JP2010172225A - Method for deciding or detecting pluripotency or differentiation postency in stem cell on basis of variation of amount of expression of tex19 gene in the stem cell - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To elucidate functions and molecular bases of Tex19, especially functions in spermatogonial stem cell and to utilize the functions in various fields. <P>SOLUTION: The method for deciding or detecting pluripotency or differentiation postency in stem cells is based on the variation in amount of expression of Tex19 gene in the stem cells. The detection marker of spermatogenesis ability in spermatogonial stem cells includes an expression product of Tex19 gene. The Tex19 knockout animal exhibits male sterility. The method for screening a substance for treating male sterility uses the Tex19 knockout animal. The stem cell strain has destroyed Tex19. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to a method for determining or detecting pluripotency or differentiation ability in a stem cell based on a variation in the expression level of the Tex19 gene in a stem cell, a detection marker for spermatogenic ability in a spermatogonial stem cell, comprising an expression product of the Tex19 gene The present invention relates to a Tex19 knockout animal exhibiting male sterility, a method for screening a substance for treating male sterility using the Tex19 knockout animal, a stem cell line in which Tex19 is disrupted, and the like.

  So far, a close relationship between embryonic stem cells (ES) and germline stem cells has been shown. Germ stem cells are tissue stem cells that can spontaneously convert to pluripotent stem cells (Kanatsu-Shinohara et al., 2004). Furthermore, Nanog, Oct3 / 4 (POU domain, class5 transcription factor 1: Pou5f1), a gene belonging to the pluripotent cycle (Pan and Thonpson, 2007; Wang et al., 2006), can also be expressed in the germline. Well known (Chambers et al., 2007; Yoshimizu et al, 1999).

  Tex19 (Testis Expressed gene 19) gene was first identified as a spermatogonia and ovary-specific gene (Non-patent Document 1). Recently, two Tex19 paralogs, Tex19 (Tex19.1) and the RIKEN cDNA 4921530G0 gene (Tex19.2) have been reported in the mouse genome. Tex19.1 is expressed in mouse and human embryonic stem cells (Non-patent Document 2). Furthermore, the expression of the gene is observed in the early developmental stages of the fetus, ie from the 1 cell stage to the blastocyst, and in unfertilized oocytes. Furthermore, the expression profiles of Tex19 gene and Oct3 / 4 have been shown to be very similar. Furthermore, it has been reported that Tex19 knockout mice show male infertility and show abnormalities during meiosis (Non-patent Document 3).

Wang, P. J., McCarrey, J. R., Yang, F. and Page, D. C. (2001). An abundance of X-linked genes expressed in spermatogonia. Nat Genet 27, 422-426. Kuntz, S., Kieffer, E., Bianchetti, L., Lamoureux, N., Fuhrmann, G. and Viville, S. (2008) .Tex19, a mammalian-specific protein with a restricted expression in pluripotent stem cells and germ line. Stem Cells. 26,734-744. Epub 2007. Ollinger R, Childs AJ, Burgess HM, Speed RM, Lundegaard PR, Reynolds N, Gray NK, Cooke HJ, Adams IR. (2008) Deletion of the pluripotency-associated Tex19.1 gene causes activation of endogenous retroviruses and defective spermatogenesis in mice .PLoS Genet. 4, e1000199.

Spermatogenesis is necessary to maintain the species, and Spermatogenial stem cells (SSCs) have been of great interest and have been of great interest to developmental biologists. So far, several genes expressed in SSC have been identified (Buaas et al., 2004; Costoyaetal., 2004; Naughton et al., 2006; Raverotet al., 2005; Yoshida et al., 2004) but the molecular basis of their function in SSCs is not yet understood.

  Therefore, the main object of the present invention is to elucidate the function and molecular basis of Tex19, particularly the function in spermatogonial stem cells, and to contribute to use in various fields.

The present inventor created a Tex19 knockout mouse and elucidated the specific expression and function of the Tex19 gene in adult SSCs. The present invention has been completed based on such new findings.

That is, the present invention relates to the following aspects.
[Aspect 1] A method for determining or detecting the pluripotency or differentiation ability of a stem cell by measuring a change in the expression level of the Tex19 gene in the stem cell.
[Aspect 2] A substance that maintains or inhibits the pluripotency of the stem cell, comprising (1) a step of bringing a test substance into contact with the stem cell, and (2) a step of measuring a change in the expression level of the Tex19 gene in the stem cell Or a method for screening for a substance that increases or inhibits the differentiation ability of the stem cells.
[Aspect 3] The method according to Aspect 1 or 2, wherein the variation in the expression level of the Tex19 gene is measured based on the expression level of mRNA of the gene.
[Aspect 4] The method according to Aspect 1 or 2, wherein the variation in the expression level of the Tex19 gene is determined from a gene expression profile produced based on the HiCEP method.
[Aspect 5] The method according to any one of Aspects 1 to 4, wherein the variation in the expression level of the Tex19 gene is measured by PCR with respect to the expression level of the mRNA of the Tex19 gene.
[Aspect 6] The method according to Aspect 1 or 2, wherein the variation in the expression level of the Tex19 gene is measured based on the expression level of the gene product (protein).
[Aspect 7] The method according to Aspect 6, wherein the expression level of Tex19 protein is measured by Western blotting.
[Aspect 8] The method according to any one of Aspects 1 to 7, wherein the stem cell is a spermatogonial stem cell or an embryonic stem cell.
[Aspect 9] The method according to any one of Aspects 1 to 7, wherein the stem cell is an iPS cell line.
[Aspect 10] A marker for detecting spermatogenesis in spermatogonial stem cells, comprising an expression product of the Tex19 gene.
[Aspect 11] The aspect 10 according to Aspect 10, wherein the expression product of the Tex19 gene is a nucleic acid molecule containing the mRNA, cDNA, or a partial base sequence thereof, or a protein encoded by the gene or a partial polypeptide thereof. Detection marker.
[Aspect 12] A screening kit for use in the screening method according to any one of Aspects 1 to 11, comprising a compound that specifically reacts with an expression product of the Tex19 gene.
[Aspect 13] A Tex19 knockout animal showing male sterility.
[Aspect 14] A Tex19 knockout animal showing spermatogenesis deficiency (abnormal).
[Aspect 15] The Tex19 knockout animal according to Aspect 13 or 14, wherein a β-galactosidase gene is inserted at the Tex19 gene locus.
[Aspect 16] The Tex19 knockout animal according to Aspect 14, which is a Tex19 knockout mouse.
[Aspect 17] (1) A step of administering a test substance to the Tex19 knockout animal according to any one of aspects 12 to 15, and (2) a step of detecting spermatogenesis in the knockout animal. A method of screening for a therapeutic agent for a disease associated with fertility, spermatogenesis dysfunction (abnormality), or spermatogonial stem cell differentiation arrest (decrease).
[Aspect 18] A stem cell line in which Tex19 is disrupted.
[Aspect 19] An ES cell line in which Tex19 is disrupted.
[Aspect 20] A mouse ES cell line in which Tex19 is disrupted.
[Aspect 21] An iPS cell line in which Tex19 is disrupted.

