JP2010220590A - Screening method using new reporter gene - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for screening a candidate substance to a well-known antibacterial agent or a substance having equivalent antibacterial actions to a well-known antibacterial agent by specifying a gene specifically expressed in adding various antibacterial actions and using the gene as a reporter gene. <P>SOLUTION: The method comprises a step of measuring expression of a specific gene in a cell acted by a test substance; and a step of identifying the test substance as a candidate substance of antibacterial agent when expression of the gene varies as compared to expression produced in the case of not acting the test substance on a cell. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to a screening method using a gene that is specifically expressed by stimulation with an active substance as a reporter gene, and a promoter that controls the expression of the gene.

  Microorganisms are exposed to various environmental stresses such as high osmotic pressure, high temperature, nutrient starvation, oxidation, and wounds. When microorganisms are exposed to these environmental stresses, it is known that biochemical, physiological, and molecular reactions such as specific gene expression are induced and show responsiveness and adaptability to environmental stresses. Such reactions proceed as a result of stimulus recognition and signal transduction in microbial cells. Exposure to antibacterial agents is one of environmental stresses, suggesting that specific gene expression is induced, but the antibacterial effect of antibacterial agents and genes that are specifically induced when the antibacterial effect is added The current situation is that there is not much knowledge about the relationship.

  For example, respiration is essential for living organisms, and respiratory chain inhibitors are highly effective as antibacterial agents. Therefore, further development is desired for substances that exhibit antibacterial activity similar to known respiratory chain inhibitors.

  In addition, ergosterol is a component of a cell membrane peculiar to fungi and essential for survival, and an ergosterol biosynthesis inhibitor exhibits a high effect as an antibacterial agent. Therefore, further development is desired for substances exhibiting the same antibacterial action as known ergosterol biosynthesis inhibitors.

  Furthermore, the cell wall composed of glucan, chitin, etc. is a component unique to fungi and is essential for survival, and cell wall biosynthesis inhibitors are highly effective as antibacterial agents. Therefore, further development is desired for substances exhibiting the same antibacterial action as known cell wall biosynthesis inhibitors.

  Furthermore, the cell wall integrity pathway is a cell wall building control pathway centered on the MAP kinase signaling pathway consisting of BckA (MAPKKK) → MkkA (MAPKK) → MpkA (MAPK), and is a biologically conserved organism that is widely conserved in fungi. It is a system, and it is known that this pathway is activated when the cell wall is damaged by exposure to a cell wall biosynthesis inhibitor, etc., and the cell wall is reconstructed by controlling the transcription of cell wall biosynthesis related genes. . Since blocking or constitutive activation of the cell wall integrity pathway causes serious damage to cells, it is considered that cell wall integrity pathway inhibitors are highly effective as antibacterial agents. Therefore, development of cell wall integrity pathway inhibitors is desired.

  Furthermore, the MpkB pathway is a homologous pathway of the MAP kinase signaling pathway consisting of Saccharomyces cerevisiae Ste11 (MAPKKK) → Ste7 (MAPKK) → Fus3 / Kss1 (MAPK) and is a biological system that is widely conserved in fungi. In many plant pathogens, it has been reported that this pathway is essential for pathogenicity. Therefore, it is considered that MpkB pathway inhibitors exhibit high effects as antibacterial agents. Accordingly, development of MpkB pathway inhibitors is desired.

  Furthermore, the HOG pathway is a homologous pathway of the MAP kinase signaling pathway consisting of the budding yeast Ssk2 / 22 (MAPKKK) → Pbs2 (MAPKK) → Hog1 (MAPK), and is a biological system that is widely conserved in fungi. In many plant pathogens, it is reported that this pathway is essential for pathogenicity. Upstream of the HOG pathway, there is a two-component signal transduction system consisting of histidine kinase → phosphate group mediator → response regulator, and acts on this histidine kinase to constitutively activate the HOG pathway for antibacterial activity. Drugs that show a practical use as an active ingredient of agricultural chemicals, HOG pathway agonists are highly effective as antibacterial agents. Therefore, since further development is desired for substances exhibiting antibacterial activity similar to known HOG pathway agonists, development of drugs targeting this pathway is desired.

  Therefore, in view of the above situation, the present invention specifies a gene that is specifically expressed when various antibacterial actions are added, and uses the gene as a reporter gene, thereby known candidate substances for antibacterial agents Alternatively, it is an object to provide a method for screening a substance having an antibacterial activity equivalent to that of a known antibacterial agent.

  In addition, the present invention specifies a gene that is specifically expressed when various antibacterial actions are added and a promoter region that controls the expression of the gene, and induces expression when various antibacterial actions are added. It aims at providing the promoter which has.

The present invention that has achieved the above-described object includes the following.
The screening method according to the present invention comprises a step of measuring the expression of at least one gene selected from a gene group identified by a Genbank accession number shown in Table 1 in a cell on which a test substance is allowed to act; And the step of identifying the test substance as a respiratory chain inhibitor candidate substance when the expression fluctuates in comparison with the expression when the test substance is not allowed to act.

  Moreover, the screening method according to the present invention comprises a step of measuring the expression of at least one gene selected from the gene group specified by the Genbank accession number shown in Table 2 in a cell on which a test substance is allowed to act; Identifying the test substance as a candidate substance for an ergosterol biosynthesis inhibitor when the expression of the gene fluctuates in comparison with the expression when the test substance is not allowed to act.

  Furthermore, the screening method according to the present invention comprises a step of measuring the expression of at least one gene selected from the gene group specified by the Genbank accession number shown in Table 3 in the cell on which the test substance is allowed to act; Identifying the test substance as a candidate substance for a cell wall biosynthesis inhibitor when the expression of the gene fluctuates in comparison with the expression when the test substance is not allowed to act.

  Furthermore, the screening method according to the present invention comprises a step of measuring the expression of a superoxide desmutase gene (Genbank accession number: XM_653297, SEQ ID NO: 71) in a cell to which a test substance is allowed to act, and expression of the gene However, the method includes a step of identifying the test substance as a candidate substance for the MpkB pathway inhibitor when the test substance varies compared to the expression when the test substance is not allowed to act.

  Furthermore, the screening method according to the present invention comprises a step of measuring the expression of at least one gene selected from the gene group specified by the Genbank accession number shown in Table 4 in the cells to which the test substance is allowed to act. Identifying the test substance as a candidate substance for a cell wall integrity pathway inhibitor when the expression of the gene fluctuates in comparison with the expression when the test substance is not allowed to act. It is out.

  Furthermore, a step of measuring the expression of the agsA gene (Genbank accession number: XM_658397, SEQ ID NO: 83) and / or the agsB gene (Genbank accession number: XM_655819, SEQ ID NO: 84) in the cells to which the test substance is allowed to act. And identifying the test substance as a candidate substance for a cell wall integrity pathway inhibitor when the expression of the gene fluctuates in comparison with the expression when the test substance is not allowed to act. Contains.

  Furthermore, the screening method according to the present invention comprises a step of measuring the expression of the cat1 gene (Genbank accession number: XM_365841, SEQ ID NO: 85) in a cell to which a test substance is allowed to act, And identifying the test substance as a candidate substance for an osmotic response (HOG: high osmolarity glycerol) pathway activator when the test substance changes compared to the expression when the test substance is not allowed to act.

  As described above, according to the screening method of the present invention, a candidate substance for respiratory chain inhibitor, a candidate substance for ergosterol biosynthesis inhibitor, a candidate substance for cell wall biosynthesis inhibitor, a candidate substance for MpkB pathway inhibitor, Candidate substances for cell wall integrity pathway inhibitors or osmotic response (HOG: high osmolarity glycerol) pathway activators can be identified. That is, according to the present invention, a simple evaluation system for the various antibacterial effects described above can be established, and candidate substances can be identified at high speed and with high efficiency from a drug library consisting of a large number of compound groups.

It is a characteristic view which shows the expression level measured by RT-PCR about the cyan resistance respiratory enzyme gene (AOX) (upper stage) and the NADH-dehydrogenase gene (lower stage) as an expression level per actin. 1 is a schematic configuration diagram of a filamentous fungus transformation vector pCH11. FIG. It is a schematic block diagram of pCH11-EGFP-LacI. It is a characteristic view which shows the result of having observed the fluorescence of EGFP when a respiratory chain inhibitor and a comparison chemical | medical agent were processed with respect to the Magnaporte glycea which introduce | transduced the pCH11-PrAOX-EGFP-LacI plasmid. It is a characteristic view which shows the expression level measured by RT-PCR about Cytochrome P450 sterol 14 (alpha) dimethylase (MGG_04628, the upper stage) and sterol 24C methyltransferase (MGG_10860, the lower stage) as an expression level per actin. It is a characteristic view which shows the result of having observed the fluorescence of EGFP when a ergosterol biosynthesis inhibitor and a comparison chemical | medical agent were processed with respect to the Magnaporte glycea which introduce | transduced the pCH11-Cyp51-EGFP-LacI plasmid. Expression levels measured by RT-PCR for MGG_02004 (upper left), MGG_00692 (upper right), MGG_04943 (middle left), MGG_09639 (middle right), MGG_05133 (lower left) and MGG_02773 (lower right) Is a characteristic diagram showing as an expression level per actin. 1 is a schematic configuration diagram of pNA (N) EGFP. FIG. It is a characteristic diagram which shows the result of having observed the fluorescence of EGFP when a cell wall biosynthesis inhibitor was processed with respect to Magnaporte glycea which introduce | transduced pMSTU1-EGFP and pAGS1-EGFP. FIG. 6 is a characteristic diagram showing the expression level of the sodM gene in the mpkBΔ strain as the expression level per Histone H2B. It is a characteristic view which shows the result of having observed fluorescence about the PagsB-EGFP transformant and the PagsA-EGFP transformant. It is a characteristic view which shows the expression level measured by RT-PCR about the cat1 gene in blast fungus as an expression level per β-tubulin.

Hereinafter, the present invention will be described in more detail.
The screening method according to the present invention includes a respiratory chain inhibitor candidate substance, an ergosterol biosynthesis inhibitor candidate substance, a cell wall biosynthesis inhibitor candidate substance, and a MpkB pathway inhibitor candidate among various test substances. It is a method for identifying substances, candidate substances for cell wall integrity pathway inhibitors or candidate substances for osmotic response (HOG: high osmolarity glycerol) pathway activators. Here, the test substance is not particularly limited and may be any substance. The test substance may be a single substance or a mixture composed of a plurality of components. As a test substance, the structure which contains an unidentified substance like the extract from a plant, for example may be sufficient, and the structure which contains a known composition by a predetermined composition ratio may be sufficient. The test substance may be any of protein, nucleic acid, lipid, polysaccharide, organic compound, and inorganic compound.

  In the present specification, the respiratory chain inhibitor means a substance having an antibacterial action that inhibits the respiratory chain in microorganisms, more preferably infectious microorganisms to plants or animals. The ergosterol biosynthesis inhibitor means a substance having an antibacterial action that inhibits ergosterol biosynthesis in fungi, more preferably infective fungi to plants or animals. The cell wall biosynthesis inhibitor means a substance having an antibacterial action that inhibits cell wall biosynthesis in fungi, more preferably fungi infecting plants or animals. The MpkB pathway inhibitor means a substance having an antibacterial action that inhibits the MAP kinase signal transduction pathway (MpkB pathway) involving MpkB in fungi, more preferably fungi infecting plants or animals. The cell wall construction pathway inhibitor means a substance having an antibacterial action that inhibits the cell wall integrity pathway activated when the cell wall is damaged. The HOG pathway activator means a substance having an antibacterial action by activating the HOG pathway.

  Candidate substances identified by the screening method according to the present invention can be used as antibacterial agents against various microorganisms, preferably infectious microorganisms, due to their antibacterial action. Examples of infectious microorganisms include blast fungus (Magnaporthe grisea). That is, according to the screening method of the present invention, a candidate substance for an antibacterial agent against infectious microorganisms such as blast fungus (Magnaporthe grisea) can be identified.

  The screening method according to the present invention includes a gene serving as an index of a respiratory chain inhibitor, a gene serving as an index of an ergosterol biosynthesis inhibitor, a gene serving as an index of a cell wall biosynthesis inhibitor, and a gene serving as an index of an MpkB pathway inhibitor , Genes that serve as indicators of cell wall integrity pathway inhibitors, and methods that use genes that serve as indicators of HOG pathway activators (screening method 1), promoter regions that control the expression of these genes, and known methods It is roughly classified into a method using a reporter gene (screening method 2).

First, genes that serve as indices for these antibacterial agents will be described.
Genes that serve as indicators of respiratory chain inhibitors Genes that serve as indicators of respiratory chain inhibitors have been found as genes whose expression is specifically enhanced when a known respiratory chain inhibitor is brought into contact with Magnaporthe grisea. Gene. Here, conventionally known respiratory chain inhibitors are not particularly limited, but include Complex 1 inhibitors such as diflumetrim and tebufenpyrad; Complex 2 inhibitors such as mepronil; Complex 3 inhibitors such as cresoxime methyl and pyribencarb; Complex 5 (F1Fo ATPase such as oligomycin) ) Inhibitors, such as fluazinam, can include uncoupling agents that act on electron transfer and inhibit ATP synthesis.

