JP2010161960A - Method for producing artificial pluripotent stem cell - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for producing an artificial pluripotent stem cell from a body cell by which the carcinogenicity of the body cell differentiated and induced from the produced artificial pluripotent stem cell can be reduced. <P>SOLUTION: The method for producing the artificial pluripotent stem cell from the body cell includes: (a) a step for introducing at least one or more kinds of initialized genes into the body cell; and (b) a step for removing the whole or at least one or more kinds of the introduced initialized genes, and selecting the cells from which the whole or at least one or more kinds of the initialized genes introduced into the body cells are removed, from the cells from which the initialized genes introduced to the body cells are not removed. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to a method for producing induced pluripotent stem cells. More specifically, the present invention relates to a method for producing induced pluripotent stem cells that can reduce the carcinogenicity of somatic cells differentiated from the produced induced pluripotent stem cells.

  Embryonic Stem cells (ES cells) are stem cell lines made from embryos in the early stages of animal development and proliferate over a long period of time while maintaining the pluripotency that can differentiate into all tissues in vitro. Therefore, application to regenerative medicine is expected. In order to apply ES cells to regenerative medicine, it is necessary to differentiate ES cells into specific cells. Currently, methods for differentiating into neural cells, cardiomyocytes, pancreatic β cells, and the like are being developed. In this way, regenerative medicine is performed by transplanting specific cells differentiated from ES cells into a living body.

  However, transplantation of ES cells has a problem of rejection as with organ transplantation. In addition, in order to establish ES cells, an early embryo at a stage up to a fertilized egg or blastocyst is required, and thus there is an ethical problem of loss of life.

  On the other hand, an induced pluripotent stem cell (induced pluripotent stem cell; iPS cell) is a pluripotent cell obtained by reprogramming somatic cells. Artificial pluripotent stem cells are produced by a group of Prof. Shinya Yamanaka at Kyoto University, a group of Rudolf Jaenisch et al. At Massachusetts Institute of Technology, a group of James Thomson et al. At University of Wisconsin, Harvard University Several groups have been successful, including the group by Konrad Hochedlinger et al. Artificial pluripotent stem cells are highly expected as ideal pluripotent cells without rejection and ethical problems.

  For example, International Publication No. WO 2007/069666 discloses somatic cell nuclear reprogramming factors including Oct family genes, Klf family genes, and Myc family gene gene products, as well as Oct family genes, Klf family genes, Sox family genes and A somatic cell nuclear reprogramming factor containing a gene product of a Myc family gene is described, and further, a pluripotent stem cell induced by somatic cell nuclear reprogramming, comprising a step of contacting the nuclear reprogramming factor with the somatic cell. A method of manufacturing is described.

  In the preparation of general induced pluripotent stem cells that have been reported so far, a reprogramming factor gene is introduced into a somatic cell by a retroviral vector or the like, and a transgene fragment is randomly inserted into the chromosome. In the conventional method, the reprogramming factor gene remains in the genome of the prepared induced pluripotent stem cell. Among reprogramming factors, c-Myc, in particular, is known to have a powerful action that causes canceration of cells when overexpressed. In fact, it has been reported that in a chimeric mouse derived from a mouse induced pluripotent stem cell, cancer was observed when the introduced c-Myc gene was reactivated and expressed. Thus, in differentiated cells generated from induced pluripotent stem cells, the introduced reprogramming gene may be re-expressed, and the cells may become cancerous. Development of a technique for producing induced pluripotent stem cells that do not have reprogramming genes and have a low possibility of canceration is required.

  In addition, WO2008 / 124133 describes a method for reprogramming somatic cells. For example, in claim 48, at least one kind of exogenously introduced somatic cells are reprogrammed to be in an ES-like state. A method for producing an initialized somatic cell comprising the steps of: preparing a somatic cell comprising the generated gene; and functionally inactivating at least one of the exogenously introduced genes. ing. Also, on page 46 of WO 2008/124133, “functionally inactivated also intends to include removal or clipping of the introduced polynucleotide. In some embodiments, at least one or more of the introduced polynucleotides. In part, the site for the site-specific recombinase is adjacent, and the introduced polynucleotide can be functionally inactivated by expressing the recombinase in the cell or introducing the recombinase into the cell. The resulting reprogrammed somatic cells may lack either exogenously introduced coding sequences and / or regulatory elements. " That is, although WO 2008/124133 suggests that site-specific recombinase is used as a method for removing the introduced reprogramming gene, it is necessary to select cells from which the gene encoding the reprogramming factor has been removed. And there is no description of such a selection method.