  According to the method of the present invention, Tex19 is expressed in primordial germ cells and stem cells in adult spermatogenesis, and its function is not involved in pluripotency but is involved in differentiation in spermatogonial stem cells, that is, spermatogenesis. It became clear.

(A) shows the relative amounts of Tex19, Oct3 / 4 and Nanog mRNA after removing LIF from the medium in ES cells. (B) The expression of Tex19 detected by in situ hybridization in germ cells is shown below. The size of the scale bar in each photograph is 50 μm. (A) Composition of target destruction of mouse Tex19 is shown. The position of each probe used for Southern hybridization, the recognition site, and the detection area are shown on the other day. ORF indicates the reading frame of Tex19. (B) shows the result of Southern hybridization. Genomic DNA was digested with ApaLI. (C) Genomic typing using the tail of a knockout mouse. (D) shows the results of Western blotting using extracts prepared from testis of 1 week old male mice (Tex19 ^{+ / +} , Tex19 ^+/− and Tex19 ^{− / −} ). (E) Testis size in males of Tex19 knockout mice (8 weeks zero). The average value of the data of various mice is indicated by a horizontal bar in the figure. (F) Results of histology and immunohistochemical analysis of testis of adult Tex19 knockout mice (zero at 1, 8, and 20 weeks) are shown. Spermatogonia, elongated sperm cells, and Sertoli cells are indicated by black arrows, black arrowheads, and white arrows, respectively. The scale bar is 100 μm. (G) shows the results of semi-quantitative PCR analysis of the testis of week 1 and week 0 Tex19 knockout mice. ("NT" is not inspected) (A) shows the results of testicular cell HE staining. (B) shows the results of GFP constitutively expressed under the control of the CAG promoter in testis cells. (C) shows the results of an immunohistological analysis of Sertoli cells with an antibody against GATA1, which is a Sertoli cell marker. (A) shows the results of immunohistochemical analysis in which 8-week-old mouse testis was double-stained using anti-PLAZF antibody and anti-Tex19 antibody. (B) Marker gene expression profile in LacZ positive cells sorted by FACS. The vertical axis represents the relative amount of mRNA “expression (LacZ positive cells) / expression (LacZ negative cells)”. The result of the quantitative RNA analysis using the LacZ positive cell acquired by FACS from the testis of 8-week-old Tex19 ^+/− mouse and Tex19 ^{− / −} mouse is shown. (A) shows the results of Southern blot hybridization analysis of various ES cells. (B) shows the results of expression of Tex19 transcripts in various ES cells by real-time PCR analysis. (C) shows the results of expression of marker transcripts of pluripotent ES cells and differentiated ES cells by real-time PCR analysis. R1: Tex19 ^{+ / +} , No.14: Tex19 ^-/- , No.15: Tex19 ^-/- .

The Tex19 gene is a gene that is specific to mammals such as humans and mice. It is known to be expressed in mouse and human embryonic stem cells and spermatogonia. Incidentally, the base sequences of human and mouse Tex19 genes can be easily obtained from databases of public institutions as GenBank Accession No .: AK093086 and GenBank Accession No. NM_028602, respectively.

  In the method of the present invention, Tex19 is expressed in primordial germ cells and stem cells in adult spermatogenesis, and as a function thereof, the expression level of Tex19 gene in stem cells is based on differentiation in spermatogonial stem cells, that is, spermatogenesis. By measuring the fluctuations in the above, the pluripotency or differentiation ability of the stem cells is determined or detected. The variation (increase or decrease) in the expression level of the gene is semi-quantified by any method known to those skilled in the art based on, for example, the expression level of the mRNA or the protein of the gene at any stage of the gene expression. Can be measured quantitatively or quantitatively.

That is, when the expression level of the Tex19 gene decreases, it is determined that the differentiation ability is lost or decreased.

  Therefore, the expression level of the gene is determined by the HICEP method using primers designed based on such known information, reverse transcription PCR (RT-PCR), real-time RT-PCR, competitive PCR, microarray chip (DNA chip) It can be quantitatively measured by any quantitative method known to those skilled in the art. Alternatively, the cDNA visualized by an appropriate means such as staining after electrophoresis can be detected, or semi-quantitatively measured by Northern blotting. On the other hand, protein expression of the gene can be quantitatively measured, for example, by Western blotting using an antibody against the protein or solid-phase enzyme immunoassay (ELISA).

  “Stem cells” are pluripotent cells that can potentially differentiate into any somatic cell. The type and origin of stem cells used in the various methods of the present invention are not particularly limited, but spermatogonial stem cells derived from mammals such as mice, monkeys, humans, for example, spermatogonial stem cells derived from adult testis, or And embryonic stem cells (ES cells: cells having total differentiation potential that can be individuals).

Furthermore, recombination using one or several genes selected from the gene groups such as Oct3 / 4, Sox2, Nanog, Klp4, and C-Myc, Lin28, etc., or their gene products or appropriate compounds are allowed to act. Thus, an induced pluripotent stem cell (iPS: Induced Pluripotent Stem Cell) obtained by artificially reprogramming somatic cells is also included in the “stem cell” herein.

As a stem cell used in the screening method of the present invention, it is preferable to use an appropriate stem cell line that has already been established and is easily available from the viewpoint of economy and efficiency. In contrast, “somatic cells” mean all types of cells other than germ cells in multicellular organisms.

