryneform bacteria, Escherichia coli, Anaerobiospirillum (Anaero)
biospirillum) and yeast are preferred, coryneform bacteria, E. coli and yeast are more preferred, and coryneform bacteria and yeast are particularly preferred.

  Examples of coryneform bacteria include the genus Corynebacterium, the genus Brevibacterium, the genus Arthrobacter, the genus Mycobacterium, the genus Microbacterium and the micrococcus. (Micrococcus) genus.

  Examples of the genus Brevibacterium include Brevibacterium flavum, Brevibacterium lactofermentum, Corynebacterium glutamicum, and the like.

  Brevibacterium flavum, Brevibacterium lactofermentum and Corynebacterium glutamicum are very closely related to each other and have similar properties. In the current taxonomy, they are classified as the same species. Sometimes.

  Particularly preferable specific examples of the parent strain of the microorganism used in the production method of the present invention include Brevibacterium flavum MJ-233 (FERM BP-1497), MJ-233 AB-41 (FERM BP-1498), and Corynebacterium. And U. glutamicum ATCC 31831 and Brevibacterium lactofermentum ATCC 13869.

  Brevibacterium flavum is currently sometimes classified as Corynebacterium glutamicum (Lielbl, W., et al., International Journal of Systemic Bacteriology, 1991, vol. 41, p255-260). Therefore, in the present invention, Brevibacterium flavum MJ-233 strain and its mutant MJ-233 AB-41 strain are the same as Corynebacterium glutamicum MJ-233 strain and MJ-233 AB-41 strain, respectively. Stocks.

Brevibacterium flavum MJ-233 was established on April 28, 1975 at the Institute of Microbiology and Industrial Technology, Ministry of International Trade and Industry (currently National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center) (305-8665 Japan) Deposited as deposit number FERM P-3068 in Tsukuba City, Ibaraki Prefecture, 1-chome, 1-chome, 1st 6th), transferred to an international deposit based on the Budapest Treaty on May 1, 1981, deposited under the deposit number of FERM BP-1497 Has been.

Examples of filamentous fungi include Aspergillus genus, Penicillium genus, R
Examples include the genus ipusus. Examples of Aspergillus genus include Aspergillus niger and Aspergillus oryzae. Examples of the genus Penicillium include Penicillium chrysogenum, Penicillium simplicium, and the like. Examples of the Risopus genus include Rhizopus oryzae and the like.

  Examples of the yeast include, for example, Saccharomyces, Shizosaccharomyces, Candida, Pichia, Kluyveromyces and Kluyveromyces. Is mentioned.

  Examples of the genus Saccharomyces include Saccharomyces cerevisiae, S. uvarum, S. bayanus, and the like.

  Examples of the genus Shizosaccharomyces include Schizosaccharomyces pombe.

  Examples of the genus Candida include Candida albicans, C. sonorensis, C. glabrata, and the like.

  Examples of the genus Pichia include Pichia pastoris and P. stipidis.

  The genus Kluyveromyces includes Kluyveromyces lactis, Kluyveromyces marxianus and K. thermotolerans. Etc.

  Examples of the genus Zygosaccharomyces include Zygosaccharomyces bailii, Zygosaccharomyces bailii and Z. rouxii.

  The production method of the present invention includes not only wild strains of microorganisms used in the production method of the present invention, but also genetic strains such as mutant strains obtained by normal mutation treatment such as UV irradiation and NTG treatment, cell fusion, and gene recombination methods. The recombinant etc. which are induced | guided | derived by the method are also used.

As said recombinant, what was obtained by well-known methods, such as the expression enhancement of a biosynthetic enzyme gene and the expression fall of a degradation enzyme gene, is used about succinic acid. Specifically, for example, in the method for producing succinic acid, the activity of a supplemental pathway enzyme selected from pyruvate carboxylase, phosphoenolpyruvate carboxylase and phosphoenolpyruvate carboxykinase is enhanced or imparted to the unmodified form. And the like that have been genetically modified. In addition, pyruvate-derived by-product-producing enzymes, that is, microorganisms in which the pyruvate-derived by-product is lactic acid, are those that have been genetically modified so that the activity of lactate dehydrogenase is reduced compared to the unmodified type, respectively. Can be mentioned. Furthermore, in microorganisms in which the pyruvate-derived by-product is ethanol, those that have been genetically modified so that the activity of pyruvate decarboxylase or alcohol dehydrogenase is reduced compared to the unmodified type, respectively. .

  Microorganisms genetically modified so that pyruvate carboxylase (hereinafter also referred to as “PC” or “pc”) activity is enhanced compared to the unmodified type, for example, the method described in Japanese Patent Application Laid-Open No. 11-196888 Similarly, the pc gene can be constructed by high expression in a host microorganism using a plasmid. Moreover, it may be integrated on the chromosome by homologous recombination, or the expression of the pc gene can be enhanced by promoter replacement. Transformation can be performed, for example, by an electric pulse method (Res. Microbiol., Vol. 144, p. 181-185, 1993).

  “The PC activity is enhanced” means that the PC activity is preferably increased by 1.5 times or more, more preferably by 3.0 times or more per unit cell weight with respect to the unmodified type such as the wild strain or the parent strain. It means that The enhanced PC activity is confirmed by a known method such as J. Org. Bacteriol. , 158, 55-62, (1984), and can be confirmed by measuring PC activity. As the pc gene and a specific introduction method, those described in Japanese Patent Application Laid-Open No. 2008-259451 are used.

  A phosphoenolpyruvate carboxykinase (hereinafter referred to as “PEPCK”) (EC 4.1.1.49) is genetically modified so as to be enhanced or imparted as compared to the unmodified type, For example, in the same manner as described in WO2009 / 065780, Escherichia coli, Mannheimia sp. , Actinobacillus sp. And Anaerobiospirillum sp. More preferably, the gene derived from Mannheimia succiniciproducens, Actinobacillus succinogenes and Anaerobiospirillum succiniciproducens can be directly introduced into a host microorganism by a plasmid or integrated by homologous recombination. A promoter for highly expressing the gene in the host is not particularly limited as long as it functions in the host microorganism at least under anaerobic conditions or oxygen-limited conditions.

  Construction of a microorganism in which phosphoenolpyruvate carboxylase (hereinafter referred to as “PEPC”) (EC 4.1.1.38) has been genetically modified or introduced so as to be enhanced as compared to the unmodified type. The gene used in is not particularly limited as long as it encodes the enzyme activity, but preferably a gene encoding an enzyme whose activity inhibition by at least one of aspartic acid, malic acid and oxaloacetic acid is reduced. Specific examples of aspartic acid resistance include those described in Japanese Patent Application Laid-Open No. 8-70860.

  In addition, a gene modified so that the activity of lactodehydrogenase (hereinafter sometimes referred to as “LDH”) is reduced as compared with the non-modified type is described in, for example, Japanese Patent Application Laid-Open No. 11-206385. It can be constructed by disrupting the LDH gene on the chromosome by the method using homologous recombination and the method using sacB gene (Schaffer, A. et al. Gene 145 (1994) 69-73).

Note that “LDH activity is reduced” means that LDH activity is reduced as compared to the unmodified type. LDH activity may be completely lost. The decrease in LDH activity was confirmed by a known method (L. Kanarek, et al., J. Biol. Chem. 239,
4202 (1964) etc.) and can be confirmed by measuring LDH activity.

  Pyruvate decarboxylase (hereinafter sometimes referred to as “PDC”) (EC 4.1.1.1) yeast that has been genetically modified to reduce activity compared to the unmodified type is, for example, Japan As described in Japanese Patent Application Publication No. 2007-174947 and International Publication No. 2005/052174, a gene encoding pyruvate decarboxylase 1, a gene encoding pyruvate decarboxylase 5, and pyruvate decarboxylase 6 Can be constructed by deleting the gene encoding.

  In addition, the yeast having reduced pyruvate decarboxylase activity may mutate or interfere with the promoter of the pyruvate decarboxylase structural gene, the gene that regulates the expression of the pyruvate decarboxylase structural gene, or the promoter of the regulatory gene, Alternatively, it may be constructed by deleting at least a part of the gene and introducing an antisense construct that reduces translation from pyruvate decarboxylase mRNA into pyruvate decarboxylase protein into the yeast. it can. The decrease in the activity of pyruvate decarboxylase can be confirmed by measuring the enzyme activity by a known method (van Maris, et al, 2003).