  A gene serving as an index of a respiratory chain inhibitor is a gene identified by a Genbank accession number listed in Table 5 below. In the column of “CDS base sequence” in Table 5 below, a sequence number indicating the base sequence of the CDS region of the gene specified by the Genbank accession number is described. In addition, in the column of “BROAD ID Ver6” in Table 5 below, the registration number of the Magnaporthe grisea genome database of Broad Institute is described.

Genes that serve as indicators of ergosterol biosynthesis inhibitors Genes that serve as indicators of ergosterol biosynthesis inhibitors are specifically expressed when a known ergosterol biosynthesis inhibitor is brought into contact with Magnaporthe grisea. It is a gene that was found as an enhanced gene. Here, conventionally known ergosterol biosynthesis inhibitors are not particularly limited, and examples thereof include oxpoconazole fumarate and fenhexamide.

  The gene serving as an index of an ergosterol biosynthesis inhibitor is a gene identified by the Genbank accession number listed in Table 6 below. In the column of “CDS base sequence” in Table 6 below, a sequence number indicating the base sequence of the CDS region of the gene specified by the Genbank accession number is described. Also, in the column of “BROAD ID Ver6” in Table 6 below, the registration number of the Broad Institute's Magnaporthe grisea genome database is described.

Genes that are indicators of cell wall biosynthesis inhibitors Genes that are indicators of cell wall biosynthesis inhibitors are genes whose expression is specifically enhanced when a known cell wall biosynthesis inhibitor is brought into contact with Magnaporthe grisea. It was found as a gene. Here, conventionally known cell wall biosynthesis inhibitors are not particularly limited, and examples thereof include Micafungin and calcoflor white.

  The gene that serves as an indicator of a cell wall biosynthesis inhibitor is a gene identified by the Genbank accession number listed in Table 7 below. In the column of “CDS base sequence” in Table 7 below, a sequence number indicating the base sequence of the CDS region of the gene specified by the Genbank accession number is described. In addition, in the column of “BROAD ID Ver6” in Table 7 below, the registration number of the Magnaporthe grisea genome database of Broad Institute is described.

Genes that serve as indicators of MpkB pathway inhibitors
The gene that is an indicator of the MpkB pathway inhibitor is a gene whose expression is specifically increased in the mpkB gene disruption strain by measuring the gene expression pattern in the wild strain of Aspergillus nidulans and the mpkB gene disruption strain. It was found as a gene.
A gene that serves as an indicator of an MpkB pathway inhibitor is a superoxide desmutase gene (Genbank accession number: XM — 653297, SEQ ID NO: 71).

Genes that serve as indicators of cell wall assembly pathway inhibitors Genes that serve as indicators of cell wall assembly pathway inhibitors are gene expression in wild strains of Aspergillus oryzae and mpkA gene disruption strains involved in the cell wall integrity pathway The gene was found as a gene whose expression is specifically increased or specifically decreased in the mpkA gene-disrupted strain by measuring the pattern. In a strain in which the mpkA gene is disrupted, the cell wall integrity pathway is inhibited.

  A gene that serves as an indicator of a cell wall assembly pathway inhibitor is a gene identified by the Genbank accession number listed in Table 8 below. In the column of “CDS base sequence” in Table 8 below, a sequence number indicating the base sequence of the CDS region of the gene specified by the Genbank accession number is described. In addition, the “DOGAN ID” column in Table 8 below shows the registration number of the DOGAN database of the National Institute of Technology and Evaluation.

  In Table 8, the genes XM_001825115, XM_001820488, XM_001817008 and XM_001822481 are genes whose expression is specifically enhanced in the mpkA gene-disrupted strain. In Table 8, the genes XM — 001820375, XM — 001727556, XM — 001727176, XM — 001727558, XM — 001727555, XM — 001820346, and XM — 001827554 are genes whose expression is specifically reduced in the mpkA gene disruption strain.

  In addition, genes that serve as indicators for cell wall assembly pathway inhibitors include the MpkA-disrupted strain of Aspergillus oryzae and wild-type strain described in the paper of Fujioka et al. (2007) Eukaryotic Cell 6: 1497-1510. These are the agsA gene (Genbank accession number: XM_658397, SEQ ID NO: 83) and agsB gene (Genbank accession number: XM_655819, SEQ ID NO: 84) selected based on the transcription analysis data in the strain.

Genes that serve as indicators of HOG pathway activators
A gene that serves as an index of an HOG pathway activator is a gene found as a homologous gene in blast fungus to a catalase gene that is known to be upregulated by activation of the HOG pathway in research on Neurospora crassa. In addition, it has been confirmed that the homologous gene is specifically enhanced when it is brought into contact with known HOG pathway activators such as fludioxonil and iprodione.
It is a gene cat1 gene (Genbank accession number: XM_365841, SEQ ID NO: 85) which serves as an index of an HOG pathway activator.

  As described above, the genes that are indicators of antibacterial agents having different antibacterial actions have been described by specifying the Genbank accession number and specific sequence number, but the genes that are indicators of antibacterial agents are the nucleotide sequences of the CDS region. Is not limited to the specific base sequence described in the above SEQ ID NO, but also includes homologous genes for the gene. The homologous gene generally means a gene that has evolved and branched from a common ancestral gene. Two kinds of homologous genes (orthologs) and homologous genes (due to overlapping branches in the same species) ( Meaning to include paralog).

  More specifically, a similarity degree of 70% or more, preferably 80% or more, more preferably 90% or more, more preferably 95% or more, and most preferably 98% or more with respect to the base sequence shown in the above SEQ ID NO ( A gene having a CDS region containing a base sequence having a similarity) is also included in a gene serving as an index of an antibacterial agent. Here, the value of similarity means a value obtained by default setting using a computer program in which a BLAST (Basic Local Alignment Search Tool) program is installed and a database storing gene sequence information.

  More specifically, an antibacterial agent is also a gene identified from a cDNA or genomic region that hybridizes under stringent conditions to a polynucleotide having a base sequence complementary to the base sequence shown in SEQ ID NO: Included in genes that are indicators of Here, stringent conditions refer to conditions under which so-called specific hybrids are formed and non-specific hybrids are not formed. For example, hybridization at 45 ° C. and 6 × SSC (sodium chloride / sodium citrate), followed by washing at 50 to 65 ° C., 0.2 to 1 × SSC, 0.1% SDS, or such conditions And hybridization at 65 to 70 ° C. and 1 × SSC, and subsequent washing at 65 to 70 ° C. and 0.3 × SSC. Hybridization can be performed by a conventionally known method such as the method described in J. Sambrook et al. Molecular Cloning, A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory (1989).

Screening method 1
Next, the screening method 1 described above will be described. In order to evaluate whether the test substance has the above-described antibacterial action, first, the test substance to be tested is brought into contact with, for example, an infectious microorganism, the expression level of the gene in the presence of the test substance, and the test The expression level in the absence of the substance is compared. And in the same manner as when a known antibacterial agent (respiratory chain inhibitor, ergosterol biosynthesis inhibitor, cell wall biosynthesis inhibitor, HOG pathway activator) is allowed to act or with an mpkB gene disruption strain or mpkA gene disruption strain Similarly, when the expression level of the predetermined gene varies, the test substance can be identified as having the antibacterial action described above.

  The expression level of the gene described above can be measured by a conventionally known method. The technique for measuring the expression level of the gene is not limited at all, but, for example, a real-time PCR method can be applied. Alternatively, the expression level of the gene described above may be measured using a microarray.

  For example, the expression level in the presence of the test substance was increased for at least one gene identified by the Genbank accession numbers shown in Table 5, preferably 5 or more, more preferably 10 or more. In this case, the test substance can be identified as a candidate substance for respiratory chain inhibitor. In particular, when identifying candidate substances for respiratory chain inhibitors, it is preferable to examine the expression level of the gene identified by XM_001403469 among the genes shown in Table 5. If the expression level of the gene specified by XM_001403469 is increased in the presence of the test substance, it can be determined that the test substance has a very high probability of being a candidate substance for a respiratory chain inhibitor.

  In addition, for example, the expression level in the presence of the test substance is increased for at least one gene identified by the Genbank accession number shown in Table 6, preferably 3 or more, more preferably 5 or more. If so, the test substance can be identified as a candidate substance for an ergosterol biosynthesis inhibitor. In particular, when identifying a candidate substance for an ergosterol biosynthesis inhibitor, it is preferable to examine the expression level of the gene specified by XM_362183 among the genes shown in Table 6. When the expression level of the gene specified by XM_362183 is increased in the presence of the test substance, it can be determined that the test substance is very likely to be a candidate substance for an ergosterol biosynthesis inhibitor.

  Furthermore, for example, at least one gene, preferably 5 or more, more preferably 10 or more, and still more preferably 20 or more genes among the genes specified by the Genbank accession numbers shown in Table 7 in the presence of the test substance. If the expression level in is increased, the test substance can be identified as a candidate substance for a cell wall biosynthesis inhibitor. In particular, when identifying candidate substances for cell wall biosynthesis inhibitors, it is preferable to examine the expression level of the gene specified by XM_364794 and / or the gene specified by XM_368552 among the genes shown in Table 7. When the expression level of the gene specified by XM_364794 or the gene specified by XM_368552 is increased in the presence of the test substance, the test substance is very likely to be a candidate for a cell wall biosynthesis inhibitor. It can be judged that it is very high.

  Furthermore, for example, when the expression level of the superoxide desmutase gene specified by Genbank accession number XM_653297 is increased in the presence of the test substance, the test substance is a candidate substance for an MpkB pathway inhibitor. Can be identified as

  Furthermore, for example, the expression level in the presence of the test substance varies for at least one gene identified by the Genbank accession number shown in Table 8, preferably 3 or more, more preferably 5 or more. If so, the test substance can be identified as a candidate substance for a cell wall assembly pathway inhibitor. More specifically, for the gene identified by XM_001825115, the gene identified by XM_001820488, the gene identified by XM_001817008, and the gene identified by XM_001822481, the expression level in the presence of the test substance was increased In this case, the test substance can be identified as a candidate substance for a cell wall assembly pathway inhibitor. In addition, a gene identified by XM_001820375, a gene identified by XM_001727556, a gene identified by XM_001727176, a gene identified by XM_001727558, a gene identified by XM_001727555, a gene identified by XM_001820346, and a gene identified by XM_001827554 When the expression level in the presence of the test substance is decreased, the test substance can be identified as a candidate substance for a cell wall construction pathway inhibitor. In particular, when identifying candidate substances for cell wall assembly pathway inhibitors, it is preferable to examine the expression level of the gene specified by XM — 001825115 among the genes shown in Table 8. If the expression level of the gene specified by XM — 001825115 is increased in the presence of the test substance, it can be determined that the test substance has a very high probability of being a candidate substance for a cell wall construction pathway inhibitor.

  Furthermore, if the expression level of the agsA gene specified by Genbank accession number XM_658397 and / or the agsB gene specified by Genbank accession number XM_655819 is increased in the presence of the test substance, A test substance can be identified as a candidate substance for a cell wall assembly pathway inhibitor.

  Furthermore, if the expression level of the cat1 gene specified by Genbank accession number XM_365841 is increased in the presence of the test substance, the test substance is identified as a candidate substance for the HOG pathway activator. be able to.

  As described above, candidate substances for antibacterial agents can be screened by determining various antibacterial actions of various test substances based on gene expression patterns. However, in this screening method, the presence or absence of a specific antibacterial action may be determined for a candidate substance, but for a candidate substance, respiratory chain inhibitory action, ergosterol biosynthesis inhibitory action, cell wall biosynthesis inhibitory action, MpkB It may be determined which antibacterial effect is selected from the pathway inhibitory action, cell wall construction pathway inhibitory action, and HOG pathway activation action. Some candidate substances may be screened as having a plurality of antibacterial actions among the various antibacterial actions described above.

Screening method 2
Next, the screening method 2 described above will be described. Unlike screening method 1, screening method 2 does not measure the expression level of the gene itself specified by the above-mentioned Genbank accession number, but uses the promoter region of the gene specified by the above-mentioned Genbank accession number. It is a method to do. Specifically, a recombinant DNA in which the promoter region and a reporter gene that can be expressed under the control of the promoter region are linked is used. This recombinant DNA can be stored and used by being incorporated into a vector. The vector is not limited in any way, but it is preferable to select and use a type of vector that can be replicated in the microorganism to be introduced.

  Since the promoter region of the gene specified by the above Genbank accession number controls the expression of the gene, the promoter region also controls the expression of the reporter gene. A candidate substance is brought into contact with a transformed cell having this recombinant DNA introduced into an infectious microorganism, and the expression level of the reporter gene in the presence of the test substance and the expression level in the absence of the test substance are determined. Compare. And in the same manner as when a known antibacterial agent (respiratory chain inhibitor, ergosterol biosynthesis inhibitor, cell wall biosynthesis inhibitor, HOG pathway activator) is allowed to act or with an mpkB gene disruption strain or mpkA gene disruption strain Similarly, when the expression level of the reporter gene varies, the test substance can be identified as having the antibacterial action described above.

