JP2010193869A - Highly productive transformant of exogenous protein and use thereof - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a more practical yeast transformant stably producing an exogenous protein in high productivity. <P>SOLUTION: The yeast transformant has a DNA encoding one or more exogenous proteins on a chromosome, wherein one or more genes of a host selected from a group consisting of ADA2, ADE5,7, ARV1, BUD23, etc., are inactivated. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to a high production transformant of a foreign protein and use thereof.

  In recent years, as an alternative to finite petroleum resources, there is an increasing expectation for biomass derived from the photosynthesis of plants, and various attempts have been made to use biomass for energy and various materials. In order to effectively use biomass as an energy source and other raw materials, it is necessary to saccharify biomass into a carbon source that can be easily used by animals and microorganisms.

  A large amount of cellulase is required to use typical biomass such as cellulose and hemicellulose. The cost ratio of the enzyme preparation cost used for saccharifying such biomass into glucose, xylose or the like is considerably high. In order to saccharify cellulose and convert it into a useful substance at a low cost, it greatly depends on how much the use of cellulase can be reduced.

  As one solution, it is conceivable to suppress the amount of cellulase to be added by producing cellulase directly from a glucose-producing microorganism such as yeast that fermentably produces useful substances such as ethanol and organic acids from glucose. Yeast does not have a cellulase gene, and it is necessary to obtain a transformant by introducing the cellulase gene as a foreign gene. It has been reported that a mutant strain that highly produces cellulase was obtained by a mutagenesis method using a classic mutagen (Non-Patent Document 1). However, it takes a lot of time and labor to obtain such mutants.

  On the other hand, a high production mutant of a heterologous protein in yeast and a gene involved in the mutant have been disclosed (Patent Document 1). This document introduces a laccase gene, which is a heterologous gene, into a gene-disrupted strain library of Saccharomyces cerevisiae, exhaustively searches for genes that highly express laccase, and a total of 18 mutant strains are found. Genes that have been selected and promoted secretory production of 18 laccases are described.

JP 2005-58143 A

Aho S., Arffman A., Korhola M., Saccharomyces cerevisiae mutants selected for increased production of Trichoderma reesei cellulases., Appl. Microbiol. Biotechnol., 1996, 46 (1), 36-45.

  In the method described in Patent Document 1, in order to examine a gene-disrupted strain that highly produces a protein that does not affect growth, the substrate-decomposed substrate in the medium is cultured while the gene-disrupted strain introduced with a foreign gene is cultured on a solid medium A high-producing mutant strain is obtained using the amount as an index, and a gene that promotes secretory production of the protein is identified. These genes include BUB2, BUB3, BUL1, END3. FYV10, IKI3, MAD1, MAD2, MAD3, NCL1, NCL1, PER1, PFK26, RPS24A, VHS2, VIK1, VRP1, YKL053W, YML094C-A and the like. Such disruption of the gene may act in the direction of promoting secretion of a heterologous protein even when the yeast is cultured in a liquid medium. On the other hand, regarding the secretion of protein, it is considered that the environments in solid culture and liquid culture are completely different. In liquid culture, it is considered that the destruction of completely different genes may be involved in the promotion of secretion.

  All of the above prior art documents produce foreign proteins on extrachromosomal plasmids. The plasmid may be dropped depending on the culture conditions. When a foreign gene is retained on the plasmid, the gene cannot be stably expressed.

  Accordingly, an object of the present invention is to provide a more practical yeast transformant capable of stably producing a foreign protein in a high yield, a gene involved in the high production, and use of these.

  In order to solve the above-mentioned problems, the present inventors attempted to introduce a cellulase gene, which is a foreign gene and a secreted protein, into a gene-disrupted strain of S. cerevisiae extrachromosomally or on a chromosome. Transformants were cultured in liquid and screened for disrupted strains showing high cellulase activity. As a result, among the disrupted strains that showed high cellulase activity when a foreign gene was introduced outside the chromosome, a disrupted strain that showed high cellulase activity when a foreign gene was introduced onto the chromosome was found. That is, when a foreign gene is introduced on a chromosome, a gene-disrupted strain that promotes secretion of a protein encoded by the foreign gene has been found. Based on these findings, the following means are provided.

  According to the present invention, DNA encoding one or more foreign proteins is retained on the chromosome and the following genes of the host: ADA2, ADE5, 7, ARV1, BUD23, BUR2, CHO2, CSG2, DYN3 , ERG3, ERG6, FAR8, FYV6, GCN5, GDH1, GND1, HMO1, MMM1, MON2, NBP2, NPR2, OPI3, OPI9, PER1, RAV1, RMD11, RPL13B, RPL19B, RPL36A, RPS6A, RRD1, RSA1, C1 , SNF7, SNF8, URM1, VMA7, VPS16, VPS25, VPS27, VPS28, VPS3, VPS36, VPS4, VPS41, VPS45, VRP1, YDR065W, YKL118W, YNL120C, YNL228W, YOL138C, YOR331C, YPT7 and ZUO1 are selected from the group A yeast transformant is provided in which one or more genes are inactivated.

  In the yeast transformant of the present invention, the foreign protein is preferably a secreted protein. Moreover, it is also preferable that it is a yeast transformant used for producing the said foreign protein by liquid culture. Further, the foreign protein is preferably one or more selected from cellulases.

  In the yeast transformant of the present invention, the gene is selected from the group consisting of DYN3, GCN5, OPI3, PER1, RPL13B, RPL19B, RPL36A, SNF7, VMA7, VPS3, VPS4, VPS16, VPS27, YKL118W and YOL138C It is preferable that it is 1 type or 2 types or more. The gene may be one or more selected from the group consisting of DYN3, GCN5, OPI3, PER1, RPL13B, RPL19B, RPL36A, VMA7, VPS3, VPS4, VPS16, VPS27, YKL118W and YOL138C. preferable. More preferably, it is one or more selected from the group consisting of DYN3, GCN5, OPI3, PER1, RPL13B, RPL19B, RPL36A, VMA7, VPS3, VPS4, VPS27, YKL118W and YOL138C, and the gene is DYN3, GCN5, OPI3, PER1, RPL13B, RPL19B, VPS3, YKL118W and YOL138C are also preferably one type or two or more types. Most preferably, it is one or more selected from GCN5, RPL19B and VPS3.

In the yeast transformant of the present invention, the inactivated genes are ARV1, CHO2, CSG2, ERG3, ERG6, FAR8, MON2, OPI3, PER1, RAV1, SAC1, SNF7, SNF8, VPS3, VPS4, VPS16. , VPS25, VPS27, VPS28, VPS36, VPS45, YPT7, and preferably two or more selected from the group consisting of RRD1, ARV1, CHO2, CSG2, ERG3, ERG6, FAR8, MON2, OPI3, PER1, RAV1, It is more preferable to include two or more selected from the group consisting of SAC1, SNF7, SNF8, VPS3, VPS4, VPS16, VPS25, VPS27, VPS28, VPS36, VPS45 and YPT7. More preferably, the inactivated gene preferably includes two or more selected from the group consisting of FAR8, RAV1, RRD1 and VPS3. Furthermore, it is preferable that the inactivated gene includes any combination selected from the following (a) to (c).
(A) RAV1 and FAR8
(B) RAV1 and RRD1
(C) RAV1 and VPS3

  In the yeast transformant of the present invention, the exogenous protein is preferably one or more selected from β-glucosidase, cellobiohydrolase and endoglucanase.

  Furthermore, in the yeast transformant of the present invention, the host is preferably a Saccharomyces yeast, and more preferably, the host is Saccharomyces cerevisiae.

According to the present invention, a vector for expressing a foreign protein in yeast,
The following genes: ADA2, ADE5, 7, ARV1, BUD23, BUR2, CHO2, CSG2, DYN3, ERG3, ERG6, FAR8, FYV6, GCN5, GDH1, GND1, HMO1, MMM1, MON2, NBP2, NPR2, OPI3, OPI9, PER1, RAV1, RMD11, RPL13B, RPL19B, RPL36A, RPS6A, RRD1, RSA1, SAC1, SFP1, SNF7, SNF8, URM1, VMA7, VPS16, VPS25, VPS27, VPS28, VPS3, VPS36, VPS4, VPS41, 45PS Provided is a vector for inactivating one or more selected from the group consisting of YDR065W, YKL118W, YNL120C, YNL228W, YOL138C, YOR331C, YPT7 and ZUO1.

  According to the present invention, a host yeast for expressing a foreign protein comprising the following genes of the host: ADA2, ADE5, 7, ARV1, BUD23, BUR2, CHO2, CSG2, DYN3, ERG3, ERG6, FAR8 , FYV6, GCN5, GDH1, GND1, HMO1, MMM1, MON2, NBP2, NPR2, OPI3, OPI9, PER1, RAV1, RMD11, RPL13B, RPL19B, RPL36A, RPS6A, RRD1, RSA1, SAC1, SFP1, SNF7S1 , VMA7, VPS16, VPS25, VPS27, VPS28, VPS3, VPS36, VPS4, VPS41, VPS45, VRP1, YDR065W, YKL118W, YNL120C, YNL228W, YOL138C, YOR331C, YPT7 and ZUO1 A host yeast is provided in which the above is inactivated.

  The inactivated genes are ARV1, CHO2, CSG2, ERG3, ERG6, FAR8, MON2, OPI3, PER1, RAV1, SAC1, SNF7, SNF8, VPS3, VPS4, VPS16, VPS25, VPS27, VPS28, VPS36, The host yeast according to claim 16, which is two or more selected from the group consisting of VPS45, YPT7 and RRD1.

  According to the present invention, there is provided a method for producing a degradation product of a cellulose-containing material, the step of preparing the yeast transformant of the present invention secreting and producing cellulase as an exogenous protein, and the cellulose-containing material as a carbon source. And a step of culturing the yeast transformant in a liquid medium.

  According to the present invention, there is provided a method for producing a useful substance from a cellulose-containing material, the step of preparing the yeast transformant according to any one of the above, wherein cellulase is secreted and produced as an exogenous protein, and the cellulose-containing material comprises And culturing the yeast transformant in a liquid medium containing as a carbon source to fermentatively produce useful substances.

  According to this invention, it is a manufacturing method of protein, Comprising: The manufacturing method provided with the process of preparing the yeast transformant in any one of the said, and the process of culture | cultivating the said yeast transformant in a liquid medium. Provided.