  Alcohol dehydrogenase (hereinafter sometimes referred to as “ADH”) (EC 1.1.1.1) yeast that has been genetically modified to reduce activity compared to the unmodified type is, for example, A gene encoding alcohol dehydrogenase 1 as described in JP 2007-174947, more preferably a gene encoding alcohol dehydrogenase 1 and alcohol dehydrogenase 2 as described in WO 2010/003728. It can be constructed by deleting the encoding gene.

  Yeast having reduced alcohol dehydrogenase activity may mutate or interfere with the promoter of the alcohol dehydrogenase structural gene, the gene that regulates the expression of the alcohol dehydrogenase structural gene, or the promoter of the regulatory gene, or at least one of the genes. It can also be constructed by deleting a part, and by introducing into the yeast an antisense construct that reduces translation from alcohol dehydrogenase mRNA to alcohol dehydrogenase protein.

  Furthermore, the microorganism used in the production method of the present invention may be an acetate kinase (hereinafter referred to as “the enhancement of the supplementary pathway enzyme activity or the enhancement of the supplementary pathway enzyme activity and the reduction of the pyruvate-derived byproduct-producing enzyme activity”). ACK), phosphotransacetylase (hereinafter also referred to as “PTA”), pyruvate oxidase (hereinafter also referred to as “POXB”) and acetyl CoA hydrolase (hereinafter also referred to as “ACH”). It may be modified so that the activity of one or more kinds of enzymes selected from the above is reduced, and further, fumarate reductase (hereinafter also referred to as “FRD”), malate dehydrogenase (hereinafter also referred to as “MDH”). ), At least one selected from the group consisting of malate transport protein (hereinafter also referred to as “MAE”) By genetic recombination or may be obtained by introducing the enhanced or new the enzyme activity.

  Either PTA or ACK may decrease the activity, but in order to efficiently reduce acetic acid by-product, it is more preferable to decrease both activities.

“PTA activity” refers to the activity of catalyzing the reaction of transferring phosphoric acid to acetyl CoA to produce acetyl phosphate. “Modified to reduce PTA activity” means that PTA activity is lower than that of an unmodified type, for example, a wild type strain. The PTA activity is preferably reduced to 30% or less per unit cell weight, more preferably 10% or less, compared to the unmodified type. Further, the PTA activity may be completely lost. The decrease in PTA activity is described in, for example, Klotzsch, H. et al. R. , Meth Enzymol. 12, 381-386 (1969), etc., and can be confirmed by measuring PTA activity.

  “ACK activity” refers to the activity of catalyzing the reaction of producing acetic acid from acetyl phosphate and ADP. “Modified to reduce ACK activity” means that ACK activity is lower than that of an unmodified type, for example, a wild type strain. The ACK activity is preferably reduced to 30% or less per unit cell weight, more preferably 10% or less, compared to the unmodified type. Further, the ACK activity may be completely lost. The decrease in ACK activity can be confirmed by measuring the ACK activity by the method of Ramponi et al. (Ramponi G., Meth. Enzymol. 42, 409-426 (1975)).

  In Corynebacterium glutamicum (including those classified as Brevibacterium flavum), Microbiology. 1999 Feb; 145 (Pt 2): 503-13, both enzymes are encoded by the pta-ack operon (GenBank Accession No. X89084), so when the pta gene is disrupted, PTA And the activity of both ACK enzymes can be reduced.

  The activity of PTA and ACK is reduced by disrupting these genes according to a known method, for example, a method using homologous recombination or a method using a sacB gene (Schaffer, A. et al. Gene 145 (1994) 69-73). Can be done. Specifically, it can be performed according to the method disclosed in Japanese Patent Application Laid-Open No. 2006-000091.

As the pta gene and the ack gene, the above GenBank Accession
No. In addition to the gene having the base sequence of X89084, a gene having a degree of homology that causes homologous recombination with the pta gene and the ack gene on the host chromosome can also be used. Here, the homology that causes homologous recombination is preferably 80% or more, more preferably 90% or more, and particularly preferably 95% or more. In addition, homologous recombination can occur if the DNAs can hybridize with each other under stringent conditions.

  “POXB activity” refers to the activity of catalyzing the reaction of producing acetic acid from pyruvic acid and water. “Modified to reduce POXB activity” means that POXB activity is lower than that of an unmodified type, for example, a wild type strain. The POXB activity is preferably reduced to 30% or less per unit cell weight, more preferably 10% or less, compared to the non-modified type. Further, the POXB activity may be completely lost. POXB activity is determined by Chang Y. et al. , Et al. , J .; Bacteriol. 151, 1279-1289 (1982) and the like, and can be confirmed by measuring the activity.

  The decrease in POXB activity is caused by disrupting the poxB gene according to a known method, for example, a method using homologous recombination or a method using the sacB gene (Schaffer, A. et al. Gene 145 (1994) 69-73). Can be performed. Specifically, it can be performed according to the method disclosed in International Publication No. 2005/113745.

  As the poxB gene, for example, GenBank Accession No. The gene has the base sequence of Cgl2610 (the complementary sequence of 2776576-2778505 of GenBank Accession No. BA000036), but has homology to the extent that homologous recombination occurs with the podB gene on the chromosomal DNA of the host bacterium. Therefore, a homologous gene of the sequence can also be used. Here, the homology that causes homologous recombination is preferably 80% or more, more preferably 90% or more, and particularly preferably 95% or more. In addition, homologous recombination can occur if the DNAs can hybridize with each other under stringent conditions.

  “ACH activity” refers to the activity of catalyzing the reaction of producing acetic acid from acetyl-CoA and water. “Modified to reduce ACH activity” means that ACH activity is lower than that of an unmodified type, for example, a wild type strain.

  The ACH activity is preferably reduced to 30% or less per unit cell weight, more preferably 10% or less, compared to the unmodified type. The “decrease” includes the case where the activity is completely lost. ACH activity is described, for example, by Gergely, J. et al. , Et al. , (1952) J. Am. Biol. Chem. 198 It can be measured by the method described in p323-334 etc.

  ACH activity is reduced by disrupting the ach gene according to a known method, for example, a method using homologous recombination or a method using the sacB gene (Schaffer, A. et al. Gene 145 (1994) 69-73). It can be carried out. Specifically, it can be performed according to the method disclosed in International Publication No. 2005/113744.

  Examples of the ach gene include GenBank Accession No. A gene having the base sequence of Cgl2569 (the complementary sequence of 2729376-2730917 of GenBank Accession No. BA00000036) is mentioned, but it has homology to the extent that homologous recombination occurs with the ach gene on the chromosomal DNA of the host bacteria. Therefore, a homologous gene of the sequence can also be used. Here, the homology that causes homologous recombination is preferably 80% or more, more preferably 90% or more, and particularly preferably 95% or more. In addition, homologous recombination can occur if the DNAs can hybridize with each other under stringent conditions.

  Microorganisms recombined with the FRD gene can be constructed by the methods described in Japanese Patent Application Laid-Open No. 2005-95169 and International Publication No. 2010/003728.

  Microorganisms recombined with the MDH gene can be constructed by the methods described in Japanese Patent Application Laid-Open No. 2006-320208 and International Publication No. 2010/003728.

  A microorganism in which the MAE gene is recombined can be constructed by the methods described in International Publication Nos. 2010/003728 and 2007/061590.

  In addition, the microorganisms used in the production method of the present invention include two or more of the above modifications in addition to the enhancement of the supplementary pathway enzyme activity, or the enhancement of the supplementary pathway enzyme activity and the reduction of pyruvate-derived byproduct production activity. It may be a microorganism obtained by combining these modifications.

Among the microorganisms, a microorganism that is at least one of those that have been genetically modified so that lactate dehydrogenase activity is reduced compared to the unmodified type and those that have been genetically modified so that pyruvate carboxylase activity is enhanced compared to the unmodified type More preferred are microorganisms that have been genetically modified so that lactate dehydrogenase activity is reduced compared to the unmodified form and genetically modified so that pyruvate carboxylase activity is enhanced compared to the unmodified form.

Preferred microorganisms include, for example, the Brevibacterium flavum MJ233 / PC-4 / ΔLDH strain described in Japanese Patent Application Laid-Open No. 2008-259451, the alcohol dehydrogenase described in International Publication No. 2010/003728, etc. Disruption of ADH1 and ADH2 genes, destruction of GPD1 gene encoding glycerol 3-phosphate dehydrogenase, and phosphoenolpyruvate carboxykinase gene, malate dehydrogenase gene, fumarase gene, NADH type fumarate reductase gene and malate transport protein gene Recombinant yeast strain SUC-200 (MATA
ura3-52 leu2-112 trp1-289 adh1 :: lox adh2 :: lox gpd1 :: Kanlox, overexpressing PCKa, MDH3, FUMR, FRDg and SpMAE1).

