JP2010207160A - Enzymatic reagent for removing modified group of dna 3' terminal - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a new use utilizing the unknown function of a heat-resistant DNA polymerase, or a method for utilizing the same. <P>SOLUTION: The enzymatic reagent has a function for cleaving the deoxyribose-3'-phosphate of a DNA 3' terminal. The cleaving function does not relate to the kind of a substituent bound to the phosphate group of the ester, and is low in substrate specificity. The activity of the DNA polymerase is utilized to perform a PCR gene amplification using a primer also used as a probe, a real time PCR, or the restoration of the damaged gene of an ancient organism, and the amplification thereof. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to an enzyme reagent for removing a DNA 3'-end modification group comprising a DNA polymerase and a method for using the reagent.

A DNA polymerase is an enzyme that synthesizes a complementary DNA using a single-stranded nucleic acid as a template, and has been classified into six families based on commonality of amino acid sequences.
DNA polymerase is useful for DNA sequencing reactions, gene amplification reactions, radioactive labeling of DNA, in vitro synthesis of mutant genes, etc., and is indispensable in the fields of organisms that handle genes, medical care, foods, etc. Yes.
Among them, commonly used enzyme reagents include Escherichia coli DNA polymerase I, family A DNA polymerases typified by thermophile Thermus aquatics DNA polymerase (Taq DNA polymerase), or T4 phage DNA. Examples include family B DNA polymerases typified by polymerase. In addition, various DNA polymerases have been discovered from bacteria, animals and plants to date, but most of them are DNA polymerases derived from normal temperature organisms, so they have poor heat resistance, and PCR includes a heat denaturation reaction at 94 ° C. or higher. It was inappropriate for the reaction. On the other hand, the thermophilic bacterium, thermus aquatics DNA polymerase (Taq DNA polymerase) is thermostable, but lacks 3'-5 'proofreading exonuclease activity, so it is easy to induce errors in PCR reaction, It was unsuitable.

On the other hand, under such circumstances, the present applicant consists of 775 amino acid residues as a DNA polymerase derived from the hyperthermophilic bacterium Pyrococcus horikoshi and having heat resistance and 3'-5 'proofreading exonuclease activity. DNA polymerase (see Patent Document 1), heterodimer DNA polymerase from which the small subunit and intein sequence have been removed (see Patent Document 2), and a mutant of the heterodimeric DNA polymerase (see Patent Document 3) ing.
In addition, some DNA polymerases are known to have 5'-3 proofreading exonuclease action or damage overcoming repair function.
However, the full extent of the action, function and properties of DNA polymerase has not yet been clarified, and the possibility of having an unknown action and function cannot be denied.

Japanese Patent No. 3015878 Japanese Patent No. 3829174 Japanese Patent Laid-Open No. 2007-228897

  An object of the present invention is to search and discover an unknown function of a DNA polymerase, particularly a heat-resistant DNA polymerase, and to provide a new use of the DNA polymerase utilizing the function or a method for using the new use.

As a result of intensive studies to solve the above problems, the present inventors have found that the DNA polymerase has a function of cleaving deoxyribose-3′-phosphate ester at the DNA 3 ′ end, and the cleaving function comprises the ester Regardless of the type of substituent that binds to the phosphate group, the inventors have found that the substrate specificity is low, and have created a new use of DNA polymerase and its utilization method, thereby completing the present invention.
That is, the present invention is as follows.

(1) An enzyme reagent for cleaving a free or modified phosphate ester bound to the DNA 3 ′ terminal nucleotide 3 ′ position, comprising DNA polymerase.

(2) The enzyme reagent according to (1) above, which has a complementary strand extending action corresponding to the template DNA sequence from the DNA 3 ′ end after cleavage of the modified phosphate ester.

(3) The enzyme reagent according to (1) or (2) above, wherein the DNA polymerase is thermostable.

(4) The DNA polymerase has the amino acid sequence represented by SEQ ID NO: 3, or has an amino acid sequence in which one or several amino acid residues are deleted, substituted or added in the amino acid sequence, and the DNA polymerase The enzyme reagent according to (3) above, which is an enzyme having activity.

(5) The DNA polymerase is a heterodimeric enzyme having a DNA polymerase activity comprising a small subunit and a large subunit,
The small subunit is a protein having the amino acid sequence shown in SEQ ID NO: 9, or a protein containing substitution, deletion or addition of one or several amino acid residues in the amino acid sequence, wherein the large subunit is A protein having a sequence obtained by removing the amino acid sequence (955th to 1120th) encoded by the intein sequence from the amino acid sequence shown in SEQ ID NO: 5, or substitution of one or several amino acid residues in the sequence The enzyme reagent according to (3) above, which is a protein containing a deletion or addition.

(6) The small subunit further has an amino acid sequence in which at least the 167th to 200th region is deleted in the amino acid sequence shown in SEQ ID NO: 9, or one or several in the deleted amino acid sequence The enzyme reagent according to (5) above, which is a protein comprising substitution, deletion or addition of the amino acid residues of

(7) The enzyme reagent according to any one of (1) to (6) above, wherein the modified phosphate ester is bound to a fluorescent dye, biotin or an enzyme via a phosphate residue.

(8) The enzyme reagent according to any one of (1) to (6) above, wherein the modified phosphate ester is a phosphate ester derived from a damaged nucleotide.

(9) A DNA polymerase is allowed to act on DNA hybridized with a primer having a sequence partially complementary to the template DNA sequence, and a primer sequence is subjected to 3 'terminal extension reaction to prepare double-stranded DNA. A method as described above, characterized in that the deoxyribose 3 'hydroxyl group in the 3' terminal nucleotide of the primer DNA sequence is esterified with free or modified phosphate.

(10) A method of amplifying a DNA to be amplified by a PCR method using an upper and a lower primer and a DNA polymerase, and forming an ester with a 3'-hydroxyl group of a 3'-terminal nucleotide of at least one primer And binding to a labeling compound via the phosphate group.

(11) The method according to (10) above, wherein the labeling compound is a fluorescent compound, biotin, or an enzyme.