  Here, the promoter region means a region that exists in a region upstream from the start codon of the gene specified by the above-mentioned Genbank accession number and to which a transcription factor binds. More specifically, the promoter region is contained in a 2 kb region upstream of the initiation codon of the gene specified by the above-mentioned Genbank accession number, preferably a 1.5 kb region upstream. More specifically, SEQ ID NOs: 86 to 169 show the base sequences of the 2 kb region upstream of the start codon of 84 genes shown in SEQ ID NOs: 1 to 84, respectively. The base sequence of the 1.5 kb region upstream of the start codon of the gene shown in SEQ ID NO: 85 is shown in SEQ ID NO: 170.

  In this screening method, as the promoter region, a polynucleotide consisting of the nucleotide sequences shown in SEQ ID NOs: 86 to 170 can be used. The promoter region is 70% or more, preferably 80% or more, more preferably 90% or more, more preferably 95% or more, and most preferably 98% or more with respect to the nucleotide sequence shown in SEQ ID NOs: 86 to 170. A polynucleotide having a base sequence having a similarity of 1 to 5 can be used. Note that the similarity is the same as the definition described above. Furthermore, as the promoter region, a polynucleotide that hybridizes under stringent conditions to a polynucleotide having a base sequence complementary to the base sequences shown in SEQ ID NOs: 86 to 170 can be used. Stringent conditions are the same as those defined above.

  Here, the reporter gene is not particularly limited as long as it is used in a so-called reporter assay, and any gene may be used. Examples of the reporter gene include CAT gene, lacZ gene, luciferase gene, β-glucuronidase gene (GUS), and GFP gene. The reporter gene is linked to the promoter region so that it can be expressed under the control of the promoter region described above. In other words, the promoter region and the reporter gene are bound so that expression of the reporter gene is induced by binding of the transcription factor to the promoter region.

  The expression level of the reporter gene can be measured by methods known to those skilled in the art depending on the type of reporter gene used. For example, when the reporter gene is a CAT gene, the expression level of the reporter gene can be measured by detecting acetylation of chloramphenicol by the gene product. When the reporter gene is a lacZ gene, by detecting the color development of the dye compound catalyzed by the gene expression product, and when the reporter gene is a luciferase gene, the fluorescent compound catalyzed by the gene expression product By detecting fluorescence, and in the case of a β-glucuronidase gene (GUS), luminescence of Glucuron (ICN) or 5-bromo-4-chloro-3-indolyl- By detecting the color development of β-glucuronide (X-Gluc), and in the case of a GFP gene, the expression level of the reporter gene can be measured by detecting fluorescence due to the GFP protein.

  Also in this screening method, as in the screening method 1 described above, for example, at least one of the genes specified by the Genbank accession numbers shown in Table 5, preferably 5 or more, more preferably 10 or more genes. When the promoter region is used and the expression level of the reporter gene is increased in the presence of the test substance, the test substance can be identified as a candidate substance for a respiratory chain inhibitor. In particular, when identifying candidate substances for respiratory chain inhibitors, it is preferable to examine the expression level of the reporter gene using the promoter region of the gene identified by XM_001403469 among the genes shown in Table 5. When the promoter region of the gene specified by XM_001403469 is used, if the expression level in the presence of the test substance is increased, the probability that the test substance is a candidate for respiratory chain inhibitor is very high It can be judged that it is very high.

  Further, for example, among the genes specified by the Genbank accession numbers shown in Table 6, at least one, preferably 3 or more, more preferably 5 or more promoter regions of genes are used in the presence of the test substance. When the expression level of the reporter gene is increased, the test substance can be identified as a candidate substance for an ergosterol biosynthesis inhibitor. In particular, when identifying a candidate substance for an ergosterol biosynthesis inhibitor, it is preferable to examine the expression level of the reporter gene using the promoter region of the gene specified by XM_362183 among the genes shown in Table 6. When using the promoter region of the gene identified by XM_362183, if the expression level in the presence of the test substance is increased, the test substance is likely to be a candidate for an ergosterol biosynthesis inhibitor Can be judged to be very high.

  Further, for example, at least one of the genes specified by the Genbank accession numbers shown in Table 7, preferably 5 or more, more preferably 10 or more, and still more preferably 20 or more promoter regions are used. When the expression level of the reporter gene is increased in the presence of the test substance, the test substance can be identified as a candidate substance for a cell wall biosynthesis inhibitor. In particular, when a candidate substance for a cell wall biosynthesis inhibitor is identified, the promoter region of the gene specified by XM_364794 and / or the promoter region of the gene specified by XM_368552 among the genes shown in Table 7 is used. It is preferable to examine the expression level. When the promoter region of the gene specified by XM_364794 or the promoter region of the gene specified by XM_368552 is used, if the expression level in the presence of the test substance is increased, the test substance is It can be judged that the probability as a candidate substance of a synthesis inhibitor is very high.

  Furthermore, for example, when the promoter region of the superoxide desmutase gene specified by Genbank accession number XM_653297 is used and the expression level of the reporter gene is increased in the presence of the test substance, Substances can be identified as candidates for MpkB pathway inhibitors.

  Furthermore, for example, using the promoter region of at least one gene identified by the Genbank accession number shown in Table 8, preferably 3 or more, more preferably 5 or more, in the presence of the test substance. When the expression level of the reporter gene in is fluctuated, the test substance can be identified as a candidate substance for a cell wall construction pathway inhibitor. More specifically, for the promoter region of the gene specified by XM_001825115, the promoter region of the gene specified by XM_001820488, the promoter region of the gene specified by XM_001817008, and the promoter region of the gene specified by XM_001822481, the test substance When the expression level of the reporter gene in the presence of is increased, the test substance can be identified as a candidate substance for a cell wall assembly pathway inhibitor. Further, the promoter region of the gene specified by XM_001820375, the promoter region of the gene specified by XM_001727556, the promoter region of the gene specified by XM_001727176, the promoter region of the gene specified by XM_001727558, the promoter of the gene specified by XM_001727555 Region, the promoter region of the gene specified by XM_001820346 and the promoter region of the gene specified by XM_001827554, if the expression level of the reporter gene in the presence of the test substance has decreased, the test substance It can be identified as a candidate substance for a cell wall assembly pathway inhibitor. In particular, when identifying candidate substances for cell wall assembly pathway inhibitors, it is preferable to examine the expression level of the reporter gene using the promoter region of the gene identified by XM_001825115 among the genes shown in Table 8. If the expression level of the reporter gene in the presence of the test substance is increased using the promoter region of the gene specified by XM_001825115, the test substance is likely to be a candidate substance for a cell wall construction pathway inhibitor Can be judged to be very high.

  Furthermore, using the promoter region of the agsA gene identified by Genbank accession number XM_658397 and / or the promoter region of the agsB gene identified by Genbank accession number XM_655819, expression of the reporter gene in the presence of the test substance If the amount is increased, the test substance can be identified as a candidate substance for a cell wall assembly pathway inhibitor.

  Furthermore, for the promoter region of the cat1 gene identified by Genbank accession number XM_365841, if the expression level of the reporter gene is increased in the presence of the test substance, the test substance is treated as an HOG pathway activator. It can be identified as a candidate substance.

  As described above, candidate substances for antibacterial agents can be screened by determining various antibacterial actions for various test substances based on the expression pattern of the reporter gene. However, in this screening method, the presence or absence of a specific antibacterial action may be determined for a candidate substance, but for a candidate substance, respiratory chain inhibitory action, ergosterol biosynthesis inhibitory action, cell wall biosynthesis inhibitory action, MpkB It may be determined which antibacterial effect is selected from the pathway inhibitory action, cell wall construction pathway inhibitory action, and HOG pathway activation action. Some candidate substances may be screened as having a plurality of antibacterial actions among the various antibacterial actions described above.

EXAMPLES Hereinafter, although this invention is demonstrated in detail using an Example, the technical scope of this invention is not limited to a following example.
[Example 1]
Selection Method for Respiratory Chain Inhibitor Detection Marker A selection method for a marker gene capable of detecting a drug having an action on the respiratory chain is shown below.

Microarray expression analysis under respiratory chain inhibitor exposure
(1) Total RNA extraction The cells used for total RNA extraction are about 2 x 10 ⁶ conidia of Magnaporte grisea wild strain Guy11 in a 300 ml Erlenmeyer flask containing 100 ml of YG liquid medium. After incubating with gentle shaking at 26 ° C for 48 hours, diflumetrim and tebufenpyrad as respiratory chain Complex1 inhibitors, mepronil as Complex2 inhibitors, cresoxime methyl and pyribencarb as Complex3 inhibitors, oligos as Complex5 (F1Fo ATPase) inhibitors Fluazinam was added at a concentration of 0.01 to 30 ppm as an uncoupling agent that acts on mycin and electron transfer to inhibit ATP synthesis, and further cultured at 26 ° C. for 2 hours. The cells treated with this drug and the untreated cells were collected with Miracloth (CALBIOCHEM). The collected fungus was crushed in a mortar until it became powdery while pouring liquid nitrogen. The powdered cells were extracted using RNA Plant Mini Kit (Qiagen) according to the attached manual.

(2) Microarray The DNA chip used for the microarray uses a unique microarray spotted by inkjet method with a 60mer oligo probe designed from 10,000 genes of Magnaporte Grisea. The two-color method using Cyanine3 and Cyanine5 was used for comparison. A total of two repeated experiments were performed by performing color swap of Cyanine3 and Cyanine5 for each experimental section.

(3) RNA labeling (Cyanine5, Cyanine3)
RNA was labeled with Cyanine3 and Cyanine5 using mRNA, and mRNA was purified from total RNA using Oligotex-dT30 <super> mRNA purification Kit (manufactured by Takara Bio Inc.) according to the manual attached to this kit. Preparation and labeling of cDNA from mRNA were performed using CyScribe cDNA Post Labeling Kit (GE helthcare) according to the manual attached to this kit.

(4) Hybridization
60 μl of hybridization buffer shown in Table 9 was added to the Cyanine3 and Cyanine5 labeled cDNA mixed sample and dissolved, and then heat-denatured at 95 ° C. for 5 minutes. Then, after holding at room temperature for 30 minutes, it was dropped on the DNA chip and a cover glass was placed. The DNA chip on which the cover glass was placed was placed in a humid chamber floated on warm water and incubated overnight at 42 ° C. for hybridization.

(5) Post-hybridization
After overnight incubation at 42 ° C., the DNA chip was removed from the cover glass in Wash buffer 1 shown in Table 10, then 15 minutes with new Wash Buffer 1, then 5 minutes with Wash Buffer 2 shown in Table 11, and Table 12 Washing was performed by shaking with the indicated Wash Buffer 3 in the order of 5 minutes. Thereafter, after further washing in dH ₂ O for 2 minutes, water was removed by centrifugation at 800 × g for 2 minutes, and spot scanning was performed using GenePix 4000B (Axon instrument).

  Among the genes commonly expressed by respiratory chain inhibitor treatment extracted from the microarray results, genes excluding respiratory chain inhibitors and other genes related to drug metabolism of antibacterial agents are detected as candidate respiratory chain inhibitor detection markers. did. Table 13 below shows the results of microarray analysis of the top 10 genes. The value was shown as a relative value when compared with the untreated group, and values with an expression ratio of 1.5 times or more were shaded.

[Example 2]
Verification of Respiratory Chain Inhibitor Detection Marker Gene MGG — 12936 Cyan Resistance Respiratory Enzyme Gene (AOX) ) And MGG_04999NADH-dehydrogenase gene.

(1) Total RNA extraction The cells used for total RNA extraction are about 2 x 10 ⁶ conidia of Magnaporte grisea wild strain Guy11 in a 300 ml Erlenmeyer flask containing 100 ml of YG liquid medium. Inoculate and gently shake culture at 26 ° C for 48 hours. Thereafter, each concentration of the specified drug was added, and further cultured at 26 ° C. for 30 minutes, 2 hours, and 6 hours. Respiratory chain inhibitor used for drug treatment and treatment concentration are diflumetrim as a respiratory chain complex 1 inhibitor, mepronil as a complex 2 inhibitor, cresoxime methyl as a complex 3 inhibitor, oligomycin as a complex 5 (F1Fo ATPase) inhibitor, and electron transfer. As the uncoupling agent that inhibits ATP synthesis, fluazinam was adjusted to 1 ppm, 30 ppm, 20 ppm, 0.5 ppm, and 0.01 ppm, respectively. In addition, the flavanone compound sakuranetin 10 ppm, fludioxonil 20 ppm, procymidone 10 ppm, iprodione 30 ppm, ergosterol biosynthesis inhibitor oxpoconazole fumarate 1 ppm, which are considered to act on MAP kinase signaling, were used as control drugs. The microbial cells and non-treated microbial cells obtained by this chemical treatment were collected with Miracloth (CALBIOCHEM). The collected bacteria were crushed in a mortar until pouring with liquid nitrogen. The powdered cells were extracted using RNA Plant Mini Kit (Qiagen) according to the attached manual.