It is a figure which shows the structure of the plasmid for expressing cellulase in yeast. It is a figure which shows the evaluation result of the endoglucanase activity of Ctcel8A about the culture supernatant of various culture media. It is a figure which shows transformation to the yeast gene disruption library of a Ctcel8A expression plasmid. It is a figure which shows the screening result of the highly active strain of a Ctcel8A transformant. It is a figure which shows the high production yeast mutant strain (activity grade +++) of Ctcel8A. It is a figure which shows the high production yeast mutant strain (activity level ++) of Ctcel8A. It is a figure which shows the high production yeast mutant strain (activity grade +) of Ctcel8A. It is a figure which shows the activity of Ctcel8A in a rich medium (YPD). It is a figure which shows the activity of Cccel5A in a rich medium (YPD). It is a figure which shows the structure of the plasmid for chromosome introduction | transduction of Ctcel8A and Cccel5A. It is a figure which shows the evaluation result of the activity of the vps3 disruption strain in the cellulase chromosome introduction | transduction strain | stump | stock culture | cultivated in the rich medium. It is a figure which shows the evaluation result of the activity of the vps3 disruption strain in the cellulase chromosomal transfer strain cultured on the oligotrophic medium. FIG. 3 is a view showing the structure of a plasmid pAL-HOR7p-Ctcel8A for chromosomal introduction of Ctcel8A. It is a figure which shows an example of the evaluation result of the cellulase activity by the CMC plate of a Ctcel8A chromosome introduction | transduction strain | stump | stock. It is a figure which shows the CMC decomposition | disassembly activity by endoglucanase of the culture supernatant of the various gene-disrupted strains into which Ctcel8A was introduced into the chromosome when the decomposition activity of the reference strain was 1. It is a figure which shows the result of the CMC plate assay using the culture supernatant of the cel8A high production strain of a Ctcel8A chromosome introduction | transduction strain | stump | stock. It is a figure which shows the structure of vector pDU-HOR7p-AaBGLsec for introduce | transducing AaBGL into a chromosome. It is a figure which shows the fermentation test result of the cellobiose in the YPcellobiose (5%) culture medium of a DYN3 destruction strain. The upper graph is a graph showing the growth rate, and the lower graph is a graph showing changes in the ethanol concentration, cellobiose concentration, and glucose concentration. It is a figure which shows the fermentation test result of the cellobiose in the YPcellobiose (5%) culture medium of a GCN5 destruction strain. The upper graph is a graph showing the growth rate, and the lower graph is a graph showing changes in the ethanol concentration, cellobiose concentration, and glucose concentration. It is a figure which shows the fermentation test result of the cellobiose in the YPcellobiose (5%) culture medium of an OPI3 destruction strain. The upper graph is a graph showing the growth rate, and the lower graph is a graph showing changes in the ethanol concentration, cellobiose concentration, and glucose concentration. It is a figure which shows the fermentation test result of the cellobiose in the YPcellobiose (5%) culture medium of a PER1 destruction strain. The upper graph is a graph showing the growth rate, and the lower graph is a graph showing changes in the ethanol concentration, cellobiose concentration, and glucose concentration. It is a figure which shows the fermentation test result of the cellobiose in the YPcellobiose (5%) culture medium of a RPL13B destruction strain. The upper graph is a graph showing the growth rate, and the lower graph is a graph showing changes in the ethanol concentration, cellobiose concentration, and glucose concentration. It is a figure which shows the fermentation test result of the cellobiose in the YPcellobiose (5%) culture medium of a RPL19B destruction strain. The upper graph is a graph showing the growth rate, and the lower graph is a graph showing changes in ethanol concentration, cellobiose concentration, and glucose concentration. It is a figure which shows the fermentation test result of the cellobiose in the YPcellobiose (5%) culture medium of RP136A destruction strain. The upper graph is a graph showing the growth rate, and the lower graph is a graph showing changes in the ethanol concentration, cellobiose concentration, and glucose concentration. It is a figure which shows the fermentation test result of the cellobiose in the YPcellobiose (5%) culture medium of a SNF7 destruction strain. The upper graph is a graph showing the growth rate, and the lower graph is a graph showing changes in the ethanol concentration, cellobiose concentration, and glucose concentration. It is a figure which shows the fermentation test result of the cellobiose in the YPcellobiose (5%) culture medium of a VMA7 destruction strain. The upper graph is a graph showing the growth rate, and the lower graph is a graph showing changes in ethanol concentration, cellobiose concentration, and glucose concentration. It is a figure which shows the fermentation test result of the cellobiose in the YPcellobiose (5%) culture medium of a VPS3 destruction strain. The upper graph is a graph showing the growth rate, and the lower graph is a graph showing changes in the ethanol concentration, cellobiose concentration, and glucose concentration. It is a figure which shows the fermentation test result of the cellobiose in the YPcellobiose (5%) culture medium of a VPS4 destruction strain. The upper graph is a graph showing the growth rate, and the lower graph is a graph showing changes in ethanol concentration, cellobiose concentration, and glucose concentration. It is a figure which shows the fermentation test result of the cellobiose in the YPcellobiose (5%) culture medium of a VPS16 destruction strain. The upper graph is a graph showing the growth rate, and the lower graph is a graph showing changes in the ethanol concentration, cellobiose concentration, and glucose concentration. It is a figure which shows the fermentation test result of the cellobiose in the YPcellobiose (5%) culture medium of a VPS27 destruction strain. The upper graph is a graph showing the growth rate, and the lower graph is a graph showing changes in the ethanol concentration, cellobiose concentration, and glucose concentration. It is a figure which shows the fermentation test result of the cellobiose in the YPcellobiose (5%) culture medium of a YKL118W destruction strain. The upper graph is a graph showing the growth rate, and the lower graph is a graph showing changes in the ethanol concentration, cellobiose concentration, and glucose concentration. It is a figure which shows the fermentation test result of the cellobiose in the YPcellobiose (5%) culture medium of a YOL138C destruction strain. The upper graph is a graph showing the growth rate, and the lower graph is a graph showing changes in the ethanol concentration, cellobiose concentration, and glucose concentration. It is a figure which shows the relative specific activity of BGL in the cell surface (white area) and culture medium supernatant (gray) of a BGL introduction | transduction strain | stump | stock. It is a figure which shows the result of the CMC decomposition | disassembly plate assay of each double disruption strain of rav1 * far8, rav1 * rrd1. It is a figure which shows the measurement result of the CMC degradation activity by TZ method of each double disruption strain of rav1 * far8, rav1 * rrd1. It is a figure which shows the measurement result of CMC degradation activity by TZ method of the double disruption strain of rav1 * vps3. It is a figure which shows the measurement result of the CMC degradation activity by the TZ method of the double disruption strain about rpl19b. It is a figure which shows the result of having investigated the intracellular localization etc. of 55 types of genes by Saccharomycees cerevisiae genome database (http://www.yeastgenome.org/).

  The present invention relates to a yeast transformant capable of stably producing a foreign protein stably, a host yeast for the same, a vector, and a production method using the yeast transformant. The present invention is based on the fact that secretion production of foreign proteins is stably promoted by inactivating one or more selected from the following 55 genes in yeast.

  The present inventors searched for a gene that promotes secretory production of an exogenous secreted protein in liquid culture by being inactivated by using a yeast gene-disrupted strain library. A number of genes were found that were completely different from this type of gene obtained by screening on solid media. The gene found by screening in liquid culture was considered to coincide to some extent with the gene found by screening in solid culture, and the present inventors were able to reconfirm secretion promotion of secretory proteins. Of the 96 genes, 2 genes (PER1, VRP1 only) only overlapped with the genes obtained by screening in solid culture. Such gene differences were beyond expectations.

  In addition, when a gene encoding a foreign protein is retained on the chromosome, it has been found that only 55 of these 96 genes are effective for secretory production of the foreign protein. That is, regarding the secretory production of a protein encoded by a foreign gene, the gene disruption that promotes the secretory production of the protein encoded by the foreign gene on the extrachromosomal plasmid does not necessarily result in the secretory production of the protein encoded by the foreign gene on the chromosome. It turns out that does not promote.

  The foreign protein high-producing strain found by the present inventors is that high production of a heterologous secreted protein encoded by a foreign gene introduced on a chromosome is caused by the destruction of a specific gene in the gene-disrupted strain used. Conceivable. In a normal state before the specific gene is destroyed, it is considered that the production amount of the foreign protein encoded by the foreign gene introduced onto the chromosome by the gene is directly or indirectly suppressed. Among the high foreign protein production strains, some of the vacuolar protein mis-sorting (vps) gene disruption strains were included. These gene-disrupted strains are strains in which endogenous proteins normally sorted into intracellular vacuoles are missorted outside the cells and secreted outside the cells. Abnormal proteins that cannot perform their original functions even with endogenous proteins are degraded within the vacuole. Although not restricting the present invention, it is considered that a foreign protein is recognized as an abnormal protein and processed in a vacuole is secreted to the outside of the cell because the gene has been destroyed.

  According to the present invention, in the liquid culture discovered by the present inventors, a gene that promotes secretory production of an exogenous protein by being inactivated can be used to stably stabilize the heterologous secreted protein. In addition to the yeast transformant to be produced, a host and a vector used for such a transformant are also provided. Furthermore, by using such yeast transformants, proteins can be produced with high efficiency, and the cellulose-containing material can be efficiently decomposed and used.

  Hereinafter, various embodiments of the present invention will be described in detail.

(Transformant)
The yeast transformant of the present invention retains DNA encoding one or more foreign proteins, and one or more selected from the first gene group of the host is inactivated. Yes. Hereinafter, the host, the heterologous secreted protein, and the gene group to be inactivated will be sequentially described.

(Host)
The host yeast of the transformant of the present invention is not particularly limited, and various known yeasts can be used. In consideration of ethanol fermentation described later, yeasts of the genus Saccharomyces cerevisiae such as Saccharomyces cerevisiae, yeasts of the genus Schizosaccharomyces pombe such as Schizosaccharomyces pombe, Candida shehatae, etc. Yeast of the genus Candida, yeast of the genus Pichia such as Pichia stipitis, yeast of the genus Hansenula, yeast of the genus Trichosporon, yeast of the genus Brettanomyces, the genus Pachysolen And yeast of the genus Yamadazyma, yeasts of the genus Kluyveromyces such as Kluyveromyces marxianus and Kluveromyces lactis. Of these, Saccharomyces yeasts are preferable from the viewpoint of industrial availability. Of these, Saccharomyces cerevisiae is preferable.

(DNA encoding foreign protein)
The foreign protein may be foreign to the host yeast. Therefore, even proteins derived from other yeasts are included in the foreign protein. The foreign protein is preferably a protein derived from an organism including microorganisms other than yeast.

  The foreign protein is preferably secreted in yeast. In the present specification, the protein secretory means a protein produced as a membrane protein (including cell surface display protein) or a secreted protein in the host yeast. As a foreign protein having a secretory property, a protein that can itself be a membrane protein or a secreted protein in yeast can be used, and even if it does not have such a secretory property, a fusion in which a known secretory signal is linked. It may be a protein. Moreover, even if it has secretion itself, the secretion signal may be modified according to the host yeast. The secretion signal and the like will be described later. In addition, in this specification, the surface layer display form in cell surface layer display protein is not specifically limited. It may be retained and presented directly or indirectly on the surface of yeast cells.

  Such an exogenous secreted protein can be appropriately selected. For example, from the viewpoint of degrading cellulose-containing materials, in addition to various cellulases such as endoglucanase, cellobiohydrolase, β-glucosidase, lignin peroxidase, manganese Examples include lignin degrading enzymes such as peroxidase and laccase. In addition, examples include cellulose binding domains (proteins) that are constituent parts of cellulose relieving proteins swollenin and expansin, cellulosome and cellulase. In addition, other biomass degrading enzymes such as xylanase and hemicellulase can also be mentioned. Any of these proteins can improve the accessibility of cellulase to cellulose.

  Preferred exogenous secreted proteins include endoglucanase (EC 3.2.1.74), cellobiohydrolase (EC 3.2.1.91) and β-glucosidase (EC 23.2.4.1, EC 3.2.1.21). By allowing these yeasts to produce a large amount of secreted yeast, the cellulose-containing material can be efficiently decomposed. Among them, it is preferable to express endoglucanase in order to decompose crystalline cellulose and efficiently reduce the molecular weight of cellulose. Note that cellulase 13 (5, 6, 7, 8, 9) of GHF (Glycoside Hydrolase family) (http://www.cazy.org/fam/acc.gh.html) is based on the similarity of amino acid sequences. , 10, 12, 44, 45, 48, 51, 61, 74). You may combine the same or different cellulases classified into a different family.