International Publication No. WO2007 / 069666 International Publication WO2008 / 124133

  The present invention provides a method for producing induced pluripotent stem cells from somatic cells, which provides a method capable of reducing the carcinogenicity of somatic cells induced to differentiate from the produced induced pluripotent stem cells. It was a problem to be solved. That is, an object of the present invention is to provide a method for producing an induced pluripotent stem cell that does not have a reprogramming factor gene and has a low possibility of canceration. Furthermore, the present invention provides an induced pluripotent system comprising an induced pluripotent stem cell produced by a method for producing an induced pluripotent stem cell from the above-described somatic cell; and a method for producing an induced pluripotent stem cell from the aforementioned somatic cell A method for producing a somatic cell induced to differentiate from a stem cell; a somatic cell derived from an induced pluripotent stem cell produced by the above method; and a tissue containing a somatic cell derived from the induced pluripotent stem cell. Or, providing an organ was a problem to be solved.

  As a result of intensive studies to solve the above problems, the present inventor has introduced at least one or more types of reprogramming genes into somatic cells to initialize the somatic cells, and then has been introduced into the somatic cells. All or all of them are removed, and all the reprogramming genes introduced into somatic cells or at least one of them are removed from the reprogramming genes introduced into somatic cells. It has been found that by selecting from untreated cells, it is possible to produce induced pluripotent stem cells with reduced risk of carcinogenesis from somatic cells, and the present invention has been completed.

That is, according to the present invention, the following inventions are provided.
(1) A method for producing induced pluripotent stem cells from somatic cells, comprising the following steps.
(A) introducing at least one or more reprogramming genes into somatic cells; and (b) removing all or at least one of the reprogramming genes introduced into somatic cells and introducing them into somatic cells. A step of selecting cells from which all of the reprogramming genes or at least one of them have been removed from cells from which the reprogramming genes introduced into somatic cells have not been removed.

(2) The method according to (1), wherein the reprogramming gene introduced into the somatic cell in step (a) includes at least the Myc gene.
(3) The method according to (1) or (2), wherein the reprogramming genes introduced into somatic cells in step (a) are an Oct gene, a Klf gene, a Sox gene, and a Myc gene.
(4) The reprogramming gene introduced into the somatic cell in the step (a) is an Oct3 / 4 gene, a Klf4 gene, a Sox2 gene, and a c-Myc gene, according to any one of (1) to (3) the method of.

(5) The method according to any one of (1) to (4), wherein in the step (a), the reprogramming gene is integrated into a somatic cell chromosome.
(6) The method according to any one of (1) to (5), wherein in the step (a), the reprogramming gene is introduced into a somatic cell using a lentiviral vector.

(7) The method according to any one of (1) to (6), wherein the reprogramming gene removed in step (b) is one or more genes including at least the Myc gene.
(8) A DNA recombination enzyme recognition sequence is added to both ends of the reprogramming gene to be removed, and after introducing the reprogramming gene into somatic cells in step (a), The method according to any one of (1) to (7), wherein the reprogramming enzyme is used to remove the introduced reprogramming gene.
(9) In step (b), the reprogramming gene introduced into the somatic cell is removed from the cell from which all or at least one of the reprogramming genes introduced into the somatic cell has been removed by drug selection. The method according to any one of (1) to (8), wherein the cells are selected from cells that are not.

(10) In step (b), an expression vector that simultaneously expresses the DNA recombination enzyme and the drug resistance gene is introduced into the somatic cell, and the DNA recombination enzyme and the drug resistance gene are expressed in the somatic cell. Based on the action of the expression of the drug resistance gene by removing all or at least one of the reprogramming genes introduced into the somatic cell by the action of, and culturing the somatic cell in the presence of the drug. Selecting cells from which all or at least one of the reprogramming genes introduced into the somatic cell has been removed from cells from which the reprogramming gene introduced into the somatic cell has not been removed; The method according to any one of (9).

(11) The expression vector which simultaneously expresses a DNA recombinant enzyme and a drug resistance gene is an expression vector comprising a DNA recombinant enzyme gene, an IRES (internal ribosomal entry site) and a drug resistance gene. Method.
(12) The method according to (11), wherein the DNA recombinase gene is a Cre gene and the drug resistance gene is a neomycin resistance gene.