(2) cDNA synthesis
Total RNA was used for cDNA synthesis. Calculated from the absorbance at 260 nm, 5 μg of total RNA was transferred to an RNase free 1.5 ml tube, and DEPC-treated water was added to make 100 μl. To this, 5 units of RNase free DNase I was added and reacted at 37 ° C. for 1 hour to decompose the mixed genomic DNA. Then, reverse transcription reaction was performed using ExScript RT reagent Kit (manufactured by Takara Bio Inc.) according to the attached manual to obtain cDNA.

(3) Quantitative RT-PCR
A DyNAmo SYBR Green qPCR Kit (Finnzymes) was used for the labeling reaction of the synthesized cDNA with a fluorescent dye. DNA Engine OPTICON2 (manufactured by MJ Research) was used for scanner analysis, and analysis software Opticon Monitor 2 ver. 2.02 (manufactured by MJ Research) was used for data analysis. The reaction procedure was in accordance with the manual attached to the DyNAmo SYBR Green qPCR Kit. Reaction conditions are 95 ° C, heat shock for 10 minutes, heat denaturation 95 ° C, 10 seconds, annealing 60 ° C, 30 seconds, extension reaction 72 ° C, 30 seconds, plate read reaction 40 cycles, 60-95 ° C A Dissociation Curve was created with a gradient (hold for 1 second every 0.2 ° C). PCR was performed in triplicate for each cDNA and each target gene.

The expression of cyanogen resistant respiratory enzyme gene (AOX) and NADH-dehydrogenase gene was examined over time using a respiratory chain inhibitor-treated cDNA sample. As a control, the amount of transcription of a gene presumed to encode the Actin protein was examined. The following specific primers were used respectively.
Actin-F: ATGCCATCGGAAAGACAGAC (SEQ ID NO: 171)
Actin-R: CAGGAGTCGATCTCCAAAGC (SEQ ID NO: 172)
AOX_RTF: TTGTCGCATACCTCATCAGC (SEQ ID NO: 173)
AOX_RTR: CAATTTCTGGCACCTGGAAC (SEQ ID NO: 174)
NADH_RTF: AATCACCAAGGATGGACGAC (SEQ ID NO: 175)
NADH_RTR: CCTAGGTATGCCATGGTTCC (SEQ ID NO: 176)

After completion of PCR, analysis was performed using dedicated analysis software Opticon Monitor 2 ver. 2.02 (MJ Research). On the Quantitation screen, the number of cycles (CT) at which the PCR product of each gene begins to be amplified logarithmically was determined. Based on this value, the relative expression level of each cDNA target gene was determined by the following calculation method.
a) Calculation of ΔCT value (difference between target gene of each cDNA and γ-actin)
ΔCT = (yx)
Where x is CT (γ-actin) and y is CT (Target gene)
b) Calculation of ΔCT value (difference between ΔCT of a certain cDNA and ΔCT of a reference cDNA)
ΔCT = ΔCT (C) -ΔCT (S)
Where C is Comparative cDNA and S is Standard cDNA
c) Calculation of relative expression level
2- ^(ΔCT)

  The RT-PCR results are shown in the upper graph of FIG. 1 for the cyanogenic respiratory enzyme gene (AOX) and the graph of the expression level per actin for the NADH-dehydrogenase gene in the lower graph of FIG. When wild-type strains were exposed to respiratory chain inhibitors, the transcription levels of cyanogen resistant respiratory enzyme gene (AOX) and NADH-dehydrogenase gene increased. On the other hand, no significant increase in gene expression was observed for compounds that have no mechanism of action on the respiratory chain. Thus, it is considered that the expression of the cyanogen-resistant respiratory enzyme gene (AOX) and NADH-dehydrogenase gene, which are set as examples in this example, is increased specifically for the drug acting on the respiratory chain. Thus, for example, the cyanide-resistant respiratory enzyme gene (AOX) and the NADH-dehydrogenase gene 5'-UTR (promoter region in the 5 'upstream region) are functionally linked to the reporter gene to screen for respiratory chain inhibitors. It was confirmed that it could be used as

Example 3
Respiratory chain inhibitor detection reporter 5'-UTR (5 ') of this gene, taking as an example the cyan resistant respiratory enzyme gene (AOX), which shows increased expression of a specific gene when exposed to a respiratory chain inhibitor in Example 2. An example is shown in which a system for visualizing a respiratory chain-specific increase in transcription amount is constructed by functionally binding a promoter in the upstream region) to a reporter gene.

(1) Cloning of cyanogen resistant respiratory enzyme gene (AOX) 5 'region
Obtain the nucleotide sequence information of the 5 'region of the AOX gene from the Broad Institute's Magnaporthe grisea genomic database (http://www.broad.mit.edu/annotation/genome/magnaporthe_grisea/MultiHome.html) A set of oligonucleotides was designed with reference to the sequence information (5′-CCAAGCTTCCTTCCTCACTA-3 ′ (SEQ ID NO: 177), 5′-CCAAGCTTAAGACGGTACGTTCAGTGT-3 ′ (SEQ ID NO: 178)). PCR reaction was performed using the genomic DNA of Magnaporte glycea Guy11 strain as a template. Amplification reaction was performed by denaturing the template DNA at 94 ° C for 3 minutes, followed by 35 cycles of holding at 94 ° C for 30 seconds, 55 ° C, 30 seconds, 72 ° C for 2 minutes, followed by complete extension at 72 ° C for 5 minutes. And kept at 4 ° C. PCR Thermal Cycler PERSONAL (manufactured by Takara Bio Inc.) was used as the PCR apparatus. When the amplified fragment by PCR was confirmed by agarose electrophoresis, amplification of about 889 base pairs was observed. The amplified fragment was extracted from the gel subjected to agarose gel electrophoresis using GENECLEAN III kit (manufactured by Qbiogene), and this was used as an inserted DNA fragment. This inserted DNA fragment was ligated to pGEM-T Easy Vector using pGEM-T Easy Vector System (Promega) to obtain a ligated DNA solution. After thoroughly cooling 10 μl of the ligated DNA solution in ice, 100 μl of competent cell JM109 thawed on ice was added and gently agitated, followed by heat shock treatment in ice for 20 minutes and subsequently at 42 ° C. for 45 seconds. 400 μl of LB liquid medium was added thereto and cultured at 37 ° C. for 1 hour, and then plated on LB plate medium supplemented with 100 μg / ml ampicillin and cultured at 37 ° C. overnight. A single colony of E. coli transformed with the target plasmid DNA was inoculated into 3 ml of LB liquid medium supplemented with 100 μg / ml ampicillin and cultured overnight at 37 ° C. with shaking. Transfer 1.5 ml of the culture to a 1.5 ml Eppendorf tube, centrifuge at 15,000 xg for 1 min, and suspend the precipitate in 100 μl ice-cold TEG (25 mM Tris-HCl, 10 mM EDTA, 50 mM Glucose, pH 8.0). The solution became cloudy, and 200 μl of 0.2N NaOH-1% SDS was added thereto and stirred gently, and then 150 μl of 3M NaOAc (pH 5.2) was added and mixed. This was centrifuged at 15,000 × g for 5 minutes at 4 ° C., and the supernatant was collected. After adding 450 μl of phenol / chloroform / isoamyl alcohol (25: 24: 1) and stirring vigorously, 15,000 × g at room temperature for 5 minutes. Centrifugation was performed to recover the upper layer. 900 μl of ethanol cooled with ice at −20 ° C. was added to this solution and allowed to stand at −20 ° C. for 10 minutes, followed by centrifugation at 15,000 × g for 5 minutes at 4 ° C. The precipitate was rinsed with 500 μl of 70% ethanol, dried, and finally dissolved in 50 μl of TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) containing RNase (100 μg / ml). After the obtained plasmid was cleaved with HindIII, the presence of the inserted fragment was confirmed by agarose electrophoresis, and the inserted DNA fragment in this plasmid was subjected to ABI PRISM ^TM 377 DNA sequencing system (PE Biosystem) according to the attached protocol. Analyzed. The nucleotide sequence of the promoter of the cyan resistant respiratory enzyme gene (AOX) 5 ′ upstream region consisting of 889 base pairs is shown in SEQ ID NO: 179. This vector is designated as pGEM-PrAOX.

(2) Creation of EGFP vector
A filamentous fungus transformation vector pCH11 (Fig. 2) prepared by fusing the hygromycin B resistance gene Hph as a drug selection marker with the pCAMBIA-0380 binary vector (purchased from CAMBIA) as the backbone, was digested with HindIII and BglII, EGFP-LacI-TagdA (p3'SS d EGFP and E. coli LacI: Lactose operon transcriptional repressor Lac1 (E. coli EU337980, 4-1068 bp) and Aspergillus oryzae Α-glucosidase gene agdA terminator (Aspergillus oryzae, Supercontig 6: 3289259-3289838 An EGFP vector, pCH11-EGFP-LacI was prepared by combining the HindIII-BglII fragment of (+) fusion) (FIG. 3).

(3) Preparation of AOX-EGFP-LacI reporter (reporter gene vector)
The pCH11-EGFP-LacI (FIG. 2) plasmid was digested with HindIII, and the cyan resistant respiratory enzyme gene (AOX) 5 ′ region obtained by treating HindIII with pGEM-PrAOX was fused by a conventional method. This reporter assay plasmid, AOX-EGFP-LacI reporter vector, was named pCH11-PrAOX-EGFP-LacI.

(4) Transformation of magnaporte glycea using pCH11-PrAOX-EGFP-LacI plasmid Magnaporte glycea was transformed by the Agrobacterium method (Gento Tsuji, Satoshi Fujii, Naoki Fujihara, Chika Hirose, Seiji Tsuge, Tomonori Shiraishi and Yasuyuki Kubo (2003): Agrobacterium tumefaciens-mediated transformation for random insertional mutagenesis in Colletorichum lagenarium. Journal of General Plant Pathology 69: 230-239). Confirmation of vector insertion into the obtained strain was performed by PCR, sequencing and Southern analysis.

(5) Confirmation of reporter action Confirmation of reporter action is confirmed by EGFP when the cells are treated with the respiratory chain inhibitors diflumetrim, cresoxime methyl, oligomycin and oxpoconazole, fenhexamide, carpropamide, and benomyl as comparative drugs. This was done by observing the fluorescence. Inoculated into a 300 ml Sakaguchi flask containing 100 ml of YG liquid medium so that the conidia of the transformant of Magnaporte glycea PAOX-NLS was 2 × 10 ⁶ conidia / 100 ml, and cultured under the following conditions.
(Condition 1) Culture at 26 ° C for 24 hours
(Condition 2) After culturing at 26 ° C. for 24 hours, the above-mentioned drug was added, and further cultured at 26 ° C. for 6 hours.
Thereafter, the fluorescence of each treated strain was observed using a fluorescence microscope.

(6) EGFP fluorescence observation The mycelium after culture | cultivation was put on the slide glass, and the fluorescence observation of GFP was performed. 6 hours after addition of various drugs, strong EGFP-LacI fluorescence localized in the nucleus was observed only in the treatment of respiratory chain inhibitors (diflumetrim, cresoxime methyl, oligomycin), and in the treatment of compounds other than the untreated group and respiratory chain inhibitors Little EGFP-LacI fluorescence was observed (FIG. 4). From the above results, it can be said that the pAOX-EGFP-LacI reporter can be used for specific screening of respiratory chain inhibitors.

Example 4
Method for selecting marker for detection of ergosterol biosynthesis inhibitor The method for selecting a marker gene that can detect a drug that has an effect on the biosynthesis of ergosterol is an ergosterol biosynthesis inhibitor instead of a respiratory chain inhibitor The same procedure as in Example 1 was conducted except that oxpoconazole fumarate was used at a concentration of 1 and 5 ppm and fenhexamide was used at a concentration of 0.5 ppm.

  Among genes commonly expressed in ergosterol biosynthesis inhibitors extracted from microarray results, ergosterol biosynthesis inhibitors are excluded from genes that are related to drug metabolism of ergosterol biosynthesis inhibitors and other antibacterial agents. Detection marker candidates. Table 14 below shows the results of microarray analysis of the top 5 genes. The value was shown as a relative value when compared with the untreated group, and values with an expression ratio of 1.5 times or more were shaded.

Example 5
Validation of Ergosterol Biosynthesis Inhibitor Detection Marker Gene When the gene shown in Table 14 is treated with an ergosterol biosynthesis inhibitor, whether it is specifically altered and can be used as a detection marker, Cytochrome P450 sterol 14α Dimethylase (MGG_04628) and sterol 24C methyltransferase (MGG_10860) were verified as examples.