  Although it does not specifically limit as a cellulase, It is preferable that it is a cellulase with high activity itself. Examples of such cellulases include Phanerochaete bacteria, Trichoderma bacteria such as Trichoderma reesei, Fusarium bacteria, Fusarium bacteria, Tremetes bacteria, Penicillium bacteria, and Humicola bacteria. In addition to filamentous fungi such as Humicola, Acremonium, and Aspergillus, Clostridium, Pseudomonas, Cellulomonas, and Luminococcus Bacteria such as genus (Ruminococcus) and Bacillus, primordial fungi such as Sulfolobus, and more, such as Streptomyces and Thermoactinomyces Derived cellulase. Such cellulase may be artificially modified.

  The transformant of the present invention retains at least one DNA encoding a foreign protein on the host chromosome. The encoded DNA is retained so that it can be expressed as a protein in the host yeast. Specifically, it is linked under the control of a promoter operable in the host yeast (typically a yeast promoter) and held in a state having an appropriate terminator downstream thereof. The promoter may be a constitutive promoter or an inducible promoter. In general, with the introduction of such foreign DNA, a selectable marker gene that can be used in the host is simultaneously retained on the host chromosome.

(Gene to be inactivated)
A gene that is preferably inactivated in the transformant of the present invention that retains a DNA encoding a secretory protein on the chromosome, that is, an activity that promotes secretory production of an exogenous secreted protein by inactivation The genes having are shown in the table below. In addition, 55 types of genes shown in Table 1 are specific genes that inactivate DNA encoding Cel8A (hereinafter referred to as Ctcel8A) which is a cellulase (endoglucanase) belonging to GHF8 of Clostridium thermocellum. Screened based on the endoglucanase activity of the culture supernatant obtained by introduction into the yeast chromosome and liquid culture, and further encoding the endoglucanase on the yeast chromosome of the selected gene inactivated strain The culture supernatant obtained by introducing the DNA to be cultured and liquid culture was screened based on the endoglucanase activity.

  These genes are preferably inactivated to secrete and produce foreign proteins. In yeast in which one or more selected from these genes are inactivated and the encoded DNA is retained on the chromosome in a form in which the foreign protein is secreted, the gene is inactivated. The production of foreign proteins is promoted more than yeast that does not hold the same encoded DNA on the chromosome. The foreign protein is preferably one or more selected from cellulases such as endoglucanase.

  The genes to be inactivated are one type or two or more types selected from 53 types of genes other than PER1 and VRP1. When these genes are inactivated, it becomes easy to secrete and produce foreign proteins in a liquid medium. More preferably, it is one or more selected from the group consisting of DYN3, GCN5, OPI3, PER1, RPL13B, RPL19B, RPL36A, SNF7, VMA7, VPS3, VPS4, VPS16, VPS27, YKL118W and YOL138C. When these genes are inactivated, it is convenient for secretory production of endoglucanase. Note that PER1 may be excluded.

  The genes to be inactivated are one or two selected from the group consisting of DYN3, GCN5, OPI3, PER1, RPL13B, RPL19B, RPL36A, VMA7, VPS3, VPS4, VPS16, VPS27, YKL118W and YOL138C. It may be the above. Inactivation of these genes is advantageous for secretory production of cellulases such as β-glucosidase. More preferably, it is one or more selected from the group consisting of DYN3, GCN5, OPI3, PER1, RPL13B, RPL19B, RPL36A, VMA7, VPS3, VPS4, VPS27, YKL118W and YOL138C. PER1 may be excluded from these groups. More preferably, it is one or more selected from the group consisting of DYN3, GCN5, OPI3, PER1, RPL13B, RPL19B, VPS3, YKL118W and YOL138C. Most preferably, it is one or more selected from GCN5, RPL19B and VPS3.

  Table 2 shows genes that are preferably inactivated in the transformant of the present invention that retains the DNA encoding the secretory protein outside the chromosome, that is, exogenous secretory proteins due to inactivation. The gene which has the activity which accelerates | stimulates secretory production is shown.

  In the same manner as the gene of Table 1, the 96 genes in the column A in Table 2 are exogenous Cel8A (hereinafter referred to as Ctcel8A), which is a cellulase (endoglucanase) belonging to Clostridium thermocellum GHF8. This was screened based on the endoglucanase activity of the culture supernatant obtained by introducing the specific gene as a secreted protein into inactivated yeast and liquid culture.

  These 96 genes can be divided into three groups (Tables 2B to D) according to the degree of activity that promotes secretory production of exogenous secreted proteins by inactivation. The genes described in the column of Table 2B have the highest secretory production promoting activity by inactivation among the 96 species, and the genes described in the column of Table 1C have the next highest secretory production promoting activity. The gene described in the 2D column has the next highest secretory production promoting activity.

  Moreover, among 96 kinds of genes shown in Table 2A, genes that promote secretory production of cellulase belonging to GHF8 in a nutrient rich medium by inactivation can be classified into one subgroup (Table 2E). Furthermore, genes that promote the secretion production of cellulase (endoglucanase) (Cccel5A) in the nutrient rich medium of Clostridium cellulovorans belonging to GHF5 by inactivation are included in one subgroup (Table 2F column). Can be classified. Genes common to GHFs 8 and 15 are genes underlined in columns E and F of Table 2. Since these genes can activate cellulases of both families, these genes can be preferably used for secretory production of these two types of cellulases.

  The gene group in Table 2 was obtained by evaluating the activity when endoglucanase belonging to GHF8 was secreted and produced as an exogenous secreted protein, but as shown in Table 2E column and F column, they are different. It can be seen that inactivation of the genes described in Table 2A is also effective for the culture conditions and different GHF cellulases. This supports that the gene inactivation described in Table 2A column is widely useful for secretory production of exogenous secreted proteins beyond amino acid similarity.

  Two or more types selected from the gene group shown in Table 2A may be inactivated. This is because secretion of foreign protein may be further promoted by inactivation of two or more genes. When two or more types of genes are inactivated, for example, two or more types selected from Table 3 below can be used.

  In Table 3, in Table 3A column, genes preferable for inactivation in combination of two or more types are described. The Table 3A column contains the genes and RRD1 of the Table 3B column and Table 3C column. As shown in FIG. 38, the genes shown in Tables 3B and C are all genes encoding proteins relating to protein transport pathways. The genes shown in Table 3B are genes (ARV1, CHO2, CSG2, ERG6, FAR8, OPI3, PER1, SAC1) that encode proteins localized in rough endoplasmic reticulum and Golgi apparatus, and are shown in Table 3C. Genes that are localized in endosomes and mainly encode proteins involved in transport from the Golgi apparatus to endosomes and vacuoles (ERG3, MON2, RAV1, SNF7, SNF8, VPS3, VPS4, VPS16, VPS25, VPS27, VPS28, VPS36, (VPS45, YPT7) (according to Saccharomycees cerevisiae genome database (http://www.yeastgenome.org/)) Disruption of genes involved in the transport pathway of these proteins, more preferably double disruption is synergistic with high production effects As shown in Fig. 38, when the protein is secreted out of the cell, it passes through the rough endoplasmic reticulum and the Golgi apparatus, and abnormal proteins such as proteins that are not correctly folded are expressed by the Golgi apparatus. Endo from the body According to the present inventors, genes encoding proteins localized in endosomes such as RAV1 and proteins localized in rough endoplasmic reticulum such as FAR8 It has been found that the secretory production activity of exogenous proteins has been improved by double disruption of the gene coding for or a gene coding for a protein involved in the transport of vacuolar proteins such as VPS3.

  The Table 3A column contains RRD1 in addition to the genes described in the Table 3B column and the genes described in the Table 3C column. The genes that are combined and inactivated in the present invention can include two or more types selected from the genes listed in Table 3A. RRD1 encodes a protein localized in the nucleus and cytoplasm, but can be inactivated together with a gene encoding a protein related to protein transport, thereby producing a synergistic high protein production effect. Preferably, they are two or more types selected from the gene group described in Table 3B column and Table 3C column. Two or more types of inactivated genes may include both the gene group in Table 3B column and the gene group in Table 3C column, or any one of them.

  As the inactivated gene, FAR8 is preferably selected from the column in Table 3B. The inactivated genes are preferably one or two genes selected from RAV1 and VPS3 from the column in Table 3C. In particular, RAV1 is preferably selected. The inactivated gene may include two or more types selected from the group consisting of FAR8, RAV1, VPS3, and RRD1, or two or more types selected from FAR8, RAV1, and VPS3. May be. Examples of such combinations of inactivating genes include FAR8 and RAV1, RAV1 and VPS3, RAV1 and RRD1, and the like.

Rav1 protein is known to localize in endosomes and form a complex with Rav1, Rav2 and Skp1 proteins, and is known to be required for transport of early endosomes to vacuoles (Soi3p / Rav1p functions at the early endosome to regulate endocytic trafficking to the vacuole and localization of trans-Golgi network transmembrane proteins., Mol Biol Cell. 2004 Jul; 15 (7): 3196-209, Seol JH, Shevchenko A., Shevchenko A., Deshaies RJ, Skp1 forms multiple protein complexes, including RAVE, a regulator of V-ATPase assembly. Nat Cell Biol. 2001, Apr; 3 (4): 384-91). VPS3 is a protein required for sorting and processing of vacuolar proteins and is required for assembly of H ⁺ -vacuolar ATPase protein complex (Rothman JH, Yamashiro CT, Raymond CK, Kane PM, Stevens TH., Acidification of the lysosome-like vacuole and the vacuolar H + -ATPase are deficient in two yeast mutants that fail to sort vacuolar proteins., J Cell Biol. 1989 109 (1): 93-100). Far8 protein is localized to the rough endoplasmic reticulum and is known to be involved in arresting the G1 phase of the cell cycle. RRD1 protein is known to be localized in the nucleus and cytoplasm and activated by protein phosphatase PP2A (Kemp HA, Sprague GF Jr., Far3 and five interacting proteins prevent premature recovery from pheromone arrest in the budding yeast Saccharomyces cerevisiae., Mol Cell Biol. 2003 Mar; 23 (5): 1750-63)).

  The nucleotide sequences of the yeast genes shown in Tables 1, 2 and 3 are obtained from the Saccharomyces genome database (http://www.yeastgenome.org/), particularly for Saccharomyces genera such as S. cerevisiae. be able to. For these genes, including the genus Saccharomyces, the blast search site (http: //www.ncbi.nlm) of the website of the National Institutes of Health (http://www.ncbi.nlm.nih.gov/) .nih.gov / blast / Blast.cgi) etc.

  In the transformant of the present invention, one or more selected from the genes shown in Table 1 or the genes shown in Table 2, or two or more selected from the genes shown in Table 3 are inactivated. ing. Here, a gene is inactivated at least in a host yeast (1) a state in which transcription or translation of the gene is completely or partially suppressed, and (2) the gene It includes a state in which a mutation has been introduced and a protein that is incompletely expressed to the extent that it cannot exert its original function at all. Such an inactivated state is typically realized by introducing a mutation into a regulatory region such as a promoter of the gene or a coding region. Specifically, such inactivated form can be obtained by homologous recombination. Strains in which each yeast gene shown in Tables 1 to 3 is disrupted can be obtained from Open Biosystems (USA). In addition, strains in which two or more types of yeast genes are disrupted can be obtained by further gene disrupting these strains.