(13) A method for producing induced pluripotent stem cells from somatic cells, comprising the following steps.
(A) introducing Oct3 / 4 gene, Klf4 gene, Sox2 gene, and c-Myc gene (where Lox sequences are added to both ends of each gene) into somatic cells; and (b) step ( By introducing an expression vector containing a Cre gene, an IRES (internal ribosomal entry site) and a drug resistance gene into the somatic cell of a), and culturing in the presence of the drug, the action of Cre causes the step (a). A gene in which all or part of the introduced gene is removed and all or part of the gene introduced in step (a) is removed by the action of Cre is introduced into a somatic cell. Sorting from cells that have not been removed.

(14) The method according to any one of (1) to (13), wherein the somatic cell is a mammalian somatic cell.
(15) The method according to any one of (1) to (14), wherein the somatic cell is a human somatic cell.
(16) An induced pluripotent stem cell obtainable by the method according to any one of (1) to (15).
(17) A method for producing a somatic cell induced to differentiate from an induced pluripotent stem cell, comprising the following steps.
(A) a step of producing an induced pluripotent stem cell by the method according to any one of (1) to (15); and (b) a step of inducing differentiation of the induced pluripotent stem cell obtained in step (a). .

(18) A somatic cell differentiated from an induced pluripotent stem cell, which can be obtained by the method according to (17).
(19) A tissue or organ comprising the population of somatic cells according to (18).

  The induced pluripotent stem cells provided by the present invention can induce differentiation into any tissue or organ constituting the body, and can produce a tissue or organ for transplantation without rejection. . Further, in the present invention, since an early embryo is not used as in the case of ES cells, it can be applied to regenerative medicine without facing ethical problems. In particular, the induced pluripotent stem cells produced according to the present invention do not have the reprogramming gene introduced from the outside, and thus have the advantage that the possibility that the differentiated cells become cancerous is very low, A safer induced pluripotent stem cell can be provided. In addition, various cells (for example, cardiomyocytes, hepatocytes, etc.) obtained by differentiating the induced pluripotent stem cells of the present invention can be used as a system for evaluating the efficacy and toxicity of various drugs and poisons. it can.

FIG. 1 shows selection and separation of iPS cells from which a reprogramming gene has been removed using Cre-IRES-NeoR. FIG. 2 shows a method for producing human iPS cells from which the introduced reprogramming gene has been removed. FIG. 3 shows a phase contrast microscopic image of established human iPS cells. FIG. 4 shows detection of the introduced c-Myc gene by PCR. Lanes 1-6: iPS cell clones isolated after introducing the Cre gene by the first method. Lanes 7-10: iPS cell clones isolated after introducing the Cre gene by the second method. Lane 11: iPS cell clone before Cre gene introduction. FIG. 5 shows detection of the introduced Sox2 gene by PCR. Lane 1: iPS cell clone before Cre gene introduction. Lanes 2, 3, 4, 11: iPS cell clones isolated after introduction of Cre gene by the second method. Lane 5-10: iPS cell clone isolated after Cre gene was introduced by the first method.

Hereinafter, the present invention will be described in more detail.
The method for producing induced pluripotent stem cells from somatic cells according to the present invention comprises the following steps.
(A) introducing at least one or more reprogramming genes into somatic cells; and (b) removing all or at least one of the reprogramming genes introduced into somatic cells and introducing them into somatic cells. A step of selecting cells from which all of the reprogramming genes or at least one of them have been removed from cells from which the reprogramming genes introduced into somatic cells have not been removed.

  According to a preferred embodiment of the present invention, somatic cells are initialized by introducing a reprogramming factor gene to which a sequence-specific DNA recombinase recognition sequence has been added. After completion of somatic cell initialization, by introducing a sequence-specific DNA recombinase expression vector in which the structural gene of the sequence-specific DNA recombination enzyme and the drug resistance marker factor is bound via IRES, Remove the activating factor gene. The cell population after the introduction of the sequence-specific DNA recombinase expression vector is a mixture of cells from which the reprogramming factor gene has been removed and non-removed cells, so it depends on the drug corresponding to the resistance gene incorporated in the expression vector. Selection of induced pluripotent stem cells in which expression sequence-specific DNA recombinase is stably expressed for at least that period and reprogramming factor gene is removed from the chromosome by culturing for a certain period of time while selecting. (Fig. 1).

  The type of somatic cell used for initialization in the present invention is not particularly limited, and any somatic cell can be used. That is, the somatic cells referred to in the present invention include all cells other than germ cells among the cells constituting the living body, and may be differentiated somatic cells or undifferentiated stem cells. The origin of the somatic cell may be any of mammals, birds, fishes, reptiles and amphibians, but is not particularly limited, but is preferably a mammal (for example, a rodent such as a mouse or a primate such as a human). Preferably it is a human. In addition, when human somatic cells are used, any fetal, neonatal or adult somatic cells may be used. When the induced pluripotent stem cells produced by the method of the present invention are used for treatment of diseases such as regenerative medicine, it is preferable to use somatic cells isolated from the patient suffering from the disease.

  The induced pluripotent stem cell referred to in the present invention has a self-replicating ability over a long period of time under a predetermined culture condition (for example, under the condition of culturing ES cells), and is also an ectoderm, a medium under a predetermined differentiation induction condition. A stem cell having multipotency into germ layers and endoderm. The induced pluripotent stem cell in the present invention may be a stem cell capable of forming a teratoma when transplanted to a test animal such as a mouse.

In the present invention, first, at least one reprogramming gene is introduced into a somatic cell. The reprogramming gene referred to in the present invention is a gene encoding a reprogramming factor having the action of reprogramming somatic cells to become induced pluripotent stem cells. In the present invention, at least one reprogramming gene is used. Preferably, at least the Myc gene is used. Specific examples of the combination of reprogramming genes used in the present invention include the following combinations, but are not limited thereto.
(1) Oct gene, Klf gene, Sox gene, Myc gene (2) Oct gene, Sox gene, NANOG gene, LIN28 gene (3) Oct gene, Klf gene, Sox gene, Myc gene, hTERT gene, SV40 large T gene (4) Oct gene, Klf gene, Sox gene

  Among the above, a combination using at least the Myc gene is preferable, and a combination of the Oct gene, the Klf gene, the Sox gene and the Myc gene of (1) is particularly preferable.

  Each of the Oct gene, Klf gene, Sox gene and Myc gene includes a plurality of family genes. As specific examples of each family gene, those described in pages 11 to 13 of the specification of International Publication No. WO2007 / 069666 can be used. Specifically, it is as follows.

  Specific examples of genes belonging to the Oct gene include Oct3 / 4 (NM_002701), Oct1A (NM_002697), and Oct6 (NM_002699) (in parentheses indicate NCBI accession numbers of human genes). Oct3 / 4 is preferable. Oct3 / 4 is a transcription factor belonging to the POU family, is known as an undifferentiated marker, and has been reported to be involved in maintaining pluripotency.

  Specific examples of genes belonging to the Klf gene include Klf1 (NM_006563), Klf2 (NM_016270), Klf4 (NM_004235), and Klf5 (NM_001730) (in parentheses indicate NCBI accession numbers of human genes) ). Klf4 is preferred. Klf4 (Kruppel like factor-4) has been reported as a tumor suppressor.

 Specific examples of genes belonging to the Sox gene include, for example, Sox1 (NM_005986), Sox2 (NM_003106), Sox3 (NM_005634), Sox7 (NM_031439), Sox15 (NM_006942), Sox17 (NM_0022454), and Sox18 (NM_018419). (In parentheses indicate the NCBI accession number of the human gene). Preferably it is Sox2. Sox2 is a gene that is expressed during early development and encodes a transcription factor.

  Specific examples of genes belonging to the Myc gene include c-Myc (NM_002467), N-Myc (NM_005378), and L-Myc (NM_005376) (in parentheses the NCBI accession number of the human gene). Show). Preferably, it is c-Myc. c-Myc is a transcriptional regulator involved in cell differentiation and proliferation, and has been reported to be involved in maintaining pluripotency.

  The genes described above are genes that exist in common in mammals including humans, and genes derived from any mammal (eg, derived from mammals such as humans, mice, rats, monkeys) can be used in the present invention. . In addition, several (for example, 1 to 30, preferably 1 to 20, more preferably 1 to 10, more preferably 1 to 5, particularly preferably 1 to 3) of wild type genes. It is also possible to use a mutated gene having a base substitution, insertion and / or deletion and having a function similar to that of a wild-type gene.

  In the present invention, it is particularly preferable to use a combination of Oct3 / 4 gene, Klf4 gene, Sox2 gene, and c-Myc gene as the reprogramming gene.

  The method for introducing the reprogramming gene into the somatic cell is not particularly limited as long as the introduced reprogramming gene is expressed and the somatic cell can be reprogrammed. For example, the reprogramming gene can be introduced into a somatic cell using an expression vector containing at least one or more reprogramming genes. When two or more reprogramming genes are introduced into a somatic cell using a vector, the expression vector may be introduced into a somatic cell by incorporating two or more reprogramming genes into one expression vector. Two or more types of expression vectors incorporating one type of reprogramming gene may be prepared and introduced into somatic cells.

  The type of expression vector is not particularly limited, and may be a viral vector or a plasmid vector, but is preferably a viral vector, and particularly preferably a viral vector in which the introduced reprogramming gene is integrated into a somatic cell chromosome. Examples of virus vectors that can be used in the present invention include retrovirus vectors (including lentivirus vectors), adenovirus vectors, adeno-associated virus vectors, and the like. Among these, a retroviral vector is preferable, and a lentiviral vector is particularly preferable.

  As a packaging cell used for producing a recombinant viral vector, a cell capable of supplying the defective protein of a recombinant viral vector plasmid lacking at least one gene encoding a protein required for viral packaging Any cell can be used. For example, packaging cells based on human kidney-derived HEK293 cells and mouse fibroblasts NIH3T3 can be used.

  A recombinant viral vector can be produced by introducing a recombinant viral vector plasmid into a packaging cell. The method for introducing the viral vector plasmid into the packaging cell is not particularly limited, and can be performed by a known gene introduction method such as a calcium phosphate method, a lipofection method, or an electroporation method.

  In the present invention, all of the reprogramming genes introduced into somatic cells or at least one of them is removed. The reprogramming genes to be removed may be all or part of the introduced reprogramming genes, but if the reprogramming gene contains an oncogene (eg, Myc gene) The oncogene is preferably removed. For example, according to a preferred embodiment of the present invention, an Oct gene, a Klf gene, a Sox gene, and a Myc gene are introduced as reprogramming genes. In this case, at least the Myc gene is preferably removed.

  The method for removing the reprogramming gene is not particularly limited, and examples thereof include a method using a DNA recombination enzyme and a method using homologous recombination. As a method using a DNA recombination enzyme, a DNA recombination enzyme recognition sequence is added to both ends of the reprogramming gene to be removed, the reprogramming gene is introduced into somatic cells, and then the DNA recombination enzyme is allowed to act. The introduced reprogramming gene can be removed. As a DNA recombination enzyme gene used here, for example, a Cre gene can be used.

  In the present invention, the cells from which all or all of the reprogramming genes introduced into the somatic cells have been removed are selected from the cells from which the reprogramming genes introduced into the somatic cells have not been removed. In this selection, the cells from which all or at least one of the reprogramming genes introduced into the somatic cells have been removed by drug selection are removed from the cells from which the reprogramming genes introduced into the somatic cells have not been removed. Can be sorted. Specifically, an expression vector that simultaneously expresses a DNA recombination enzyme and a drug resistance gene is introduced into a somatic cell so that the DNA recombination enzyme and the drug resistance gene are expressed in the somatic cell. Based on the action of the expression of the drug resistance gene by removing all or at least one of the reprogramming genes introduced into the cells, and further culturing the somatic cells in the presence of the drug, Cells from which all or all of the reprogramming genes introduced into the cells have been removed can be selected from cells from which the reprogramming genes introduced into the somatic cells have not been removed. The combination of the drug resistance gene and the drug used here is not particularly limited, but preferably includes a combination of an antibiotic resistance gene and an antibiotic, and an example is a combination of a neomycin resistance gene and G418.

  When removing a transgene using a DNA recombination enzyme, even if it is introduced into a cell as a DNA recombination enzyme and a protein, the DNA recombination enzyme gene is introduced into the cell and the DNA recombination enzyme is expressed in the cell. Even in this case, the removal efficiency of the introduced reprogramming gene is not 100%. That is, the cell population into which the DNA recombination enzyme has been introduced contains a mixture of cells from which the introduced reprogramming gene has been removed and cells from which the introduced reprogramming gene has not been removed. In this case, since the cells in which the reprogramming gene such as Myc gene remains are more advantageous in terms of proliferation and survival, the risk of carcinogenesis is not reduced in such a state. Therefore, in the present invention, for the purpose of reducing the risk of carcinogenesis, all of the reprogramming genes introduced into the somatic cells or cells from which at least one of them has been removed are treated with the reprogramming genes introduced into the somatic cells. Sort from cells that have not been removed.

  Medium that can maintain the undifferentiation and pluripotency of ES cells is known in the art, and the artificial pluripotent stem cells of the present invention can be isolated and cultured by using a suitable medium in combination. That is, as a medium for culturing the induced pluripotent stem cells of the present invention, ES medium, MEF which is a supernatant obtained by culturing mouse embryonic fibroblasts for 24 hours after adding 10 ng / ml FGF-2 to ES medium Examples thereof include conditioned ES medium (hereinafter referred to as MEF conditioned ES medium). The medium for culturing the induced pluripotent stem cells of the present invention includes various growth factors, cytokines, hormones (eg, FGF-2, TGFb-1, activin A, Nanoggin, BDNF, NGF, NT -1, NT-2, NT-3, and other components involved in the growth and maintenance of human ES cells may be added. In addition, the differentiation ability and proliferation ability of the isolated induced pluripotent stem cells can be confirmed by using confirmation means known for ES cells.

  The use of the induced pluripotent stem cells produced by the method of the present invention is not particularly limited, and can be used for various tests / researches and disease treatments. For example, by treating the induced pluripotent stem cell obtained by the method of the present invention with a growth factor such as retinoic acid, EGF, or glucocorticoid, a desired differentiated cell (for example, neuronal cell, cardiomyocyte, hepatocyte, Pancreatic cells, blood cells, etc.) can be induced, and stem cell therapy by autologous cell transplantation can be achieved by returning the differentiated cells thus obtained to the patient.

  Examples of diseases of the central nervous system that can be treated using the induced pluripotent stem cells of the present invention include Parkinson's disease, Alzheimer's disease, multiple sclerosis, cerebral infarction, spinal cord injury and the like. For the treatment of Parkinson's disease, pluripotent stem cells can be differentiated into dopaminergic neurons and transplanted into the striatum of Parkinson's disease patients. Differentiation into dopaminergic neurons can be promoted by co-culturing mouse stromal cell line PA6 cells and the induced pluripotent stem cells of the present invention under serum-free conditions. In the treatment of Alzheimer's disease, cerebral infarction and spinal cord injury, the induced pluripotent stem cells of the present invention can be induced to differentiate into neural stem cells and then transplanted to the site of injury.

  The induced pluripotent stem cells of the present invention can be used for the treatment of liver diseases such as hepatitis, cirrhosis, and liver failure. In order to treat these diseases, the induced pluripotent stem cells of the present invention can be differentiated into hepatocytes or hepatic stem cells and transplanted. Hepatocytes or hepatic stem cells can be obtained by culturing the induced pluripotent stem cells of the present invention in the presence of activin A for 5 days and then culturing with hepatocyte growth factor (HGF) for about 1 week.

  Furthermore, the induced pluripotent stem cells of the present invention can be used for the treatment of pancreatic diseases such as type I diabetes. In the case of type I diabetes, the induced pluripotent stem cells of the present invention can be differentiated into pancreatic β cells and transplanted into the pancreas. The method of differentiating the induced pluripotent stem cell of the present invention into pancreatic β cells can be performed according to the method of differentiating ES cells into pancreatic β cells.

  Furthermore, the induced pluripotent stem cells of the present invention can be used for the treatment of heart failure associated with ischemic heart disease. For the treatment of heart failure, the induced pluripotent stem cells of the present invention are preferably differentiated into cardiomyocytes and then transplanted to the site of injury. The induced pluripotent stem cells of the present invention can obtain cardiomyocytes in about 2 weeks after the formation of embryoid bodies by adding noggin 3 days before the formation of embryoid bodies and adding it to the medium.

  The following examples further illustrate the present invention, but the present invention is not limited to the examples.

1. Preparation of cell material Human abdominal skin pieces were collected and cultured in a cell culture plate using a culture solution (DMEM / 10% bovine serum). Since one week after the start of culture, migration and proliferation of fibroblasts from skin pieces were observed, and thus fibroblasts were appropriately collected using trypsin and EDTA. Thereafter, the culture scale was expanded according to the proliferation of the cells. Within 1 to 2 months from the start of culture, the recovered fibroblasts were stored frozen and used for the subsequent production of iPS cells.

2. Preparation of reprogramming factor expression vector
Oligo DNA primers for amplifying human Oct3 / 4, Sox2, Klf4, and c-Myc by PCR based on the nucleotide sequence of cDNA published in Genbank et al. Were prepared. Using cDNA derived from human ES cells (KhES-1) as a template for reverse transcription, or genomic DNA as a template, the human Oct3 / 4, Sox2, Klf4, and c-Myc structural genes It amplified by PCR method and inserted in the plasmid vector (pENTR-D-TOPO, Gibco-Invitrogen). At this time, some genes with Lox sequences added to the ends of the PCR primers were used. After confirming the base sequence of the cloned plasmid DNA by sequence analysis, it is introduced into a lentiviral vector (CSII-EF-RfAl, distributed by Dr. Miyoshi) using LR clonase (Gibco-Invitrogen). did. For some, LOX sequences were added to both ends of the cDNA after insertion into CSII-EF-RfAl.

3. Preparation of Cre expression vector
Gene fragments were prepared by PCR using the Cre structural gene as a template. This was operated by the CAG promoter and inserted into pCAGGS-IRES-Neo, which is a vector incorporating the IRES (internal ribosomal entry site) and neomycin resistance gene, to create a vector that simultaneously expresses the Cre enzyme and the neomycin resistance gene. .

4). Production of recombinant lentiviral vectors:
Using the lipofection method (Lipofectamine 2000, Invitrogen), each of the reprogramming factor genes introduced into CSII-EF prepared above, the packaging construct, and the envelope & Rev construct were introduced into 293T cells. Three days after gene introduction, the cell culture solution was collected, passed through a 0.45 μm filter, and then virus particles were precipitated and collected by centrifugation (50,000 G, 2 hours). The recovered recombinant virus particles were suspended in a DMEM solution, dispensed into a freezing tube, and stored in a freezer (−80 ° C.) until use.

5). Gene transfer:
Human fibroblasts that had been cryopreserved were thawed, cultured again for several days, and then infected by adding a virus suspension in a culture plate, and gene transfer was performed. Four to six days after gene transfer, infected cells were collected using trypsin and EDTA, and co-cultured with mouse embryonic fibroblasts (feeder cells) that had been prepared in advance and whose growth was stopped by mitomycin C treatment. The culture was started. From the next day, the culture solution was replaced with a culture solution for human ES cells, and the culture was continued. Several days later, some cells grew and formed colonies. An explanatory diagram of the following operation procedure is attached to FIG.

  After 20-30 days after gene transfer, colonies showing ES cell-like morphology were isolated as micro-chips using a microchip under microscopic observation, and separately prepared mouse embryo-derived feeder cells Was co-cultured. Then, according to the growth of the cells, the culture was continued while expanding the culture vessel, a part was cryopreserved as it was, a part was induced to differentiate into blood cells, and part was the introduction of Cre gene . The Cre gene was also introduced into some of the remaining cells from which colonies showing ES cell-like morphology were isolated, or some of the cells from which colonies were not isolated.

6). Introduction of Cre expression vector:
The Cre expression vector was introduced by two methods (FIG. 2). In the first method, as described in the previous section, a Cre expression vector was introduced into a cell isolated as an iPS cell clone based on the morphology of the cell colony (introduction after clone isolation). In the second method, a Cre expression vector was introduced into a cell population in which iPS cells and non-iPS cells were mixed (introduction before clone isolation). The Cre expression vector was introduced by electroporation and co-cultured with G418 resistant (neomycin resistant) feeder cells. G418 (Gibco-Invitrogen) was added to the culture solution 24 to 48 hours after the electroporation, and the culture was continued. After 15-25 days after the electroporation, a mouse fetus-derived feeder that had been prepared separately was isolated using a microchip with G418-resistant cell colonies showing iPS cell-like morphology under microscopic observation. Co-culture with cells was performed. Then, according to the proliferation of the cells, the culture was continued while expanding the culture vessel, a part was cryopreserved as it was and a part was induced to differentiate into blood cells.

7). Cell morphology and differentiation into blood cells:
Half of the cell clones (about 70 clones) isolated as iPS cells under microscopic observation can be continuously cultured, and the morphology and growth rate are similar to those of human ES cells or human iPS already reported in the paper. Many of them had the ability to differentiate into blood cells. Both those with and without the introduction of the Cre expression vector had the ability to differentiate into blood cells. As an overall trend, those in which the Cre expression vector was introduced tended to be somewhat slow in proliferation in an undifferentiated state and to be easily differentiated. An iPS cell clone having the ability to differentiate into blood cells could be produced from both introduction before clone isolation and introduction after clone isolation. FIG. 3 shows the morphology of iPS cells into which the Cre expression vector has been introduced (introduction before clone isolation) and iPS cells that have not been introduced. All of these have the ability to differentiate into blood cells.

8). Analysis of the presence or absence of reprogramming factor gene removal:
We analyzed by PCR whether the gene of the reprogramming factor introduced for the purpose of iPS cell preparation was removed by the introduction of Cre expression vector. The base sequences of the primers used in the PCR method for detecting the reprogramming factor gene introduced for the purpose of iPS cell production by introducing the Cre expression vector are as follows.
c-Myc:
GATCAGCAACAACCGAAAAT (SEQ ID NO: 1)
GTTGCGTCAGCAAACACAGT (SEQ ID NO: 2)
Sox2:
CATGTCCCAGCACTACCAGA (SEQ ID NO: 3)
GGCATTAAAGCAGCGTATCC (SEQ ID NO: 4)

  Among the methods described in the introduction of the Cre expression vector, after the introduction of the Cre expression vector by the first and second methods, the isolated iPS cell clone and the iPS cell clone in which the Cre expression vector has not been introduced. The analysis results for c-Myc are shown in FIG. 4, and the analysis results for Sox2 are shown in FIG. 4 and 5 show that the c-Myc gene and the Sox2 gene have been removed by introducing the Cre expression vector.

Claims (19)

A method for producing induced pluripotent stem cells from somatic cells, comprising the following steps.
(A) introducing at least one or more reprogramming genes into somatic cells; and (b) removing all or at least one of the reprogramming genes introduced into somatic cells and introducing them into somatic cells. A step of selecting cells from which all of the reprogramming genes or at least one of them have been removed from cells from which the reprogramming genes introduced into somatic cells have not been removed. The method according to claim 1, wherein the reprogramming gene introduced into the somatic cell in step (a) includes at least a Myc gene. The method according to claim 1 or 2, wherein the reprogramming gene introduced into the somatic cell in the step (a) is an Oct gene, a Klf gene, a Sox gene, and a Myc gene. The method according to any one of claims 1 to 3, wherein the reprogramming gene introduced into the somatic cell in the step (a) is an Oct3 / 4 gene, a Klf4 gene, a Sox2 gene, and a c-Myc gene. The method according to any one of claims 1 to 4, wherein in step (a), the reprogramming gene is integrated into a chromosome of a somatic cell. The method according to any one of claims 1 to 5, wherein in the step (a), the reprogramming gene is introduced into a somatic cell using a lentiviral vector. The method according to any one of claims 1 to 6, wherein the reprogramming gene to be removed in the step (b) is one or more kinds of genes including at least the Myc gene. A recognition sequence for a DNA recombinase is added to both ends of the reprogramming gene to be removed, and after introducing the reprogramming gene into a somatic cell in step (a), in step (b) The method according to any one of claims 1 to 7, wherein the reprogramming gene introduced by the action is removed. In step (b), the cells from which all or all of the reprogramming genes introduced into the somatic cells have been removed by drug selection are the cells from which the reprogramming genes introduced into the somatic cells have not been removed. 9. The method according to any one of claims 1 to 8, wherein the method is selected from the following. In step (b), an expression vector that simultaneously expresses the DNA recombination enzyme and the drug resistance gene is introduced into the somatic cell, and the DNA recombination enzyme and the drug resistance gene are expressed in the somatic cell. Based on the action of the expression of the drug resistance gene by removing all or at least one of the reprogramming genes introduced into the somatic cell and culturing the somatic cell in the presence of the drug, The cell according to any one of claims 1 to 9, wherein a cell from which all or at least one of the reprogramming genes introduced into the cell has been removed is selected from cells from which the reprogramming gene introduced into the somatic cell has not been removed. The method of crab. The method according to claim 10, wherein the expression vector that simultaneously expresses the DNA recombination enzyme and the drug resistance gene is an expression vector comprising a DNA recombination enzyme gene, an IRES (internal ribosomal entry site), and a drug resistance gene. The method according to claim 11, wherein the DNA recombination enzyme gene is a Cre gene and the drug resistance gene is a neomycin resistance gene. A method for producing induced pluripotent stem cells from somatic cells, comprising the following steps.
(A) introducing Oct3 / 4 gene, Klf4 gene, Sox2 gene, and c-Myc gene (where Lox sequences are added to both ends of each gene) into somatic cells; and (b) step ( By introducing an expression vector containing a Cre gene, an IRES (internal ribosomal entry site) and a drug resistance gene into the somatic cell of a), and culturing in the presence of the drug, the action of Cre causes the step (a). A gene in which all or part of the introduced gene is removed and all or part of the gene introduced in step (a) is removed by the action of Cre is introduced into a somatic cell. Sorting from cells that have not been removed. The method according to any one of claims 1 to 13, wherein the somatic cell is a mammalian somatic cell. The method according to any one of claims 1 to 14, wherein the somatic cell is a human somatic cell. An induced pluripotent stem cell obtainable by the method according to any one of claims 1 to 15. A method for producing a somatic cell induced to differentiate from an induced pluripotent stem cell, comprising the following steps.
(A) a step of producing an induced pluripotent stem cell by the method according to any one of claims 1 to 15; and (b) a step of inducing differentiation of the induced pluripotent stem cell obtained in step (a). A somatic cell induced to differentiate from an induced pluripotent stem cell, which can be obtained by the method according to claim 17. A tissue or organ comprising the somatic cell population of claim 18.