In this example, Cytochrome P450 sterol 14α dimethylase (MGG_04628) and sterol 24C methyltransferase (MGG_10860) were specifically detected, and the amount of gene transcription was examined in the same manner as in Example 2 except that the following specific primers were used. It was.
SteCyp51-F: CCACATGATGATCACGCTTC (SEQ ID NO: 180)
SteCyp51-R: GTCTCCTTGACCACGTTTGC (SEQ ID NO: 181)
24C-F: AACATGCAGACAGCCAAGAC (SEQ ID NO: 182)
24C-R: ATTCGAAATGTTCCCAGCAC (SEQ ID NO: 183)

  The RT-PCR results are shown in graphs of expression levels per actin in the upper part of FIG. 5 for Cytochrome P450 sterol 14α dimethylase (MGG_04628) and in the lower part of FIG. 5 for sterol 24C methyltransferase (MGG_10860). When wild-type strains were exposed to various drugs, the transcription amounts of Cytochrome P450 sterol 14α dimethylase (MGG_04628) and sterol 24C methyltransferase (MGG_10860) increased after the addition of oxpoconazole, an ergosterol biosynthesis inhibitor. Thus, it is considered that the expression of Cytochrome P450 sterol 14α dimethylase (MGG_04628) and sterol 24C methyltransferase (MGG_10860) set as an example this time is increased under the treatment with a drug that acts on ergosterol biosynthesis. Thus, for example, Cytochrome P450 sterol 14α dimethylase (MGG_04628) and sterol 24C methyltransferase (MGG_10860) 5′-UTR (promoter in the 5 ′ upstream region) are functionally linked to a reporter gene to ergosterol biosynthesis. The possibility that it could be used as a screening system for inhibitors was confirmed.

Example 6
Ergosterol Biosynthesis Inhibitor Detection Reporter Cytochrome P450 sterol 14α dimethylase (MGG_04628), which shows increased expression of a specific gene when exposed to an ergosterol biosynthesis inhibitor in Example 5, was used as an example for 5'- An example is shown in which a system for visualizing an ergosterol biosynthesis inhibitor-specific increase in transcription amount is constructed by functionally binding a UTR (promoter in the 5 ′ upstream region) to a reporter gene.

  Base of 5 'region of Cytochrome P450 sterol 14α dimethylase (MGG_04628) from Broad Institute's Magnaporthe grisea genome database (http://www.broad.mit.edu/annotation/genome/magnaporthe_grisea/MultiHome.html) Sequence information was acquired, and a set of oligonucleotides was designed with reference to the sequence information (5′-CCAAGCTTATGTGAGCCATCTTCGGATT-3 ′ (SEQ ID NO: 184), 5′-CCAAGCTTGACGATCGGGTAAGGAGACT-3 ′ (SEQ ID NO: 185)). PCR reaction was performed using the genomic DNA of Magnaporte glycea Guy11 strain as a template. Amplification reaction was performed by denaturing the template DNA at 94 ° C for 3 minutes, followed by 35 cycles of holding at 94 ° C for 30 seconds, 55 ° C, 30 seconds, 72 ° C for 2 minutes, followed by complete extension at 72 ° C for 5 minutes And kept at 4 ° C. PCR Thermal Cycler PERSONAL (manufactured by Takara Bio Inc.) was used as the PCR apparatus. When the amplified fragment by PCR was confirmed by agarose electrophoresis, amplification of about 1,405 base pairs was observed.

  Then, the result of analyzing the base sequence of the promoter region in the same manner as in Example 3 is shown in SEQ ID NO: 186. This vector is designated as pGEM-PrCyp51.

  In addition, a Cyp51-EGFP-LacI reporter was prepared in the same manner as in Example 3, and the reporter operation was confirmed. The results are shown in FIG. Six hours after the addition of various drugs, strong EGFP-LacI fluorescence localized in the nucleus was observed only in the treatment with oxpoconazole fumarate, and almost no EGFP-LacI fluorescence was observed with other compound treatments. . From the above results, it can be said that the pCyp51-EGFP-LacI reporter system can be used for screening of ergosterol biosynthesis inhibitors.

Example 7
Cell wall biosynthesis inhibitor detection marker selection method The marker gene selection method that can detect drugs that have an effect on cell wall biosynthesis is 1 μg Micafungin, which is a cell wall biosynthesis inhibitor instead of a respiratory chain inhibitor. (Astellas Pharma) and 1 mg calcoflor white (Sigma Aldrich) were used in the same manner as in Example 1.

  Cell wall biosynthesis inhibitors are genes whose expression is commonly induced or suppressed by cell wall biosynthesis inhibitors extracted from microarray results, excluding genes involved in drug metabolism of cell wall biosynthesis inhibitors. Detection marker candidates. Table 15 below lists some of the microarray results. The value is shown as a relative value when compared with the untreated section.

Example 8
Cell wall biosynthesis inhibitor detection reporter When the gene shown in Table 15 was treated with a cell wall biosynthesis inhibitor, it was verified whether or not it was specifically changed and can be used as a detection marker. In this example, the amount of gene transcription was examined in the same manner as in Example 2 except that the following specific primers were used.
MGG_02004-F: GGACAAAATGACAGTCCA (SEQ ID NO: 187)
MGG_02004-R: CCAAGTTTTCTTTCGGTTTC (SEQ ID NO: 188)
MGG_00692-F: TACAGACATGCCGCCGGGTGGACAA (SEQ ID NO: 189)
MGG_00692-R: ACGCTTGAGGTCCATCTGACCACTGCT (SEQ ID NO: 190)
MGG_04943-F: CCTTCTCGATCGCATGCT (SEQ ID NO: 191)
MGG_04943-R: ATCTGACCGACGTACTCTTG (SEQ ID NO: 192)
MGG_09639-F: TGTTTTCGTCGCAGTTCGTC (SEQ ID NO: 193)
MGG_09639-R: GCTCCTTTCTAAAGACCTTGGA (SEQ ID NO: 194)
MGG_05133-F: GTTGTTTCTGAGACCGGCCTGGTCTAC (SEQ ID NO: 195)
MGG_05133-R: CCATCGCTGATGGGTCCATGCCTACA (SEQ ID NO: 196)
MGG_02773-F: GATCATGGAACGGCAAAG (SEQ ID NO: 197)
MGG_02773-R: GTACCCCATTTCACCAAAC (SEQ ID NO: 198)

  The RT-PCR results are shown in FIG. 7 as a graph of the expression level per actin. When the wild strain was exposed to a cell wall stress agent, the transcription amount of 4 genes (MGG_02004, MGG_00692, MGG_04943 and MGG_09639) increased after addition of cell wall biosynthesis inhibitors, as in the microarray results, and 2 genes (MGG_05133 and MGG_02773) The amount of transcription decreased. From this, it is considered that the expression of the 6 genes set as an example this time varies in a drug-specific manner that affects cell wall biosynthesis. Thus, for example, these 5′-UTRs (promoters in the 5 ′ upstream region) are functionally linked to the reporter gene, and by detecting changes in the transcription amount of the reporter gene in the screening method of the present invention, the cell wall The possibility that it could be used as a screening system for biosynthesis inhibitors was confirmed.

Example 9
Production of reporter assay strains used for screening of cell wall biosynthesis inhibitors In the example 8, two genes (MGG_00692 and MGG_09639) that show increased expression of specific genes when exposed to cell wall biosynthesis inhibitors in Example 8 were used as examples. An example is shown in which a system for visualizing a cell wall biosynthesis inhibitor-specific increase in transcription amount is constructed by functionally binding a gene 5′-UTR (promoter in the 5 ′ upstream region) to a reporter gene.

(1) Cloning of gene (MGG_00692) 5 'region
Obtain the nucleotide sequence information of the 5 'region of the gene (MGG_00692) from the Broad Institute's Magnaporthe grisea genome database (http://www.broad.mit.edu/annotation/genome/magnaporthe_grisea/MultiHome.html) Then, a set of oligonucleotides was designed with reference to the sequence information (5′-CTTAGGCAACCTTGACGGCC-3 ′ (SEQ ID NO: 199), 5′-GTCGTGTCCTTGGTTCATGG-3 ′ (SEQ ID NO: 200)). PCR reaction was performed using the genomic DNA of Magnaporte glycea Guy11 strain as a template. The amplification reaction was performed by denaturing the template DNA at 94 ° C for 3 minutes and performing 35 cycles of holding at 94 ° C for 30 seconds, 55 ° C, 30 seconds, 72 ° C for 2 minutes, and then completely extending at 72 ° C for 5 minutes. And kept at 4 ° C. PCR Thermal Cycler PERSONAL (manufactured by Takara Bio Inc.) was used as the PCR apparatus. When the amplified fragment by PCR was confirmed by agarose electrophoresis, amplification of about 1,000 base pairs was observed.

  Then, the result of analyzing the base sequence of the promoter region in the same manner as in Example 3 is shown in SEQ ID NO: 201. This vector is designated as pGEM-MSTU1.

(2) Cloning of gene (MGG_09639) 5 'region
Obtain the nucleotide sequence information of the 5 'region of the gene (MGG_09639) from the Magnaporthe grisea genome database (http://www.broad.mit.edu/annotation/genome/magnaporthe_grisea/MultiHome.html) from Broad Institute Then, a set of oligonucleotides was designed with reference to the sequence information (5′-GTCCCGACAGCCAGTGTGCA-3 ′ (SEQ ID NO: 202), 5′-GTTTTTTTACGATACCACCATAAAGTG-3 ′ (SEQ ID NO: 203)). PCR reaction was performed using the genomic DNA of Magnaporte glycea Guy11 strain as a template. The amplification reaction was performed by denaturing the template DNA at 94 ° C for 3 minutes and performing 35 cycles of holding at 94 ° C for 30 seconds, 55 ° C, 30 seconds, 72 ° C for 2 minutes, and then completely extending at 72 ° C for 5 minutes. And kept at 4 ° C. PCR Thermal Cycler PERSONAL (manufactured by Takara Bio Inc.) was used as the PCR apparatus. When the amplified fragment by PCR was confirmed by agarose electrophoresis, amplification of about 1,000 base pairs was observed.

  Thereafter, the result of analyzing the base sequence of the promoter region in the same manner as in Example 3 is shown in SEQ ID NO: 204. This vector is designated as pGEM-AGS1.

(3) Creation of EGFP vector
EGFP-LacI-NLS-TagdA (p3'SS dEGFP and E. coli LacI: Lactose operon transcriptional repressor Lac1 (E EGFP vector pNA (N) EGFP combined with nuclear localization sequence of SV40, nuclear localization sequence of SV40, and Aspergillus oryzae Α-glucosidase gene agdA terminator (Aspergillus oryzae, Supercontig 6: 3289259-3289838 +) fusion) (Fig. 8).

(4) Preparation of pMSTU1-EGFP reporter (reporter gene vector)
The pNA (N) EGFP (FIG. 8) plasmid was digested with NotI, and the 5 ′ region of the gene MGG_00692 obtained by treating NotI with pGEM-MSTU1 was fused by a conventional method. This reporter assay plasmid was named pMSTU1-EGFP.

(5) Preparation of pAGS1-EGFP reporter (reporter gene vector)
The pNA (N) EGFP (FIG. 8) plasmid was digested with NotI, and the 5 ′ region of the gene MGG — 09639 obtained by treating NotI with pGEM-AGS1 was fused by a conventional method. This reporter assay plasmid was named pAGS1-EGFP.

(6) Transformation of magnaporte glycea using pMSTU1-EGFP and pAGS1-EGFP Magnaporte glycea was transformed by PEG-protoplast method (Leung, H., Lehtinen, U., Karjalainen, R., Skinner, D. , Tooley, P., Leong, S., Ellingboe, A., 1990. Transformation of the rice blast fungus Magnaporthe grisea to hygromycin B resistance. Curr. Genet. 17, 409-411.). Confirmation of vector insertion into the obtained strain was performed by PCR, sequencing and Southern analysis.

(7) Confirmation of reporter operation Confirmation of reporter operation was performed in the same manner as in Example 3. FIG. 9 shows the result of fluorescence observation of GFP by placing the cultured mycelium on a slide glass. In the treatment 3 hours after addition of the cell wall biosynthesis inhibitor, strong green fluorescence localized in the nucleus was observed, and almost no green fluorescence was observed in the untreated group. From the above results, the pMSTU1-EGFP reporter and the pAGS1-EGFP reporter can be used for specific screening of cell wall biosynthesis inhibitors.

Example 10
Construction of Aspergillus nidulans mpkB gene disruption strain (1) Preparation of DNA fragment for gene deletion disruption Select argB gene of Aspergillus oryzae as a marker for selection of deletion disruption strain, and use pAORB plasmid containing argB gene The argB gene fragment was PCR-amplified using primers designed as follows (5′-GAATTCCATCCGCTGTGGCCGACTCA-3 ′ (SEQ ID NO: 205), 5′-GGTACCGACGGAGTAACTGGAAAGATACGA-3 ′ (SEQ ID NO: 206)). TAKARA's PrimeStar HS DNA polymerase is used for amplification, and the amplification reaction is performed by denaturing the template DNA at 95 ° C for 2 minutes and holding at 98 ° C for 10 seconds, 55 ° C for 5 seconds, 72 ° C for 2 minutes 30 seconds. After 30 cycles, the film was completely extended at 72 ° C. for 5 minutes and kept at 4 ° C. When the amplified fragment by PCR was confirmed by agarose gel electrophoresis, amplification of about 2700 base pairs was observed.