  The screening method of the present invention comprises a substance that maintains (increases) or inhibits (decreases) stem cell pluripotency or increases (promotes differentiation) or inhibits (decreases) differentiation ability based on the Tex19 function described above. To be screened. Therefore, it can be carried out by any method capable of measuring the variation in the expression level of the Tex19 gene in the stem cells. As an example, a substance that maintains or inhibits the pluripotency of the stem cell, comprising (1) a step of bringing a test substance into contact with the stem cell, and (2) a step of measuring a change in the expression level of the Tex19 gene in the stem cell. Alternatively, a method of screening for a substance that increases or inhibits the differentiation ability of the stem cell can be mentioned.

As a result, when the expression level of the Tex19 gene decreases, the test substance is considered to have an action / function of inhibiting (decreasing) the differentiation ability of the stem cells.

Therefore, the expression product of Tex19 gene is useful as a marker for detecting spermatogenic ability in spermatogonial stem cells. The expression product can be in any form or molecule known to those skilled in the art. For example, the expression product of the gene includes mRNA, cDNA, or a nucleic acid molecule containing a partial base sequence thereof, or a protein encoded by the gene.

The measurement of the expression level of the expression product of the Tex19 gene can be quantitative, semi-quantitative, or qualitative depending on the measurement method and principle. The selection of the substance that varies the expression level can be performed by, for example, comparing with the expression level of the expression product of the Tex19 gene in the absence of the test substance.

For example, mRNA (or cDNA) of the Tex19 gene is determined by various quantifications such as RT-PCR using a primer or probe appropriately designed based on the nucleotide sequence of the gene, real-time reverse transcription PCR (real-time RT-PCR), etc. Amplification and detection can be carried out by methods known to those skilled in the art, such as selective PCR, HiCEP, and various microarray (DNA chip) methods. Detection and identification of nucleic acid molecules amplified by the PCR method can be performed by an appropriate method such as a method for directly determining the base sequence (sequence method) or a combination with electrophoresis. The specific steps of the HiCEP method are described in detail in, for example, WO02 / 48352 and WO2005 / 118791.

The base sequence of the primer or probe preferably has a number of bases that enables specific binding to the template, for example, 15-40 bases, more specifically, about 15-25 bases, Furthermore, it is also important to have a base sequence that does not have a hairpin structure in the primer or that the sense strand and the antisense strand do not anneal with each other. For example, commercially available primer design software such as Oligo ™ (National Bioscience Inc.) can be used.

  The production amount of the protein encoded by the Tex19 gene can be measured by any method known to those skilled in the art. For example, a method using immunostaining such as Western blot using an appropriate antibody and various immunological specific reactions such as EIA, an amino acid sequence analysis method for peptides such as a gas phase sequencer using Edman method, and MALDI -It can detect by mass spectrometry represented by TOF / MS and ESI Q-TOF / MS method.

Among the above methods, a test method for measuring the expression level of the white matter by an antigen-antibody reaction with an antibody specific for the protein, such as Western blotting and enzyme immunoassay such as EIA, is preferable. Such antibodies include those labeled with various labeling substances known to those skilled in the art, such as enzymes, radioisotope fluorescent dyes, and metal atoms.

Therefore, the above antibody should be prepared by an appropriate method known to those skilled in the art using the protein or an appropriate partial polypeptide (peptide fragment) thereof or various derivatives or complexes thereof as an antigenic substance or immunogen. Is possible. For example, in the case of a polyclonal antibody, it can be administered to an appropriate animal such as a mouse, rat, rabbit, goat or chicken and prepared from the antiserum. Alternatively, known methods described in the monoclonal antibody production method (“monoclonal antibody”, Kamei Nagamune, Hiroaki Terada, Yodogawa Shoten, 1990; “Monoclonal Antibody” James W. Goding, third edition, Academic Press, 1996) It is also possible to prepare a monoclonal antibody by a method using cell fusion.

  As cells used for screening, any cells known to those skilled in the art can be used depending on the purpose and the like. However, when a drug used for human treatment is screened, an organ or tissue to be treated It is preferable to use human-derived stem cells derived as target cells.

The kit used in the screening method of the present invention can have an appropriate configuration depending on the measurement object or measurement principle. The kit includes, for example, antibodies specific for the above proteins, various secondary antibodies (labeled antibodies), primers for amplification of the above mRNA (cDNA), DNA chips, and the like for hybridization. A compound that specifically reacts with the expression product of the Tex19 gene, such as a probe (for example, consisting of about 10 to 100 consecutive base sequences) is included. Further, the kit includes other elements or components known to those skilled in the art, such as various reagents, enzymes, buffers, reaction plates (containers), and the like, depending on the configuration and purpose of use. In order to facilitate detection after the PCR reaction, it is preferable that a labeling substance such as an arbitrary fluorescent substance known to those skilled in the art is bound to at least one end of these primers. For example, suitable fluorescent substances include 6-carboxyfluorescein (FAM), 4,7,2 ′, 4 ′, 5 ′, 7′-hexachloro-6-carboxyfluorescein (HEX), NED (Applied Systems Japan) And 6-carboxy-X-rhodamine (Rox).

  The materials, instruments, and devices used for each of the above measurements are readily available to those skilled in the art, and the procedures and conditions for each measurement operation follow or use the manual attached to the instruments and devices to be used. It can set suitably according to other conditions, such as a kind of cell.

In the present inventors, Tex19 knockout animals, particularly Tex19 knockout animals that are homozygotes, have been found that male sterility, spermatogenic dysplasia (abnormal), or spermatogonial stem cell differentiation has stopped (reduced). It was done. An example of such a Tex19 knockout animal is a Tex19 knockout animal in which a β-galactosidase gene is inserted at the Tex19 gene locus as described in Examples. In this knockout animal, cells expressing a β-galactosidase gene instead of the Tex19 gene can be easily selected and collected by sorting LacZ positive cells by flow cytometry.

Furthermore, by using such a Tex19 knockout animal, for example, by administering a test substance to the Tex19 knockout animal, and (2) detecting spermatogenesis in the knockout animal, male sterility, sperm It becomes possible to screen for substances that can be therapeutic agents for diseases associated with dysplasia (abnormality) or spermatogonial stem cell differentiation arrest (decrease).

The present invention also relates to stem cell lines in which Tex19 is disrupted, particularly mouse ES cell lines and iPS cell lines. Each of these stem cells can be prepared by methods known to those skilled in the art. These stem cells have the characteristics that male sterility, spermatogenesis dysfunction (abnormality), or differentiation of spermatogonial stem cells is stopped (reduced) while maintaining pluripotency.