(12) A method for quantifying DNA to be measured by real-time PCR using upper and lower primer DNAs and DNA polymerase, wherein the 3 ′ hydroxyl group of the 3 ′ terminal nucleotide of at least one primer DNA is a phosphate group The method according to (11) above, wherein an ester is formed, a fluorescent dye is bonded via the phosphate group, and the 5 ′ end is labeled with a quencher.

(13) The 3 ′ hydroxyl group of the 3 ′ terminal nucleotide of DNA in an ancient biological sample is esterified with a phosphate modified by a substituent generated by nucleotide degradation accompanying damage or a free phosphate, and one of the complementary strands Is a method for repairing damaged gene DNA having an interrupted portion, and after denatured and annealed to the damaged gene DNA, DNA polymerase is allowed to act to cleave the modified phosphate ester and complementary strand extension reaction A method for repairing damaged genes in ancient biological samples, characterized in that

(14) The method according to any one of (9) to (13) above, wherein the DNA polymerase is heat resistant.

(15) The DNA polymerase has the amino acid sequence represented by SEQ ID NO: 3, or has an amino acid sequence in which one or several amino acid residues are deleted, substituted or added in the amino acid sequence, and the DNA polymerase The method according to (14) above, which is an enzyme having activity.

(16) The DNA polymerase is a heterodimeric enzyme having a DNA polymerase activity comprising a small subunit and a large subunit,
The small subunit is a protein having the amino acid sequence shown in SEQ ID NO: 9, or a protein containing substitution, deletion or addition of one or several amino acid residues in the amino acid sequence, wherein the large subunit is A protein having a sequence obtained by removing the amino acid sequence (955th to 1120th) encoded by the intein sequence from the amino acid sequence shown in SEQ ID NO: 5, or substitution of one or several amino acid residues in the sequence The method according to (14) above, wherein the protein comprises a deletion or addition.

(17) The small subunit further has an amino acid sequence in which at least the 167th to 200th region is deleted in the amino acid sequence shown in SEQ ID NO: 9, or one or several in the deleted amino acid sequence The method according to (14) above, wherein the protein comprises a substitution, deletion or addition of the amino acid residue.

(18) A PCR reagent kit having at least upper and lower primer DNAs and a DNA polymerase having a sequence complementary to each terminal side sequence of the DNA to be amplified, the 3 ′ terminal nucleotide of at least one primer DNA The above-mentioned reagent kit, wherein the 3 ′ hydroxyl group forms an ester with a phosphonic acid group and is bonded to the labeling compound via the phosphoric acid group.

(19) A reagent kit for real-time PCR quantification of DNA comprising at least an upper and lower primer DNA having a sequence complementary to each terminal sequence of the DNA to be measured, and a DNA polymerase, wherein one primer DNA is The 3′-terminal nucleotide of the 3′-terminal nucleotide forms an ester with a phosphonic acid group, is bonded to a fluorescent dye via the phosphate group, and the 5′-end is labeled with a quencher. The reagent kit.

  In the present invention, DNA having a free or modified phosphate ester bound to the 3 ′ terminal nucleotide 3 ′ position by cleaving free or modified phosphate ester bound to the DNA 3 ′ terminal nucleotide 3 ′ position When hybridized with template DNA, it has a complementary strand elongation action corresponding to the sequence, and it was found that its substrate characteristics were extremely low, and labeled with fluorescence, biotin, enzyme, etc. at the DNA 3 ′ end Even if it has a phosphate ester group or other modified phosphate ester group, most of it is excised, and complementary strand extension from the 3 ′ end becomes possible. By utilizing the cleavage activity of the modified phosphate ester with low substrate specificity of DNA polymerase and the subsequent complementary strand extension activity, for example, gene amplification by PCR or repair and amplification of damaged genes of ancient organisms is extremely simple. Will be able to do.

  For example, in PCR, if DNA that has a labeled phosphoric ester at the 3 ′ end with a fluorescent dye or the like is used as a primer, the primer can be used as a probe. In addition to eliminating this, the experimental operation is simplified. In particular, polymerase B, polymerase D and polymerase D mutants derived from Pyrococcus horikoshi have high heat resistance, 3′-5 ′ proofreading exonuclease activity, and the activity of cleaving the 3 ′ terminal phosphate group is In particular, it can be advantageously used in gene amplification by PCR and in the technique using the above-mentioned primer for both probes in real-time PCR.

It is a figure which shows the outline | summary of the search and amplification method of the gene of this invention using DNA polymerase. It is a figure which shows the outline | summary of the real-time PCR method of this invention using DNA polymerase. It is a figure which shows the outline | summary of the repair and amplification method of the damage gene derived from the ancient organism of this invention using DNA polymerase. It is a figure which shows the outline of the structure of each oligonucleotide which has a modified phosphate ester in 3 'terminal. Using an oligonucleotide having a FITC-modified phosphate ester at the 3 ′ end and an oligonucleotide having a 3-amino-propyl group-modified phosphate ester at the 3 ′ end and modified with a 5 ′ end FAM as a substrate, PhPolB and It is a figure which shows the result of having made PhPolD act and performing the cutting test of the modified phosphate ester. Each oligonucleotide having a phosphate ester modified with biotin, 3-amino-propyl group, 3-hydroxy-propyl group, and free phosphate group at the 3 ′ end and modified with FAM at the 5 ′ end is used as a substrate. It is a figure which shows the result of having made PhPolB and PhPolD act and having carried out the cutting test of the modified phosphate ester. As a result of testing the cleavage test and the complementary strand extension activity of the modified phosphate ester by using PhPolB and PhPolD with the oligonucleotide having a FITC modified phosphate ester at the 3 ′ end and modified with the 5 ′ end TAMRA as a substrate FIG. Each oligonucleotide having a phosphate ester modified with biotin, 3-amino-propyl group, 3-hydroxy-propyl group, and free phosphate group at the 3 ′ end and modified with FAM at the 5 ′ end is used as a substrate. It is a figure which shows the result of having made PhPolB and PhPolD act, and testing the cleavage test and complementary strand extension activity of a modified phosphate ester. It is a figure which shows the result of having performed the cleavage test of the modified phosphate ester of PhPolB and PhPolD under each temperature using the oligonucleotide which has FITC modified phosphate ester as a substrate at 3 'terminal. Using Klenow Fragment, T4 DNA polymerase as the DNA polymerase, an oligonucleotide having a FITC-labeled phosphate group at the 3 ′ end and a 5 ′ FAM-modified oligonucleotide having a free phosphate group at the 3 ′ end It is a figure which shows the result of having tested the cutting | disconnection activity of 3 'terminal modification phosphate ester group. Using each oligonucleotide having a FITC-modified phosphate ester at the 3 ′ end and a phosphate ester modified with biotin at the 3 ′ end and modified with FAM at the 5 ′ end as a substrate, It is a figure which shows the result of having tested the cutting activity of PhPolD and PhPolD mutant.