  Next, the Aspergillus genome database (http://www.broad.mit.edu/annotation/genome/aspergillus_group/MultiHome.html) from the Broad Institute contains upstream and downstream bases containing the mpkB gene of Aspergillus nidulans. Primers are designed with reference to the sequence, and each 1kb DNA region from the start codon of the mpkB gene to the 5 'upstream region (5'-UTR) and from the stop codon to the 3' downstream region (3'-UTR) is obtained by PCR. Amplified. Amplification reaction is performed using PrimeStar HS DNA polymerase manufactured by Takara Bio Inc., and amplification reaction is performed by denaturing template DNA at 95 ° C for 2 minutes and holding at 98 ° C for 10 seconds, 55 ° C for 5 seconds, 72 ° C for 2 minutes. After 30 cycles, the film was completely extended at 72 ° C. for 5 minutes and kept at 4 ° C. When the amplified fragment by PCR was confirmed by agarose gel electrophoresis, amplification of about 1,000 base pairs was observed. 5'-UTR, the above-mentioned argB gene fragment, and 3'-UTR are ligated by fusion PCR, but in the tail part of the primer that anneals to the position where it will be ligated with the argB gene fragment, A terminal sequence of 35 base was introduced. The sequence of each primer is shown in Table 16.

  DNA was extracted from each gel of 5′-UTR, argB gene, and 3′-UTR using illustra GFX PCR DNA and Gel Band Purification Kit (GE healthcare) from a gel subjected to agarose gel electrophoresis. Fusion PCR was performed using a DNA solution in which these three fragments were mixed in equal amounts as a PCR template. In fusion PCR, primers of ANmpkB-5′UTR-F and ANmpkB-3′UTR-R located at both ends were used, and amplification reactions described below were performed using PrimeStar HS DNA polymerase (manufactured by Takara Bio Inc.). That is, after denaturing the template DNA at 94 ° C for 2 minutes and performing 30 cycles of holding at 94 ° C for 30 seconds, 58 ° C, 45 seconds, 72 ° C for 5 minutes, complete extension at 72 ° C for 10 minutes, Hold at 4 ° C. When the amplified fragment by PCR was confirmed by agarose gel electrophoresis, amplification of about 4,700 base pairs, which was the same as the total size of the three fragments, was observed. From this gel subjected to agarose gel electrophoresis, DNA was extracted using illustra GFX PCR DNA and Gel Band Purification Kit (manufactured by GE healthcare) to obtain a DNA fragment for mpkB gene deletion disruption.

(2) Transformation
The transformation for mpkB gene deletion disruption used a method improved from the protoplast-PEG method, and the DNA fragment to be transformed was the DNA fragment for mpkB gene deletion disruption prepared above. Aspergillus nidulans ABPU1 ΔligD :: ptrA (biotin (biA1), arginine (argB2), uridine (pyrG89), pyridoxine (pyroA4) requirement strains (provided by Tohoku University Graduate School of Agriculture, Dr. Tomonori Fujioka)) The suspension was inoculated into YPD medium and cultured with shaking at 37 ° C. for 20 hours. After collection using a 17G1 sterilized glass filter, the cells were transferred to a 50 ml centrifuge tube and washed with sterilized water. Thereafter, the microbial cells were 30 ml of protoplast solution (0.8 M NaCl, 10 mM NaH ₂ PO ₄ , 10 mg / ml Lysing enzyme (Sigma Chemical), 5 mg / ml Cellulase Onozuka R-10 (Yakult Pharmaceutical Ind.) 2.5 mg / ml Yatalase (manufactured by Takara Bio Inc.) was suspended and shaken at 30 ° C., 90 rpm for 3 hours to carry out protoplast reaction, filtered through sterilized MIRACLOTH (CALBIOCHEM), and the protoplast in the filtrate. The protoplast was centrifuged at 3,000 × g and 4 ° C. for 5 minutes to obtain a precipitate, washed once with 0.8 M NaCl, and centrifuged at 3,000 × g at 4 ° C. for 5 minutes to precipitate the protoplast. Was suspended in Solution 1 (0.8 M NaCl, 10 mM CaCl ₂ , 10 mM Tris-HCl, pH 8.0), 200 μl of each protoplast suspension was transferred to a 15 ml centrifuge tube, and each solution 2 (40% (w _{/ v) PEG♯4000, 50mM CaCl 2} , 50mM Tris-HCl, pH8.0) added 40μl the aforementioned transforming DNA solution each 5 [mu] l (5 [mu] g as the amount of DNA) Mix and leave for 30 minutes in ice, add 1 ml of Sol.2 and mix, let stand for 20 minutes at room temperature, wash twice with 5 ml of Sol.1 and remove Sol.2 as much as possible. Add protoplast suspension to Czapek-Dox (CD) soft agar medium supplemented with 0.02 μg / ml biotin, 5 mM uridine, 10 mM uracil, 0.5 μg / ml pyridoxine, warmed to The cells were overlaid on a CD agar medium supplemented with biotin at a final concentration of 0.02 μg / ml, 5 mM uridine, 10 mM uracil, and 0.5 μg / ml pyridoxine, and then cultured at 30 ° C. until conidia were formed. The mpkBΔ strain was selected from the PCR using the following primers (5′-ATGCACTGTAAACTTTCGATCCCGTCTTAG-3 ′ (SEQ ID NO: 211), 5′-CTACAGGGTGTGACGCTATGGTCAG-3 ′ (SEQ ID NO: 212)). And determine the mpkBΔ candidate strain with only the amplified fragment of about 4,700 bp, and finally quantify It was confirmed by RT-PCR that the mpkB gene was not expressed (FIG. 10).

(3) Microarray analysis in mpkBΔ strain: Aspergillus nidulans ABPU1 ΔligD :: ptrA strain and mpkB disrupted conidia to 2 × 10 ⁶ conidia / ml, final concentration of 0.02 μg / ml biotin, 5 mM uridine, A 500 ml Erlenmeyer flask containing 200 ml of CD liquid medium supplemented with 10 mM uracil and 0.5 μg / ml pyridoxine was inoculated, and cultured with shaking at 37 ° C. for 24 hours. The cells were collected with MIRACLOTH (manufactured by CALBIOCHEM), and the collected bacteria were pulverized in a mortar while pouring liquid nitrogen into a powder form. The powdered cells were transferred to a 50 ml tube containing 10 ml Sepasol-RNA I Super (manufactured by Nacalai Tesque), suspended, and left at room temperature for 5 minutes. The mixture was centrifuged at 9,500 × g, 4 ° C. for 10 minutes, the aqueous layer was transferred to a 15 ml tube, 2 ml of chloroform was added, and the mixture was vigorously stirred and left at room temperature for 5 minutes. Centrifuge at 11,000 xg, 4 ° C for 15 minutes, transfer the aqueous layer to another 15 ml tube, add equal volume of water-saturated acidic phenol: chloroform (5: 1), stir vigorously, and leave at room temperature for 5 minutes. . Centrifuge at 10,000 xg, 4 ° C for 10 minutes, transfer the aqueous layer to another 15 ml tube, add half of isopropanol, half of High Salt Precipitation Solution (0.8 M Sodium Citrate, 1.2 M NaCl, DEPC-treated) After stirring, the mixture was left at room temperature for 10 minutes. Centrifugation was performed at 10,000 × g and 4 ° C. for 10 minutes, and the supernatant was discarded and rinsed with 70% ethanol. After air drying, it was dissolved in an appropriate amount of DEPC (diethylpyrocarbonate) water to obtain a total RNA solution. Next, mRNA was purified from total RNA using oligotex-dt30 <Super> mRNA Purification kit (From Total RNA) (manufactured by Takara Bio Inc.) according to the attached manual.

  In the microarray analysis, the probe was prepared by a post-labeling method using Cy3 and Cy5. Purified mRNA was prepared at 1 μg / 9 μl, and aminoallyl-labeled cDNA was synthesized from mRNA using CyScribe cDNA Post Labeling Kit (GE healthcare) according to the attached manual. The synthesized aminoallyl-labeled cDNA was purified using CyScribe GFX Purification Kit (GE healthcare) and then CyDye-labeled using CyScribe cDNA Post Labeling Kit (GE healthcare). At this time, a set in which the cDNA derived from the ABPU1 ΔligD :: ptrA strain was labeled with Cy3 and the cDNA derived from the mpkB disrupted strain was labeled with Cy5, and a set labeled with the reverse (Dye swap) was prepared. The labeled probe was purified by CyScribe GFX Purification Kit (GE healthcare) and dried with a centrifugal evaporator. A procedure for preparing a hybridization solution shown in Table 17 and dissolving Cy3-labeled cDNA using 60 μL of this solution so as to achieve the above combination, and then dissolving the Cy5-labeled cDNA using the solution. To obtain a hybridization solution.

  TIGER glass slide microarray (version 2) was used as an Aspergillus nidulans microarray. A prehybridization buffer (5 × SSC, 0.1% SDDS, 1% BSA) was prepared, a glass slide was immersed in this buffer, and kept at 42 ° C. for at least 1 hour. The glass slide was transferred into a washing container filled with MilliQ water and washed by shaking at room temperature for 2 minutes. Washing with MilliQ water was repeated until 2 L of MilliQ water was used up. Next, another container was filled with isopropanol, and a glass slide was transferred thereto, followed by washing with shaking at room temperature for 2 minutes. Thereafter, the mixture was centrifuged at 800 rpm for 2 minutes to completely remove isopropanol.

  Spaced Cover Glass XL (manufactured by Takara Bio Inc.) was placed on the pre-hybridized array slide, and the labeled hybridization solution was filled between the array slide and the cover glass. This was installed in SlideBooster (Advaritix) and kept at 42 ° C. for 17 hours. Thereafter, the array slide was taken out from SlideBooster, and the cover glass was peeled off in a washing container filled with Wash buffer 1 (2 × SSC, 0.1% SDS). The array slide was washed by washing in Wash buffer 1 for 15 minutes at room temperature. Next, it was transferred to a washing container filled with Wash Buffer 2 (1 × SSC, 0.1% SDS) and washed with shaking for 5 minutes at room temperature. Finally, it was transferred to a washing container filled with Wash Buffer 3 (0.2 × SSC), washed with shaking for 5 minutes at room temperature, and then centrifuged at 800 rpm for 2 minutes to completely remove moisture.

  GenePix4000B (Axon) was used for imaging the array slide. The imaged scan data was digitized using GenePixPro microarray analysis software attached as standard to GenePix4000B. The array data was standardized using Genomic Profiler (Mitsui Information Co., Ltd.) and t-tested using Excel. By narrowing down the data obtained here by the p-value of the t-test, only sufficiently reliable data was used for subsequent analysis. From the obtained array data, a gene having a large difference in the expression level ratio between the Aspergillus nidulans ABPU1 ΔligD :: ptrA strain and the mpkB disruption strain was extracted and used as a gene whose expression changes depending on MpkB.

Example 11
Quantitative RT-PCR of sodM gene in mpkBΔ strain
(1) RNA extraction Aspergillus nidulans ABPU1 ΔligD :: ptrA strain and mpkB disrupted conidia to 2 × 10 ⁶ conidia / ml, final concentration of 0.02 μg / ml biotin, 5 mM uridine, 10 mM A 300 ml Erlenmeyer flask containing 100 ml of CD liquid medium supplemented with uracil and 0.5 μg / ml pyridoxine was inoculated, and cultured with shaking at 37 ° C. for 24 hours. The cells were collected with MIRACLOTH (CALBIOCHEM). The collected bacteria were pulverized in a mortar while pouring liquid nitrogen until powdered. The powdered cells were transferred to a 50 ml tube containing 10 ml Sepasol-RNA I Super (manufactured by Nacalai Tesque), suspended, and left at room temperature for 5 minutes. The mixture was centrifuged at 9,500 × g, 4 ° C. for 10 minutes, the aqueous layer was transferred to a 15 ml tube, 2 ml of chloroform was added, and the mixture was vigorously stirred and left at room temperature for 5 minutes. Centrifuge at 11,000 xg, 4 ° C for 15 minutes, transfer the aqueous layer to another 15 ml tube, add equal volume of water-saturated acidic phenol: chloroform (5: 1), stir vigorously, and leave at room temperature for 5 minutes. . Centrifuge at 10,000 xg, 4 ° C for 10 minutes, transfer the aqueous layer to another 15 ml tube, add half of isopropanol, half of High Salt Precipitation Solution (0.8 M Sodium Citrate, 1.2 M NaCl, DEPC-treated) After stirring, the mixture was left at room temperature for 10 minutes. Centrifugation was performed at 10,000 × g and 4 ° C. for 10 minutes, and the supernatant was discarded and rinsed with 70% ethanol. After air drying, it was dissolved in an appropriate amount of DEPC (diethylpyrocarbonate) water to obtain a total RNA solution.

(2) cDNA synthesis
Total RNA was used for cDNA synthesis. 100 μg of total RNA calculated from the absorbance at 260 nm was transferred to an RNase free 1.5 ml tube, and DEPC-treated water was added to make 87.5 μl. To this, 10 μl of Buffer RDD attached to RNase-free DNaseI set (QIAGEN) and 10 μl of DNaseI solution were added, and the mixture was reacted at 37 ° C. for 10 minutes to decompose the mixed genomic DNA. Thereafter, total RNA was cleaned up according to the RNA cleanup protocol of RNeasy mini kit (QIAGEN). 2 μg of the cleaned up total RNA was transferred to an RNase free 1.5 ml tube, and DEPC-treated water was added to make 10 μl. To this was added the reaction solution attached to the High Capacity cDNA Reverse Transcription kit (Applied Biosystems) as shown in Table 18 to prepare 20 μl of cDNA synthesis reaction solution.