  In the transformant of the present invention, the secretion production of the foreign protein in liquid culture is promoted more than when one or more genes selected from the genes shown in Table 1 are not inactivated. It can have the characteristics. That is, except that the host is a wild type (the gene shown in Table 1 is not inactivated), it is more foreign than a transformant obtained by introducing DNA encoding a foreign secretory protein. Secreted production of sex secreted proteins is promoted.

  The conditions for liquid culture are not particularly limited, and can be set as appropriate in consideration of, for example, the liquid culture process to be performed. Therefore, the medium may be a rich medium or a poor nutrient medium, and the pH may be appropriately set according to the yeast to be used, and the medium may or may not be provided with a pH buffering ability. Usually, YPD medium and SD medium, which are general yeast culture media, and media appropriately modified for these can be used.

  Whether or not the secretory production of the exogenous secretory protein is promoted can be evaluated by the secretory production amount of the exogenous secretory protein or the activity of the secretory protein. Preferably, the amount of the protein and the like is evaluated for a culture supernatant obtained by subjecting the transformant of the present invention to a wild-type transformant to be compared for a certain period of time.

  The amount of protein and the method for measuring protein activity can be appropriately selected according to the type of protein. If the protein is an enzyme or the like, the enzyme activity may be measured by a known method. For example, when the exogenous secretory protein is a cellulase such as endoglucanase, the collected culture supernatant is reacted with an appropriate cellulase substrate (carboxymethyl cellulose, cellulose phosphate, crystalline cellulose, etc.), and the amount of reaction product The enzyme activity can be evaluated by measuring the mass and the base mass. The reaction temperature, pH, and time can be appropriately set depending on the type of enzyme. In addition, methods for quantifying the amount of reducing sugar resulting from the enzyme reaction include the Somogyi method, Tauber-Kleiner method, Hanes method (titration method), Park-Johnson method, 3,5-dinitrosalicylic acid (DNS) method, TZ method (Journal of Biochemical Methods, 11 (1985) 109-115) or the like may be employed as appropriate.

  In addition, cellulase activity such as endoglucanase is supplied to the evaluation region consisting of a solid phase containing cellulose such as carboxymethyl cellulose, and a test protein that has the potential of the present invention is supplied. The endoglucanase activity can also be evaluated based on the size of the region in which cellulose is decomposed and disappeared in the solid phase after being decomposed (halo: the region in the solid phase that is lightened or decolorized by the degradation of biomass). The halo based on the disappearance of the cellulose in the solid phase can be visually recognized, and the halo can be clearly detected by staining the cellulose with Congo Red or the like when detecting the halo. In addition, when dye-bonded cellulose (such as Cellulose Azure, manufactured by Sigma) is used as biomass, the cellulose diffuses into the solid phase due to the decomposition of the cellulose and forms a halo, so cellulolytic activity is easily detected. be able to. Similarly, halo can be easily detected by using cellulose combined with a fluorescent dye as biomass. Further, when acid-treated cellulose or the like is used as biomass, a transparent halo is formed by the decomposition of cellulose, so that the cellulolytic activity can be easily detected.

  Examples of the solid body for forming halo include a gel and a film supporting biomass. The constituent material of the gel or film is not particularly limited, and a natural or artificial polymer material can be preferably used. As such a polymer material, agarose (agar) can be preferably used.

  In the transformant of the present invention, one or more or two or more of the genes shown in Table 1, Table 2 or Table 3 are inactivated, and at least one of the DNAs encoding a foreign protein such as cellulase is at least a chromosome. In addition to being introduced above, it may be further modified to produce other foreign proteins, for example, useful substances described below.

(Production of yeast transformant)
The transformant of the present invention described above can be prepared according to the method described in Molecular Cloning 3rd edition, Current Protocols in Molecular Biology and the like. Introducing an expression vector or the like having a DNA encoding a foreign secreted protein into a host yeast in which one or more of the genes shown in Table 1, Table 2 or Table 3 have been previously inactivated, It can also be obtained by transforming host yeast.

  The host yeast can be obtained from Open Biosystems (USA) or can be obtained by introducing a mutation into a regulatory region or a coding region such as a promoter of a gene to be disrupted. The inactivation of a specific gene can be achieved by introducing a mutation into a specific gene or introducing another gene using a homologous recombination method, for example. A host yeast in which two or more specific genes have been inactivated can also be obtained by gene transfer by various known methods or by using an available disrupted strain.

  A preferred host yeast of the present invention is a yeast in which one or more of the genes shown in Tables 1 to 3 are inactivated. In the host yeast of the present invention, the genes already described as suitable inactivated genes or combinations thereof are preferably inactivated.

  One form of the vector for expressing the foreign protein in the yeast of the present invention includes a vector for inactivating one or more selected from the genes listed in Tables 1 to 3. . This vector has a homologous region with the gene to be inactivated or its vicinity, and the gene is inactivated by substituting the gene or its neighborhood with the DNA region held by the vector via this homologous region. It is to become. Such vectors for homologous recombination and their production are well known to those skilled in the art and are disclosed in Molecular Cloning 3rd Edition, Current Protocols in Molecular Biology and the like.

  Another form of the vector for expressing the exogenous secretory protein in yeast has a coding region of the desired exogenous secretory protein. The protein to be expressed preferably has extracellular secretion in yeast. Such secretory property can be artificially imparted by using a secretory signal or the like in addition to the case where the intended protein originally has. The form secreted and expressed outside the cell is not particularly limited. Examples of the secretory expression include a form secreted without being restricted to the cell surface and a form presenting the protein on the cell surface. For example, the former form may provide a signal peptide that functions in yeast, for example, for secretion of proteins in yeast, the natural signal sequence may be, for example, a yeast invertase leader, an alpha factor leader, or Rhizopus oryzae And C. albicans glucoamylase leader. Moreover, the latter form can utilize the well-known yeast cell surface display system. As such a presentation system, the protein can be secreted into a state presented on the surface of yeast by using an aggregating protein or a part thereof. For example, in addition to the secretion signal, a peptide comprising 320 amino acid residues on the C-terminal side of α-agglutinin which is an aggregating protein is used. Polypeptides and methods for displaying a desired protein on the cell surface are disclosed in WO01 / 79483, JP2003-235579, WO2002 / 042483, WO2003 / 016525, and JP2006-136223. Publication, Fujita et al. (Fujita et al., 2004. Appl Environ Microbiol 70: 1207-1212 and Fujita et al., 2002. Appl Environ Microbiol 68: 5136-5141.), Murai et al., 1998. Appl Environ Microbiol 64: 4857-4861 Is disclosed. For example, the signal sequence may be an element incorporated into the vector, but may be a part of the cellulase gene.

  The vector of the present invention can include a regulatory region (promoter, terminator, etc.) together with the above-described protein-encoding DNA, as well as an appropriate expression marker gene cassette. A vector is a component other than the above coding region (chromosome by homologous recombination) depending on the transformation method and the retention form of the encoded DNA in the host cell (form introduced into the chromosome, form retained outside the chromosome, etc.). When intended to be introduced into the DNA, a region of homology with yeast chromosomal DNA is required). Moreover, the form of a vector can take various forms according to a usage form. For example, it can take the form of a DNA fragment, and can also take the form of a suitable yeast vector such as a 2 microplasmid.

  The yeast transformant of the present invention can be obtained by appropriately transforming a suitable yeast host with such a vector. For the transformation, various conventionally known methods such as transformation method, transfection method, conjugation method, protoplast method, electroporation method, lipofection method, lithium acetate method and the like can be used.

(Method for producing degradation product of cellulose-containing material)
The method for producing a degradation product of a cellulose-containing material of the present invention comprises the steps of preparing a yeast transformant of the present invention that secretes and produces cellulase as an exogenous protein, and the yeast in a liquid medium containing the cellulose-containing material as a carbon source. Culturing the transformant. According to the production method of the present invention, the cellulose-containing material can be directly used by yeast without adding a cellulase for saccharifying the cellulose-containing material or suppressing the addition amount. For this reason, a cellulose containing material can be utilized efficiently.

(Preparation of transformants)
As a cellulase secreted and produced by a yeast transformant, one or a combination of two or more cellulases described above can be used. Preferably, two or more types of cellulases (for example, endoglucanase and cellobiohydrolase) can be used. Two or more types of cellulases may be secreted and produced by one transformant, but may be two or more types of transformants that secrete and produce each cellulase. In addition, various aspects of the transformant of the present invention described above can be applied to the transformant used in the production method of the present invention.

(Liquid culture)
In order to perform liquid culture of the above yeast transformant in a liquid medium, a known liquid medium can be used or appropriately modified, except that a cellulose-containing material is used as at least one kind of carbon source. The culture medium composition, temperature, pH, aeration conditions and the like can be appropriately set as necessary.

  The cellulose-containing material contains a polymer in which glucose is polymerized by β-1,4-glucoside bonds and derivatives thereof. The degree of polymerization of glucose is not particularly limited. In addition, examples of the derivative include derivatives such as carboxymethylation, aldehyde formation, or esterification. The cellulose may be crystalline cellulose or non-crystalline cellulose. Cellulose may be cellooligosaccharide or cellobiose, which is a partially decomposed product thereof. The cellulose-containing material may be a complex with β-glucoside which is a glycoside, lignocellulose which is a complex with lignin and / or hemicellulose, pectin and the like. The origin of the cellulose-containing material is not particularly limited. It may be derived from plants, fungi, or bacteria. Examples of the cellulose-containing material include natural fiber products such as cotton and hemp, recycled fiber products such as rayon, cupra, acetate, and lyocell, and agricultural waste such as rice straw, rice husk, and wood chips.

  Cellulose degradation products obtained by the method of the present invention include cellobiose and cellooligosaccharides in addition to glucose. The cellulose degradation product thus obtained can be used as a fermentation raw material of a useful substance, as in the case of normal glucose. In addition, as a transformant used with the manufacturing method of this invention, when it has yeast original alcohol fermentability, useful substances, such as alcohol (ethanol), are implemented by implementing a culture | cultivation process so that it may mention later. Can be manufactured. Moreover, when the transformant to be used is modified by genetic engineering to produce an organic acid such as lactic acid, the organic acid can be produced.

(Method for producing useful substance from cellulose-containing material)
The method for producing a useful substance of the present invention comprises a step of preparing a yeast transformant of the present invention that secretes and produces cellulase as an exogenous protein, and the yeast transformant in a liquid medium containing a cellulose-containing material as a carbon source. Culturing and producing a useful substance by fermentation. According to the production method of the present invention, a useful substance can be produced by directly using a cellulose-containing material with yeast without adding a cellulase for saccharifying the cellulose-containing material or suppressing its addition amount. For this reason, a cellulase cost can be reduced compared with the former and a useful substance can be manufactured.

  Although it does not specifically limit as a useful substance, What is necessary is just what can produce yeast using glucose. For example, it may be a compound that is not an original metabolite by replacing or adding one or more enzymes in the metabolic system from glucose in yeast by genetic recombination. Specifically, in addition to lower alcohols such as ethanol, organic acids such as lactic acid, fine chemicals (coenzyme Q10, vitamins and their raw materials, etc.) by adding an isoprenod synthesis route, glycerin by modifying glycolysis, plastics and chemical raw materials For example, materials targeted by biorefinery technology. Since yeast has a high alcohol fermentability, this transformed yeast can efficiently produce ethanol from cellulose-containing materials.