The present invention relates to an enzyme reagent for cleaving a free or modified phosphate ester bound to the 3′-end nucleotide 3 ′ of DNA, comprising a DNA polymerase, and a nucleotide at the 3′-end of DNA by phosphoesterase activity found in DNA polymerase Is used to hydrolyze the ester moiety in which the hydroxyl group of deoxyribose 3 ′ is esterified with a modified phosphate group.
Hydrolysis of the modified phosphate ester by DNA polymerase proceeds even in the absence of template DNA, but when the template DNA and the DNA having the modified phosphate ester at the 3 ′ end are hybridized, The polymerase cleaves the modified phosphate ester in the presence of the substrate nucleoside triphosphate (dNTP), and extends a complementary strand corresponding to the template DNA sequence from the 3 ′ end to form a double-stranded DNA.

  Examples of such DNA polymerases include Klenow Fragment and T4 DNA polymerase. Among them, thermophilic archaea, Pyrococcus holicosi-derived thermostable DNA polymerase, compared to other DNA polymerases. The modified ester group is particularly preferably hydrolyzed, and is preferably used because of its wide substrate specificity regardless of the type of the modifying group.

Examples of the DNA polymerase derived from Pyrococcus horikoshi include the following (a) to (c) according to the application of the present applicant.
(A) DNA polymerase having the amino acid sequence represented by SEQ ID NO: 3 from which the intein in the protein consisting of the amino acid sequence of SEQ ID NO: 1 (its gene base sequence is represented by SEQ ID NO: 2) has been removed (Japanese Patent No. 301587) ). This DNA polymerase is hereinafter referred to as PhPolB.
(B) a heterodimeric enzyme comprising a small subunit and a large subunit, wherein the small subunit is a protein having the amino acid sequence shown in SEQ ID NO: 9, and the large subunit is an amino acid shown in SEQ ID NO: 5 DNA polymerase (Japanese Patent No. 3829174), which is a protein having a sequence (SEQ ID NO: 7) from which the amino acid sequence (955th to 1120th) encoded by the intein sequence has been removed. Hereinafter, this DNA polymerase is referred to as PhPolD.
(C) In the DNA polymerase of (b) above, in the amino acid sequence of the small subunit (SEQ ID NO: 9), at least the 167th to 200th region, and the 3′-5 ′ exonuclease activity suppression region is deleted. DNA polymerases having the amino acid sequence described above, and the types of mutants include a mutant lacking the 1-200th amino acid from the N-terminal of the small subunit (SEQ ID NO: 11), and 1- A mutant lacking the 65th amino acid, a mutant lacking the 167-200th amino acid from the N-terminal of the small subunit, or a mutant lacking the 140-200th amino acid from the N-terminal of the small subunit; All of these have increased 3′-5 ′ exonuclease activity (Japanese Patent Application Laid-Open No. 2007-228897). This DNA polymerase is hereinafter referred to as a PhPolD mutant.

On the other hand, the base sequence of the PolB gene is shown in SEQ ID NO: 4, and the base sequence of the large subunit and small subunit of PolD and the base sequence of the gene of the large subunit after removal of the intein sequence are sequentially arranged. The numbers 6, 10, 8 are shown. In addition, the amino acid sequence of the small subunit from which the 1st to 200th positions are deleted as the 3′-5 ′ exonuclease activity suppression region and the base sequence of the gene in the PolD mutant are shown in SEQ ID NO: 12, respectively.
Moreover, as long as these PolB, polD, and polD mutants have DNA polymerase activity, in the present invention, one or several amino acids in the amino acid sequence of the DNA polymerase or each subunit of (a) to (c) above. Those having an amino acid sequence in which residues are deleted, substituted or added are also included.
Comparing the cleavage activity of the DNA 3 ′ end-modified phosphate ester of these DNA polymerases, PhPolD or PhpolD mutant has higher activity.

  PhPolB, PhPolD, and PhPolD mutants are synthesized based on the primers synthesized based on the above-mentioned PhPolB gene base sequences, or the base sequences of the PhPolD, PhPolD small subunit and large subunit genes and the remaining region. Can be easily obtained from the transformant by transforming a host such as Escherichia coli using each of the genes obtained by PCR amplification using the DNA derived from Pyrococcus horikoshii genome as a template. Is possible. In the case of PhPolD and PhPolD mutants, it is preferable to co-express the small subunit gene and the large subunit in the transformant. Details of this production method are disclosed in the above publication.

The method for using the DNA polymerase of the present invention will be described below.
The substrate specificity of the phosphoesterase activity of DNA polymerases is very wide and cleaves phosphate esters that are free or modified with various modifying groups. For example, even a phosphate ester labeled with a fluorescent dye, biotin, enzyme or the like can be cleaved and removed, and a complementary strand corresponding to the template DNA can be extended from the 3 ′ end of the DNA from which the label has been removed.
As a utilization method making use of such characteristics, there is a PCR method in which a prober also has a probe function, and this method is exemplified below.

Exploration and amplification of target genes (Figure 1)
1) First, a pair of primer DNAs corresponding to the target gene was synthesized, and a labeling compound such as a fluorescent dye was bound to the 3 ′ hydroxyl group of at least one of the 3 ′ ends via a phosphate group. Create a 3 'end labeled primer.
2) This 3 'end labeled primer has a probe function. For example, this 3' end labeled primer is added to a PCR well on which a candidate gene sample is immobilized, and the 3 'end labeled primer that has not hybridized is added. The candidate gene sample hybridized with the 3 ′ end-labeled primer is washed and removed, and is detected by fluorescence and selected.

3) Then, when the 3 ′ end-labeled primer used is only one corresponding to one end of the target gene, a primer corresponding to the other end is added to the selected well, and the target gene When a pair of 3 ′ end-labeled primers corresponding to both ends of is used, a DNA polymerase and a dNTP reagent are added as they are, and a PCR reaction is performed. At this time, the label of the 3 ′ end labeled primer is removed by the phosphoesterase action of the DNA polymerase, the complementary strand is extended, and the target gene is amplified.
4) The amplified target gene is introduced into a vector and cloned.
In this method, since the PCR amplification primer has a probe function, it is possible to perform PCR extremely simply without separately preparing and using the probe and the primer as in the prior art.

Real-time PCR (Figure 2)
A pair of primer DNAs corresponding to the gene to be measured is synthesized, and a labeling compound such as the above fluorescent dye is bound to the 3 ′ hydroxyl group at the 3 ′ end of one primer DNA via a phosphate group, and the 5 ′ end A quencher such as BHQ-1 is bound to the two to prepare labeled primers at both ends, and the labeled primer and the other primer, dNTP and DNA polymerase are added to the sample containing the gene to be measured, and a PCR reaction is performed.
Both end-labeled primers hybridize with the gene to be measured. At the time of hybridization, the 3′-end fluorescent label is suppressed from generating fluorescence even when irradiated with excitation light by a quencher. However, in the PCR reaction, the fluorescent label is removed by the phosphoesterase activity of the DNA polymerase, and fluorescence is generated by releasing the fluorescence suppression by the quencher.

This fluorescence intensity reflects the amount of amplified PCR product corresponding to the number of PCR cycles, and the amount of PCR product depends on the initial amount (concentration) of the gene to be measured. Thus, the amplification curve of the measurement target gene corresponding to each cycle number can be obtained. From the amplification curve obtained using the serially diluted measurement target gene, the Ct (Threshold Cycle) value and the initial measurement target gene amount are obtained. A calibration curve can be created.
In the present invention, from the Ct value obtained for the gene sample to be measured whose concentration is unknown, the calibration curve is used. The measured gene can be quantified. Such a calibration curve creation and gene quantification method itself is the same as the conventional real-time PCR method using the TagMan probe, but the real-time method of the present invention does not require separate preparation of primers and probes as compared with the conventional method. In this respect, the target gene can be quantified very easily.

The present invention includes the provision of a reagent kit for searching for a target gene, amplification, and quantifying a specific gene by real-time PCR as described above.
The reagent kit for exploring and amplifying the target gene includes at least an upper and lower primer DNA having a sequence complementary to each terminal sequence of the gene DNA to be probed and amplified, and a DNA polymerase. At least one of the primer DNAs includes a primer in which the 3 ′ hydroxyl group of the 3 ′ terminal nucleotide forms an ester with a phosphate group and is bound to the labeling compound via the phosphate group. In this reagent kit, dNTP (a mixture of equal amounts of ATP, GTP, TTP, and CTP), buffer preparation material, magnesium agent such as MgSO ₄ , Enzyme stabilizers such as KCl, (NH ₄ ) ₂ SO _4, surfactants such as Triton X100, replication factors such as PCNA and RFC, DNA polymerase antibodies and the like may be included. Furthermore, the DNA polymerase may be a mixture.

As the DNA polymerase, the above PhPolB, PhPolD and PhPolD mutants are all desirable in that they have sufficient heat resistance under PCR conditions and have other 3′-5 ′ proofreading exonuclease activity. The latter two are most preferable in terms of enzyme activity.
Examples of the labeling compound include fluorescent dyes such as FITC, FAM, TET, JOE, Cy3, Cy5, biotin, a complex of biotin and avidin, enzymes such as peroxidase and luciferase, and fluorescent proteins. Alternatively, it may be radiolabeled with an isotope and phosphoric acid may be ester-bonded to the 3'-terminal 3 hydroxyl group. When labeling a protein such as an enzyme, for example, the carboxyl group or amino group of the protein to be labeled with a modifying group having a functional group such as an amino group, a hydroxy group, or a carboxyl group at the end as shown in the Examples below. Can be combined.

In addition, the reagent kit for quantifying a specific gene by the real-time PCR method includes at least an upper and lower primer DNA having a sequence complementary to each terminal side sequence of the DNA to be measured, and a DNA polymerase. The primer DNA has an ester with the 3 'hydroxyl group of its 3' terminal nucleotide and a phosphate group, and is linked to a fluorescent dye via the phosphate group, and the 5 'end is labeled with a quencher. It is necessary.
This reagent kit further includes a dNTP (a mixture of equal amounts of ATP, GTP, TTP, and CTP), a magnesium agent such as a buffer preparation material MgSO ₄ , Enzyme stabilizers such as KCl, (NH ₄ ) ₂ SO _4, surfactants such as Triton X100, replication factors such as PCNA and RFC, DNA polymerase antibodies and the like may be included. As the fluorescent dye to be used, the same fluorescent dyes as exemplified above are used, and as the quencher, TAMRA, dabcyl, Black Hole Quencher Dyes (BHQ-0, BHQ-1, BHQ-2, BHQ-3) etc. Is mentioned.
As the DNA polymerase, PhPolB, PhPolD and PhPolD mutants are desirable as described above, but PhPolD and PhPolD mutants are more preferable.

Repair and amplification of damaged genes in ancient biological samples (Figure 3)
Other uses of the DNA polymerase of the present invention include repair and amplification of damaged gene DNA contained in ancient biological samples.
Genetic DNA contained in ancient biological samples, such as fossils and old bones, is damaged, and the damaged part is cleaved by damage-specific AP nuclease or the like to the 3 ′ end or 5 ′ end. Damage may remain. Furthermore, these gene DNAs are finely cut by exposure to ultraviolet rays or the like. For this reason, DNA amplification by the PCR method has been considered extremely difficult. For example, in a genetic DNA contained in such an ancient biological sample, one of the complementary strands of the gene is missing in the middle and the 3 ′ terminal nucleotide is often further damaged. Such a damaged gene DNA has a nucleotide having a 3 ′ hydroxyl group modified with a phosphate ester or a free phosphate ester having a nucleotide degradation product accompanying the damage as a substituent at the 3 ′ end.

Examples of the damage of the 3 ′ terminal nucleotide include the following cases.
1) When the base is damaged, then the damaged base is removed with DNA glucosylase, and then the 5 ′ side of the damaged site is cleaved with AP endonuclease or the like, deoxyribose phosphate remains at the 3 ′ end. These are further decomposed to form alpha and beta unsaturated aldehydes. 2) Phosphoglycolic acid is formed at the 3 ′ end by single-strand breakage with active oxygen, ionizing radiation, bleomycin, and the like. 3) Single-strand breakage with active oxygen leaves phosphoric acid at the 3 'end. In such a case, the 3 ′ end is blocked, and it has been difficult to extend the complementary strand from the 3 ′ end.

  However, even in the above case, the DNA polymerase treats such a damaged nucleotide at the 3 ′ end as a modified phosphate ester, cleaves and removes it from the new 3 ′ end from which the damaged nucleotide is removed. Using one DNA strand as a template, the complementary strand is extended to repair the damage.

A method that uses DNA polymerase to perform PCR using repair and amplification of damaged gene DNA in an ancient biological sample will be described below.
First, sample DNA is denatured at high temperature and annealed. Fragmented DNA is annealed in various combinations, and some of the long templates can be combined with a primer having a 3 ′ end damaged in the upstream region. Next, a DNA polymerase that performs an extension reaction removes damage at the 3 ′ end and extends the DNA strand in the 5 ′ direction to form double-stranded DNA. By repeating this, longer double-stranded DNA can be obtained. Next, this is put into a vector and cloning is performed. PCR amplification is performed using primers from the multicloning site of the vector, and sequencing is performed. The gene analysis is performed by computer analysis of the obtained large amount of sequence data.
Examples of the present invention are shown below, but the present invention is not limited to these examples.

Example 1
1) Synthesis of FITC-modified oligonucleotide
3′-Fluorescein CPG [1-dimethoxytrityloxy-2- (N-thiourea- (di-O-pivaloyl-fluorescein) -4-aminobutyl) -propyl-3-O-succinoyl-long chain alkylamino-CPG] DC-CE phosphoramidide [5′-dimethoxytrityl-N-isobutyryl-2′-deoxycytidine, 3 ′-[(2-cyanoethyl)-(N, N-diisopropyl)]-phosphoamidide] An ester bond was made by removing the DMT of the linker bonded to the phosphate group of fluorescein and the phosphate group of deoxycytidine with a phosphate group at the end. Next, a phosphoramidide reagent (dT-CE phosphoramidide {5'-dimethoxytrityl-2'-deoxythymidine, 3 '-[(2-cyanoethyl)-, (N, N-diisopropyl)]-phosphoamidide} dG-CE phosphoramidide {5′-dimethoxytrityl-N-isobutyryl-2′-deoxyguanosine, 3 ′-[(2-cyanoethyl)-(N, N-diisopropyl)]-phosphoamidide} · dA-CE phosphoramidide {5′-dimethoxytrityl- N-benzoyl-2'-deoxyadenosine, 3 '-[(2-cyanoethyl)-(N, N-diisopropyl)]-phosphoamidide} .dC-CE phosphoramidide {5'-dimethoxytrityl-N-benzoyl-2'- Oligonucleotide was synthesized by adding deoxycytidine, 3 ′-[(2-cyanoethyl)-(N, N-diisopropyl)]-phosphoamidide}) sequentially in the order of synthesis. After completion of the synthesis, CPG was cleaved and deprotected (reacted with ammonium hydroxide at room temperature for 2 hours) to remove succinoyl-long-chain alkylamino-CPG to obtain 3′FITC-modified oligonucleotide.

The structure of the compound used for the synthesis is shown below.
1-Dimethoxytrityloxy-2- (N-thiourea- (di-O-pivaloyl-fluorescein) -4-aminobutyl) -propyl-3-O-succinoyl-long chain alkylamino-CPG

2) Synthesis of biotin-modified oligonucleotide 3′-biotin TEG CPG {1-dimethoxytrityloxy-3-O- (N-biotinyl-3-aminopropyl) -triethyleneglycolyl-, represented by the following structural formula Glyceryl-2-O-succinyl-long chain alkylamino-CPG} and dC-CE phosphoramidide [5'-dimethoxytrityl-N-isobutyryl-2'-deoxycytidine, 3 '-[(2-cyanoethyl)-(N, N-diisopropyl)]-phosphoamidide] was added to remove the DMT of the deoxycytidine phosphate group having a phosphate group at the 3 ′ end and the linker DMT bound to biotin to form an ester bond. Next, phosphoamidide reagents (dT-CE, dA-CG, dC-CA, dG-CA phosphoamidide) were sequentially added in the order of synthesis to synthesize oligonucleotides. After completion of the synthesis, cleaving and deprotection (reaction with ammonium hydroxide at room temperature for 2 hours) are performed to remove succinoyl-long chain alkylamino-CPG. A 3 ′ biotin modified oligonucleotide was obtained.

1-Dimethoxytrityloxy-3-O- (N-biotinyl-3-aminopropyl) -triethyleneglycolyl-glyceryl-2-O-succinyl-long chain alkylamino-CPG

3) Synthesis of 3 'aminopropyl group-modified oligonucleotide 3'-PT-amino modified C3 CPG represented by the following structural formula {N- (3- (O-dimethoxytrityl) -propyl)-(2-carboxyamine) ) -Phthalimidyl-lcaa-CPG} and dC-CE phosphoramidide [5'-dimethoxytrityl-N-isobutyryl-2'-deoxycytidine, 3 '-[(2-cyanoethyl)-(N, N-diisopropyl)]-phosphoamidide ] And a phosphate group of deoxycytidine having a phosphate group at the 3 ′ end and {N- (3- (O-dimethoxytrityl) -propyl)-(2-carboxyamine) -phthalimidyl-lcaa-CPG The DMT group was removed to create an ester bond. Next, a phosphoramidide reagent (dT-CE, dA-CG, dC-CA, dG-CA phosphoramidide) is sequentially added in the order of synthesis to synthesize an oligonucleotide. After the synthesis was completed, excision was performed (55 ° C, overnight with ammonium hydroxide; the nucleobase could be deprotected at the same time) to obtain an aminopropyl group-modified oligonucleotide at the 3 'end.

N- (3- (O-dimethoxytrityl) -propyl)-(2-carboxyamine) -phthalimidyl-lcaa-CPG

4) Synthesis of 3'-hydroxy-propyl modified oligonucleotide 3'-spacer C3 CPG represented by the following structural formula {(1-dimethoxytrityloxy-propanediol-3-succinoyl) -long chain alkylamino-CPG } With dC-CE phosphoramidide [5′-dimethoxytrityl-N-isobutyryl-2′-deoxycytidine, 3 ′-[(2-cyanoethyl)-(N, N-diisopropyl)]-phosphoamidide] An ester bond was created by removing the phosphate group of deoxycytidine with a phosphate group at the end and the DMT of the propyl group bonded to CPG. Next, phosphoamidide reagents (dT-CE, dA-CG, dC-CA, dG-CA phosphoamidide) were sequentially added in the order of synthesis to synthesize oligonucleotides. After the synthesis was completed, cleaving and deprotection were performed (reaction with ammonium hydroxide at room temperature for 2 hours) to remove succinoyl-long chain alkylamino-CPG, and an oligonucleotide having a propanol group at the 3 ′ end was obtained.

(1-Dimethoxytrityloxy-propanediol-3-succinoyl) -long chain alkylamino-CPG

5) Synthesis of oligonucleotide having a modified phosphate group at the 3 ′ end 3′-phosphate ester CPG represented by the following structural formula {2- [2- (4,4′-dimethoxytrityloxy) ethylsulfonyl] Ethyl-2-succinoyl) -long chain alkylamino-CPG} and dC-CE phosphoramidide [5'-dimethoxytrityl-N-isobutyryl-2'-deoxycytidine, 3 '-[(2-cyanoethyl)-(N, N -Diisopropyl)]-phosphoamidide], 3′-phosphate group bound to deoxycytidine and 2- [2- (4,4′-dimethoxytrityloxy) ethylsulfonyl] ethyl-2-succinoyl) -long The DMT group of the chain alkylamino-CPG was removed to create an ester linkage. Next, phosphoamidide reagents (dT-CE, dA-CG, dC-CA, dG-CA phosphoamidide) were sequentially added in the order of synthesis to synthesize oligonucleotides. After the synthesis is completed, the CPG is cleaved (reacted with ammonium hydroxide at room temperature for 2 hours), and then deprotected (4 hours with ammonium hydroxide at 55 ° C.). Finally, a nucleotide having a phosphate group at the 3 ′ end was obtained.

2- [2- (4,4'-Dimethoxytrityloxy) ethylsulfonyl] ethyl-2-succinoyl) -long chain alkylamino-CPG

In addition, in the case of biotin modification, aminopropyl group modification, 3'-hydroxy-propyl group modification and free phosphate modification, a phosphate group is present at position 5 of deoxyribose of the 5 'terminal nucleotide residue in order to detect the cleavage activity. Fluorescence group FAM for detection was coupled through and modified.
The FAM labeling was performed as follows.
Oligonucleotides were synthesized from the 3 ′ end by the phosphoramidide method, and finally, 5′-fluorescein phosphoramidide represented by the following structural formula: Chemical name [(3 ′, 6′-dipivaloylfluoresceinyl) -6- Carboxamidohexyl] -1-O- (2-cyanoethyl)-(N, N-diisopropyl) -phosphoamidide was added, coupled, cleaved, and deprotected.

[(3 ', 6'-dipivaloylfluoresceinyl) -6-carboxamidohexyl] -1-O- (2-cyanoethyl)-(N, N-diisopropyl) -phosphoamidide

The outline of the chemical structure of each oligonucleotide having a modified phosphate group at the 3 ′ end is shown in FIG. This FAM labeling was also performed on an oligonucleotide having no modified phosphate group at the 3 ′ end (3 ′ hydroxyl group) as a control.
The nucleotide sequences of each oligonucleotide having a modified phosphate group at the 3 ′ end and the unmodified oligonucleotide portion of the 3 ′ end are shown below.
FITC-labeled oligonucleotide sequence; 27mer, CTTGAGGCAGAGTCCGACATCTAGCTC (SEQ ID NO: 13)
Sequence of each nucleotide having biotin modification, aminopropyl group modification, 3-hydroxypropyl group modification, and free phosphate group modification, and 3'-terminal unmodified oligonucleotide; 34mer
GTAACGCCAGGGTTTTCCCAGTCACGACGTTGTA (SEQ ID NO: 16)

Example 2
Cleavage of modified phosphate esters in the absence of template
10 μl of 50 mM Tris-HCl buffer (pH 8.0, 15 mM MgCl ₂ ), as an substrate, oligonucleotide having 3-t-terminal FITC-labeled phosphate ester group synthesized in Example 1 of 1 pmoles and 3-aminopropyl phosphate Each oligonucleotide having an ester group at the 3 ′ end was added, and 2 μg of PhPolB (Pyrococcus horikoshii DNA Polymerase B) and 0.4 μg of PhPolD (Pyrococcus horikoshii DNA Polymerase) were added to each of these substrates and reacted at 60 ° C. for 10 minutes. . Next, 10 μl of 95% formamide, 10 mM EDTA, 1 mg / ml xylene cyanol was added to stop the enzyme reaction. This was analyzed by 12% olyacrylamide gel electrophoresis (PAGE) containing 7M urea after heating at 100 ° C and quenching in ice. The FITC-labeled substrate was a 10 cm × 10 cn size gel, and the 3-aminopropyl phosphate-modified substrate was a 20 cm × 50 cm size gel.
The electrophoretic pattern was autoradiographed with phosphoImager (Bio-Rad).