  EXAMPLES Hereinafter, although this invention is demonstrated further in detail based on an Example, these Examples do not limit the technical scope of this invention at all. A person skilled in the art can make many variations and modifications based on the description of the present specification without departing from the technical scope of the present invention.

  The main experimental operation methods used in this example are described below. Unless otherwise noted, each experimental condition and other experimental procedures were performed by appropriate methods known to those skilled in the art.

Real-time PCR
Real-time PCR was performed by a conventional method. Specifically, total RNA was prepared from ES cells using RNeasy mini kit (Qiagen, Hilden, Germany), treated with DNase (Invitrogen /), and single-stranded cDNA was obtained using SuperScript III (Invitrogen, Carlsbad, CA). Synthesis and PCR was performed using Ex taq (Takara Bio, Otsu, Japan). Oligo d (T) 18 primer was used for the reaction. Real-time PCR was performed using SYBER GREEN PCR MASTER MIX (Applied Biosysteems, Foster City, Calif.) Or Quantitect SYBER-PCR kit (Qiagen) and analyzed with ABI PRISM 7700 (Applied Biosysteems). The results for each sample were normalized to the expression level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). PCR conditions were 95.0 ° C. for 10 minutes, 95.0 ° C. for 15 seconds for 50 cycles, 60.0 ° C. for 30 seconds, and 78.0 ° C. for 40 seconds.

The nucleotide sequence of each primer used in this real-time PCR is as follows.
Tex19:
Sense: GAGCAAGAGGTTGCCTGTTC (SEQ ID NO: 1)
Antisense: CCATAACACCCACCACACAA (SEQ ID NO: 2)
Oct3 / 4:
Sense: TCTTTCCACCAGGCCCCCGGCTC (SEQ ID NO: 3)
Antisense: TGCGGGCGGACATGGGGAGATCC (SEQ ID NO: 4)
Nanog:
Sense: TAGGCTTTGGAGACAGTGAG (SEQ ID NO: 5)
Antisense: TCGAGAGTAGCCACCATATC (SEQ ID NO: 6)
Plzf:
Sense: TGTACATGAGGGGCAGATGA (SEQ ID NO: 7)
Antisense: CACGAAATGAAGTGGGTGTG (SEQ ID NO: 8)
Ret:
Sense: ATCCACACCTTCGGACTCAC (SEQ ID NO: 9)
Antisense: AACCCAGTGCTAGTGCCATC (SEQ ID NO: 10)
Ngn3:
Sense: GGCCCATAGATGATGTTCGT (SEQ ID NO: 11)
Antisense: ACACGGGAGACAAGTTGGAG (SEQ ID NO: 12)
Calmegin:
Sense: ACCTGAGGACTGGAGTGACG (SEQ ID NO: 13)
Antisense: TCTGGGTTGGGAATCTTCTG (SEQ ID NO: 14)
Oppo1:
Sense: TCGGCTGGAGCTATTTCATT (SEQ ID NO: 15)
Antisense: GACTCCTGGCTGTTCTCCTG (SEQ ID NO: 16)
Rex1:
Sense: GCAAGGCCAGTCCAGAATAC (SEQ ID NO: 17)
Antisense: CTTCTCGCAGCCATCAAAAG (SEQ ID NO: 18)
Laminin B1:
Sense: AGGCAGTACATTCAGGACCG (SEQ ID NO: 19)
Antisense: GTAGGGCATGAGAACAAGCG (SEQ ID NO: 20)

Genomic typing and in situ hybridization A 385 bp DNA fragment corresponding to nucleotides 1320-1704 of mouse Tex19 gene cDNA (GenBank Accession Ni. NM_028602) was subcloned into pGEMT-Easy vector (Promega, Madison, USA), and DIG Using RNA Labeling Mix (Roche, Basel, Switzerland), two types of sense and antisense RNA primers having the following nucleotide sequences were prepared and used for genome typing. In situ hybridization was performed by a method known to those skilled in the art (Hoshino et al., 1999).

The genotype of the prepared knockout mouse was determined by PCR using the following primers P1 and P2 (wild type allele) and primers P3 and P4 (mutant allele) (FIG. 2, C). Here, P1 to P4 represent primers having the following nucleotide sequences used for genotype determination.
P1 (sense): CTTAGCTGCAGACAGACTTCTTGAC (SEQ ID NO: 21)
P2 (antisense): GTAGCATCTGTGATAAACAGCCTCTC (SEQ ID NO: 22)
P3 (sense): GATTGAACAAGATGGATTGCACGCAGGTTC (SEQ ID NO: 23)
P4 (antisense): CTAAAAGCACTGGTTACTCTCCTAGAGG (SEQ ID NO: 24)

Production of anti-mouse Tex19 antibody
Using MBL (Ina, Japan), rabbits were immunized with a synthetic peptide consisting of amino acids 326 to 351 in the amino acid sequence of mouse Tex19 to obtain antiserum.
Western blotting Extracts prepared from testis of 1-week-old male mice (Tex19 ^{+ / +} , Tex19 ^+/- and Tex19 ^-/- ) were dissolved in lysis buffer (10% glycerol, 5% sodium dodecyl sulfate, 50 mM DTT, 62.5 mM Tris-HCl, pH 6.8) and electrophoresed on 10% SDS-PAGE, after which the protein was transferred electrically to an Immunobilon PVDF membrane (Millipore, Bedford, Mass.). The membrane was washed with Tris buffered saline (TBST) containing 0.1% Tween 20. Membranes were blocked with TBST containing 5% non-fat milk for 1 hour and incubated overnight at 4 ° C. with the above rabbit anti-mouse Tex19 polyclonal antibody as the primary antibody. All primary antibodies were diluted 1000 times with TBST containing 3% bovine serum albumin. After treatment with this primary antibody, the membrane was washed 3 times with TBST and reacted with an anti-rabbit IgG-horseradish peroxidase (HRP) conjugate (DAKO, Glostrup, Denmark) diluted 1000-fold. The reaction with these secondary antibodies was carried out at room temperature for 1 hour. Thereafter, the membrane was washed 3 times with TBST, and the signal was detected using SuperSignal West Dura Extended duration substrate reagent (PIERCE, Rockford, IL). Quantitative measurement was performed using LightCapture (AE-6960, ATTO, Tokyo, Japan).