  A carbon source containing a cellulose-containing material is used for the fermentation of transformed yeast. At the start of culture, a carbon source in a form that can be easily used by yeast, such as glucose and sucrose, can also be used. Cellulase may be added to the medium. Although the cellulase to be added is not particularly limited, it may be produced by culturing the transformed yeast of the present invention.

  In addition, culture conditions generally applied to yeast can be appropriately selected and used for fermentation of transformed yeast. Typically, the culture for fermentation can be stationary culture, shaking culture, aeration-agitation culture, or the like. The aeration conditions can be appropriately selected from anaerobic conditions, microaerobic conditions, aerobic conditions, and the like. The culture temperature is not particularly limited, but may be in the range of 25 ° C to 55 ° C. Moreover, although culture | cultivation time is also set as needed, it can be set as several hours-about 150 hours. The pH can be adjusted using an inorganic or organic acid, an alkaline solution, or the like. During the culture, antibiotics such as ampicillin and tetracycline can be added to the medium as necessary.

  After completion of fermentation, a step of recovering a useful substance-containing fraction from the culture solution, and a step of purifying or concentrating the fraction can also be performed. The recovery process and the purification process are appropriately selected according to the type of useful substance.

  The ethanol production method of the present invention only needs to have alcohol fermentability as a yeast transformant in the method for producing a degradation product of a cellulose-containing material of the present invention.

(Protein production method)
The method for producing a protein of the present invention can comprise the steps of preparing the transformant of the present invention and culturing the transformant in a liquid medium. According to the yeast transformant of the present invention, a desired foreign protein can be efficiently secreted and produced, which is advantageous for protein production. Conditions such as the composition, temperature, pH and the like of the liquid medium used in the culturing step can be appropriately set. The liquid medium should just have the carbon source which the said yeast transformant can utilize. Therefore, in the case where cellulase is secreted and produced as a foreign protein in the yeast transformant, the liquid medium may contain a cellulose-containing material as a carbon source. The culture supernatant obtained in the culture step contains a protein secreted and produced by the transformant of the present invention. When the protein is an enzyme or the like, it may be purified, but the culture supernatant may be used as it is as an enzyme solution.

  EXAMPLES Hereinafter, although an Example is given and this invention is demonstrated concretely, this invention is not limited to these Examples. The gene recombination described below was performed according to Molecular Cloning: A Laboratory Manual (T. Maniatis, et al., Cold Spring Harbor Laboratory).

Construction of cellulase expression plasmid
A signal peptide of Rhizopus Oryzae-derived glucoamylase was introduced between SacII-SpeI of a 2-micron vector for yeast expression having a TDH3 promoter, a CYC1 terminator, and a marker URA3. Clostridium thermocellum (hereinafter C. thermocellum) endoglucanase Cel8A (hereinafter Ctcel8A) or Clostridium cellulovorans (hereinafter C. cellulovorans) endoglucanase cel5A (hereinafter Cccel5A) was introduced between the downstream SphI and SpeI of this signal peptide ( FIG. 1). The prepared plasmid DNA was named pRSA436GAPcelA for Ctcel8A and pRS436GAPCccel5A for Cccel5A.

Confirmation of endoglucanase activity in yeast
A diploid yeast BY4743 (genotype: MATa / α his3Δ1 / his3Δ1 leu2Δ0 / leu2Δ0 lys2Δ0 / LYS2 MET15 / met15Δ0 ura3Δ0 / ura3Δ0) derived from the S288C strain of Saccharomyces cerevisiae was transformed by the lithium acetate method. After streaking yeast on a YPD plate and culturing at 30 ° C for 1 day, the transformant (35 μl of 60% polyethylene glycol average molecular weight 3350 + 2.5 μl of 4M lithium acetate + 5 μl of 1M dithiothreitol + 5 μl of 10 mg / ml sperm sperm DNA 1 μl of pRS436GAPcelA was mixed, and sterilized water was added to a total volume of 50 μl), and the yeast was cultured from the YPD plate. The transformation solution was heated at 42 ° C. for 2 hours, and spread on SD-uracil (0.67% YNB w / o aa + 2% glucose + amino acid mix (-uracil)) medium. In the amino acid mix (-uracil), 0.5 g of adenine, 2 g of tryptophan, 2 g of histidine hydrochloride, 2 g of methionine, 4 g of leucine and 2 g of lysine hydrochloride were added per liter. Whether the change in endoglucanase activity occurred when the pH of the medium was controlled was examined. Endoglucanase activity is detected in culture supernatants cultured in YPD medium (1% yeast extract, 2% peptone + 2% glucose), SD-uracil medium, and SD-uracil with 0.1 M KPO ₄ and pH buffered. It was spotted on a 2% agar medium (hereinafter, CMC medium) containing 0.1% carboxymethylcellulose and allowed to react at 40 ° C. for 1 day. The plate was stained with 0.1% CongoRed / 1 M Tris (pH 9) (hereinafter referred to as Congo red solution), and after decolorization with 1 M NaCl, an unstained halo (circle) having endoglucanase activity was confirmed (FIG. 2). The endoglucanase activity of celA decreased greatly with the decrease of culture pH. From the above, in the subsequent evaluation of endoglucanase activity, it was decided to ensure a state in which pH reduction was suppressed.

Transformation into Yeast Gene Disrupted Strain Library Plasmid pRS436GAPcelA constructed in “Example 1” was transformed into a diploid yeast gene disrupted strain library. In the method, the disrupted strain library stored on the YPD plate was inoculated into a 96-well microplate containing 25 μl of YPD, cultured at 30 ° C. for 1 day at rest, mixed with the culture solution, and the literature (kitagawa et al., Biosci Biotechnol Biochem. 2007 Mar; 71 (3): 772-82. Epub 2007 Mar 7.Screening of drugs that suppress Ste11 MAPKKK activation in yeast identified a c-Abl tyrosine kinase inhibitor.) And then mixed with 3500 μl of 60% polyethylene glycol average molecular weight 3350 + 250 μl of 1 M dithiothreitol + 250 μl of 4 M sodium acetate + 250 μl of 10 mg / ml sperm DNA + 250 μl of pRS436GAPcelA DNA solution at 42 ° C Heat was applied for 2 hours and spotted on SD-uracil medium (FIG. 3).

Screening of Ctcel8A high production yeast mutant
In order to screen for yeast mutants producing Ctcel8A at a high yield, each strain was collected from a plate transformed with Ctcel8A, and cultured on a 96-well microplate containing 50 μl of SD-uracil at 30 ° C. for 1 day. 5 μl of the culture supernatant was spotted on CMC medium with an 8-lane pipette, reacted at 40 ° C. for 1 day, stained with Congo red solution, and decolorized with 1 M NaCl. 226 strains having a larger halo with endoglucanase activity than other gene-disrupted strains were obtained (FIG. 4).

In order to obtain the reproducibility of 226 Ctcel8A highly active strains obtained by reconfirmation screening of Ctcel8A high-producing yeast mutants , the obtained highly active strains were cultured with shaking in SD-uracil medium one by one in a test tube. Reproducibility of 147 strains was obtained as a strain having higher activity than wild type BY4743 by the same operation as in Example 2. In order to confirm the nutritional requirement of 147 Ctcel8A high-producing strains, strains that streak into SD-UMK (0.67% YNB w / o aa + 2% glucose + amino acid mix (-UMK)) medium and cannot grow are high-producing strains It became 117 shares. The SD-UMK medium amino acid mix (-UMK) was prepared by mixing 0.4 g per liter of adenine 0.5 g, tryptophan 2 g, histidine hydrochloride 2 g, and leucine 4 g into the SD medium. Since the disrupted strain library used was diploid, if the obtained highly active strain is mixed with haploid, it should be mated with haploid. To eliminate haploids, N435-1A (genotype: MATa his7 lys7 met6 arg1 gal4 MAL2 SUC), N435-2A (genotype: MATα his7 lys7 met6 arg1 gal4 MAL2 SUC) and high-producing strains on the YPD plate Streaks were mixed and cultured at 30 ° C for 1 day. Cultured plates were replicated to minimal medium (0.67% YNB w / o aa + 2% glucose). Except that 7 strains grew on the minimal medium, 110 strains were removed. In order to remove the strain with little difference in activity from the wild type (BY4743 strain) once again, the cells were cultured again in SD-uracil medium in a test tube and re-tested in the same manner as in Example 2. The reproducibility of 96 strains It could be confirmed. The 96 strains were classified as Ctcel8A highly active strains, and the activity intensity was classified into three levels: +++, ++, and + (FIGS. 5 to 7).

  These 96 strains can be said to have preferable mutations for producing and secreting foreign proteins. That is, it has been found that the genes that are disrupted in these strains are genes that are preferably inactivated in order to secrete and produce foreign proteins.

The 96 Ctcel8A high activity strains obtained by screening the activity of the Ctcel8A highly active strain on the nutrient rich medium were cultured on the YPD medium, which is the nutrient rich medium, and the activity of the culture supernatant diluted 100 times was the same as in Example 2. (After spotting on CMC medium and reacting at 40 ° C. for 1 day, the plate was stained with 0.1% CongoRed / 1 M Tris (pH 9) (hereinafter, Congo Red solution) and decolorized with 1 M NaCl.) As a result, 25 strains were more active than wild type BY4743 . Ctcel8A was retransformed against these gene-disrupted strains, and 21 strains were more active than wild-type BY4743, except for two strains that showed poor growth (FIG. 8). Two strains were not reproducible. From the above, it was found that the strain obtained in this example showed high activity regardless of the composition of the medium.

Activity in rich medium with Cccel5A 23 strains obtained by retransformation in Example 6 were transformed with the plasmid pRS436GAPCccel5A (FIG. 1) described in Example 1 expressing the endoglucanase Cccel5A of Clostridium cellulolyticum. Converted. When the activity of the culture supernatant cultured in YPD medium and diluted 50-fold was examined by the same method as in Example 2, 14 strains were more active than wild type BY4743 (FIG. 9). The remaining nine strains did not change in activity with BY4743. From the above, the mutant strains confirmed to have high activity in this Example are useful for secreting and producing both GHF5 and 8, that is, the inactivation of genes disrupted in these mutant strains. It was found that the conversion is effective for the production of foreign proteins.

Preparation of vectors for introduction of Ctcel8A and Cccel5A staining charges Vectors pAH-HORp-Ctcel8A and pAH-HOR7p-Cccel5A for introducing cellulase into the chromosome were prepared (FIG. 10). A sequence from -3000 bp to -2000 bp upstream of the AAP1 gene (hereinafter referred to as AAP1U) was cloned from the genomic DNA of S288C by PCR reaction. A sequence from -2000 bp to -1000 bp upstream of the AAP1 gene (hereinafter AAP1D) was cloned from the genomic DNA of S288C by PCR reaction. A hygromycin resistance gene was linked as a marker for confirming gene transfer. After extracting the genome from cultured cells of C. thermocellum (ATCC27405), C. cellulolyticum (ATCC35319), the cellulase gene C. thermocellum-derived Cel8A (ABN51508) excluding the secretory signal sequence is approximately 1.3 kb and C. cellulolyticum-derived Cel5A (AAA51444) About 1.3 kb was obtained by PCR. The obtained gene fragments were inserted downstream of the signal peptide of the Rhizopus Oryzae-derived glucoamylase in the chromosome introduction vector at the restriction enzyme KpnI-BglII for Cel8A and the KpnI-BamHI site for Cel5A.