  The prepared cDNA synthesis reaction solution was incubated at 25 ° C. for 2 minutes to anneal the primer. Thereafter, the mixture was incubated at 37 ° C. for 120 minutes to allow reverse transcription reaction. Next, Multiscribe Reverse Transcriptase was inactivated by incubating at 85 ° C. for 5 seconds. After completion of the reaction, the cDNA solution was diluted 1/10 and subjected to the next quantitative RT-PCR experiment.

(3) Quantitative RT-PCR
DyNAmo SYBR Green qPCR Kit (FinnzymeS) was used for the labeling reaction of the synthesized cDNA with a fluorescent dye. MiniOpticon real-time PCR analysis system (Bio-Rad Laboratories, Inc.) was used for scanner analysis and data analysis. The labeling reaction was performed according to the manual attached to the DyNAmo SYBR Green qPCR Kit. Changes in the transcription amount of the sodM gene in the mpkBΔ strain and the control strain under normal growth conditions were examined. The control was Histone H2B, and the following specific primers were used.
Histone H2B FW: 5'-CACCCGGACACTGGTATCTC-3 '(SEQ ID NO: 213)
Histone H2B RW: 5'-GAATACTTCGTAACGGCCTTGG-3 '(SEQ ID NO: 214)
sodM FW: 5'-CTCTGTAGAGGCGTTCATCAAG-3 '(SEQ ID NO: 215)
sodM RW: 5'-ACTGCAAGTAATACGCATGCTC-3 '(SEQ ID NO: 216)

To a 1.5 ml tube, 5 μl of cDNA (corresponding to 100 ng of total RNA used for cDNA synthesis), 300 nM of each target gene-specific primer, 10 μl of 2 × MasterMix, and sterilized water were added to make 25 μl. It was dispensed into dedicated PCR tubes 8-Strip Low Profile Tubes, capped with 8-Strip Ultra Clear Caps (both from MJ Research), and set in the MiniOpticon real-time PCR analysis system. Reaction conditions are 95 ° C, heat shock for 10 minutes, heat denaturation 95 ° C, 10 seconds, annealing 60 ° C, 30 seconds, extension reaction 72 ° C, 30 seconds, plate lead reaction 40 cycles, 60-95 ° C A melting curve was created with a gradient (hold for 1 second every 0.2 ° C.). The setting was set with Histone H2B as standard and sodM as a sample. PCR was performed in triplicate for each cDNA and each target gene. In performing PCR, each target gene-specific primer pair and a reaction system consisting only of 2 × Master Mix are combined, and after heat shock at 95 ° C. for 10 minutes, heat denaturation at 95 ° C., 10 seconds, 60 to 95 ° C. with a gradient of 50 Second, perform 40 cycles of the plate read reaction, create a melting curve at a gradient of 50 to 95 ° C (hold for 2 seconds every 0.5 ° C), and confirm that non-specific amplification between primers does not occur did. After completion of PCR, analysis was performed using dedicated analysis software attached to the MiniOpticon real-time PCR analysis system. On the Quantitation screen, the number of cycles (CT) at which the PCR product of each gene begins to be amplified logarithmically was determined. Based on this value, the relative expression level of each cDNA target gene was determined by the following calculation method.
a) Calculation of △ CT value (difference between the target gene of each cDNA and Histone H2B)
△ CT = (y−x)
x is CT (Histone H2B), and y is CT (Target gene).
b) Calculation of △ CT value (difference between △ CT of a certain cDNA and △ CT of the reference cDNA)
△ CT = △ CT (C)-△ CT (S)
C is Comparative cDNA and S is Standard cDNA.
C) Calculation of relative expression level
2- ^{(△ CT)}
Further, it was confirmed that the amplification was correctly performed from the Melting Curve waveform, and the PCR product was further subjected to agarose gel electrophoresis to confirm that it was amplified to the desired size.

  FIG. 10 shows the RT-PCR results as a graph of the expression level ratio with Histone H2B. The expression level of sodM gene in mpkBΔ strain increased significantly compared to the control strain. That is, the change in the transcription amount of the sodM gene was thought to depend on MpkB. Therefore, the inhibitory action of the test substance MpkB pathway can be detected in the screening method of the present invention by functionally binding the 5′-UTR (promoter of the 5 ′ upstream region) of the sodM gene to the reporter gene. it can.

Example 12
Determination of MpkA-dependent gene of Aspergillus oryzae (1) RNA extraction Aspergillus oryzae mpkA gene disruption strain (NS4 ΔligD :: ptrA ΔmpkA :: sC) and control strain (NS4 ΔligD :: ptrA sC +) Granted by Dr. Osamu Mizutani of the Liquor Research Institute (Mizutani et al. Fungal Genet. Biol., 2008 (45) 878-889). Inoculate a 500 ml Erlenmeyer flask containing 200 ml of CD liquid medium in which the nitrogen source is replaced with sodium glutamate so that the conidia of the mpkA gene disrupted strain and the control strain are 2 × 10 ⁶ conidia / ml And cultured with shaking at 30 ° C. for 24 hours.

  The cells were collected with MIRACLOTH (manufactured by CALBIOCHEM), and the collected bacteria were pulverized in a mortar while pouring liquid nitrogen into a powder form. The powdered cells were transferred to a 50 ml tube containing 10 ml Sepasol-RNA I Super (Nacalai Tesque), suspended, and left at room temperature for 5 minutes. The mixture was centrifuged at 9,500 × g, 4 ° C. for 10 minutes, the aqueous layer was transferred to a 15 ml tube, 2 ml of chloroform was added, and the mixture was vigorously stirred and left at room temperature for 5 minutes. Centrifuge at 11,000 xg, 4 ° C for 15 minutes, transfer the aqueous layer to another 15 ml tube, add equal volume of water-saturated acidic phenol: chloroform (5: 1), stir vigorously, and leave at room temperature for 5 minutes. . Centrifuge at 10,000 xg, 4 ° C for 10 minutes, transfer the aqueous layer to another 15 ml tube, add half of isopropanol, half of High Salt Precipitation Solution (0.8 M Sodium Citrate, 1.2 M NaCl, DEPC-treated) After stirring, the mixture was left at room temperature for 10 minutes. Centrifugation was performed at 10,000 × g and 4 ° C. for 10 minutes, and the supernatant was discarded and rinsed with 70% ethanol. After air drying, it was dissolved in an appropriate amount of DEPC (diethylpyrocarbonate) water to obtain a total RNA solution. Next, mRNA was purified from total RNA using oligotex-dt30 <Super> mRNA Purification kit (From Total RNA) (manufactured by Takara Bio Inc.) according to the attached manual.

  In the microarray analysis, the probe was prepared by a post-labeling method using Cy3 and Cy5. Purified mRNA was prepared to 1 μg / 9 μl, and aminoallyl-labeled cDNA was synthesized from mRNA using CyScribe cDNA Post Labeling Kit (manufactured by GE healthcare) according to the attached manual. The synthesized aminoallyl-labeled cDNA was purified using CyScribe GFX Purification Kit (manufactured by GE healthcare), and then CyDye-labeled using CyScribe cDNA Post Labeling Kit (manufactured by GE healthcare). At this time, a set in which the cDNA derived from the control strain was labeled with Cy3 and the cDNA derived from the mpkA-disrupted strain was labeled with Cy5, and the reverse set (Dye swap) was prepared. The labeled probe was purified by CyScribe GFX Purification Kit (manufactured by GE healthcare) and dried with a centrifugal evaporator. A hybridization solution shown in Table 17 of Example 10 was prepared, and using this solution 60 μL, the Cy3-labeled cDNA was dissolved so that the above combination was used, and then the Cy5-labeled cDNA was used using the solution. The solution was mixed by a procedure such as dissolving to prepare a hybridization solution.

  Aspergillus oryzae microarray used was a Neisseria gonorrhoeae 12K glass slide microarray manufactured by Farm Lab. The array slide was covered with a gap cover glass (manufactured by Matsunami), and the labeled hybridization solution was filled between the array slide and the cover glass. It installed in the array slide chamber (made by Takara Bio Inc.), and hold | maintained for 17 hours in the water bath set to 40 degreeC. Thereafter, the array slide was taken out from the array slide chamber, and the cover glass was peeled off in a plastic washing container filled with Wash buffer 1 (2 × SSC, 0.03% SDS). The array slide was washed by washing in Wash buffer 1 for 15 minutes at room temperature. Next, it was transferred to a washing container filled with Wash Buffer 2 (0.2 × SSC), and washed with shaking for 5 minutes at room temperature. Finally, it was transferred to a washing container filled with Wash Buffer 3 (0.05 × SSC), washed with shaking for 5 minutes at room temperature, and then centrifuged at 800 rpm for 2 minutes to completely remove moisture.

  GenePix4000B (Axon) was used for imaging the array slide. The imaged scan data was digitized using GenePixPro microarray analysis software attached as standard to GenePix4000B. The array data was standardized using Genomic Profiler (Mitsui Information Co., Ltd.) and t-tested using Excel. By narrowing down the data obtained here by the p-value of the t-test, only sufficiently reliable data was used for subsequent analysis. From the obtained array data, a gene having a large difference in the expression level ratio between the Aspergillus oryzae mpkA-disrupted strain and the control strain was extracted and used as a gene whose expression varies depending on MpkA.

  As a result, among Aspergillus oryzae genes whose expression changes depending on MpkA, genes whose activity is increased by pathway blockage (AO090038000214, AO090003001496, AO090009000634, AO090102000339), and genes whose activity is suppressed by pathway blockage (AO090003001367, AO090012000623, AO090012000169, AO090012000625, AO090012000622, AO090003001336, AO09001000644) were identified. The promoters of these genes can detect the activation or inhibitory action of the test substance on the MpkA pathway, which is one of the MAP kinase pathways, by functionally binding to the reporter gene.

Example 13
In this example, transcription analysis data in the disrupted and wild-type strains of MAP kinase MpkA constituting the cell wall integrity pathway described in the paper of Fujioka et al. (2007) Eukaryotic Cell 6: 1497-1510 A reporter strain using the promoter regions of agsA gene and agsB gene was prepared.

(1) Construction of reporter gene vector
From the Broad Institute Aspergillus Genome Database (http://www.broad.mit.edu/annotation/genome/aspergillus_group/MultiHome.html) 5 'upstream region of the agsA and agsB genes of Aspergillus nidulans 1,000 The bp was amplified by PCR using the primer set shown in Table 19.

  The PCR product was introduced into pGEM-T Easy Vector (Promega) to obtain pGEM-PagsA and pGEM-PagsB. Next, pGEM-PagsA and pGEM-PagsB were digested with NotI, PagsA and PagsB (the 5 ′ upstream region of PagsA and PagsB, 1,000 bP) were excised, introduced into the NotI site of pNA (N) EGFP, and pNA (N) EGFP / PagsA and pNA (N) EGFP / PagsB were prepared. PNA (N) EGFP was provided by Dr. Kentaro Furukawa, Graduate School of Agriculture, Tohoku University, and nuclear transfer signal LacI was added to EGFP (Furukawa et al. Biosci. Biotechnol. Biochem., 2007 (71) 1724-1730).

  In the above plasmid, pNA (N) EGFP / PagsA was linearly cleaved at the SrfI site present in the aureobasidin resistance gene aurA, and pNA (N) EGFP / PagsB was cleaved linearly at the BssHII site present in aurA. Using the fragments, A. Nidulans A89 + argB (formally RB89) strain and mpkAΔ strain (A89 ΔmpkA :: argB) were transformed. Aureobasidin resistant strains were selected and gene transfer was confirmed by PCR.

(2) EGFP-LacI fluorescence observation
A 96-well titer plate was mixed with 200 μL of a CD biotin liquid medium and a spore suspension 20 (200 cells) prepared from a transformant from the RB89 strain, and cultured at 30 ° C. for 24 hours. The cells were scraped from the titer plate and the fluorescence of EGFP-LacI was observed. In the PagsB-EGFP transformant, EGFP-LacI fluorescence localized in the nucleus was observed, but no fluorescence was observed in the PagsA-EGFP transformant. On the other hand, when the mpkAΔ strain was used as the host, fluorescence was observed in the PagsA-EGFP transformant, and no fluorescence was observed in the PagsB-EGFP transformant (FIG. 11). This completely matches the expression analysis pattern of agsA and agsB (Fujioka et al. Eukaryotic Cell, 2007 (6) 1497-1510). From the above results, it can be said that PagsA-EGFP and PagsB-EGFP reporter can be used for screening of signal cleavage agonists of MpkA pathway.

Example 14
Verification of possibility of cat1 gene as HOG pathway reporter gene (1) Search of CAT-1 gene homologue of blast fungus from genome database In this example, CAT-1 (catalase 1) gene is HOG pathway in Neurospora crassa The orthologue of CAT-1 gene was searched from the genome database of blast fungus (http://www.broad.mit.edu/annotation/genome/magnaporthe_grisea/MultiHome.html) . When a blastp search was performed using the CAT-1 gene (NCU08791.3) of N. crassa as a query sequence, MGG_10061.6 (Genbank accession number XM_365841) was hit with high homology, so this gene was the cat1 gene in blast It was.