Histological analysis Testis samples were fixed with Bouin fixative and embedded in paraffin. It was cut into 3 μm sections to remove wax, and stained with hematoxylin and eosin (HE staining).

Immunohistochemical analysis In immunohistochemical analysis, testis samples were fixed overnight with 4% paraformaldehyde at 4 ° C, embedded in OCT compound (Sakura Finetek, Tokyo, Japan), and cryostat microme was used. Cut into 10 μm sections. As primary antibodies, anti-GATA1 antibody (Santa Cruz, Heidelberg, Germany), anti-PLZF antibody (Santa Cruz, Heidelberg, Germany) and the above anti-Tex19 antibody were used at a concentration of 2 μg / ml. For the detection of each of the above antibodies, Alexa Fluor 488 anti-rat, Alexa Fluor 488 anti-mouse, and Alexa Fluor 594 anti-rabbit (Molecular Probes) were used at a 500-fold dilution.

RT-PCR analysis
Single-strand cDNA synthesis and PCR were performed using Superscript III (Invitroge) and Ex taq (Takara Bio Otsu, Japan), respectively. PCR products at different numbers of cycles of 26, 30, 34 and 38 were loaded on a 2.0% agarose gel so that the reaction in log phase could be analyzed. The nucleotide sequences of the primers used for PCR of each gene are the same as those used for the above real-time PCR. For the GDNF gene, the following primers were used.

GDNF sense: GACTGGGAAGTGGAGCTACG (SEQ ID NO: 25)
GDNF antisense: TGCTGAGTTCTCCAGGGATT (SEQ ID NO: 26)

Flow cytometric analysis Testicular cells were digested with 1 mg / ml collagenase (type IV, Sigma, St. Louis, MO) for 15 minutes and digested with 0.25% trypsin / 0.04% EDTA at 37 ° C. for 10 minutes from individual cells. A suspension was prepared. Lac-Z positive cells were sorted using FluoRecepter LAcZ Flow Cytometry Kit (Invitrogen) and FACSAria (BD, Franklin Lakes, NJ).

Transcriptome analysis was performed using the HiCEP method (Fukumura et al., 2003). Here, the HiCEP method is a gene expression profiling method developed based on restriction enzyme DNA fragment length polymorphism (RFLP) and polymerase chain reaction (PCR), and data on migration distance and peak obtained from electrophoresis of PCR products. To obtain a gene expression profile consisting of information on gene expression patterns in specific cells under certain conditions, presence / absence of expression of known and unknown genes, expression level thereof, etc. This is a method for identifying genes. In this HiCEP method, a false positive signal can be reduced to 2% or less. As a result, by using a 4-base recognition restriction enzyme having a high abundance, a very high coverage rate of 80% (total expression transcript) The ratio of observable transcripts can be achieved, and it is also possible to detect expression differences up to 1.2 times.

For the conditions related to the HiCEP method and the equipment used, the descriptions in WO 02/48352 and WO 2005/118791 can be referred to. The obtained gene expression profile can be analyzed using analysis software known to those skilled in the art, for example, GeneScan (registered trademark) (Applied Biosystems Japan). In addition, as long as it has the above basic features, even a method to which further technical improvement or change is added is included in the “HiCEP method” in this specification.

Specifically, single-stranded DNA was synthesized in a 5.0 μl reaction volume using the SuperScript III First Strand Synthesis System (Invitrogen, Carlsbad, Calif.) According to the manufacturer's protocol. 50 mM Biotin-d (T) 18 (0.25 μl), 10 mM dNTP (0.25 μl) and 2 μl RNA solution were carefully mixed and then incubated at 65 ° C. for 5 minutes. Immediately cooled on ice for 3 minutes. 2.5 μl of the buffer mixture described in the manufacturer's manual was added and mixed well, maintained at 50 ° C. for 60 minutes, and then maintained at 85 ° C. for 5 minutes. All these operations were performed in 200 μl test tubes. The reaction step after the synthesis of the single-stranded DNA was performed as described in the above document. As a correction, the magnetic bead technology (Dinabeads M-280 Streptavidin; Veritas, Oslo, Norway) was used in place of the ethanol precipitation process already reported.

Example 1: Expression of Tex19 Undifferentiated ES cells, E14 cells (one of the most widely used ES cell lines in the world for the production of knockout mice. In Dr. M Hooper laboratory of University of Edinburgh TT2 cells (ES cells collected from F1 hybrids of C57BL / 6 mice and CBA mice. Used from GIBCO at that time. Currently available from RIKEN BRC) And leukocyte inhibitory factor (available from Dr. A. Nagy, University of Toronto) from R1 cells (ES cells collected from F1 hybrids of 129X1 / SvJ and 129S1 mice). As a result of excluding (LIF), genes whose expression level was down-regulated were identified by quantitative real-time PCR.
Each cell was first prepared with KO-DMEM (CHEMICON, Temecula, CA) supplemented with 5% KSR (GIBCO), 6 mM L-glutamine, 100 μM 2-mercaptoethanol (2-ME) and 500 units LIF (CHEMICON, Temecula, CA). After culturing in GIBCO, Gaithersburg, MD), LIF was removed from the medium.
As a result, in addition to Oct3 / 4 and Nanog (Chambers et al., 2003; Mitsui et al., 2003; Niwa t al, 2000) as genes with decreased expression levels in all three types of ES cells described above. Tex19 was further identified. The results for TT2 cells are shown in FIG. 1A.
Furthermore, considering that Tex19 is expressed in germ cells (Wang et al., 2001), the above results indicate that the expression profiles of Tex19, Oct3 / 4 and Nanog are very similar. Show.

  Next, Tex19 expression in germ cells was detected by in situ hybridization. As a result, expression of Tex19 was confirmed in a small number of cells in the basement membrane (about 0.1% of all testis cells) from embryonic day 12.5 to adulthood (FIG. 1B). The number of Tex19 positive cells is close to the number of spermatogonia of the A signal (As) type, which is the earliest spermatogonia (Tegelenbosch and de Rooij, 1993), and Tex19 is a progenitor cell and stem cell in adult spermatogenesis. It is suggested that it is expressed.