Effect of Ctcel8A and Cccel5A Chromosome-Introduced Strains in vps3 Gene Disrupted Strains Plasmids pAH-HOR7p-Ctcel8A and pAH-HOR7p-Cccel5A prepared in Example 8 were transformed. As a transformation method, BY4743 and vps3 disrupted strains were cultured in YPD medium at 30 ° C. for 1 day, and again cultured in YPD medium for 5 hours at 30 ° C. The culture solution was collected by centrifugation, washed again with sterilized water, and then collected by centrifugation. 60% polyethylene glycol Average molecular weight 3350 120 μl, 4 M lithium acetate 5 μl, 1 M dithiothreitol 10 μl, and the restriction enzyme Sse8387I to make the chromosomal transfection site linear, then add 5 μl of DNA solution 50 μl was added, suspended, and reacted at 42 ° C. for 1 hour. The reaction solution was centrifuged, YPD medium was added, and recovery culture was performed overnight at 30 ° C. The culture was spread on a plate containing hygromycin B at a final concentration of 150 μg / ml in YPD and grown at 30 ° C. Colonies that became resistant to hygromycin were again single colonized. Colonies were grown again on YPD plates. After culturing at 30 ° C. for 1 day in YPD medium, the culture solution was centrifuged, and the culture supernatant was diluted x1, x2, x4, x8, x16, x32 times. 8 μl of the supernatant was spotted on CMC medium and reacted at 40 ° C. for 1 day. Staining with Congo red solution and decolorization with 1M NaCl confirmed the activity (FIG. 11). Compared to BY4743, the vps3-disrupted strain showed an increase in activity of 8 times or more in Ctcel8A and 32 times or more in Cccel5A.

  The above Ctcel8A and Cccel5A chromosomally introduced strains are SD + complement medium (0.67% YNB w / o aa + 2% glucose + amino acid mix (complement), pH adjusted to 6 with NaOH) medium and SD + complemnent + 0.1M NaAc Culture was carried out in a medium (0.67% YNB w / o aa + 2% glucose + amino acid mix (complement) +0.1 M sodium acetate added to adjust pH to 6 with HCl). The amino acid mix was 0.5 g adenine, 2 g uracil, 2 g tryptophan, 2 g histidine hydrochloride, 2 g methionine, 4 g leucine and 2 g lysine hydrochloride and added 0.6 g per liter. After culture, 8 μl of the culture supernatant was spotted on CMC medium. The plate was reacted at 40 ° C. for 1 day, stained with Congo red solution, and decolorized with 1M NaCl (FIG. 12). When buffering so as not to lower the pH of the medium with sodium acetate (SD + complement + 0.1M NaAc medium), the activity of the vps3-disrupted strain was increased about twice as much as that of the wild type (BY4743 strain). On the other hand, in the medium not buffering pH (SD + complement), the activity of BY4743 could not be confirmed due to a decrease in the medium pH, but the activity was confirmed in the vps3-disrupted strain. Therefore, as with the YPD medium, it was confirmed that the vps3-disrupted strain can produce cellulase at a high level even in an oligotrophic medium such as SD medium.

  From the above, it was found that in the yeast in which the vps3 gene was inactivated, a high secretory production activity of the foreign protein can be obtained even if the foreign protein-encoding DNA is in the form of chromosome introduction. That is, it was found that the foreign protein can be stably secreted and produced with high activity. Moreover, it turned out that the tolerance with respect to poor nutrition and low pH is also improving rather than the wild type.

Chromosomal introduction of cel8A gene into gene disruption strains- 96 strains of haploid strains corresponding to the genes listed in Table 1 were selected from a haploid gene disruption library library (Invitrogen Corporation) stored at 80 ° C. Gene disruption was confirmed by colony PCR. A small amount of each strain was added to 5 μl of 20 mM NaOH and boiled at 100 ° C. for 10 minutes. 15 μl of ultrapure water was added to the boiled sample. The primers used were as shown in Table 3. The reverse side primer commonly used was KANMX + 600R (ATCAAGTGAGAAATCACCATGAGTGACGAC) (SEQ ID NO: 1), and the forward side primer was a gene-specific primer other than KANMX + 600R. For these PCR reactions, Extaq DNA polymerase (Takara Bio Inc.) was used. PCR was performed as follows. Specifically, 1.5 μl of the cell suspension crushed by boiling at 100 ° C. for 10 minutes was added to 6.5 μl of the PCR reaction solution. The reaction conditions were boiled at 94 ° C for 2 minutes, and 94 cycles of 94 ° C, 15 seconds, 50 ° C, 30 seconds, 72 ° C, 2 minutes were repeated. As a result, of the 96 strains, 13 strains (vma4, kap120, mtq2, ydr433W, ygr102C, yvh1, adh1, ado1, pat1, mdm34, rpl1B, vps33, ynl296W disruption strain) could not be confirmed.

  Ctcel8A was chromosomally introduced into 83 gene-disrupted strains and a reference strain (BY4741 strain, genotype: MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0) except 13 strains for which gene disruption could not be confirmed. As a chromosome introduction vector, pAL-HOR7p-Ctcel8A shown in FIG. 13 was constructed. This vector was prepared as follows. A sequence from -3000 bp to -2000 bp upstream of the AAP1 gene (hereinafter referred to as AAP1U) was cloned from the genomic DNA of S288C by PCR reaction. A sequence from -2000 bp to -1000 bp upstream of the AAP1 gene (hereinafter AAP1D) was cloned from the genomic DNA of S288C by PCR reaction. The LEU2 gene was ligated as a marker for confirming gene transfer. After extracting the genome from cultured cells of C. thermocellum (ATCC27405), about 1.3 kb of cellulase gene C. thermocellum-derived Cel8A (ABN51508) excluding the secretory signal sequence was obtained by PCR. Cel8A was inserted into the downstream of the signal peptide of Rhizopus Oryzae-derived glucoamylase in the chromosomal transfer vector at the restriction enzyme KpnI-BglII site.

Each strain was cultured in YPD medium at 30 ° C. for 24 hours. 1 ml of the culture solution was inoculated into 10 ml of YPD medium and cultured again for 5 hours. The culture solution was centrifuged, washed with ultrapure water, and then centrifuged again to pellet the cells. 120 μl of 60% polyethylene glycol average molecular weight 3350, 5 μl of 4M sodium acetate, 10 μl of 1M dithiothreitol, 10 μl of sperm DNA, 54 μl of pAL-HOR7p-Ctcel8A treated with 1 μl of Sse8387I and cell suspension were added, 42 Heat shock was applied for 1 hour at ℃. This cell suspension was inoculated into SD-leucine medium and cultured at 30 ° C. for several days. The grown colonies were smeared on YPD + 0.1% CMC medium and cultured at 30 ° C. for 1 day to confirm whether or not there was CMC degradation activity.

  Strains in which CMC degradation activity was observed in colonies on the CMC-containing medium were inoculated into YPD liquid medium and cultured at 30 ° C. for 24 hours. The culture solution was centrifuged and the culture supernatant was collected. Dilute the culture supernatant x1, x2, x4, x8, x16, x32 times, spot 8μl each on 2% agar (hereinafter referred to as CMC plate) containing 0.1% carboxymethylcellulose and 50mM sodium acetate (pH6) at 40 ℃ For 1 day. After the reaction, it was reacted with 0.1% Congo Red, 1M Tris-Base (pH9) (hereinafter Congo Red liquid) for 30 minutes at room temperature, and decolorized with 1M NaCl. The results are shown in FIGS.

  As shown in FIG. 14, when Ctcel8A chromosome-introduced strains were examined in two clones, they were divided into strains having stronger activity than the reference strain and strains having the same activity as the reference strain. In both clones, a strain that was more than twice as active as the reference strain was selected as a strain capable of high production even by chromosomal transfer. As a result, as shown in FIG. 15, 55 out of 83 strains were found to be 2 to 4 times more active than the reference strain.

In order to ensure reproducibility reproducibility of cel8A high production of Ctcel8A chromosome-introduced strain, 55 strains selected in Example 10 were again cultured in YPD liquid medium at 30 ° C. for 24 hours, and the culture supernatant was diluted 8-fold, Spotted on CMC plate, reacted at 40 ° C. for 1 day, stained with Congo red solution, and decolorized with 1M NaCl. The results are shown in FIG. It was confirmed that the 55 gene-disrupted strains selected had a halo diluted 8 times more active than the reference strain ( BY4741 strain ). From the results of Examples 10 and 11, among 55 strains, the gene disrupted strains of dyn3, gcn5, opi3, per1, rpl13b, rpl19b, rpl36a, snf7, vma7, vps3, vps4, vps16, vps27, ykl118w, yol138c Cellulase secretion was found to be high.

Preparation of BGL Chromosome Introduction Vector In order to examine whether cellulase other than endoglucanase has a high production effect, a vector for introducing Aspergillus aculeatus β-glucosidase BGL1 (hereinafter referred to as AaBGL) into a yeast chromosome was prepared.

  A vector pDU-HOR7p-AaBGLsec for introducing AaBGL into the chromosome was prepared (FIG. 17). As a homologous sequence for chromosomal introduction, a sequence from -3000 bp to -2000 bp upstream of the ADH3 gene (hereinafter referred to as ADH3U) was cloned from the genome of S288C. Similarly, a sequence from -2000 bp to -1000 bp upstream of the ADH3 gene (hereinafter referred to as ADH3D) was cloned from the genome of S288C. The URA3 gene was ligated as a marker for confirming gene transfer. The sequence excluding the secretory sequence of Aspergillus aculeatus β-glucosidase gene (Genbank Accession No. D64088) was cloned. It was inserted downstream of the signal peptide of Rhizopus Oryzae-derived glucoamylase in the chromosomal transfer vector.

BGL activity of BGL chromosomally introduced strain and ethanol fermentation in cellobiose medium The plasmid DNA prepared in Example 12 and a DNA solution treated with pDU-HOR7p-AaBGLsec with Sse8387I were used as a reference strain BY4741 and It was introduced into the chromosome of the gene-disrupted strain. As the gene disrupted strains, dyn3, gcn5, opi3, per1, rpl13b, rpl19b, rpl36a, snf7, vma7, vps3, vps4, vps16, vps27, ykl118w, yol138c disrupted strains (total 15 types) were used. Three clones having AaBGL introduced into the chromosome were cultured in YPD medium at 30 ° C. and 120 rpm for 24 hours. BGL activity on the culture supernatant and cell surface of the culture solution was measured by degradation of p-Nitrophenyl-α-glucopyranoside (pNPG). BGL activity of the culture supernatant was measured by adding 5 μl of the culture supernatant obtained by removing cells to 695 μl of MQ (Millipore) water, 200 μl of 250 mM NaAc (pH 5), 100 μl of 20 mM pNPG, and shaking at 30 ° C. The reaction was continued for 60 minutes. 50 μl of 1N Na ₂ CO ₃ was added to 100 μl of the reaction solution to stop the reaction. The stop solution was determined by absorbance altimeters A _400. BGL activity on the cell surface was determined by washing the cells twice with ultrapure water, measuring OD ₆₀₀ , 650 μl ultrapure water, 200 μl 250 mM NaAc (pH 5), 100 μl 20 mM pNPG, 50 μl OD. ₆₀₀ the combined cell suspension was added to 1 (final OD ₆₀₀ = 0.5), shaking at 30 ° C., and allowed to react for 60 minutes. The reaction solution was measured in the same manner as the culture supernatant. These results are shown in FIG.