(2) Preparation of total RNA and cDNA synthesis When cat1 gene in blast fungus is treated with HOG pathway constitutive activator fludioxonil or iprodione, it is verified whether the expression changes specifically and can be used as a detection marker did.

  Bacterial cells of blast fungus to be finely cut with a blender are cultured in 50 ml YG liquid medium (0.4% yeast extract, 2% glucose / 200 ml Erlenmeyer flask) at 27 ° C, 120 rpm, 22 h, and then 20 μl of fludioxonil (in DMSO) is 50 μl. Added (final concentration 20 μg / ml). As a control, 50 μl of DMSO was added. The culture was continued for 15 minutes after the addition of the drug, and the cells were collected with Miracloth. The cells were disrupted using liquid nitrogen and suspended in 5 ml of TRIzol (Invitrogen) and allowed to stand for 5 minutes. After adding 1 ml of chloroform and stirring vigorously, the mixture was allowed to stand at room temperature for 3 minutes. Centrifugation was performed at 5,000 rpm, 15 min, 4 ° C., and about 3 ml of the aqueous layer containing RNA was transferred to another tube. 1.2 ml of this RNA fraction was purified using the PureLink Micro-to-Midi Total RNA Purification Kit (Invitrogen). This total RNA was reverse-transcribed using PrimeScript RT reagent Kit (Perfect Real Time) (Takara Bio Inc.) to prepare single-stranded cDNA. Both Oligo dT Primer and Random 6 mers were used as reverse transcription primers.

(3) Transcriptional response analysis of cat1 gene by real-time PCR β-tubulin gene (MGG — 00604.6) was used as an internal standard gene. The primers used for the analysis are shown below.
For cat1 gene in blast fungus
Mgcat1 FW1: 5'-TGGATCAGTTCTTCCACAGCA-3 '(SEQ ID NO: 221)
Mgcat1 RV1: 5'-AACTCCACCCGCTTTCTCC-3 '(SEQ ID NO: 222)
For β-tubulin gene
Mg_b-tubulin FW1: 5'-GAGTCCAACATGAACGATCT-3 '(SEQ ID NO: 223)
Mg_b-tubulin RV1: 5'-GTACTCCTCTTCCTCCTCGT-3 '(SEQ ID NO: 224)

  SYBR Premix Ex Taq II (Perfect Real Time) (manufactured by Takara Bio Inc.) was used for the preparation of the reaction system for real-time PCR, and Thermal Cycler Dice Real Time System (manufactured by Takara Bio Inc.) was used for the thermal cycler. The reaction conditions were initial denaturation 95 ° C., 30 seconds, then denaturation 95 ° C., 5 seconds, annealing / extension: 60 ° C., 30 seconds (40 cycles).

  The results of RT-PCR are shown in FIG. The transcription amount of cat1 gene was significantly increased by fludioxonil and iprodione treatment. Thus, it was confirmed that the cat1 gene 5′-UTR (promoter of the 5 ′ upstream region) in blast fungus can be used as a screening system for HOG pathway activators by functionally binding to a reporter gene.

  The present invention can be used in the field of developing antibacterial agents used for infectious microorganisms.

Claims (54)

Measuring the expression of at least one gene selected from the gene group identified by the Genbank accession number shown in Table 1 in the cell to which the test substance is allowed to act;

And a step of identifying the test substance as a candidate substance for a respiratory chain inhibitor when the expression of the gene fluctuates in comparison with the expression when the test substance is not allowed to act.   The respiratory chain inhibitor is at least selected from the group consisting of Complex1 inhibitor, Complex2 inhibitor, Complex3 inhibitor, Complex5 (F1Fo ATPase) inhibitor, and uncoupling agent that acts on electron transfer to inhibit ATP synthesis. The screening method according to claim 1, wherein the screening method is an inhibitor having an action mechanism similar to that of one kind of inhibitor.   The screening method according to claim 1, wherein the screening method comprises identifying as a candidate substance of a respiratory chain inhibitor exhibiting a respiratory chain inhibitory action against blast fungus.   The screening method according to claim 1, wherein the expression of at least the XM_001403469 (MGG_12936) gene in the gene group shown in Table 1 is measured. A recombinant DNA obtained by linking a promoter region of a gene selected from the gene group specified by the Genbank accession number shown in Table 2 and a reporter gene that can be expressed under the control of the promoter region.

  The recombinant DNA according to claim 5, wherein the promoter region is a region 2 kb upstream from the 5 'end of the start codon in the gene.   A transformed cell into which the recombinant DNA according to claim 5 or 6 has been introduced.   A screening kit for a respiratory chain inhibitor, comprising the transformed cell according to claim 7 and a measurement reagent for measuring a reporter gene product in the transformed cell. Measuring the expression of at least one gene selected from the gene group identified by the Genbank accession number shown in Table 3 in the cell to which the test substance is allowed to act;

And a step of identifying the test substance as a candidate substance for an ergosterol biosynthesis inhibitor when the expression of the gene fluctuates in comparison with the expression when the test substance is not allowed to act.   10. The screening method according to claim 9, wherein the ergosterol biosynthesis inhibitor is an inhibitor having an action mechanism similar to that of oxpoconazole fumarate.   The screening method according to claim 9, wherein the screening method is identified as a candidate substance for an ergosterol biosynthesis inhibitor exhibiting an ergosterol biosynthesis inhibitory action against blast fungus.   The screening method according to claim 9, wherein the expression of at least the XM_362183 (MGG_04628) gene in the gene group shown in Table 3 is measured. A recombinant DNA obtained by linking a promoter region of a gene selected from the gene group specified by the Genbank accession number shown in Table 4 and a reporter gene that can be expressed under the control of the promoter region.

  The recombinant DNA according to claim 13, wherein the promoter region is a region 2 kb upstream from the 5 'end of the start codon in the gene.   A transformed cell into which the recombinant DNA according to claim 13 or 14 has been introduced.   A screening kit for an ergosterol biosynthesis inhibitor, comprising the transformed cell according to claim 15 and a measurement reagent for measuring a reporter gene product in the transformed cell. Measuring the expression of at least one gene selected from the gene group identified by the Genbank accession number shown in Table 5 in the cell to which the test substance is allowed to act;

And a step of identifying the test substance as a candidate substance for a cell wall biosynthesis inhibitor when the expression of the gene fluctuates in comparison with the expression when the test substance is not allowed to act.   18. The screening method according to claim 17, wherein the cell wall biosynthesis inhibitor is an inhibitor having an action mechanism similar to that of Micafungin and / or calcoflor white.   18. The screening method according to claim 17, wherein the screening method is identified as a candidate substance for a cell wall biosynthesis inhibitor exhibiting a cell wall biosynthesis inhibitory action against blast fungus.   18. The screening method according to claim 17, wherein the expression of at least the XM_364794 (MGG_09639) and XM_368552 (MGG_00692) genes in the gene group shown in Table 5 is measured. A recombinant DNA obtained by linking a promoter region of a gene selected from the gene group identified by the Genbank accession number shown in Table 6 and a reporter gene that can be expressed under the control of the promoter region.

  The recombinant DNA according to claim 21, wherein the promoter region is a region 2 kb upstream from the 5 'end of the initiation codon in the gene.   A transformed cell into which the recombinant DNA according to claim 21 or 22 has been introduced.   A screening kit for a cell wall biosynthesis inhibitor comprising the transformed cell according to claim 23 and a measurement reagent for measuring a reporter gene product in the transformed cell. Measuring the expression of a superoxide desmutase gene (Genbank accession number: XM — 653297, SEQ ID NO: 71) in a cell to which a test substance is allowed to act;
A step of identifying the test substance as a candidate substance for an MpkB pathway inhibitor when the expression of the gene fluctuates in comparison with the expression when the test substance is not allowed to act.   The screening method according to claim 25, wherein the MpkB pathway inhibitor is an inhibitor having an action mechanism similar to that of an inhibitor of the mpkB gene or the gene product.   26. The screening method according to claim 25, wherein the method is identified as a candidate substance for an MpkB pathway inhibitor exhibiting an MpkB pathway inhibitory action against Aspergillus.   A recombinant DNA in which a promoter region of a superoxide desmutase gene (Genbank accession number: XM — 653297, SEQ ID NO: 71) is linked to a reporter gene that can be expressed under the control of the promoter region.   The recombinant DNA according to claim 28, wherein the promoter region is a region 2 kb upstream from the 5 'end of the start codon in the gene.   A transformed cell into which the recombinant DNA according to claim 28 or 29 has been introduced.   A screening kit for an MpkB pathway inhibitor, comprising the transformed cell according to claim 30 and a measurement reagent for measuring a reporter gene product in the transformed cell. Measuring the expression of at least one gene selected from the gene group identified by the Genbank accession number shown in Table 4 in the cell to which the test substance is allowed to act;

Identifying the test substance as a candidate substance for a cell wall integrity pathway inhibitor when the expression of the gene fluctuates in comparison with the expression when the test substance is not allowed to act, Screening method.   The screening method according to claim 32, wherein the cell wall integrity pathway inhibitor is an inhibitor having an action mechanism similar to that of the inhibitor of the mpkA gene or the gene product.   33. The screening method according to claim 32, wherein the screening method is identified as a candidate substance for a cell wall integrity pathway inhibitor exhibiting a cell wall integrity pathway inhibitory action against Aspergillus oryzae.   33. The screening method according to claim 32, wherein the expression of at least the XM_001825115 (AO090038000214) gene in the gene group shown in Table 7 is measured. A recombinant DNA obtained by linking a promoter region of a gene selected from the gene group specified by the Genbank accession number shown in Table 8 and a reporter gene that can be expressed under the control of the promoter region.

  The recombinant DNA according to claim 36, wherein the promoter region is a region 2 kb upstream from the 5 'end of the initiation codon in the gene.   A transformed cell into which the recombinant DNA according to claim 36 or 37 is introduced.   A screening kit for a cell wall integrity pathway inhibitor, comprising the transformed cell according to claim 38 and a measurement reagent for measuring a reporter gene product in the transformed cell. Measuring the expression of the agsA gene (Genbank accession number: XM_658397, SEQ ID NO: 83) and / or the agsB gene (Genbank accession number: XM_655819, SEQ ID NO: 84) in the cell to which the test substance is allowed to act;
Identifying the test substance as a candidate substance for a cell wall integrity pathway inhibitor when the expression of the gene fluctuates in comparison with the expression when the test substance is not allowed to act, Screening method.   41. The screening method according to claim 40, wherein the cell wall integrity pathway inhibitor is an inhibitor having an action mechanism similar to that of the inhibitor of the gene or the gene product.   41. The screening method according to claim 40, wherein the screening method is identified as a candidate substance for a cell wall integrity pathway inhibitor that exhibits cell wall integrity pathway inhibitory action against Aspergillus nidulans.   41. The screening method according to claim 40, wherein expression of at least agsB gene among agsA gene and agsB gene is measured.   a promoter region of agsA gene (Genbank accession number: XM_658397, SEQ ID NO: 83) and / or agsB gene (Genbank accession number: XM_655819, SEQ ID NO: 84), and a reporter gene that can be expressed under the control of the promoter region. Ligated recombinant DNA.   45. The recombinant DNA according to claim 44, wherein the promoter region is a region 2 kb upstream from the 5 'end of the start codon in the gene.   46. A transformed cell into which the recombinant DNA according to claim 44 or 45 has been introduced.   49. A screening kit for a cell wall integrity pathway inhibitor comprising the transformed cell according to claim 46 and a measurement reagent for measuring a reporter gene product in the transformed cell. Measuring the expression of the cat1 gene (Genbank accession number: XM_365841, SEQ ID NO: 85) in the cells treated with the test substance;
A step of identifying the test substance as a candidate substance for an osmotic response (HOG: high osmolarity glycerol) pathway activator when the expression of the gene fluctuates in comparison with the expression when the test substance is not allowed to act A screening method comprising:   49. The screening method according to claim 48, wherein the osmotic response (HOG: high osmolarity glycerol) pathway activator is an activator having a mechanism of action similar to fludioxonil and / or iprodione.   49. The screening method according to claim 48, wherein the screening method is identified as a candidate substance for an osmotic response (HOG: high osmolarity glycerol) pathway activator that exhibits an osmotic response (HOG: high osmolarity glycerol) pathway activity action against blast fungus. .   A recombinant DNA obtained by linking a promoter region of the cat1 gene (Genbank accession number: XM_365841, SEQ ID NO: 85) and a reporter gene that can be expressed under the control of the promoter region.   52. The recombinant DNA according to claim 51, wherein the promoter region is a region 1.5 kb upstream from the 5 'end of the start codon in the gene.   53. A transformed cell into which the recombinant DNA according to claim 51 or 52 has been introduced.   54. A screening kit for an osmotic response (HOG: high osmolarity glycerol) pathway activator comprising the transformed cell according to claim 53 and a measurement reagent for measuring a reporter gene product in the transformed cell.

Images