Example 2 Generation of Tex19 Knockout Mice In order to clarify the function of Tex19 in vivo, Tex19 knockout mice were generated by methods known to those skilled in the art (Nagy et al., 2002). In addition, five independent knockout mouse systems were prepared using three types of Tex19 knockout constructs having the basic structure illustrated in FIG. The experimental design for creating knockout mice was approved by the Animal Use Committee of the National Institute of Radiological Sciences. Two of the five knockout mice obtained ES cells independently from the construct described in this case. Further, knockout mice in which the β-geo part was replaced with EGFP and DsRed2 were prepared in one line and two lines, respectively.

The target disruption of mouse Tex19 gene, leaving only the 46 amino acids at the N-terminus of the reading frame (ORF) of the mouse Tex19 gene consisting of 351 amino acids, almost all of the Tex19 gene was transferred to RIKEN CDB (Kobe, Japan The Tex19 knockout construct was prepared by replacing the IRES (Internal ribosome entry site) -β-geo (β-galactosidase and neomycin resistance encoding gene) cassette (Mountford et al., 1994) provided by Mr. Niwa. The composition is shown in FIG.

The disruption of the Tex19 gene in the prepared knockout mice was confirmed by Southern hybridization.
Southern hybridization of ES cells was performed using a probe having the following nucleotide sequence according to a method known to those skilled in the art (FIG. 2, B).
Probe (SEQ ID NO 27): a agctcagaca ttccccaggg ccctggggac tgtgaagagc aagaggttgc ctgttctgag cagctcaggg gaacagttgg tccaggactt gagggggcat cttgaacatc ctgtgagctt atgaacctca gagggaagtc tggcatgttc gtgtcagtgt tcagtgtttg gtaggtgagg cctagctgta tgtttagctg tatggagtgt tgtgtggtgg gtgttatggg ggctccggtc acagatctac gtatgtatgg actctgaggc actagttgac cttactgtca taggggtcat atgcttactg tcttagggtc aagatacctg attttagggt tcactgtttt tgttgtttta ctttgttcgt tactcgtgct cctt

Furthermore, genome typing was performed using PCR for wild type and knockout mice (FIG. 2, C).

Example 3: Confirmation of the presence or absence of Tex19 expression in Tex19 knockout mice Further, the presence or absence of Tex19 expression in knockout mice was confirmed by Western blotting. As a result, it was confirmed that the expression of Tex19 disappeared in Tex19 ^{− / −} mice (FIG. 2, D).

Example 4: Phenotype of Tex19 Knockout Mice Tex19 knockout mice generated in this way grew to adults with a normal phenotype as shown in Table 1 below, but in all of the strains males were sterile. Met. In Tex19 ^{− / −} knockout mice (8 weeks zero), there was a considerable decrease in testicular size (FIG. 2, E). The above results indicate that Tex19 is not involved in pluripotency but is involved in spermatogenesis.

Example 5: Histological analysis of Tex19 knockout mice From the results of histological analysis, the adult testes of Tex19 knockout mice at 0 weeks and 0 weeks contain many dividing cells, but the number of meiotic cells is It turns out that it is few (FIG. 2, F). Incidentally, a similar phenotype was observed in the 56-week-old mice, the oldest being studied. No particular abnormality was found in Sertoli cells of Tex19 knockout mice.

Furthermore, from the results of semi-quantitative RT-PCR, there was no difference in the expression of “Gdnf”, a spermatogonial stem cell supporting factor secreted from Sertoli cells, between Tex19 ^{− / −} mice and normal mice. On the other hand, the expression of Oppo1 gene, which is a differentiation marker, is not observed at all, and the expression level of Calmegin and Haspin genes is decreased, so that differentiation of spermatogonia is stopped at the early stage of development. (Fig. 2, G).

Example 6: Transplantation experiment
In order to confirm the abnormalities observed in the testis of Tex19 ^{− / −} mice, transplantation experiments were conducted. That is, in order to introduce the enhanced green fluorescent protein (EGFP) gene, C57BL / 6-transgenic (GAG-EGFP) mice (Okabe et al., 1997) (SLC, Hamamatsu, Japan) and female Tex19 ^{− / −} mice Were mated. Transplantation was performed by methods known to those skilled in the art (Ogawa et al., 1997). Cells obtained from 5-week-old EGFP transgenic Tex19 ^{− / −} mice obtained as a result of the above mating were used as 8-week-old WBB6F1-W / Wv mice (obtained from Japan SLC, Ogawa et al., 1997). Eight weeks after transplantation, the transplanted mice were killed, and testis cells were examined by fluorescence analysis and flow cytometry analysis.

  Testicular cell HE staining (FIG. 3, A) and GFP fluorescence (FIG. 3, B top) confirmed that GFP-positive tubules were formed in the testes of recipient mice. It was also confirmed that GFP positive cells were scattered along the basement membrane of the seminiferous tubule (FIG. 3, B bottom). Furthermore, as a result of immunohistochemical analysis of Sertoli cells with anti-GATA1 antibody (Yomogida et al., 1994), it was found that disruption of the Tex19 gene does not affect the system supporting spermatogenesis.

Example 7: Localization of Tex19 in SSC Since the above Tex19 knockout mouse had the LacZ gene inserted, LacZ positive cells were detected by flow cytometry. As a result, about 0.4 + 0.09% (n = 4) of testicular cells were positive for LacZ in 8-week-old mice. Since this ratio is similar to the ratio of As cells, this LacZ positive cell is considered to be SSC (Tegelenbosch and de Rooiji, 1993).

  Furthermore, immunohistochemical analysis using anti-Plzf antibody and anti-Tex19 antibody was performed. As a result, in the testis of 8-week-old mice, Tex19 positive cells were also stained with anti-Plzf antibody, and a small number of positive cells were observed in the vicinity of the basement membrane (FIG. 4, A). In contrast, a considerable number of positive cells were observed in the testis of 2-week-old mice.

LacZ positive cells were obtained by FACS from the testis of 8 week old Tex19 ^+/− and Tex19 ^{− / −} mice. As a result of quantitative real-time RNA analysis of the LacZ positive cells thus obtained, it was found that the LacZ positive cells contained a large amount of SSC. That is, as shown in FIG. 4B, the expression of Sz markers Plzf, Ret and Ngn3 is very high, whereas the expression of spermatogenesis markers Calmegin and Oppo1 is hardly seen. (Ikawa et al., 1997; Nakamura et al., 2002; Tanaka et al., 1999).