(3) Seed culture As the microorganism used in the production method of the present invention, a microorganism cultured on a slope in a solid medium such as an agar medium may be directly used for the production reaction of succinic acid. It is preferable to use a culture medium (seed culture) in a liquid medium.

  As a medium used for seed culture, a normal medium used for culturing the above-mentioned microorganism can be used. For example, a general medium in which natural nutrient sources such as meat extract, yeast extract and peptone are added to a composition comprising inorganic salts such as ammonium sulfate, potassium phosphate and magnesium sulfate can be used.

  The sugar used for seed culture is not particularly limited as long as it is a sugar that can be succinic acid produced by the above-mentioned microorganisms. Usually, galactose, lactose, glucose, fructose, glycerol, sucrose, saccharose, starch, cellulose, etc. Carbohydrates; fermentable carbohydrates such as polyalcohols such as glycerin, mannitol, xylitol and ribitol are used, among which glucose, sucrose, fructose and glycerol are preferred, and glucose, purified sucrose and impurities containing impurities X are particularly preferred. Sugar is preferred. Purified sucrose is more preferred in that it does not contain fructose, which has a poor yield of microorganisms per oxygen supply.

  Moreover, the starch saccharified liquid and molasses containing the said fermentable saccharide | sugar can also be used. These sugars can be used alone or in combination.

The content of the sugar in the medium used for seed culture is not particularly limited, but is advantageously as high as possible within a range not inhibiting the production of succinic acid. V), preferably 10 to 20% (W / V). Further, additional sugar may be added in accordance with the decrease of the sugar as the reaction proceeds.
The medium containing sucrose used for seed culture of succinic acid is preferably subjected to a heat treatment before acting on a microorganism having ability to produce succinic acid. Moreover, it is preferable to adjust the pH of the reaction solution containing sucrose to usually 6 or more, preferably 7 or more, and usually 10 or less, preferably 9 or less before the heat treatment. By setting the pH of the reaction solution containing sucrose before the heat treatment to 6 or more, production of fructose which is a decomposition product of sucrose can be prevented.

The conditions for seed culture in which the microorganisms used in the production method of the present invention are preliminarily grown can be appropriately set depending on the microorganisms to be used. However, in the case of coryneform bacteria, the optimal growth temperature is usually 20 ° C to 40 ° C. In the case of yeast, it is usually 10 ° C to 40 ° C, more preferably 20 ° C to 35 ° C, particularly preferably 30 ° C to 35 ° C. At 35 ° C., both are conducted with aeration and stirring while supplying oxygen. The culture time may be a time for obtaining a certain amount of microorganisms, but is usually 6 to 96 hours. The optimum growth temperature refers to the temperature at which the growth rate is fastest under the conditions used for producing succinic acid.

  In addition, as a method for preparing a microorganism more suitable for the production of succinic acid, a method for culturing so as to alternately and repeatedly repeat depletion and fullness of the carbon source described in Japanese Patent Application Laid-Open No. 2008-259451 is also used. Can do.

  The microorganism after the seed culture is preferably used in the method of the present invention after being collected by centrifugation, membrane separation or the like. In this invention, the processed material of this microorganism can also be used as a microorganism used for the manufacturing method of this invention. Examples of the processed microorganisms include microorganisms cultured and recovered by the above-described method fixed with acrylamide, carrageenan, etc., disrupted microorganisms, centrifuged supernatant of the disrupted substances, and supernatant obtained from ammonium sulfate. Examples include fractions partially purified by treatment.

(4) Succinic acid production reaction In the production method of the present invention, succinic acid is produced by allowing a microorganism having succinic acid-producing ability to act on sucrose containing impurities X. The microorganism used for producing the succinic acid is preferably a microorganism obtained by proliferating in advance by seed culture.

  The production method of the present invention comprises a step of growing a microorganism having succinic acid-producing ability in advance (a seed culture step), and a microorganism obtained by the seed culture step is allowed to act on sucrose containing an impurity X to produce succinic acid. It is preferable to include the process (succinic acid production | generation process) which produces | generates, and it is more preferable to supply sucrose separately in a seed culture process and a succinic acid production | generation process, respectively.

  That is, in the seed culture process for mainly growing microorganisms, if sugars used for both the growth of microorganisms and succinic acid production are supplied all at once, an aerobic atmosphere suitable for growth (the dissolved oxygen concentration in the culture solution is zero). ), The yield of microorganisms per sugar amount tends to be low. Therefore, it is preferable to supply sugar newly in the succinic acid production step that mainly produces succinic acid in an anaerobic atmosphere (oxygen-limited conditions).

  The sucrose used in the seed culture step may be the same as or different from the sucrose used in the succinic acid production step. The sucrose used in the succinic acid production step is preferably sucrose containing an impurity X that is presumed to have an action of enhancing the succinic acid metabolic system in an anaerobic atmosphere as described above.

  The content of sucrose containing impurities X in the reaction solution in the succinic acid production reaction is not particularly limited, but can be as high as possible within the range that does not inhibit the production of succinic acid, usually 5.0-30. % (W / V), preferably 10 to 20% (W / V).

  Moreover, additional addition of sucrose containing impurities X may be performed in accordance with the decrease of sucrose containing impurities X accompanying the progress of the succinic acid production reaction. The additional addition may be a stepwise addition or a continuous addition.

  On the other hand, when using microorganisms in which high-concentration sugars inhibit the production of succinic acid, such as yeast, it is preferable to add to the reaction solution sequentially so that the sugar-limiting condition is satisfied. Is preferably adjusted to 1 g / L or less, more preferably 0.7 g / L, and particularly preferably 0.5 g / L or less.

The reaction solution containing sucrose used in the succinic acid production reaction is preferably subjected to a heat treatment before acting on a microorganism having succinic acid-producing ability. Moreover, it is preferable to adjust the pH of the reaction solution containing sucrose to usually 6 or more, preferably 7 or more, and usually 10 or less, preferably 9 or less before the heat treatment. By setting the pH of the reaction solution containing sucrose before the heat treatment to 6 or more, decomposition of sucrose can be prevented.

  The reaction solution containing sucrose used for the succinic acid production reaction is not particularly limited. For example, the reaction solution may be a medium for culturing microorganisms capable of producing succinic acid, or a buffer solution such as a phosphate buffer. It may be. The reaction solution is preferably an aqueous solution containing a nitrogen source and an inorganic salt.

  The nitrogen source is not particularly limited as long as it is a nitrogen source that can be used by microorganisms capable of producing succinic acid to produce succinic acid and the like. Specifically, for example, ammonium salt, nitrate, urea, soybean hydrolyzate, etc. Examples include various organic and inorganic nitrogen compounds such as degradation products, casein degradation products, peptone, yeast extract, meat extract, and corn steep liquor.

  Examples of the inorganic salt include metal salts such as various phosphates, sulfates, magnesium, potassium, manganese, iron, and zinc. In addition, factors that promote growth such as vitamins such as biotin, pantothenic acid, inositol, and nicotinic acid, nucleotides, and amino acids are added as necessary. In order to suppress foaming during the reaction, it is desirable to add an appropriate amount of a commercially available antifoaming agent to the culture solution.

  The reaction solution used for the succinic acid production reaction contains, for example, carbonate ion, bicarbonate ion, carbon dioxide gas (carbon dioxide gas), in addition to sucrose, nitrogen source and inorganic salt containing the impurity X described above. It is preferable to make it. Carbonate ions and bicarbonate ions are supplied from magnesium carbonate, sodium carbonate, sodium bicarbonate, potassium carbonate and potassium bicarbonate, which can also be used as a neutralizing agent. Or it can also supply from these salts or carbon dioxide gas.

  Specific examples of the carbonate or bicarbonate salt include magnesium carbonate, ammonium carbonate, sodium carbonate, potassium carbonate, ammonium bicarbonate, sodium bicarbonate and potassium bicarbonate. The carbonate ions and bicarbonate ions are preferably added at a concentration of 1 to 500 mM, more preferably 2 to 300 mM, and still more preferably 3 to 200 mM. When carbon dioxide gas is contained, 50 mg to 25 g, more preferably 100 mg to 15 g, and still more preferably 150 mg to 10 g of carbon dioxide gas is contained per liter of the solution.

  The pH of the reaction solution used for the succinic acid production reaction should be adjusted by adding sodium carbonate, sodium bicarbonate, potassium carbonate, potassium bicarbonate, magnesium carbonate, sodium hydroxide, calcium hydroxide, magnesium hydroxide, etc. Can do.

  The pH of the reaction solution used for the succinic acid production reaction is usually 5 to 10, preferably 6 to 9.5 for microorganisms with weak acid resistance. The pH is adjusted within the above range with an alkaline substance, carbonate, urea or the like.