The results are shown in FIGS. 5 and 6 including the case where these DNA polymerases are not used. According to this, both PhPolB and PhPolD bind to the 3 ′ end of the oligonucleotide when using an oligonucleotide (3′FITC in the figure) having a FITC-labeled phosphate group at the 3 ′ end as a substrate. It was revealed that the fluorescent dye (FITC) is cut and separated. The cleavage product is a fluorescent dye (FITC) that does not contain oligonucleotide (FIG. 5-1). In addition, as a result of partial degradation using PhPol B and PhPol D using an oligonucleotide having a 3-amino-propyl phosphate group at the 3 'end (3'AMI5'FAM in the figure) as a substrate, PhPolB and In both cases, a band was detected at the same mobility as that of the unmodified oligonucleotide at the 3 ′ end. This is the 3-amino-propyl phosphate group removed.
From the above, it became clear that the phosphate ester was cleaved (FIG. 5-2).
In addition, as a result of examining the activity of PhPolB and PhPol D for biotin-modified, aminopropyl-modified, hydroxy-propyl-modified, and free phosphoric acid esters, nucleotides with a small molecular weight at the 5 'end label were detected (Fig. 6). This is the result of cleavage with 3'-5 'exonuclease after cleavage of the phosphate ester bond modified with biotin, aminopropyl group, or hydroxypropyl group at the 3' end and removal of the modification group. It is guessed.

Example 3
Cleavage of the modified phosphate ester at the 3 ′ end by DNA polymerase and extension of the DNA strand from the 3 ′ end DNA having the following sequence was synthesized as a template DNA by the phosphoramidide method.
Template strand 1; GAGCTAGATGTCGGACTCTGCCTCAAGACGGTAGTCAACGTGCACTCGAGGTCA (SEQ ID NO: 14)

Template strand 2; TCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCCTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTAC (SEQ ID NO: 15)

On the other hand, the following modified primers synthesized in Examples were used as primers.
Primer DNA 1;
3'FITC 5'TAMRA modified oligonucleotide primer 1 (27mer) nucleotide sequence; CTTGAGGCAGAGTCCGACATCTAGCTC (SEQ ID NO: 13)

Plasmar DNA 2; 3 ′ terminal biotin modified phosphate, 5 ′ terminal FAM, modified primer DNA 3; 3 ′ terminal 3-aminopropyl phosphate, 5 ′ terminal FAM, modified primer DNA 4; 3 ′ terminal 3′-hydroxy-propyl phosphate 5 ′ terminal FAM, modified primer DNA 5; 3 ′ terminal free phosphate, 5 ′ terminal FAM, base sequence of modified primer 2-5 (34mer);
GTAACGCCAGGGTTTTCCCAGTCACGACGTTGTA (SEQ ID NO: 16)

The primer DNA 1 is annealed with template strand 1 and the primer DNA 2-5 is annealed with template strand 2, and the 3′-end modified phosphate ester is cleaved and the DNA strand from the 3 ′ end by DNA polymerase as follows. The elongation activity of was examined.
Add 10 μl of 50 mM Tris-HCl buffer (pH 8.0, 15 mM MgCl ₂ ), add 0.25 mM dNTP, add 1 pmoles of the annealed template and each oligonucleotide, and add PhPolB (Pyrococcus horikoshii DNA Polymerase B for each oligonucleotide). 2 μg and PhPolD (Pyrococcus horikoshii DNA Polymerase) 0.4 μg were added and reacted at 60 ° C. for 10 minutes. Next, 10 μl of 95% formamide, 10 mM EDTA, 1 mg / ml xylene cyanol was added to stop the enzyme reaction. This was analyzed by 12% olyacrylamide gel electrophoresis (PAGE) containing 7M urea after heating at 100 ° C. and quenching in ice. The electrophoretic pattern was autoradiographed with phosphoImager (Bio-Rad). The results are shown in FIGS. 7 and 8, including the case where DNA polymerase was not used.
According to this result, when an oligonucleotide having a FITC-modified phosphate group at the 3 ′ end was used as a primer, the FITC fluorescent dye component and the molecular length of the oligonucleotide used as the primer Oligonucleotides with TAMRA at the long 5 ′ end were detected. Even in the presence of dNTP, PhPolB and PhPolD cleaved the modification group at the 3 ′ end to extend the DNA strand. (Fig. 7)

On the other hand, when using each oligonucleotide having 3 ester ends of biotin-modified phosphate, 3-aminopropyl phosphate, 3′-hydroxy-propyl phosphate and free phosphate as a primer, It is shown in FIG. (In FIG. 8, Amino group is 3-amino-propyl phosphate, BIOTIN is biotin-modified phosphate, C3 is 3-hydroxy-propyl phosphate, and phosphate group is free phosphate.)
As is apparent from the results, even when an oligonucleotide having each of these ester groups at the 3 ′ end was used as a primer, the 3 ′ end modified phosphate group was removed and the DNA chain could be extended. From the above, it can be said that any modifying group can be removed in the presence of dNTP to extend the DNA strand.

Example 4
Activity of cleaving Ph 3P terminal modification group of PhPolB and PhPolD under each temperature condition Example 3 using PhPolB and PhPolD with the oligonucleotide synthesized at the 3 'end of FITC-labeled phosphate group synthesized in Example 1, 2) 'The cleaving activity of the terminal modified ester group was investigated under each reaction temperature condition. The enzyme reaction conditions are the same as those described in Example 2 except for the temperature conditions, and the reaction temperature conditions set at 60 degrees, 70 degrees, and 80 degrees are shown in FIG. According to this result, it is clear that both of Pol B and Pol D are detected with the cleaved FITC component separated from the substrate even at 80 ° C. Were present.

Example 5
Cleavage activity of other polymerase 3 'terminal modification groups
As a DNA polymerase, PhPolB and PhPolD are replaced with Klenow Fragment and T4 DNA polymerase, under the same enzyme reaction conditions as in Example 2, an oligonucleotide having a FITC-labeled phosphate group at the 3 ′ end and a free phosphate group The cleavage activity of the 3′-end-modified phosphate group was examined using an oligonucleotide having three ends as a substrate.
The results are shown in FIG. According to this, any of the above DNA polymerases showed the activity of cleaving the 3 ′ end-modified phosphate group. However, the substrate remains, and it is considered that the cleavage activity of these DNA polymerase 3 ′ end-modified phosphate groups is lower than that of PhPolB and PhPolD.

Example 6
Using the same concentration of PhPolD and PhPolD mutant (mutant lacking the 1-200th amino acid from the N-terminal of the small subunit) as DNA polymerase, under the same enzyme reaction conditions as in Example 2, FITC-labeled phosphate group The cleaving activity of the 3′-end-modified phosphate group was examined using an oligonucleotide having a 3′-end and an oligonucleotide having a biotin-labeled phosphate group at the 3-end as a substrate.
The results are shown in FIG. According to this, it is considered that the mutant DNA also shows the activity of cleaving the 3 ′ end-modified phosphate group, and further has the same activity as PhPolD.

Claims (19)

  An enzyme reagent for cleaving a free or modified phosphate ester bound to the DNA 3 'terminal nucleotide 3' position, comprising a DNA polymerase.   The enzyme reagent according to claim 1, which has a complementary strand extending action corresponding to the template DNA sequence from the DNA 3 'end after cleavage of the modified phosphate ester.   The enzyme reagent according to claim 1 or 2, wherein the DNA polymerase is thermostable.   DNA polymerase has the amino acid sequence shown by SEQ ID NO: 3, or has an amino acid sequence in which one or several amino acid residues are deleted, substituted or added in the amino acid sequence, and has DNA polymerase activity The enzyme reagent according to claim 3, which is an enzyme. DNA polymerase is a heterodimeric enzyme having a DNA polymerase activity consisting of a small subunit and a large subunit,
The small subunit is a protein having the amino acid sequence shown in SEQ ID NO: 9, or a protein containing substitution, deletion or addition of one or several amino acid residues in the amino acid sequence, wherein the large subunit is A protein having a sequence obtained by removing the amino acid sequence (955th to 1120th) encoded by the intein sequence from the amino acid sequence shown in SEQ ID NO: 5, or substitution of one or several amino acid residues in the sequence The enzyme reagent according to claim 3, wherein the enzyme reagent comprises a deletion or addition protein.   The small subunit further has an amino acid from which at least the 167th to 200th region has been deleted in the amino acid sequence shown in SEQ ID NO: 9, or one or several amino acid residues in the deleted amino acid sequence The enzyme reagent according to claim 5, wherein the enzyme reagent comprises a substitution, deletion or addition.   The enzyme reagent according to any one of claims 1 to 6, wherein the modified phosphate ester is bound to a fluorescent dye, biotin, or an enzyme via a phosphate residue.   The enzyme reagent according to any one of claims 1 to 6, wherein the modified phosphate ester is a phosphate ester derived from a damaged nucleotide.   In this method, a DNA polymerase is allowed to act on DNA hybridized with a primer having a sequence partially complementary to the template DNA sequence, and a primer sequence is subjected to 3'-end extension reaction to prepare double-stranded DNA. And the deoxyribose 3 ′ hydroxyl group in the 3 ′ terminal nucleotide of the primer DNA sequence is esterified with free or modified phosphate.   A method of amplifying a DNA to be amplified by a PCR method using an upper and a lower primer and a DNA polymerase, and forming an ester with a 3′-hydroxyl group of a 3′-terminal nucleotide of at least one primer, The method as described above, which is bound to a labeling compound via a phosphate group.   The method according to claim 10, wherein the labeling compound is a fluorescent compound, biotin, or an enzyme.   This method quantifies the DNA to be measured by real-time PCR using upper and lower primer DNA and DNA polymerase, and the 3 'hydroxyl group of the 3' terminal nucleotide of at least one primer DNA forms an ester with a phosphate group. The method according to claim 11, wherein a fluorescent dye is bonded via the phosphate group, and the 5 ′ end is labeled with a quencher.   In an ancient biological sample, the 3 'hydroxyl group of the 3' terminal nucleotide of DNA was esterified with a phosphate or free phosphate modified by a substituent caused by damage-induced nucleotide degradation, interrupting one of the complementary strands A method for repairing a damaged gene DNA having a portion, wherein denaturation and annealing are performed on the damaged gene DNA, and then a DNA polymerase is allowed to act. A method for repairing a damaged gene in an ancient biological sample, comprising cleaving a modified phosphate ester and carrying out a complementary strand extension reaction.   The method according to any one of claims 9 to 13, wherein the DNA polymerase is thermostable.   DNA polymerase has the amino acid sequence shown by SEQ ID NO: 3, or has an amino acid sequence in which one or several amino acid residues are deleted, substituted or added in the amino acid sequence, and has DNA polymerase activity The method according to claim 14, wherein the method is an enzyme. DNA polymerase is a heterodimeric enzyme having a DNA polymerase activity consisting of a small subunit and a large subunit,
The small subunit is a protein having the amino acid sequence shown in SEQ ID NO: 9, or a protein containing substitution, deletion or addition of one or several amino acid residues in the amino acid sequence, wherein the large subunit is A protein having a sequence obtained by removing the amino acid sequence (955th to 1120th) encoded by the intein sequence from the amino acid sequence shown in SEQ ID NO: 5, or substitution of one or several amino acid residues in the sequence The method according to claim 14, wherein the protein comprises a deletion or addition.   The small subunit further has an amino acid sequence in which at least the 167th to 200th region is deleted in the amino acid sequence shown in SEQ ID NO: 9, or one or several amino acid residues are left in the deleted amino acid sequence. 15. A method according to claim 14, characterized in that the protein comprises a group substitution, deletion or addition.   A PCR reagent kit comprising at least an upper and lower primer DNA having a sequence complementary to each terminal side sequence of DNA to be amplified, and a DNA polymerase, wherein 3 ′ of 3 ′ terminal nucleotide of at least one primer DNA The above-mentioned reagent kit, wherein the hydroxyl group forms an ester with a phosphonic acid group and is bonded to the labeling compound via the phosphoric acid group.   A reagent kit for real-time PCR quantification of DNA comprising at least an upper and lower primer DNA having a sequence complementary to each terminal-side sequence of DNA to be measured, and a DNA polymerase, wherein one primer DNA has its 3 ′ end The above reagent, wherein the 3 ′ hydroxyl group of the nucleotide forms an ester with a phosphonic acid group, is bonded to a fluorescent dye via the phosphate group, and the 5 ′ end is labeled with a quencher kit.