Example 8: Transcriptome analysis About 500 LacZ positive cells (total RNA amount: about 5 ng) obtained by FACS from testis of 8-week old Tex19 ^+/− mice and Tex19 ^{− / −} mice were used as starting materials. Transcriptome analysis by the HiCEP method was performed. As a result, about 30,000 kinds of transcripts could be detected quantitatively. Listed were those in which a difference of 3 times or more was observed in the expression level between Tex19 ^+/− mice and Tex19 ^{− / −} mice (Table 2). Since the expression of “4921525O09Rik”, which is known to be expressed in normal differentiated testis, is reduced to 1/10 or less in Tex19 ^{− / −} mice compared to Tex19 ^+/− mice, Tex19 ^{− / −} Mouse SSCs were shown to be defective in differentiation potential. On the other hand, the expression of Akt3 and Tnks2 increased three-fold or more in Tex19 ^{− / −} mice, suggesting an abnormality in the Gdnf1 pathway essential for maintaining the pluripotency of SSC.

Example 9: Quantitative RNA analysis Quantitative RNA analysis was performed using LacZ positive cells obtained by FACS from the testis of 8 week old Tex19 ^+/− and Tex19 ^{− / −} mice. As a result, it was found that the expression of stem cell-related genes Plzf, Ret and Ngn3 in SSC was increased in Tex19 ^{− / −} mice compared to Tex19 ^+/− mice (FIG. 5). In addition, no difference was observed in the housekeeping gene group. The above results indicate that Tex19 ^{− / −} mouse SSC cells are immature as compared to Tex19 ^+/− mice.

Furthermore, two Tex19 ^{− / −} ES cell lines were obtained from Tex19 ^+/− ES cells prepared in the production of the Tex19 knockout mouse in Example 2 by a recombination method known to those skilled in the art (Mortensen, et al., 1992). Established. These were used to examine the effect of Tex19 disruption on both alleles. As a result, it was found that the expression of stem cell markers Nanog and Rex1 increased due to the lack of Tex19 (FIG. 6).

In addition, the well-known literature quoted with the number in a parenthesis in this specification is as follows.
Araki, R., Fukumura, R., Sasaki, N., K asama, Y., Suzuki, N., Takahashi, H., Tabata, Y.,
Saito, T. and Abe, M. (2006) .More than 40,000 transcripts, including novel and noncoding transcripts, in mouse embryonic stem cells.Stem Cells 24, 2522-2528.
Braydich-Stolle, L., Kostereva, N., Dym, M. and Hofmann, MC (2007) .Role of Src family kinases and N-Myc in spermatogonial stem cell proliferation.Dev Biol 304, 34-45.
Buaas, FW, Kirsh, AL, Sharma, M., McLean, DJ, Morris, JL, Griswold, MD, de
Rooij, DG and Braun, RE (2004) .Plzf is required in adult male germ cells for stem cell self-renewal. Nat Genet 36, 647-652.
Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S. and Smith, A. (2003). Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells.Cell 113, 643-655.
Chambers, I., Silva, J., Colby, D., Nichols, J., Nijmeijer, B., Robertson, M., Vrana, J., Jones, K., Grotewold, L. and Smith, A. ( 2007) .Nanog safeguards pluripotency and mediates germline development.Nature 450, 1230-1234.
Costoya, JA, Hobbs, RM, Barna, M., Cattoretti, G., Manova, K., Sukhwani, M., Orwig, KE, Wolgemuth, DJ and Pandolfi, PP (2004). Essential role of Plzf in maintenance of spermatogonial stem cells. Nat Genet 36, 653-659.
Fukumura, R., Takahashi, H., Saito, T., Tsutsumi, Y., Fujimori, A., Sato, S., Tatsumi, K.,
Araki, R. and Abe, M. (2003) .A sensitive transcriptome analysis method that can detect unknown transcripts.Nucleic Acids Res 31, e94.
Hoshino, M., Sone, M., Fukata, M., Kuroda, S., Kaibuchi, K., Nabeshima, Y. and H ama, C.
(1999). Identification of the stef gene that encodes a novel guanine nucleotide exchange factor specific for Rac1. J Biol Chem 274, 17837-17844.
Ikawa, M., Wada, I., Kominami, K., Watanabe, D., Toshimori, K., Nishimune, Y. and Okabe, M. (1 997). The putative chaperone calmegin is required for sperm fertility. Nature 387,
607-61 1.
Kanatsu-Shinohara, M., Inoue, K., Lee, J., Yoshimoto, M., Ogonuki, N., Miki, H., Baba, S.,
Kato, T., Kazuki, Y., Toyokuni, S. et al. (2004). Generation of pluripotent stem cells from neonatal mouse testis.Cell 11 9, 1 001-1 01 2.
Kuntz, S., Kieffer, E., Bianchetti, L., Lamoureux, N., Fuhrmann, G. and Viville, S. (2008).
Tex1 9, a mammalian-specific protein with a restricted expression in pluripotent stem cells and germ line.Stem Cells 26, 734-744.
Lee, J., Kanatsu-Shinohara, M., Inoue, K., Ogonuki, N., Miki, H., Toyokuni, S., Kimura, T., Nakano, T., Ogura, A. and Shinohara, T (2007). Akt mediates self-renewal division of mouse spermatogonial stem cells. Development 134, 1853-1 859.
Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K., Maruyama, M., Maeda, M. and Yamanaka, S. (2003). The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells.Cell 113, 631-642.
Mortensen, RM, Conner, DA, Chao, S., Geisterfer-Lowrance, AA and Seidman, JG
(1992). Production of homozygous mutant ES cells with a single targeting construct. Mol
Cell Biol 12, 2391-2395.
Mountford, P., Zevnik, B., Duwel, A., Nichols, J., Li, M., Dani, C., Robertson, M., Chambers, I. and Smith, A. (1994). Dicistronic targeting constructs: reporters and modifiers of mammalian gene expression.Proc Natl Acad Sci USA 91, 4303-4307.
Nagy, A., Gertsenstein, M., Vintersten, K. and Behringer, R. (2002). Manipulating the Mouse Embryo A Laboratory Manual 3rd edn. New York: Cold Spring Harbor Laboratory Press.
Nakamura, Y., Tanaka, H., Koga, M., Miyagawa, Y., Iguchi, N., Egydio de Carvalho, C.,
Yomogida, K., Nozaki, M., Nojima, H., Matsumiya, K. et al. (2002). Molecular cloning and characterization of oppo 1: a haploid germ cell-specific complementary DNA encoding sperm tail protein. Biol Reprod 67 , 1-7.
Naughton, CK, Jain, S., Strickland, AM, Gupta, A. and Milbrandt, J. (2006) .Glial cell-line derived neurotrophic factor-mediated RET signaling regulates spermatogonial stem cell fate.Biol Reprod 74, 31 4- 321.
Niwa, H., Miyazaki, J. and Smith, AG (2000) .Quantitative expression of Oct-3 / 4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 24, 372-376.
Ogawa, T., Arechaga, JM, Avarbock, MR and Brinster, RL (1997) .Transplantation of testis germinal cells into mouse seminiferous tubules. Int J Dev Biol 41, 111-122.
Okabe, M., Ikawa, M., Kominami, K., Nakanishi, T. and Nishimune, Y. (1997). 'Green mice' as a source of ubiquitous green cells.FEBS Lett 407, 313-319.
Pan, G. and Thomson, JA (2007) .Nanog and transcriptional networks in embryonic stem cell pluripotency.Cell Res 17, 42-49.
Raverot, G., Weiss, J., Park, SY, Hurley, L. and Jameson, JL (2005) .Sox3 expression in undifferentiated spermatogonia is required for the progression of spermatogenesis. Dev Biol 283, 21 5-225.
Suzuki, S., Ono, R., Narita, T., Pask, AJ, Shaw, G., Wang, C., Kohda, T., Alsop, AE,
Marshall Graves, JA, Kohara, Y. et al. (2007). Retrotransposon silencing by DNA methylation can drive mammalian genomic imprinting.PLoS Genet 3, e55.
Tanaka, H., Yoshimura, Y., Nozaki, M., Yomogida, K., Tsuchida, J., Tosaka, Y., Habu, T.,
Nakanishi, T., Okada, M., Nojima, H. et al. (1 999) .Identification and characterization of a haploid germ cell-specific nuclear protein kinase (Haspin) in spermatid nuclei and its effects on somatic cells.J Biol Chem 274, 17049-17057.
Tegelenbosch, RA and de Rooij, DG (1993) .A quantitative study of spermatogonial multiplication and stem cell renewal in the C3H / 101 F1 hybrid mouse.Mutat Res 290,
1 93-200.
Wang, J., Rao, S., Chu, J., Shen, X., Levasseur, DN, Theunissen, TW and Orkin, SH
(2006) .A protein interaction network for pluripotency of embryonic stem cells.Nature 444, 364-368.
Wang, PJ, McCarrey, JR, Yang, F. and Page, DC (2001). An abundance of X-linked genes expressed in spermatogonia. Nat Genet 27, 422-426.
Yomogida, K., Ohtani, H., Harigae, H., Ito, E., Nishimune, Y., Engel, JD and Yamamoto, M. (1 994). Developmental stage- and spermatogenic cycle-specific expression of transcription factor GATA -1 in mouse Sertoli cells.Development 120, 1 759-1 766.
Yoshida, S., Takakura, A., Ohbo, K., Abe, K., Wakabayashi, J., Yamamoto, M., Suda, T. and Nabeshima, Y. (2004). Neurogenin3 delineates the earliest stages of spermatogenesis in the mouse testis.Dev Biol 269, 447-458.
Yoshimizu, T., Sugiyama, N., De Felice, M., Yeom, YI, Ohbo, K., Masuko, K., Obinata, M., Abe, K., Scholer, HR and Matsui, Y. (1999 ). Germline-specific expression of the Oct-4 / green fluorescent protein (GFP) transgene in mice.Dev Growth Differ 41, 675-684.
Mortensen, RM, Conner, DA, Chao, S., Geisterfer-Lowrance, AA, and Seidman, JG (1992) .Production of homozygous mutant ES cells with a single targeting construct.Mole Cell Biol 12, 2391-2395.