  On the other hand, when a highly acid-resistant microorganism such as a filamentous fungus or a yeast is used, the pH of the reaction solution used for the succinic acid production reaction is usually pH 1 to 5, preferably pH 1.5 to 4, particularly preferably pH 2. It is preferable to set it to -3.5.

  The reaction temperature in the succinic acid production reaction is preferably set to an optimum growth temperature for microorganisms having the ability to produce succinic acid, or a temperature 2 to 20 ° C. higher than the optimum growth temperature, and a temperature 7 to 15 ° C. higher. More preferably. Specifically, for example, in the case of coryneform bacteria, the reaction temperature is preferably 37 to 45 ° C, more preferably 39 to 45 ° C, still more preferably 39 to 43 ° C, It is especially preferable to set it as 39-41 degreeC.

  During the reaction for producing succinic acid, it is not always necessary to use a suitable temperature, but it is preferable to set the temperature within the above temperature range for 50% or more, preferably 80% or more of the total reaction time. The reaction time in the succinic acid production reaction is preferably 1 to 168 hours, more preferably 3 to 72 hours.

  The amount of cells in the reaction solution in the succinic acid production reaction is not particularly defined, but is preferably 1 to 700 g / L, more preferably 10 to 500 g / L, and still more preferably 20 to 400 g / L.

  The succinic acid production reaction may be carried out by aeration and stirring, but it is preferably carried out in an anaerobic atmosphere in which no aeration is performed and oxygen is not supplied or the aeration is restricted and the oxygen supply amount is limited. Here, “under an anaerobic atmosphere” means that the reaction is performed while the dissolved oxygen concentration in the solution is kept low.

  When the succinic acid production reaction is carried out in an anaerobic atmosphere, the dissolved oxygen concentration is usually preferably 0 ppm or more. Further, it is usually 2 ppm or less, preferably 1 ppm or less, more preferably 0.5 ppm or less. As a method for carrying out the succinic acid generation reaction in an anaerobic atmosphere, for example, the container is sealed and reacted without aeration, or an inert gas such as nitrogen gas is supplied to react. It can be obtained by a method such as venting active gas.

  The doubling time of the microorganism having succinic acid-producing ability in the succinic acid production reaction is not particularly limited, but is usually 40 hours or longer, preferably 50 hours or longer, more preferably 60 hours or longer. Also, it is usually 500 hours or shorter, preferably 300 hours or shorter, more preferably 200 hours or shorter.

  By setting the doubling time to 40 hours or more, it is possible to prevent a decrease in the amount of succinic acid produced because sugar is used for cell growth, and to suppress an increase in by-products produced along with the growth. The cost in the succinic acid production process can be reduced. In addition, by setting the doubling time to 500 hours or less, it is possible to prevent a decrease in the amount of succinic acid produced due to the killing of the cells that are the catalyst.

  Here, the doubling time of the microorganism having the ability to produce succinic acid in the succinic acid production reaction is the time taken for the number of the microorganisms to increase by a factor of two, and the concentration of cells at two points (OD) ) Or based on the value of the dry cell mass, the following formula (1) is used.

In the above formula (1), T2 and T1 are sampling points at two points, and X1 and X2 are values of the cell concentration or dry cell weight corresponding to the two points.

  By the reaction as described above, succinic acid is generated and accumulated in the reaction solution. Succinic acid accumulated in the reaction solution (culture solution) can be collected from the reaction solution according to a conventional method. Specifically, for example, solid substances such as bacterial cells are removed by centrifugation and filtration, and then desalted with an ion exchange resin or the like and purified from the solution by crystallization or column chromatography. Acid can be collected.

  After producing succinic acid by the production method of the present invention described above, the obtained succinic acid can be hydrogenated to produce 1,4-butanediol. 1,4-butanediol is used as a raw material for polybutylene succinate resin, polybutylene terephthalate resin, tetrahydrofuran (solvent), and γ-butyrolactan which is a precursor of N-methylpyrrolidone and N-vinylpyrrolidone.

  Furthermore, a succinic acid-containing polymer can be produced by conducting a polymerization reaction using succinic acid produced by the production method of the present invention as a raw material. In recent years, as the number of environmentally friendly industrial products has increased, attention has been focused on polymers using plant-derived raw materials. In particular, succinic acid produced by the production method of the present invention is a polymer such as polyester and polyamide. It can be processed and used.

  As the succinic acid-containing polymer, specifically, for example, a succinic acid polyester obtained by polymerizing a diol such as butanediol and ethylene glycol and succinic acid, and a diamine such as hexamethylenediamine and succinic acid are polymerized. Examples thereof include succinic acid polyamide.

  The succinic acid obtained by the production method of the present invention or a composition containing the succinic acid can be used for food additives, pharmaceuticals, cosmetics and the like.

  Hereinafter, the present invention will be described in more detail with reference to examples. However, the present invention is not limited to these examples.

Example 1 Effect of sucrose containing impurity X (in the presence of NaHCO ₃ )
<Seed culture>
100 mL seed culture medium (urea: 4 g, ammonium sulfate: 14 g, monopotassium phosphate: 0.5 g, dipotassium phosphate 0.5 g, magnesium sulfate heptahydrate: 0.5 g, ferrous sulfate-7 water Japanese product: 20 mg, manganese sulfate / hydrate: 20 mg, yeast extract: 1 g, casamino acid: 1 g, thiamine hydrochloride: 200 μg, biotin: 200 μg, and distilled water: 1000 mL of medium 100 mL) are put into a 500 mL Erlenmeyer flask, Sterilized by heating at 120 ° C. for 20 minutes. This was cooled to room temperature, 4 mL of a 50% by weight sucrose (reagent special grade, manufactured by Wako Pure Chemical Industries) sterilized in advance was added, and Brevibacterium flavum MJ233 / described in Japanese Patent Application Laid-Open No. 2008-259451. PC-4 / ΔLDH strain was inoculated and seed-cultured at 30 ° C. for 16 hours.

<Succinic acid production reaction>
The obtained whole culture broth was collected by centrifugation at 5000 × g, 4 ° C. for 7 minutes, and a cell suspension medium (magnesium sulfate 7-hydrate: 1 g, ferrous sulfate 7-hydrate: 40 mg, manganese sulfate hydrate: 40 mg, monoammonium phosphate: 0.8 g, diammonium phosphate: 0.8 g, potassium chloride: 0.3 g, thiamine hydrochloride: 200 μg, biotin: 200 μg, and distilled water: 1000 mL ) After washing twice with 100 mL, it was suspended in a cell suspension medium so that the absorbance of OD660 was 20. Into a 4 mL reactor, 0.5 mL of the above cell suspension, a substrate solution (reagent special grade sucrose (manufactured by Wako Pure Chemical Industries) or sucrose containing each impurity X shown in Table 1): 50 g, hydrogen carbonate Sodium: 67.0 g dissolved in distilled water and made up to 1000 mL) 0.5 mL was added, and the mixture was reacted at 39 ° C. for 5 hours in an atmosphere of 20 vol% carbon dioxide gas and 80 vol% nitrogen gas. The doubling time of the MJ233 / PC-4 / ΔLDH strain in the succinic acid production reaction was 70 hours or more. After the reaction, the succinic acid concentration of the supernatant centrifuged at 12,000 rpm and room temperature for 5 minutes was quantified. The results are shown in Table 2.

  The method for measuring the amount of succinic acid accumulated in the centrifugal supernatant is as follows. The high-performance liquid chromatography system [UV detector; L-2400, RI detector; -2490, pump; L-2130, column oven; L-2350, autosampler; L-2200], and detected with succinic acid standard in the analysis at a wavelength of 210 nm using a UV detector The succinic acid accumulation amount was converted from the ratio of the succinic acid peak area value to the succinic acid peak area value detected in the supernatant. The measurement conditions of high performance liquid chromatography are shown below.

(Measurement condition)
Column: ULTRON PS-80H (manufactured by Shinwa Kako)
Eluent: 60 wt% perchloric acid 1.8 mL / 1 L distilled water Flow rate: 1.0 mL / min Column temperature: 60 ° C.
UV detection wavelength: 210 nm
Injection volume: 10 mL

  As shown in Table 2, when sucrose containing impurity X was used as a substrate, the amount of succinic acid accumulated in the reaction solution was clearly increased compared to purified sucrose (reagent special grade sucrose) as a control substrate. .

(Example 2) Effect of sucrose containing impurity X (in the presence of MgCO ₃ )
<Seed culture>
100 mL seed culture medium (urea: 4 g, ammonium sulfate: 14 g, monopotassium phosphate: 0.5 g, dipotassium phosphate 0.5 g, magnesium sulfate heptahydrate: 0.5 g, ferrous sulfate 7 water Japanese product: 20 mg, manganese sulfate / hydrate: 20 mg, yeast extract: 1 g, casamino acid: 1 g, thiamine hydrochloride: 200 μg, biotin: 200 μg, and distilled water: 1000 mL of medium 100 mL) are put into a 500 mL Erlenmeyer flask, Sterilized by heating at 120 ° C. for 20 minutes. This was cooled to room temperature, 4 mL of 50 wt% sucrose (reagent special grade, manufactured by Wako Pure Chemical Industries) aqueous solution sterilized in advance was added, and the above Brevibacterium flavum MJ233 / PC-4 / ΔLDH strain was inoculated for 16 hours. Seed culture was performed at 30 ° C.

<Succinic acid production reaction>
The obtained whole culture broth was collected by centrifugation at 5000 × g, 4 ° C. for 7 minutes, and a cell suspension medium (magnesium sulfate 7-hydrate: 1 g, ferrous sulfate 7-hydrate: 40 mg, manganese sulfate hydrate: 40 mg, monoammonium phosphate: 0.8 g, diammonium phosphate: 0.8 g, potassium chloride: 0.3 g, thiamine hydrochloride: 200 μg, biotin: 200 μg, and distilled water: 1000 mL After washing twice with 100 mL, the suspension was suspended in a cell suspension medium so that the absorbance of OD660 was 40.

  In a 4 mL reactor, 0.5 mL of the above cell suspension is added to a substrate solution (reagent special grade sucrose (manufactured by Wako Pure Chemical Industries) or sucrose containing each impurity X shown in Table 1): 50 g of distilled water In addition, 194 g of magnesium carbonate was suspended and the volume was increased to 1000 mL with distilled water. 0.5 mL was added, and 3% at 39 ° C. in an atmosphere of 20 vol% carbon dioxide gas and 80 vol% nitrogen gas. Reacted for hours. After the reaction, the mixture was centrifuged at 12,000 rpm and room temperature for 5 minutes, and the succinic acid accumulation concentration of the supernatant was quantified in the same manner as in Example 1. The results are shown in Table 3. The doubling time of the MJ233 / PC-4 / ΔLDH strain related to the succinic acid production reaction was 70 hours or more.

As shown in Table 3, in the same manner as in the presence of NaHCO ₃ , when sucrose containing impurity X was used as a substrate, it was found in the reaction solution as compared with purified sucrose (reagent special grade sucrose) as a control substrate. The amount of succinic acid accumulated in the water was obviously improved.

(Example 3) Examination of the relationship between the absorbance of sucrose containing impurities X and the amount of accumulated succinic acid Absorbance was measured as a measure of the coloring degree of the sugar used. Using a microbalance, 10 g each of purified sucrose and sucrose containing various impurities X shown in Table 1 were weighed, placed in a 100 mL volumetric flask, and dissolved in distilled water to prepare a 10 wt% sugar aqueous solution. The absorbance at 350 nm and 500 nm of the aqueous sugar solution prepared using a spectrophotometer (manufactured by Shimadzu Corporation: UV-1200) was measured. When the absorbance was 1.0 or more, it was appropriately diluted, and after confirming that the absorbance was 1.0 or less, the absorbance was calculated by multiplying the value by the dilution factor. The absorbance measurement results are shown in Table 4. The detection limit of this measurement is 0.010.

  Also, FIG. 1 shows the relationship between the succinic acid accumulation concentration in the microorganism using sucrose containing each impurity X obtained in Example 1 as a raw material and the absorbance measured above, and FIG. The relationship of the succinic acid accumulation density | concentration in microorganisms at the time of the magnesium carbonate neutralization obtained by 2 is shown, respectively.

  As apparent from FIGS. 1 and 2, it was found that there is a positive correlation between the absorbance of sucrose containing the impurity X and the amount of accumulated succinic acid. In particular, when the absorbance at 350 nm of a 10% by weight sucrose solution is preferably 0.50 or more, more preferably 3.0 or more, and even more preferably 4.0 or more, the succinic acid accumulation amount is It turned out to be expensive.

(Example 4) Examination of relationship between content of impurity X in sucrose and accumulated amount of succinic acid Using a microbalance, 1 g each of purified sucrose and sucrose containing various impurities X shown in Table 1 were weighed. Then, it was put into a 100 mL volumetric flask and dissolved in distilled water to prepare a 1 wt% sugar aqueous solution, and impurities were confirmed. Hitachi high performance liquid chromatography system [UV detector; L-2400, RI detector; L-2490, pump; L-2130, column oven; L-2350, autosampler; L-2200] is used for confirmation of impurities. Measured. The measurement conditions are shown below.

(Measurement condition)
Column: ULTRON PS-80H (manufactured by Shinwa Kako)
Eluent: 60 wt% perchloric acid 1.8 mL / 1 L distilled water Flow rate: 1.0 mL / min Column temperature: 60 ° C.
UV detection wavelength: 210 nm
Injection volume: 10 mL

ULTRON PS-80H (manufactured by Shinwa Kako) is a polymer-based organic acid analysis column packed with a substrate-crosslinked styrene divinylbenzene copolymer having a particle size of 10 μm and a crosslinking degree of 8%, and the inner diameter of the column is 8 mm. The column length is 300 mm.
As a result of analysis at a wavelength of 210 nm using a UV detector, any sucrose containing impurity X used immediately after the elution peak of fructose, which is a sucrose hydrolyzate, that is, a retention time of 6.7 to 6. A substance having a UV absorption maximum was detected at 95 minutes, and this substance was defined as impurity X. In the analysis using the RI detector, the impurity X did not show a significant absorption intensity at the same position, suggesting that the impurity X is a substance having strong absorption in the ultraviolet region.

  The content of impurity X in sucrose is measured by analyzing a succinic acid sample having a concentration of 10 g / L under the same analysis conditions as the peak area value of the impurity X by the above analysis. It calculated | required by converting with the density | concentration of a succinic-acid sample using the ratio with the peak area value of an acid. This concentration is shown in Table 5. This detection limit value is 0.010 g / L.

  The area value of impurity X is calculated from the point where the peak is vertically divided at the valley between the fructose and impurity X peaks, from the start point (6.6 minutes) to the impurity X peak end point (7.2 minutes). Was integrated to obtain an area value. The baseline was the horizontal line from the rising edge of the first peak (3.8 minutes) to the impurity X peak end point.

  As an example of showing the impurity X, a high-performance liquid chromatography chart of the reagent special grade sucrose (manufactured by Wako Pure Chemical Industries) and this millet red sugar (manufactured by Nisshin Sugar Co., Ltd.) when analyzed using a UV detector with a wavelength of 210 nm. The overwritten one is shown in FIG. However, under the above measurement conditions, sucrose is decomposed and a fructose peak is detected.

  The peak positions of succinic acid and acetic acid when analyzed under the same conditions are also shown in FIG. FIG. 4 shows a high-performance liquid chromatographic chart overwritten when this millet red sugar (manufactured by Nissin Sugar Co., Ltd.) is analyzed using a UV detector and a RI detector with wavelengths of 210 nm and 280 nm.

  FIG. 5 shows the relationship between the impurity X and the succinic acid accumulation concentration during neutralization of sodium bicarbonate. FIG. 6 shows the relationship between impurity X and succinic acid accumulation concentration during neutralization of magnesium carbonate.

  As shown in Table 5, it was found that the content of impurity X in the reagent grade sucrose, which is purified sucrose, was less than 0.02 g / L of impurity X under the above measurement conditions. The biotin preparation was subjected to the high performance liquid chromatography analysis, but no peak was detected.

  Moreover, as shown to FIGS. 3-5, it turned out that there exists a positive correlation between the UV peak area value of the impurity X contained in each crude sugar, and the succinic-acid accumulation density | concentration shown in Table 2 and Table 3. .

Example 5 Effect of Sucrose Containing Impurity X in Yeast (A) Preparation of Yeast Chromosomal DNA Saccharomyces cerevisiae YPH500 strain (STRATAGENE) was treated with YPAD liquid medium (1 wt% yeast extract, 2 wt% polypeptone) 20 μg / ml adenine, 2 wt% glucose) was inoculated into 10 ml, and cultured with shaking at 30 ° C. for 16 hours. Bacteria are collected from the culture solution, and STES buffer (0.1 M NaCl, 0.01 M tris (hydroxymethyl) aminomethane (hereinafter abbreviated as “Tris”), 0.001 M ethylenediaminetetraacetate (hereinafter “EDTA”) is collected. ”), 0.1 wt% sodium lauryl sulfate, pH 7.5) After suspension in 0.1 ml, quartz sand was added in the same volume as the cells.

The sample was stirred with a vortex mixer for 30 seconds, then left on ice for 1 minute, and this operation was repeated three times. Phenol / chloroform / isoamyl alcohol (volume ratio 25:
0.1 ml of 24: 1) was added, and similarly, stirring for 30 seconds and standing on ice for 1 minute were repeated twice.

  The aqueous layer was recovered by separating it into two layers using a microcentrifuge. After adding an equal volume of chloroform and stirring, it was similarly separated into two layers by a microcentrifuge, and the aqueous layer was recovered. After adding 1/10 volume of 3M sodium acetate solution (pH 5.2) and 2.5 volumes of 99% ethanol to precipitate and recover DNA, 0.05 ml of TE buffer (0.01 M Tris, 0.001 M Dissolved in EDTA, pH 7.5). To the obtained DNA, 5 mL of a 10 mM Tris buffer (pH 7.5) -1 mM EDTA · 2Na solution was added and left overnight at 4 ° C., and used as template DNA for subsequent PCR.

(B) Preparation of yeast pdc1 and pdc5 gene fragments for gene disruption The DNA fragment containing the genes pdc1 and pdc5 encoding Saccharomyces cerevisiae-derived pyruvate decarboxylase is the chromosome of Saccharomyces cerevisiae YPH500 strain obtained in (A) above. DNA was used as a template for synthesis and isolation by PCR. Details of the method are shown below.

  For the synthesis of the PDC1 gene fragment by PCR, the forward primer PDC1-F (SEQ ID NO: 1: 5′-aaactgcagagttagctatttgaatcagctttagtgtggtgggtggtgtgtgtgtgtgtggtgtgtgtgtgtgtgtgt . With this primer combination, a fragment containing the protein coding region of PDC1 can be amplified. Further, the restriction enzyme PstI and SpeI recognition sequence can be synthesized on the 5 'side, and the BamHI and SpeI recognition sequence can be synthesized on the 3' side.

For the synthesis of the PDC5 gene fragment by PCR, the forward primer PDC5-F (SEQ ID NO: 3: 5′-aaactgcagaaaatagtctgaaaaatacttag)
g-3 ′) and reverse primer PDC5-R (SEQ ID NO: 5: 5′-aaaggatccttattgttttagcgttagtagggggcag-3 ′). With this primer combination, a fragment containing the protein coding region of PDC5 can be amplified. Further, the restriction enzyme PstI recognition sequence can be synthesized on the 5 ′ side and the BamHI recognition sequence can be synthesized on the 3 ′ side.

  For PCR, PrimeSTAR polymerase (manufactured by Takara Bio Inc.) was used, and a cycle consisting of 94 ° C. for 10 seconds, 53 ° C. for 5 seconds, and 72 ° C. for 2 minutes 30 seconds was repeated 30 times. This PCR product was subjected to agarose gel electrophoresis, and an about 2.2 kbp pdc1 gene fragment and an about 1.7 kbp pdc5 gene fragment were confirmed.

(C) Construction of PDC1 gene disruption plasmid pT7Blue-pdc1 :: URA3 The PDC1 gene fragment PCR-synthesized in (B) above is a restriction enzyme PstI (manufactured by Takara Bio Inc., unless otherwise specified. And pT7Blue (manufactured by Takara Bio Inc.) cut with BamHI and treated with the same restriction enzymes, and mixed with TaKaRa DNA Ligation Kit Ver. 2 (manufactured by Takara Bio Inc.). Escherichia coli DH5α strain was transformed with this ligated product, and LB agar medium (1 wt% tryptone, 0.5 wt% yeast extract, 0.5 wt% NaCl containing 50 mg / ml ampicillin and 50 μg / mL X-Gal was used. 1.5% by weight agar). A clone forming a white colony on this medium was subjected to liquid culture by a conventional method, and then a plasmid was extracted by an alkali-SDS method. A plasmid in which about 2.2 kbp and 2.8 kbp fragments were confirmed by digestion with the restriction enzyme SpeI by agarose gel electrophoresis was designated as the target plasmid, and named pT7Blue-PDC1.

  Next, pT7Blue-PDC1 was cleaved with HincII to delete the internal 1,614 bp of the PDC1 gene. To this deletion, a URA3 gene fragment, which is a gene of about 1.2 kbp yeast uracil synthesis system obtained by cutting the plasmid pUC-URA3 with HindIII and smoothing, was transferred to TaKaRa DNA Ligation Kit Ver. 2 (manufactured by Takara Bio Inc.). In the same manner as described above, Escherichia coli DH5α strain was transformed with a ligated product of pT7Blue-PDC1 and URA3 gene fragment, and a plasmid was extracted from the resulting clone. A plasmid of about 1.8 kbp and 2.8 kbp fragments confirmed by digestion with the restriction enzyme SpeI by agarose gel electrophoresis was designated as the target plasmid, and named pT7Blue-pdc1 :: URA3.

  PUC-URA3 is a plasmid prepared by the following method. Using the chromosomal DNA of Saccharomyces cerevisiae S288C strain (ATCC204508) obtained by the method of (A) above as a template, forward primer URA3-F (SEQ ID NO: 5′-ggttaatgtgggtgtgtgtcagg-3 ′), reverse primer URA3-R (sequence) No. 6: URA3 gene fragment containing the promoter region was synthesized and isolated by PCR using 5′-gcgaggttattggatagttcc-3 ′). For PCR, Taq polymerase (manufactured by Takara Bio Inc.) was used, and a cycle consisting of 94 ° C. for 1 minute, 53 ° C. for 1 minute, and 72 ° C. for 1 minute 30 seconds was repeated 30 times.

  The obtained PCR product was subjected to agarose gel electrophoresis, and an about 1.2 kbp URA3 gene fragment was confirmed. This ADE2 gene fragment was cleaved with the restriction enzyme HindIII, digested with the same restriction enzyme, mixed with pUC18 (manufactured by Takara Bio Inc.) that had been BAP-treated and dephosphorylated, and TaKaRa DNA Ligation Kit Ver. 2 (manufactured by Takara Bio Inc.). Escherichia coli JM109 strain was transformed with this ligated product, and LB agar medium (1 wt% tryptone, 0.5 wt% yeast extract, 0.5 wt% NaCl containing 50 mg / ml ampicillin and 50 μg / mL X-Gal was used. 1.5% by weight agar). A clone forming a white colony on this medium was subjected to liquid culture by a conventional method, and then a plasmid was extracted by an alkali-SDS method. It was confirmed by agarose gel electrophoresis that fragments of about 1.2 kbp and 2.7 kbp were generated by cleavage with the restriction enzyme HindIII.

(D) Construction of PDC5 gene disruption plasmid pT7Blue-pdc5 :: ADE2 The PDC5 gene fragment PCR-synthesized in (B) above was cleaved with restriction enzymes PstI and BamHI, and treated with the same restriction enzymes pT7Blue (manufactured by Takara Bio Inc.) And mixed with TaKaRa DNA Ligation Kit Ver. 2 (manufactured by Takara Bio Inc.). Escherichia coli DH5α strain was transformed with this ligated product, and LB agar medium (1 wt% tryptone, 0.5 wt% yeast extract, 0.5 wt% NaCl containing 50 mg / ml ampicillin and 50 μg / mL X-Gal was used. 1.5% by weight agar). A clone forming a white colony on this medium was subjected to liquid culture by a conventional method, and then a plasmid was extracted by an alkali-SDS method. A plasmid of about 1.7 kbp and 2.8 kbp that could be confirmed by digestion with restriction enzymes PstI and BamHI by agarose gel electrophoresis was designated as the target plasmid, and named pT7Blue-PDC5.

Next, pT7Blue-PDC5 was cut with XbaI and smoothed to delete the internal 136 bp of the PDC5 gene. To this deletion, an ADE2 gene fragment, which is a gene of the yeast adenine synthesis system of about 2.5 kbp obtained by cutting plasmid pUC-ADE2 with SmaI, was added to TaKaRa DNA Ligation Kit Ver. 2 (manufactured by Takara Bio Inc.). In the same manner as above, Escherichia coli DH5α strain was transformed with a ligated product of pT7Blue-PDC5 and ADE2 gene fragment, and plasmid was extracted from the resulting clone. A plasmid of about 2.5 kbp and 4.1 kbp fragments confirmed by digestion with restriction enzymes PstI and BamHI by agarose gel electrophoresis was designated as the target plasmid, and named pT7Blue-pdc5 :: ADE2.

  PUC-ADE2 is a plasmid prepared by the following method. Using the chromosomal DNA of Saccharomyces cerevisiae S288C strain (ATCC204508) obtained by the method of (A) above as a template, forward primer ADE2-F (SEQ ID NO: 7: 5′-gaattcccggggtaacggccgtacctgtgtattaac-3 ′), reverse primer ADE2-R (sequence) The ADE2 gene fragment containing the promoter region was synthesized and isolated by PCR using No. 8: 5′-ggatccccgggtgtatttattatgatagaattc-3 ′). For PCR, Taq polymerase (manufactured by Takara Bio Inc.) was used, and a cycle consisting of 94 ° C. for 1 minute, 53 ° C. for 1 minute, and 72 ° C. for 3 minutes was repeated 30 times.

  The obtained PCR product was subjected to agarose gel electrophoresis, and an ADE2 gene fragment of about 2.5 kbp was confirmed. This ADE2 gene fragment was digested with the restriction enzyme SmaI, digested with the same restriction enzyme, mixed with pUC19 (manufactured by Takara Bio Inc.) that had been BAP-treated and then dephosphorylated, and TaKaRa DNA Ligation Kit Ver. 2 (manufactured by Takara Bio Inc.). Escherichia coli JM109 strain was transformed with this ligated product, and LB agar medium (1 wt% tryptone, 0.5 wt% yeast extract, 0.5 wt% NaCl containing 50 mg / ml ampicillin and 50 μg / mL X-Gal was used. 1.5% by weight agar). A clone forming a white colony on this medium was subjected to liquid culture by a conventional method, and then a plasmid was extracted by an alkali-SDS method. It was confirmed by agarose gel electrophoresis that fragments of about 2.5 kbp and 2.7 kbp were generated by cleavage with the restriction enzyme SmaI.

(E) Production of PDC5 gene disruption strain YPH500 / ΔPDC5 by introduction of gene disruption fragment pdc5 :: ADE2 Plasmid pT7Blue-pdc5 :: ADE2 constructed in (D) above was digested with restriction enzymes PstI and BamHI, and agarose gel A DNA fragment (pdc5 :: ADE2) of about 4.1 kbp was extracted from GENE CLEAN II KIT (Funakoshi). Using this DNA fragment, Saccharomyces cerevisiae YPH500 strain (MATα
leu2-, ura3-, trp1-, his3-, ade2-, lys2-) by the lithium acetate method (Ito, H., Fukuda, Y., Murata, K. and
Kimura, A.A. (1983) J. Org. Bacteriol. 153 (1),
163-168), and SDE agar medium (100 mg / ml L-leucine, 20 mg / ml uracil, 20 mg / ml tryptophan, 20 mg / ml L-histidine, 30 mg / ml L-lysine). It was seeded on 0.17% by weight YEAST NITRROGEN BASE w / o AMINO ACIDS (manufactured by DIFCO), 2% by weight glucose, 1% by volume ethanol, 2% by weight agar) and cultured at 30 ° C. for 6 days.

Adenine non-requiring colonies grown on an agar medium were transferred to a YPAE liquid medium (1 wt%
Yeast extract, 2% by weight polypeptone, 20 μg / ml adenine, 2% by volume ethanol) was inoculated into 5 ml, and cultured with shaking at 30 ° C. for 16 hours. Chromosomal DNA was extracted from this culture solution by the method (A). Using this as a template, forward primer PDC5-F (SEQ ID NO: 3: 5′-aaactgcagcaaaatgtctgaaataactttagg-3 ′) and reverse primer PDC5-R (SEQ ID NO: 5′-aaaggagtccttattttgtcgttagcgtcgcpgccccccgcpgcccggcggcggcggcgg The presence or absence of homologous recombination on the locus was examined. For PCR, PrimeSTAR polymerase (manufactured by Takara Bio Inc.) was used, and a cycle consisting of 94 ° C. for 10 seconds, 53 ° C. for 5 seconds, and 72 ° C. for 4 minutes was repeated 30 times.

  As a comparative control, PCR was performed in the same manner using the chromosomal DNA of the YPH500 strain, plasmids pT7Blue-PDC5, pT7Blue-pdc5 :: ADE2 as a template. A transformant in which a DNA fragment of about 4.1 kbp, which was the same as pT7Blue-pdc5 :: ADE2, was detected by agarose gel electrophoresis and the PDC5 gene was confirmed to be disrupted by homologous recombination was named YPH500 / ΔPDC5.

(F) Preparation of double gene disruption strain YPH500 / ΔPDC5 / ΔPDC1 strain by introduction of gene disruption fragment pdc1 :: URA3 into YPH500 / ΔPDC5 strain Plasmid pT7Blue-pdc1 :: URA3 constructed in (C) above is a restriction enzyme The DNA fragment (pdc1 :: URA3) of about 1.8 kbp was extracted from the agarose gel with GENE CLEAN II KIT (Funakoshi). Using this DNA fragment, the YPH500 / ΔPDC5 strain prepared in (E) above was transformed into the lithium acetate method (Ito, H., Fukuda, Y., Murata, K. and Kimura, A. (1983) J. Bacteriol. 153 ( 1), 163-168), SDE agar medium (0.17 containing 100 mg / ml L-leucine, 20 mg / ml tryptophan, 20 mg / ml L-histidine, 30 mg / ml L-lysine) It was seeded on weight% Yeast NITRogen BASE w / o AMINO ACIDS (manufactured by DIFCO), 2 weight% glucose, 1 volume% ethanol, 2 weight% agar) and cultured at 30 ° C. for 6 days.

Adenine non-requiring colonies grown on an agar medium were transferred to a YPAE liquid medium (1 wt%
Yeast extract, 2% by weight polypeptone, 20 μg / ml adenine, 2% by volume ethanol) was inoculated into 5 ml, and cultured with shaking at 30 ° C. for 16 hours. Chromosomal DNA was extracted from this culture solution by the method (A). Using this as a template, forward primer PDC1-F (SEQ ID NO: 1: 5′-aaactgcagagtagtagctattattgaatcagctttagggtgagtgc-3 ′) and reverse primer PDC1-R (SEQ ID NO: 2: 5′-cgcggatccacttagggtcgtgtgttgtggttgtggt The presence or absence of homologous recombination on the locus was examined. For PCR, PrimeSTAR polymerase (manufactured by Takara Bio Inc.) was used, and a cycle consisting of 94 ° C. for 10 seconds, 53 ° C. for 5 seconds, and 72 ° C. for 2 minutes 30 seconds was repeated 30 times.

  As a comparative control, PCR was performed in the same manner using the chromosomal DNA of the YPH500 strain, plasmids pT7Blue-PDC1, and pT7Blue-pdc1 :: URA3 as templates. A transformant in which a DNA fragment of about 1.8 kbp, which was the same as pT7Blue-pdc1 :: URA3, was detected by agarose gel electrophoresis and confirmed that the PDC1 gene was disrupted by homologous recombination was named YPH500 / ΔPDC5 / ΔPDC1. did.

(G) Effect of crude sugar in yeast <Seed culture>
100 mL of culture medium (yeast extract: 10 g, peptone: 20 g, adenine: 20 mg, and distilled water: 1000 mL) was placed in a 500 mL Erlenmeyer flask and sterilized by heating at 120 ° C. for 20 minutes. This was cooled to room temperature, 2 mL of 99.5% ethanol sterilized in advance was added, and the Saccharomyces cerevisiae YPH500 / ΔPDC5 / ΔPDC1 strain was inoculated so that the turbidity OD660 was 0.1, and 30 ° C. and 160 rpm. And cultured for 88 hours with shaking.

<Succinic acid production reaction>
The total amount of the obtained culture broth was collected by centrifugation at 4000 × g, 25 ° C. for 3 minutes, and the cell suspension medium (monopotassium phosphate: 6 g, magnesium sulfate heptahydrate: 1 g, ethylenediaminetetraacetic acid) Disodium dihydrate: 30 mg, zinc sulfate heptahydrate: 9 mg, cobalt chloride hexahydrate: 0.6 mg, manganese chloride tetrahydrate: 2 mg, copper sulfate pentapentahydrate: 0.6 mg, calcium chloride dihydrate: 9 mg, iron sulfate heptahydrate: 6 mg, sodium molybdate dihydrate: 0.8 mg, boric acid: 2 mg, potassium iodide: 0.2 mg, Biotin: 0.1 mg, calcium pantothenate: 2 mg, nicotinic acid: 2 mg, inositol: 50 mg, thiamine hydrochloride: 2 mg, pyridoxine hydrochloride: 2 mg, and distilled water 1000 mL medium) in 100 mL After washing times, and suspended in microbial cells suspension medium such that the absorbance of OD660 is 80. In a 4 mL reactor, 0.5 mL of the above cell suspension and substrate solution (reagent special grade sucrose (manufactured by Wako Pure Chemical Industries) or powdered brown sugar (manufactured by Nissin Sugar Co., Ltd.): 100 g, magnesium carbonate: 60 g in distilled water 0.5 mL of a solution that has been dissolved and made up to 1000 mL) is added, and the reciprocating type shaker (model MLU-4-TR-250, manufactured by Able Co., Ltd.) is used in an atmosphere of 6% carbon dioxide gas and 14% oxygen gas. The reaction was carried out at 250 ° C. for 24 hours.

  After the reaction, the succinic acid concentration of the supernatant centrifuged at 12,000 rpm and room temperature for 5 minutes was quantified. The results are shown in Table 6.

  As shown in Table 6, when powdered brown sugar, which is a sucrose containing impurities X, is used as a substrate, the amount of succinic acid accumulated in the reaction solution compared to purified sucrose (reagent special grade sucrose) which is a control substrate Increased significantly.

(Example 6) Types of molasses and content of impurities X For the molasses shown in Table 7, the absorbance and the content of impurities X were measured by the methods described in Examples 3 and 4, respectively. The results are shown in Table 7.

  As shown in Table 7, impurity X is not contained in sugar beet-derived molasses (below the detection limit), whereas sugar cane-derived products are contained in high concentrations, but only in certain types of molasses. I found out.

(Example 7) Effect of molasses containing impurity X According to the method described in Example 1, the effect of molasses was confirmed. However, the substrate solution, reaction time, and succinic acid accumulation concentration used during the cell reaction were as described below. The substrate solution is a reagent special grade sucrose (manufactured by Wako Pure Chemical Industries, Ltd.) or a solution prepared by previously adjusting molasses shown in Table 7 to a sucrose concentration of 100 g / L: 500 mL, sodium bicarbonate: 67 g dissolved in distilled water, 1000 mL The solution was dissolved in

  The concentration of succinic acid in the reaction solution at 3 hours and 5 hours from the start of the reaction was quantified, and the accumulated concentration of succinic acid produced during the 2 hours is shown in Table 8. The doubling time of the MJ233 / PC-4 / ΔLDH strain related to the succinic acid production reaction was 70 hours or more.

  As shown in Table 8, compared to purified sucrose (reagent grade sucrose), the succinic acid accumulation concentration was improved when molasses containing impurity X was used as a substrate.

Example 8 Analysis of Impurity X by High Performance Liquid Chromatography The conditions described in Table 5 were used under the conditions described in Example 5 except that MCI GEL CK08EH (manufactured by Mitsubishi Chemical) was used as a separation column for high performance liquid chromatography. The raw sugar, fructose, and succinic acid sample were analyzed, and the resulting chromatographic chart is shown in FIG. MCI GEL CK08EH (manufactured by Mitsubishi Chemical) is a polymer-based organic acid analysis column packed with a substrate-crosslinked styrene divinylbenzene copolymer having a particle size of 9 μm and a crosslinking degree of 8%. The column length is 300 mm.

  Peak top time ([b]) and impurity X peak top time ([a]) of succinic acid sample separated and detected by ULTRON PS-80H (obtained in Example 4) and MCI GEL CK08EH, and Table 9 shows the ratio of the peak top time of the impurity X to the peak top time of the acid sample ([a] / [b]).

As shown in Table 9, the peak top time of the impurity X is detected in the range of 0.85 to 0.91 in the ratio to the peak top time of the succinic acid. The contents of the impurity X defined by the peak are as shown in Table 5 and Table 7.
Although the present invention has been described in detail and with reference to specific embodiments, it will be apparent to those skilled in the art that various changes and modifications can be made without departing from the spirit and scope of the invention.
This application is based on Japanese Patent Application No. 2009-099903 filed on Apr. 16, 2009, the contents of which are incorporated herein by reference.

Claims (12)

A method for producing succinic acid, wherein a microorganism having succinic acid producing ability is allowed to act on sucrose, wherein the sucrose is as follows.
Containing a substance that is detected at a retention time of 6.7 to 6.95 minutes when an aqueous solution prepared at a sucrose concentration of 1% by weight is measured using high performance liquid chromatography under the following measurement conditions; Sucrose whose content of a substance is 0.02 g / L-100 g / L as a succinic acid conversion value.
(Measurement condition)
Separation column; ULTRON PS-80H (manufactured by Shinwa Chemical)
Solvent: 60 wt% perchloric acid 1.8 mL / 1 L distilled water Flow rate: 1.0 mL / min Column temperature: 60 ° C
Detection wavelength: 210 nm UV
Injection volume: 10 μL A method for producing succinic acid, wherein a microorganism having succinic acid producing ability is allowed to act on sucrose, wherein the sucrose is as follows.
Containing a substance that is detected at a retention time of 6.7 to 6.95 minutes when an aqueous solution prepared at a sucrose concentration of 1% by weight is measured using high performance liquid chromatography under the following measurement conditions; Sucrose whose content of a substance is 0.02 g / L-100 g / L as a succinic acid conversion value.
(Measurement condition)
Separation column; based on a substrate-crosslinked styrene divinylbenzene copolymer having a particle size of 7 to 11 μm and a degree of crosslinking of 7 to 9%, an inner diameter of 7.8 to 8.2 mm and a length of 260 to 340 mm Some separation column Solvent; 60 wt% perchloric acid 1.8 mL / 1 L distilled water Flow rate; 1.0 mL / min Column temperature; 60 ° C
Detection wavelength: 210 nm UV
Injection volume: 10 μL A method for producing succinic acid, wherein a microorganism having succinic acid producing ability is allowed to act on sucrose, wherein the sucrose is as follows.
At the peak when an aqueous solution prepared with a sucrose concentration of 1% by weight was measured using high performance liquid chromatography under the following measurement conditions, the peak top time [a] is the peak top time [b] of the succinic acid standard. In the ratio ([a] / [b]) to 0.81 to 0.91, and the content of the substance in the aqueous solution is 0.02 g / Sucrose which is L-100g / L.
(Measurement condition)
Separation column; Separation column based on a substrate-crosslinked styrene divinylbenzene copolymer having a particle size of 7 to 11 μm Solvent; 60 wt% perchloric acid 1.8 mL / 1 L distilled water Flow rate: 1.0 mL / min Column Temperature: 60 ° C
Detection wavelength: 210 nm UV
Injection volume: 10 μL The method for producing succinic acid according to any one of claims 1 to 3, wherein the sucrose is as follows.
Sucrose having an absorbance at 350 nm of an aqueous solution having a sucrose concentration of 10% by weight of 0.50 to 100.   The microorganism having succinic acid-producing ability is a microorganism selected from the group consisting of coryneform bacteria, Escherichia coli, Anaerobiospirillum genus, Actinobacillus genus, filamentous fungi and yeast The manufacturing method of the succinic acid of any one of Claims 1-4.   The sucrose is a method for concentrating and purifying a sugar solution extracted from a plant, and is produced by a production method that does not perform a decolorization step. The method for producing succinic acid according to item.   The microorganism is at least one genetically modified so that lactate dehydrogenase activity is reduced compared to the unmodified type and genetically modified so that pyruvate carboxylase activity is enhanced compared to the unmodified type. The manufacturing method of the succinic acid of any one of Claims 1-6 characterized by the above-mentioned.   The succinic acid according to any one of claims 5 to 7, wherein the coryneform bacterium is selected from Corynebacterium glutamicum, Brevibacterium flavum, and Brevibacterium lactofermentum. Production method.   The method for producing succinic acid according to any one of claims 1 to 8, wherein succinic acid is produced by allowing a microorganism having succinic acid-producing ability to act on sucrose in an anaerobic atmosphere.   A seed culturing step for proliferating a microorganism having succinic acid-producing ability in advance, and a succinic acid producing step for producing succinic acid by allowing the microorganism obtained in the seed culturing step to act on sucrose containing impurities X. The manufacturing method of the succinic acid of any one of Claims 1-9.   A method for producing 1,4-butanediol, comprising a step of producing succinic acid by the method according to any one of claims 1 to 10, and a step of hydrogenating succinic acid obtained in the step.   The manufacturing method of a succinic-acid containing polymer including the process of manufacturing a succinic acid with the method of any one of Claims 1-10, and the process of performing a polymerization reaction using the succinic acid obtained at this process as a raw material.

Images