  As shown in FIG. 33, dyn3, gcn5, opi3, per1, rpl13b, rpl19b, rpl36a, snf7, vma7, vps3, vps4, vps16, vps27, ykl118w, yol138c disrupted strains other than snf7 disrupted strains are used on the cell surface. Activity improved compared to BY4741 strain). The culture supernatant of gcn5, opi3, per1, rpl19b, vps3, vps16, yol138c disruption strains other than dyn3, rpl13b, rpl36b, snf7, vps4, vps27, ykl118w disruption strains showed higher activity than the reference strain (BY4741 strain) . Except for the snf7-disrupted strain, it was found that the degradation activity was enhanced in one or both of the culture supernatant and the cell surface, and the secretory production was improved. The activity of the snf7-disrupted strain decreased on both the cell surface and the culture supernatant.

Furthermore, ethanol fermentation was performed using cellobiose from 3 clones of AaBGL-introduced strain as a carbon source. After culturing in 2 ml of YPD medium at 30 ° C. and 120 rpm for 24 hours, it was cultured again in 20 ml of YPD medium at 30 ° C. and 80 rpm for 24 hours. OD ₆₀₀ was measured, the culture solution corresponding to OD ₆₀₀ = 10 was centrifuged, cells were washed with 10 ml of ultrapure water, and then ethanol was produced using 10 ml of YPcellobiose medium containing 5% cellobiose (FIGS. 18 to 32). . The fermentation broth was sampled at the start of culture and after 4, 6, 8, 10, and 12 hours. The cell concentration (OD ₆₀₀ ) at the time of fermentation was measured with an absorptiometer. Residual glucose, residual cellobiose, and ethanol were measured with a biosensor (Oji Scientific Instruments, BF-4). For the remaining cellobiose, add Novozyme188 (Invitrogen Corp.) so that the culture sample is diluted 20-fold to 0.25%, react with shaking at 45 ° C for 1 hour, and measure the cellobiose completely glycated. The residual glucose measurement was subtracted. Increased vps16, vps27, and snf7 during fermentation decreased compared to the reference strain. Other than snf7, vps16, dyn3, gcn5, opi3, per1, and the growth rate of rpl13b, rpl19b, rpl36a, vma7, vps3, vps4, vps27, ykl118w, yol138c disrupted strains increased ethanol production rate.

To clone the marker gene for cloning transformation of MET17 gene was cloned MET17 gene. That is, MET17 gene, S288C genomic DNA as a template, 40 cycles of KOD Plus (Toyobo Co., Ltd.) enzyme and the following primers: 94 ° C for 15 seconds, 55 ° C for 30 seconds, 68 ° C for 2 minutes It was synthesized repeatedly.
attB2-MET17-500F (ggggacagctttcttgtacaaagtggATTTAATGCTATAATAGACATTTAAATCCA) (SEQ ID NO: 98)
attB3-MET17 + 1632R (ggggacaactttgtataataaagttgACCTCCATCATCCTCTTTTGTAACTTGGTC) (SEQ ID NO: 99)

The PCR product was purified with GFX PCR DNA and gel band purification kit (GE). To 2 μl of the purified PCR product, 1 μl of pDONR P2R-P3 (Invitrogen) plasmid, 5 μl of TE buffer, and 2 μl of BP clonase enzyme mix (Invitrogen) were added and reacted at 25 ° C. for 1 hour. Thereafter, 1 μl of proteinase K was added, reacted at 37 ° C. for 10 minutes, and transformed into E. coli DH5α. With respect to the transformed E. coli, the insert was confirmed using Extaq (Takara Bio Inc.) and the following primers. The confirmed plasmid DNA was sequenced to confirm that there was no mutation. The resulting plasmid was named pE3-MET17.
M13-F (GTAAAACGACGGCCAG) (SEQ ID NO: 100)
M13-R (GGAAACAGCTATGACCATG) (SEQ ID NO: 101)

Effect of high cellulase production by double disruption of RAV1 gene and RRD1 gene or FAR8 gene
Rav1 protein, RRD1 protein, and Far8 protein are considered to have different intracellular localization or function. In order to examine whether double-disruption of genes with different functions can further increase protein production, RAV1 gene disruption was performed on haploid rrd1 or far8 disruption strains.

Using pE3-MET17 as template DNA and the following primers, boil the rav1 :: MET17 disrupted DNA fragment with PrimeSTAR MAX DNA polymerase (Takara Bio Inc.) at 98 ° C for 2 minutes, then at 98 ° C for 10 seconds, 55 The synthesis was carried out by repeating 30 cycles at 15 ° C. for 15 seconds and 72 ° C. for 1 minute.
RAV1-MET17F: (TTAAAGGGATCTAAGAACACCGCAAACAATTGAGAAAGTAAACAAACGTGCACACGCAAAGGTAGTTCTCCACGTGAAGCTGTCGATATTGGGGAACTGT) (SEQ ID NO: 102)
RAV1-MET17R: (AAAACACTACATTAATAAGATGTAATTATTTTTATTTATAAATCCATTTATTTGATAAAAAATATGATATTACGAGTCACGACATGTAACAAGGGAAAAA) (SEQ ID NO: 103)

  The rrd1 disrupted strain and the far8 disrupted strain derived from the haploid yeast gene disrupted strain library were cultured in YPD medium (1% yeast extract, 2% peptone, 2% glucose) at 30 ° C., 120 rpm for 24 hours. 1 ml of this culture solution was added to 10 ml of YPD medium, and further cultured at 30 ° C. for 5 hours. The obtained culture broth was centrifuged, the pellet cells were washed with 5 ml of ultrapure water, and centrifuged again to form a pellet. 120 μl of 60% polyethylene glycol average molecular weight 3350, 5 μl of 4M sodium acetate, 10 μl of 1M dithiothreitol, 10 μl of sperm DNA, 10 μl of rav1 :: MET17 disrupted DNA fragment and cell suspension added 45 μl, 42 ° C. A heat shock was given for 1 hour. Samples were seeded in SD-methionine medium and cultured at 30 ° C. for several days.

Use Extaq DNA polymerase (Takara Bio Inc.) to boil the grown colonies for 2 minutes at 94 ° C for 2 minutes, then 94 ° C for 15 seconds, 55 ° C for 30 seconds, 72 ° C for 2 minutes 40 minutes The PCR reaction was performed by cycling to confirm the insert. The double-destroyed strain of far8 and rav1 was named TTK175, and the double-destroyed strain of rrd1 and rav1 was named TTK176.
RAV1-500F:
(AACTTTCCTTTGCACAAGTTTTCGTACTGT) (SEQ ID NO: 104)
RAV1 + 4280R:
(AGTTATAGAACAAAGAATAGAATATGTCAA) (SEQ ID NO: 105)

  Next, Ctcel8A was introduced into the chromosomes of the double-destructed strains TTK175 and TTK176 prepared as follows. TTK175 (rav1 × far8 double disruption strain) and TTK176 (rav1 × rrd1 double disruption strain) were cultured in YPD medium at 30 ° C. and 120 rpm for 24 hours. 1 ml of culture solution was added to 10 ml of YPD medium, and further cultured at 30 ° C for 5 hours. The culture solution was centrifuged, and the pellet cells were washed with 5 ml of ultrapure water and centrifuged again to form a pellet. 120 μl of 60% polyethylene glycol average molecular weight 3350, 5 μl of 4M sodium acetate, 10 μl of 1M dithiothreitol, 10 μl of sperm DNA, 1 μl of Sse8387I restriction enzyme-treated pAL-HOR7p-Ctcel8A and 54 μl of cell suspension were added, Heat shock was applied at 42 ° C for 1 hour. Samples were seeded in SD-leucine medium and cultured at 30 ° C. for several days. The grown colonies were immersed in YPD + 0.1% CMC medium and cultured at 30 ° C. for 1 day to confirm whether they had CMC degradation activity.

  The confirmed strain was cultured in YPD medium at 30 ° C. for 1 day. The culture solution was centrifuged and divided into a culture supernatant and cells. The culture supernatant was diluted 8 times and spotted in an amount of 8 μl each on 0.1% CMC / 50 mMNaAc (pH 6) 2% agar. The plate was reacted at 40 ° C. for 1 day, stained with Congo red solution for 30 minutes, and decolorized with 1M NaCl. The results are shown in FIG. At the plate level, the double disruption strain had a slightly larger halo with CMC degradation.

Next, the quantification of the activity of the culture supernatant was measured by the following method. For yeast BY4741 (reference strain), rav1-disrupted strain, rrd1-disrupted strain, far8-disrupted strain, TTK175, and TTK176 without the Ctcel8A gene introduced, Ctcel8A-introduced and non-introduced strains were cultured in YPD medium. . The culture solution was centrifuged and divided into culture supernatant and cells. 10 μl of the culture supernatant was added to 250 μl of 1% CMC, 100 μl of 250 mM NaAc buffer (pH 6) and 140 μl of ultrapure water, and reacted at 40 ° C. for 60 minutes. 5 μl of the reaction solution was put into 100 μl of TZ buffer and reacted at 100 ° C. for 3 minutes. Absorbance A ₆₆₀ of the reaction solution was measured with a spectrophotometer. The value of activity was calculated by subtracting the value of the culture supernatant of yeast not introduced with Ctcel8A from the value of yeast introduced with Ctcel8A. The results are shown in FIG.

  As shown in FIG. 35, the activities of far8 disrupted strain, rav1 disrupted strain, and rrd1 disrupted strain increased 2.4, 2.1, and 1.4 times as compared with the reference strain. The rav1 x far8 double disruption strain (TTK175) was 3.9 times more active. In addition, the activity of the rav1 x rrd1 double disrupted strain (TTK176) increased 2.6 times. Each double-disrupted strain was found to be more active than a single disrupted strain. From the above, it has been found that the combination of genes encoding proteins with different intracellular localization and functions contributes to high production of foreign proteins.

Effect of high cellulase production by double disruption of RAV1 gene and VPS3
The VPS3 gene and RAV1 gene are genes that encode proteins that work at similar sites of action, but in order to investigate whether a higher production effect can be obtained even if these genes are double disrupted, the vps3 disruption strain The rav1 gene was disrupted to produce a double disrupted strain. The method for producing the double disruption strain was performed according to the method of Example 15. The double disruption strain of rav1 and vps3 was named TTK179. Ctcel8A was introduced into the produced double disruption strain in the same manner as in Example 15. Confirmation of chromosome introduction was performed in the same manner as in Example 15. BY4741 (reference strain) into which Ctcel8A had been introduced, rav1 disrupted strain, vps3 disrupted strain, rav1 x vps3 double disrupted strain, and similar strains into which Ctcel8A had not been introduced were each cultured at 30 ° C. for 24 hours. The culture solution was centrifuged and divided into a culture supernatant and cells. Quantification of activity by CMC degradation was performed using the TZ method described in Example 15. The results are shown in FIG.

  As shown in FIG. 36, the activity of the rav1 and vps3 disrupted strains increased by 2.5 times and 3.5 times that of BY4741 (reference strain), whereas the rav1 x vps3 double disrupted strain compared with BY4741 (reference strain). The activity increased by 4.9 times. From the above results, it was found that a combination of genes encoding rav1 protein and vps3 protein working at close or similar action sites in cells contributes to high production of foreign proteins.