  From the results of the present invention, it is considered that the Tex19 gene product functions as a mediator of differentiation in stem cells and suppresses genes necessary for maintaining stem cells (pluripotency). Therefore, it is expected that research on the function of the Tex19 gene will greatly help elucidate the function of maintaining pluripotency and differentiation in stem cells.

Claims (15)

A method for determining or detecting the pluripotency or differentiation potential of a stem cell by measuring a change in the expression level of the Tex19 gene in the stem cell. A substance that maintains or inhibits the pluripotency of the stem cell, comprising: (1) contacting a test substance with the stem cell; and (2) measuring a change in the expression level of the Tex19 gene in the stem cell, or A method for screening for a substance that increases or inhibits the differentiation potential of stem cells. The method according to claim 1 or 2, wherein the variation in the expression level of the Tex19 gene is measured based on the expression level of mRNA of the gene. The method according to claim 1 or 2, wherein the variation in the expression level of the Tex19 gene is determined from a gene expression profile produced based on the HiCEP method. The method according to any one of claims 1 to 4, wherein the variation in the expression level of the Tex19 gene is measured by PCR with respect to the expression level of the mRNA of the Tex19 gene. The method according to claim 1 or 2, wherein the variation in the expression level of the Tex19 gene is measured based on the expression level of the gene product (protein). The method according to claim 6, wherein the expression level of Tex19 protein is measured by Western blotting. The method according to any one of claims 1 to 7, wherein the stem cell is a spermatogonial stem cell. 9. The method according to claim 8, wherein the spermatogonial stem cell is derived from an adult testis. The method according to any one of claims 1 to 7, wherein the stem cell is an embryonic stem cell. The method according to any one of claims 1 to 7, wherein the stem cell is an iPS cell. A detection marker for the ability to form spermatozoa in spermatogonial stem cells, comprising an expression product of the Tex19 gene. The detection marker according to claim 12, wherein the expression product of the Tex19 gene is a nucleic acid molecule containing mRNA, cDNA, or a partial base sequence thereof, or a protein encoded by the gene or a partial polypeptide thereof. It is a screening kit used for the screening method as described in any one of Claims 1-11, Comprising: This kit containing the compound which reacts specifically with the expression product of Tex19 gene. (1) administering a test substance to a Tex19 knockout animal, and (2) detecting spermatogenesis in the knockout animal, male sterility, spermatogenesis dysplasia (abnormal), or spermatogonial stem cell differentiation arrest A method of screening a substance that can be a therapeutic agent for a disease associated with (decrease).