Effect of high cellulase production by double disruption with RPL19B gene
The RPL19B gene is one of the components of the ribosome necessary for protein translation (Song JM, Cheung E., Rabinowitz JC, Organization and characterization of the two yeast ribosomal protein YL19 genes., Curr Genet. 1996 Sep; 30 (4 ): 273-8.
). Although Ctcel8A could be produced at high levels by disruption of the RPL19B gene, in order to investigate the effects of high production by double disruption of ribosome components and other functions, genes that can produce four Ctcel8A (dyn3, gcn5, opi3, opi3, ykl118w) was selected. The DYN3 gene is a gene involved in nuclear distribution (Lee WL, Kaiser MA, Cooper JA., The offloading model for dynein function: differential function of motor subunits., J Cell Biol. 2005 Jan 17; 168 (2): 201- 7), GCN5 gene, histone acetyltransferase (Brownell JE, Zhou J, Ranalli T, Kobayashi R, Edmondson DG, Roth SY, Allis CD, Tetrahymena histone acetyltransferase A:. a homolog to yeast Gcn5p linking histone acetylation to gene activation. 1996 Mar 22; 84 (6): 843-51.) And the OPI3 gene is a phospholipid methyltransferase (McGraw P, Henry SA., Mutations in the Saccharomyces cerevisiae opi3 gene: effects on phospholipid methylation, Growth and cross-pathway regulation of inositol synthesis., Genetics. 1989 Jun; 122 (2): 317-30), YKL118W gene is unknown function and part of the gene is vacuolar H + -ATPase (V-ATPase) It overlaps with the VPH2 gene. Although the six genes function in a completely different manner from the translation function of RPL19B, double disruption strains with these genes were prepared as follows.

The DNA fragment of rpl18b :: MET17 was boiled at 98 ° C for 30 seconds with the following primers and KOD-Plus using the pEG-MET17 plasmid DNA described in Example 14 as a template, then at 98 ° C for 10 seconds at 60 ° C. The synthesis was carried out by repeating PCR reaction by repeating 35 cycles of 2 minutes and 2 minutes at 72 ° C.
RPL19B-MET17F: (ATACTTTCAATTCTTGAGTTGTAAGGCTGCATCCCTCCGTAGAACAAACCAGAGAGCCGAGCTTAGTAATCACGTGAAGCTGTCGATATTGGGGAACTGT) (SEQ ID NO: 106)
RPL19B-MET17R: (AGAAATTCAGTACAAAAAATATCGTTACATCTTATTTCCCCCTATAGCAGCAAATCAATTCACTCCTGGGTACGAGTCACGACATGTAACAAGGGAAAAA) (SEQ ID NO: 107)

In the same manner as in Example 15, the rpl19b :: MET17 disrupted DNA fragment synthesized by PCR in BY4741 strain was transformed to obtain colonies. In order to confirm whether or not the gene was disrupted, a PCR reaction was performed in the same manner as in Example 15 of colonies grown using the following primers, and it was confirmed that the target DNA fragment was obtained. The respective strains were named TTK309 (dyn3Δrpl19bΔ :: MET17), TTK310 (ykl118wΔrpl19bΔ :: MET17), TTK311 (opi3Δrpl19bΔ :: MET17), and TTK312 (gcn5Δrpl19bΔ: MET17). In order to introduce Ctcel8A into each chromosome, Ctcel8A was inserted into the chromosome in the same manner as in Example 15.
MET17 + 1F:
(ATGCCATCTCATTTCGATACTGTTCAACTA) (SEQ ID NO: 108)
RPL19B + 1530R:
(ATGTAGATAAGCTATCATAAACTGGTAGTG) (SEQ ID NO: 109)

  Each strain was cultured in YPD medium for 24 hours and divided into cells and culture supernatant. Using the TZ method described in Example 15, the activity of the cell supernatant was measured for CMC degradation activity. The results are shown in FIG. As shown in FIG. 37, the double disruption with rpl19b showed a higher activity in the rpl19b x opi3 double disruption strain than in the opi3 disruption strain, but was almost the same activity as the rpl19b disruption strain. The rpl19b x dyn3 double disruption strain and the rpl19b x ykl118w double disruption strain were as active as the dyn3 and ykl118w disruption strains alone. In addition, the rpl19b x gcn5 double disruption strain was less active than the gcn5 single disruption strain.

As described above, there were strains in which the activity did not change even when the gene was double disrupted and strains in which the activity decreased. Intracellular localization of the 55 genes obtained was examined using the Saccharomycees cerevisiae genome database (http://www.yeastgenome.org/) (FIG. 38). When proteins are secreted outside the cell, they pass through the rough endoplasmic reticulum and the Golgi apparatus. In addition, abnormal proteins such as proteins that are not correctly folded are degraded in vacuoles via protein transport from the Golgi apparatus to the endosome. RAV1 located in the endosome and FAR8 gene located in the rough endoplasmic reticulum, and double disruption of VPS3 involved in the transport of vacuolar proteins increased CMC degradation activity. This indicates that double disruption of genes involved in protein transport pathways has a higher production effect. In particular, it is localized in rough endoplasmic reticulum and Golgi apparatus (ARV1, CHO2, CSG2, ERG6, FAR8, OPI3, PER1, SAC1), endosome, etc., mainly from Golgi apparatus to endosome and vacuole. The genes related to transport (ERG3, MON2, RAV1, SNF7, SNF8, VPS3, VPS4, VPS16, VPS25, VPS27, VPS28, VPS36, VPS45, YPT7) were considered to be most effective.

SEQ ID NOs: 1-109: Primers

Claims (20)

  DNA encoding one or more foreign proteins is retained on the chromosome, and the following genes of the host: ADA2, ADE5, 7, ARV1, BUD23, BUR2, CHO2, CSG2, DYN3, ERG3, ERG6, FAR8 , FYV6, GCN5, GDH1, GND1, HMO1, MMM1, MON2, NBP2, NPR2, OPI3, OPI9, PER1, RAV1, RMD11, RPL13B, RPL19B, RPL36A, RPS6A, RRD1, RSA1, SAC1, SFP1, SNF7S1 , VMA7, VPS16, VPS25, VPS27, VPS28, VPS3, VPS36, VPS4, VPS41, VPS45, VRP1, YDR065W, YKL118W, YNL120C, YNL228W, YOL138C, YOR331C, YPT7 and ZUO1 A yeast transformant in which the above genes are inactivated.   The yeast transformant according to claim 1, wherein the foreign protein is a secreted protein.   The yeast transformant according to claim 1 or 2, which is used for producing the exogenous protein by liquid culture.   The yeast transformant according to any one of claims 1 to 3, wherein the exogenous protein is one or more selected from cellulases.   The inactivated gene is one or two selected from the group consisting of DYN3, GCN5, OPI3, PER1, RPL13B, RPL19B, RPL36A, SNF7, VMA7, VPS3, VPS4, VPS16, VPS27, YKL118W and YOL138C The yeast transformant in any one of Claims 1-4 containing the above.   The inactivated gene is one or more selected from the group consisting of DYN3, GCN5, OPI3, PER1, RPL13B, RPL19B, RPL36A, VMA7, VPS3, VPS4, VPS16, VPS27, YKL118W and YOL138C The yeast transformant in any one of Claims 1-5 containing this.   The inactivated gene includes one or more selected from the group consisting of DYN3, GCN5, OPI3, PER1, RPL13B, RPL19B, VPS3, YKL118W and YOL138C. A yeast transformant according to claim 1.   The inactivated genes are ARV1, CHO2, CSG2, ERG3, ERG6, FAR8, MON2, OPI3, PER1, RAV1, SAC1, SNF7, SNF8, VPS3, VPS4, VPS16, VPS25, VPS27, VPS28, VPS36, The yeast transformant according to any one of claims 1 to 7, comprising two or more selected from the group consisting of VPS45, YPT7 and RRD1.   The inactivated genes are ARV1, CHO2, CSG2, ERG3, ERG6, FAR8, MON2, OPI3, PER1, RAV1, SAC1, SNF7, SNF8, VPS3, VPS4, VPS16, VPS25, VPS27, VPS28, VPS36, The yeast transformant according to claim 8, comprising two or more selected from the group consisting of VPS45 and YPT7.   The yeast transformant according to claim 8 or 9, wherein the inactivated gene comprises one or more selected from the group consisting of FAR8, RAV1 and VPS3. The yeast transformant according to any one of claims 8 to 10, wherein the inactivated gene includes any combination selected from the following (a) to (c).
(A) RAV1 and FAR8
(B) RAV1 and RRD1
(C) RAV1 and VPS3   The yeast transformant according to any one of claims 1 to 11, wherein the foreign protein is one or more selected from β-glucosidase, cellobiohydrolase and endoglucanase.   The yeast transformant according to any one of claims 1 to 12, wherein the host is Saccharomyces yeast.   The yeast transformant according to any one of claims 1 to 13, wherein the host is Saccharomyces cerevisiae. A vector for expressing a foreign protein in yeast,
The following genes: ADA2, ADE5, 7, ARV1, BUD23, BUR2, CHO2, CSG2, DYN3, ERG3, ERG6, FAR8, FYV6, GCN5, GDH1, GND1, HMO1, MMM1, MON2, NBP2, NPR2, OPI3, OPI9, PER1, RAV1, RMD11, RPL13B, RPL19B, RPL36A, RPS6A, RRD1, RSA1, SAC1, SFP1, SNF7, SNF8, URM1, VMA7, VPS16, VPS25, VPS27, VPS28, VPS3, VPS36, VPS4, VPS41, 45PS A vector for inactivating one or more selected from the group consisting of YDR065W, YKL118W, YNL120C, YNL228W, YOL138C, YOR331C, YPT7 and ZUO1. A host yeast for expressing a foreign protein,
The following genes of the host: ADA2, ADE5, 7, ARV1, BUD23, BUR2, CHO2, CSG2, DYN3, ERG3, ERG6, FAR8, FYV6, GCN5, GDH1, GND1, HMO1, MMM1, MON2, NBP2, NPR2, OPI3, OPI9, PER1, RAV1, RMD11, RPL13B, RPL19B, RPL36A, RPS6A, RRD1, RSA1, SAC1, SFP1, SNF7, SNF8, URM1, VMA7, VPS16, VPS25, VPS27, VPS28, VPS3, VPS36, VPS4, 45PS A host yeast in which one or more selected from the group consisting of VRP1, YDR065W, YKL118W, YNL120C, YNL228W, YOL138C, YOR331C, YPT7 and ZUO1 are inactivated.   The inactivated genes are ARV1, CHO2, CSG2, ERG3, ERG6, FAR8, MON2, OPI3, PER1, RAV1, SAC1, SNF7, SNF8, VPS3, VPS4, VPS16, VPS25, VPS27, VPS28, VPS36, The host yeast according to claim 16, which is two or more selected from the group consisting of VPS45, YPT7 and RRD1. A method for producing a degradation product of a cellulose-containing material,
A step of preparing a yeast transformant according to any one of claims 1 to 9, wherein cellulase is secreted and produced as an exogenous protein;
Culturing the yeast transformant in a liquid medium containing the cellulose-containing material as a carbon source;
A manufacturing method comprising: A method for producing a useful substance from a cellulose-containing material,
Preparing a yeast transformant according to any one of claims 1 to 14, wherein cellulase is secreted and produced as an exogenous protein;
Culturing the yeast transformant in a liquid medium containing the cellulose-containing material as a carbon source to fermentatively produce useful substances;
A manufacturing method comprising: A method for producing a protein comprising:
Preparing a yeast transformant according to any one of claims 1-14;
Culturing with the yeast transformant in a liquid medium containing a cellulose-containing material as a carbon source;
A manufacturing method comprising: