JP2010077091A - METHOD FOR ENCAPSULATION OF siRNA AND CELL-SELECTIVE INTRODUCTION OF siRNA BY USING HOLLOW BIO-NANOCAPSULE OF HEPATITIS B VIRUS PROTEIN AND LIPOSOME - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a complex particle for efficiently delivering siRNA to a target and decreasing expression of a target gene in a target cell and a method for producing the particle. <P>SOLUTION: The method for producing a BNC (bio-nanocapsule)-liposome complex particle comprises formation of a complex from a hollow bionanoparticle containing hepatitis B virus protein and liposome in the presence of a surfactant and encapsulating siRNA in the complex capsule. The method for producing a complex particle of BNC and liposome containing encapsulated siRNA comprises fusion of BNC to the liposome containing encapsulated siRNA. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to a technique for introducing siRNA into cells using hepatitis B virus protein hollow bio-nanoparticles.

  In RNAi (RNA interference), when a double-stranded RNA (dsRNA) that is homologous to the target gene is introduced into the cell, the homologous portion of the mRNA that is the transcription product of the target gene is specifically degraded, thereby This is a phenomenon in which expression is suppressed. Since the discovery of RNAi in nematodes in 1998 (Fire et al., Nature, 391, 806-811, 1998), RNAi phenomena have been observed in various species, including mammals including humans in 2001. However, it has been reported that siRNA (small interference RNA), which is a dsRNA of about 21 to 23 bases, can cause an RNAi phenomenon (Elbashirst al., Nature, 411, 494-498, 2001).

  Currently, great expectations are placed on the application of RNAi technology to pharmaceuticals. Most diseases are thought to be caused by some kind of protein dysfunction, and siRNA capable of suppressing the expression of the abnormal protein may be applied to a large number of diseases. Moreover, since the gene expression suppression effect by siRNA is high in sequence specificity, it is assumed that the effect appears only in the target causal factor, and almost no side effects occur. Currently, drugs using siRNA (siRNA drugs) are based on a mechanism of action different from conventional drugs, and safety in humans has not been fully established. Development has been ahead as a therapeutic agent for diseases such as cancer and infectious diseases.

  Another advantage of siRNA medicines is that siRNA as an active ingredient can be designed if the relationship between the disease and the gene becomes clear, and the active ingredient can be easily synthesized. While conventional small molecule drugs have spent a great deal of time and effort searching for their active ingredients, siRNA drugs can minimize such efforts.

  On the other hand, siRNA is very poor in vivo and has a serious problem of poor biomembrane permeability. Yet another major problem is the long-lasting delivery of the required amount of siRNA only to the target cells.

Much research has been conducted on DDS technology for siRNA. In order to introduce siRNA into a cell and to exert its function, it is necessary to clear several steps as follows.
1. Reaching siRNA complexes to cells
Since siRNA is easily degraded by blood degrading enzymes such as exonuclease, it is degraded before reaching the target site. For this reason, it is necessary to protect against degrading enzymes.
・ Incorporation of siRNA into cells
Since siRNA itself cannot penetrate the cell membrane into the cell, it is not taken into the cytoplasm. For this reason, it is carried out through a cellular uptake mechanism such as endocytosis. Membrane-permeable peptides and cationic lipids were thought to act directly on the cell membrane and introduce siRNA into the cell, but at least the membrane-permeable peptide passed the siRNA into the cell via endocytosis. It is known that endocysis is involved in cases where the cationic lipid is used at a concentration other than a high concentration.
・ Escape from the uptake mechanism into the cytoplasm siRNA taken up through the uptake mechanism enters intracellular vesicles mainly composed of endosomes. Since siRNA does not act as it is, it is necessary to escape from it. For escape from endosomes, those using pH-sensitive lipids, some membrane-permeable peptides, cationic lipids, and the like are used.

  When all of the above steps are cleared, the knockdown effect by siRNA can be seen.

  On the other hand, Patent Documents 1 and 2 describe delivery of siRNA using hollow bio-nanoparticles (BNC) having hepatitis B virus protein as a constituent element.

Since siRNA is rapidly degraded until it is introduced into a cell or even after being introduced into a cell, it is necessary to continuously introduce siRNA into the cell for a long time.
JP2008-162981 JP2008-029249

  The present invention provides a siRNA-introducing substance / introducing agent that can deliver siRNA into target cells, tissues or organs continuously for a long time, has low toxicity, and can deliver an amount that can sufficiently suppress the expression of the target gene. The purpose is to do.

  As a result of repeated investigations in view of the above problems, the present inventors have encapsulated siRNA in hollow bio-nanoparticles (BNC) comprising a hepatitis B virus protein complexed with liposomes or a modified form thereof as a component, Has been found to be able to suppress the expression of the target gene.

The present invention provides the following siRNA-encapsulating BNC liposome composite particles, siRNA-introducing agents, and methods for producing siRNA-encapsulating BNC liposome composite particles.
Item 1. siRNA-encapsulated BNC liposome composite particles in which siRNA is encapsulated in composite particles of hollow bio-nanoparticles (BNC) and liposomes containing hepatitis B virus protein or a variant thereof.
Item 2. Item 2. The siRNA-encapsulated BNC liposome composite particle according to Item 1, wherein the particle size of the composite particle is 70 nm to 300 nm.
Item 3. Item 3. The siRNA-encapsulated BNC liposome composite particle according to Item 1 or 2, wherein the hepatitis B virus protein or a variant thereof includes a targeting part of a cell, organ or tissue.
Item 4. Item 4. The siRNA-encapsulated BNC liposome composite particle according to any one of Items 1 to 3, wherein a surface charge of the composite particle is within a range of −5 mV to +5 mV.
Item 5. Item 5. The siRNA-encapsulated BNC liposome composite particle according to any one of Items 1 to 4, wherein BNC comprises hepatitis B virus protein as a constituent and siRNA is specifically introduced into hepatocytes.
Item 6. Item 6. The siRNA-encapsulated BNC liposome composite particle according to any one of Items 1 to 5, wherein the hepatitis B virus protein is HBsAg (Q129R, G145R).
Item 7. Item 7. An siRNA introduction agent for target cells, tissues, and organs comprising the composite particles according to any one of Items 1 to 6.
Item 8. A method for producing siRNA-encapsulated BNC liposome composite particles, wherein siRNA-encapsulated liposomes and hollow bio-nanoparticles (BNC) comprising hepatitis B virus protein or a variant thereof as a constituent element are complexed.
Item 9. A siRNA-encapsulated BNC comprising a complex of a hollow bio-nanoparticle (BNC) comprising liposome and hepatitis B virus protein or a variant thereof in the presence of a surfactant, and adding siRNA to the complex. A method for producing liposome composite particles.
Item 10. Item 10. The method for producing siRNA-encapsulated BNC liposome composite particles according to Item 8 or 9, wherein the composite particles have a particle size of 70 nm to 300 nm, and the composite particles have a surface charge in the range of −5 mV to +5 mV.
Item 11. Surfactant is MEGA-8, Triton X-100, Tween 20, Tween 80, N-lauroyl sarcosine-sodium salt, lithium dodecyl sulfate, sodium cholate, sodium deoxycholate, SDS, cetylpyridinium chloride, CTAB, CHAPS, Item 10. The method according to Item 9, selected from the group consisting of CHAPSO, sulfobetaine SB10 and sulfobetaine SB16.
Item 12. Item 8. The composite particle according to any one of Items 1 to 6, the siRNA introduction agent according to Item 7, wherein the hepatitis B virus protein or a variant thereof is a Hepatitis B virus protein having a PreS1 region or a variant thereof. The manufacturing method in any one of 8-11.
Item 13. Item 8. The composite particle according to any one of Items 1 to 6, wherein the hepatitis B virus protein or a variant thereof is a Hepatitis B virus protein having a PreS1 region and an S region or a variant thereof, and siRNA introduction according to Item 7 The manufacturing method in any one of claim | item 8-11.

  The complex or transduction agent of the present invention introduces siRNA into a target cell / tissue / organ as a pharmaceutical target in a living body in an effective amount for suppressing the expression of the target gene over a very long period of about 1 day to 1 week. be able to.

  In the introduction of DNA into the cell, if even a small amount of DNA molecules are introduced into the cytoplasm, the expression level of the protein, which is the gene product, increases in a time-dependent manner. Is possible. On the other hand, in the case of RNA interference, siRNA itself acts enzymatically on the target gene mRNA (as a component of the RNase complex), so it is said that it is necessary to introduce an amount suitable for it, It is generally said that it is more difficult than gene transfer. In the present invention, the introduction of siRNA into cells and the knockdown effect of a cell-specific target gene, which has been difficult in the prior art, are achieved.

  The composite particle of the present invention is one in which siRNA is encapsulated in a composite particle of a hollow bio-nanoparticle (hereinafter, may be abbreviated as “BNC”) and a liposome, which are composed of hepatitis B virus protein or a variant thereof. Here, "encapsulation" means that siRNA is complexed with BNC in a state where it is not degraded in the living body such as blood before being introduced into the target cell, etc., and is encapsulated in BNC particles. In addition to the case, it is outside the BNC particle but includes a case where it is complexed in a state where it interacts with a part of the liposome and is not subjected to degradation by an enzyme such as RNase.

  The hollow bio-nanoparticle according to the present invention comprises hepatitis B virus protein having a particle forming ability and a lipid membrane as constituent elements. For example, the hepatitis B virus protein having a particle forming ability has a spherical shape, an ellipsoid shape, or a shape similar to these. It has a structure complexed with a lipid membrane.

  In the present specification, examples of hollow bio-nanoparticles comprising hepatitis B virus protein or a variant thereof as a constituent include particles comprising hepatitis B virus surface antigen protein (HBsAg) and a lipid membrane as constituents. The HBsAg protein may be combined with a hepatitis B virus internal core antigen protein to form particles.

In the present specification, the hollow bio-nanoparticle includes a hepatitis B virus protein or a variant thereof as a main component, and the protein is retained in a lipid membrane. In addition, sugar chains are usually bound to the protein. This sugar chain is bound in a eukaryotic cell when hepatitis B virus protein or a modified form thereof is expressed in a eukaryotic cell. A sugar chain may be chemically bonded
Examples of BNC include those obtained by expressing hepatitis B virus protein or a variant thereof in eukaryotic cells including mammalian cells such as yeast, insect cells or CHO cells. A method for producing hollow bio-nanoparticles is described in JP-A-2001-316298, and a method for adjusting HBsAg is described in Vaccine. 2001 Apr 30; 19 (23-24): 3154-63. Physicochemical and immunological characterization of hepatitis B virus envelope particles exclusively consisting of the entire L (pre-S1 + pre-S2 + S) protein.In Yamada T, Iwabuki H, Kanno T, Tanaka H, Kawai T, Fukuda H, Kondo A, Seno M, Tanizawa K, Kuroda S. Are listed.

  When an HBsAg protein is expressed in a eukaryotic cell, the protein is expressed and accumulated as a membrane protein on the endoplasmic reticulum membrane, and is released as a nanoparticle, resulting in a structure having a lipid membrane. Since hollow bio-nanoparticles expressed in eukaryotic cells do not contain any HBV genome, they are extremely safe for the human body.

  In one preferred embodiment, the hollow bionanoparticles are composed of 65-80 parts by weight of hepatitis B virus protein or variant thereof, 8-20 parts by weight lipid, 5-20 parts by weight sugar chain. The hollow bio-nanoparticles (L particles) used in the examples of the present application are composed of about 70 parts by weight of HBsAg or a variant thereof, about 16 parts by weight of sugar chain, and about 13 parts by weight of lipid.

  The siRNA is not particularly limited as long as it can degrade RNA (especially mRNA) of a target gene, and can be designed according to a conventional method once the target gene is determined. siRNA is usually double-stranded, but one or both ends of double-stranded RNA may be linked. The siRNA has a length of 21 to 23 bases, but may have a longer or shorter sequence of, for example, 15 to 30 bases as long as the target RNA can be cleaved.

  In a preferred embodiment of the present invention, the liposome BNC composite particles excluding siRNA after complexed with liposomes are 10-60 parts by weight of hepatitis B virus protein or a variant thereof, 40-95 parts by weight of lipid. It may be composed of 1 to 10 parts by weight of sugar chains (including phospholipids).

  Examples of lipids constituting the composite particles include membrane components derived from eukaryotic cells such as yeast or animal cells (for example, triglycerides), and phospholipids constituting liposomes. A sugar chain is introduced into a protein when expressed in a eukaryotic cell, but it is also possible to bind a sugar chain as a site that specifically recognizes a target cell / tissue / organ. An example of a sugar chain that can be used as a target recognition site is sialyl Lewis X. Since sialyl Lewis X interacts with a lectin protein present on the surface of an inflamed cell, it can be used for targeting an inflamed site in vivo. A sugar chain as a target recognition molecule such as sialyl Lewis X may be introduced into any particle before and after the introduction of the complex.

  S protein (226 amino acids), which is included in HBsAg and is a component of S particles, has the ability to form particles. Pre-S2 consisting of 55 amino acids added to S particles is M protein (M particle constituent protein), and M protein added with Pre-S1 consisting of 108 or 119 amino acids is L protein (L particles) Protein). L protein and M protein have the ability to form particles, as does S protein. Therefore, the two regions of PreS1 and PreS2 may be arbitrarily substituted, added, deleted, or inserted. For example, by using a modified protein in which the hepatocyte recognition site contained in amino acid residues 3 to 77 of the Pre-S1 region is deleted, hollow particles having lost hepatocyte recognition ability can be obtained. In addition, since the PreS2 region includes a site that recognizes hepatocytes via albumin, this albumin recognition site can also be deleted. On the other hand, since the S region (226 amino acids) is responsible for particle forming ability, modification of the S region must be performed so as not to impair the particle forming ability. For example, in the S region, a protein in which Gln at position 129 is substituted with Arg and / or Gly at position 145 is substituted with Arg has a reduced antigenicity of BNC, and has the ability to form particles and introduce siRNA into cells. HBsAg (Q129R, G145R), which is a protein in which Gln at position 129 is substituted with Arg and Gly at position 145 is substituted with Arg in the S region of the L protein, is particularly preferable. And siRNA have the ability to introduce into cells, and are preferred because of their low immunogenicity. BNCs obtained by expressing a modified product (HBsAg (Q129R, G145R)) in which the amino acid at position 129 of the L protein is modified from Gln → Arg and the amino acid at position 145 from Gly → Arg are produced in the examples. .

  In addition, it became clear by the present inventors that amino acids at positions 1 to 50 in the PreS1 region, particularly the PreS1 region, contribute to fusion with lipids such as liposomes. Accordingly, the hepatitis B virus protein of the present invention or a variant thereof preferably has a PreS1 region, particularly those having positions 1 to 50 of the PreS1 region, and there are alterations such as substitution, addition, deletion, insertion and the like in this region. However, it is preferable that the mutation does not impair the particle-forming ability in this region.

  Various variants of hepatitis B virus protein are widely included as long as they have the ability to form virus hollow nanoparticles. Taking HBsAg as an example, any number of substitutions and deletions are possible for the PreS1 and PreS2 regions. Loss, addition, insertion, etc. With regard to the S region, one or several or a plurality, for example, 1 to 120, preferably 1 to 50, more preferably 1 to 20, more preferably 1 to 10 In particular, 1 to 5 amino acids may be substituted, added, deleted or inserted. As a method for introducing mutations such as substitution, addition, deletion, insertion and the like, in the DNA encoding the protein, for example, cytospecific mutagenesis (Methods in Enzymology, 154, 350, 367-382 (1987); , 468 (1983); Nucleic Acids Res., 12, 9441 (1984)), chemical synthesis means such as the phosphate triester method and phosphate amidite method (for example, using a DNA synthesizer) ( J. Am. Chem. Soc., 89, 4801 (1967); 91, 3350 (1969); Science, 150, 178 (1968); Tetrahedron Lett., 22, 1859 (1981)). Codon selection can be determined by taking into account the codon usage of the host.

  In the case of hollow bio-nanoparticles composed of proteins capable of recognizing hepatocytes such as hepatitis B virus protein or L protein as a variant thereof, it is not necessary to introduce a cell recognition site. On the other hand, a hollow bio-nanoparticle composed of a modified protein in which the hepatocyte recognition site contained in amino acids 3 to 77 of the Pre-S1 region has been deleted, or a protein in which both the PreS1 and PreS2 regions have been deleted. In this case, since cell recognition cannot be performed as it is, a cell recognition site can be introduced to recognize any cell other than hepatocytes, and the polymer / nucleic acid complex can be introduced into various target cells. Such cell recognition sites for recognizing specific cells include, for example, cell function regulatory molecules consisting of polypeptides such as growth factors and cytokines, cell surface antigens, tissue-specific antigens, receptors and other cells and tissues. These polypeptide molecules, polypeptide molecules derived from viruses and microorganisms, antibodies, sugar chains and the like are preferably used. Specifically, antibodies against EGF receptor and IL-2 receptor that appear specifically in cancer cells, EGF, and receptors presented by HBV are also included. Alternatively, a protein capable of binding an antibody Fc domain (for example, a ZZ tag), a strept tag showing biotin-like activity to present a biorecognition molecule labeled with biotin via streptavidin, and the like can also be used.

  When the cell recognition site is a polypeptide, the DNA encoding the hepatitis B virus protein or a variant thereof and the DNA encoding the cell recognition site are in-frame via the DNA encoding the spacer peptide as necessary. Hollow bio-nanoparticles that recognize any target cell can be obtained by ligation, incorporation into a vector or the like, and expression in eukaryotic cells.

  When the cell recognition site is an antibody, a DNA encoding a hepatitis B virus protein or a variant thereof and a DNA encoding a ZZ tag are linked in-frame via a DNA encoding a spacer peptide, if necessary. Is incorporated into a vector or the like, expressed in a eukaryotic cell, and the resulting hollow bionanoparticle and an antibody capable of recognizing the target cell are mixed to obtain the desired hollow bionanoparticle.

  When the cell recognition site is a sugar chain, it can be obtained by linking a sugar chain capable of recognizing a cell such as sialyl Lewis X to a hollow bionanoparticle having no cell recognition ability using a glycosyltransferase.

  The variant of HBsAg protein may be a variant with altered antigenicity (a variant in which a site involved in antigenicity such as an epitope is deleted / replaced), particle structure stability, cell selectivity, etc. .

  Fusion of BNC and liposome can be easily carried out by mixing the liposome and BNC in water or an aqueous medium and stirring or shaking as necessary (direct fusion method).

  Alternatively, the fusion of BNC and liposome (without siRNA) can be achieved by mixing and dialyzing liposome and BNC in the presence of a surfactant in water or an aqueous medium to form a complex and then encapsulating siRNA. Good.

  The size of the composite particles is 50 to 1000 nm, preferably about 60 to 700 nm, more preferably about 70 to 500 nm, particularly preferably about 70 to 300 nm, and particularly about 70 to 200 nm. The particle size of the composite particles affects the half-life and clearance in vivo (particularly in blood).

  The surface charge of the composite particles is about −20 to +20 mV, preferably about −10 to +10 mV, and more preferably about −5 to +5 mV. The closer the surface charge is to 0, the longer the half-life in the living body is preferable. In the present specification, the size of the composite particles can be measured by a measurement device using a dynamic scattering light method, for example, FPAR1000 (Otsuka Electronics), and the surface charge is measured by Zetasizer Nano-ZS (Malvern Instruments). be able to.

  When the size and surface charge of the composite particle of the present invention are both within the above ranges, it is particularly preferable because the half-life in vivo (especially in blood) is long and siRNA can be introduced into target cells for a long time.

    In order to adjust the particle size of the BNC-Liposome complex encapsulating siRNA, in the direct fusion method, a treatment for minimizing the particle size of the liposome is performed, and then the BNC is fused with the particle size minimized. In addition, in the surfactant method, for example, a liposome adjusted to a small size of, for example, 50 nm to 100 nm and a BNC with a minimized particle size are prepared and fused in the presence of a surfactant to further minimize the complex. This is possible by performing the conversion process.

  In order to minimize the particle size of the liposome, for example, the particle size can be adjusted by passing it through a filter having a small pore size (for example, 100 nm, 80 nm, 50 nm, etc.) using an extruder. As another method, it is possible to reduce the particle size by processing for several hours with a rod-shaped ultrasonic generator. Of course, there is no problem even if a method for minimizing the liposome particle diameter by another method is used. When minimizing the particle size of BNC, for example, it is possible to reduce the particle size by processing for several hours with a rod-shaped ultrasonic generator, but use the minimization method by other methods. There is no problem. When minimizing the complex by the surfactant method, for example, the particle size can be adjusted by passing it through a filter having a small pore size (for example, 200 nm, 150 nm, 100 nm, etc.) using an extruder. .

  As an adjustment method for bringing the surface charge to near neutrality, it is possible to adjust the amount of lipid having a charge, the amount of siRNA to be included, and the amount of BNC mixed. In addition, BNC modified with two amino acids has the effect of changing the charge to near neutrality regardless of whether it is a positively charged or negatively charged liposome. By determining an appropriate mixing ratio, it is possible to bring the charge of the BNC-Liposome complex encapsulating the final product siRNA to near neutrality.

  The liposome may be either a multilamellar liposome or a monolayer liposome. The size of the liposome is about 40 to 300 nm, preferably about 50 to 200 nm, particularly about 60 to 150 nm. When the liposome is directly fused with BNC, the size of the liposome is preferably about 0.5 to 2 times that of BNC. When a liposome and BNC are complexed using a surfactant, the size of the liposome is arbitrary, but a liposome having the above size is preferably exemplified.

  Liposomes can be produced by ultrasonic treatment, reverse phase evaporation, freeze-thaw, lipid dissolution, spray drying, and the like.

  Liposomes with respect to BNC are such that the surface charge of the obtained composite particles is close to 0 mV as described above, and the size of the composite particles containing BNC complex / siRNA is within the above range. It is made and used in an appropriate amount and composition. Specifically, 20 to 1000 parts by weight of liposome is used with respect to 100 parts by weight of BNC. Since the surface charge of siRNA-encapsulated BNC liposome composite particles is affected by the surface charge of BNC and the amount of siRNA encapsulated, the composition of the liposome to obtain the desired surface charge of the composite particles depends on the surface of the obtained composite particles What is necessary is just to select suitably so that an electric charge may become a desired value.

  Examples of liposome components include phospholipids, cholesterols, fatty acids, and the like. Specifically, phosphatidylcholine, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol, phosphatidylethanolamine, phosphatidic acid, cardiolipin, sphingomyelin, egg yolk lecithin, soybean In addition to natural phospholipids such as lecithin and lysolecithin, or those hydrogenated by conventional methods, distearoyl phosphatidylcholine, dipalmitoyl phosphatidylcholine, dipalmitoyl phosphatidylethanolamine, dipalmitoyl phosphatidylserine, eleostearoyl phosphatidylcholine, eleostearoyl phosphatidylethanol Amine, eleostearoyl phosphatidylserine Like synthetic phospholipids of. It is desirable to use phospholipids in combination with lipids having various degrees of saturation. In addition, cholesterols include cholesterol, phytosterol, and the like, and examples of fatty acids include oleic acid, palmitooleic acid, linoleic acid, and fatty acid mixtures containing these unsaturated fatty acids. Liposomes containing unsaturated fatty acids with small side chains are effective in producing small liposomes because of curvature.

  Liposomes preferably include at least one of pH-sensitive lipids (eg, CHEMS), membrane-permeable peptides, and cationic lipids for escape of siRNA from endosomes. Cationic lipids include DC-6-14 (O, O'-ditetradecanoyl-N- (α-trimethylammonioacetyl) diethanolamine chloride), DODAC (dioctadecyldimethylammonium chloride), DOTMA (N- (2,3-dioleyloxy) propyl-N, N, N-trimethylammonium), DDAB (didodecylammonium bromide), DOTAP (1,2-dioleoyloxy-3-trimethylammoniopropane), DC-Chol (3β-N- (N ', N',-dimethyl-aminoethane) -carbamol cholesterol ), DMRIE (1,2-dimyristoyloxypropyl-3-dimethylhydroxyethyl ammonium), DOSPA (2,3-dioleyloxy-N- [2 (sperminecarboxamido) ethyl] -N, N-dimethyl-1-propanaminum trifluoroacetate) and the like.

In one preferred embodiment, the liposome of the present invention comprises a cationic lipid, a phospholipid, and cholesterol. As these ratios, 100 parts by weight of the whole liposome, cationic lipid: 10 to 60 parts by weight, preferably 20 to 50 parts by weight, more preferably 30 to 40 parts by weight,
Phospholipid: 10-50 parts by weight, preferably 15-45 parts by weight, more preferably 20-40 parts by weight,
Cholesterol: 10-50 parts by weight, preferably 15-45 parts by weight, more preferably 20-40 parts by weight.

As the phospholipid, a phospholipid modified with PEG such as DSPE-PG10G and DSPE-PEG350 can also be used.
An example of a method for producing a composite particle of liposome and BNC is explained in detail. For example, the above-mentioned phospholipid, cholesterol, etc. are dissolved in an appropriate organic solvent, and the solution is placed in an appropriate container and the solvent is distilled off under reduced pressure. Then, a phospholipid membrane is formed on the inner surface of the container, and an aqueous solution, preferably a buffer solution, is added thereto and stirred to obtain liposomes. Liposome and BNC composite particles can be obtained by directly or lyophilizing the liposome and then mixing with BNC (direct fusion method). As another method, for example, the above-described phospholipid, cholesterol, and the like are dissolved in a suitable organic solvent, put in a suitable container, and the solvent is distilled off under reduced pressure to form a phospholipid film on the inner surface of the container. Or hydrate in an aqueous medium to produce liposomes. Freeze-thaw the prepared liposomes, adjust the size by ultrasonic treatment, and add a surfactant. A composite particle of liposome and BNC can also be obtained by mixing a BNC solution containing a surfactant and dialysis treatment (surfactant method). Surfactants include MEGA-8, MEGA-9, MEGA-10, n-octyl-α-D-glucopyranoside, n-octyl-α-D-thioglucoside, n-heptyl-β-D. -Thioglucoside, Triton X-100, Tween 20, Tween 80, N-lauroylsarcosine-sodium salt, lithium dodecyl sulfate, sodium cholate, sodium deoxycholate, SDS, cetylpyridinium chloride, CTAB, CHAPS, CHAPSO, sulfobetaine And SB10 and sulfobetaine SB16.

  In the case of fusion of liposome and BNC by the surfactant method, the concentration of the surfactant is about 0.1 to 5%, preferably about 0.5 to 2%. In this case, BNC is used in an amount of about 0.01 to 0.5 parts by weight, preferably about 0.02 to 0.1 parts by weight, and liposome is used in an amount of about 0.03 to 10 parts by weight, preferably about 0.06 to 5 parts by weight, per 100 parts by weight of a solvent such as water. The The temperature at the time of carrying out the surfactant method is preferably about 5 to 75 ° C., preferably about 10 to 60 ° C., for 10 minutes to 6 hours, preferably about 20 minutes to 3 hours.

  In the case of the direct fusion method, BNC is used in an amount of about 0.005 to 0.5 parts by weight, preferably about 0.02 to 0.2 parts by weight per 100 parts by weight of a solvent such as water, and the liposome is about 0.01 to 10 parts by weight, preferably 0.03 to 5 parts by weight. Used to a degree. The temperature at the time of carrying out the direct fusion method is about 0 to 50 ° C., preferably about 0 to 40 ° C., and preferably 1 to 120 minutes, preferably about 2 to 60 minutes.

  EXAMPLES Hereinafter, although this invention is demonstrated in detail based on an Example, it cannot be overemphasized that this invention is not limited to these Examples.

Experimental method
BNC replaces HBsAg (L protein) with HBsAg (Q129R, G145R) in which Gln at position 129 of L protein described in Example J of JP-A-2001-316298 is substituted with Arg and Gly at position 145 is substituted with Arg. According to the description in JP-A-2007-209307, the recombinant BNC-expressing yeast was purified using AKTA (GE healthcare Bioscience co., Japan) as a starting material. Cholesterol from Wako Pure Chemical Industries, Ltd. (Osaka, Japan), dioleoylphosphatidylethanolamine (DOPE), distearoylphosphatidylethanolamine-polyglycerine (DSPE-PG) and liposomes (Coatsome EL-01-D) from NOF corporation (Tokyo, Japan), DC -6-14 was purchased from Sogo Pharmaceutical Co. Ltd. (Tokyo, Japan). 1,2-Dioleoyloxy-3-trimethylammoniumpropane chloride (DOTAP) was purchased from Sigma Aldorich Japan (Tokyo, Japan). 3-[(3-Cholamidopropyl) dimethylammonio] propanesulfonate (CHAPS), 3-[(3-Cholamidopropyl) dimethylammonio] -2-hydroxypropanesulfonate (CHAPSO), n-Nonanoyl-N-methyl-D-glucamine (MEGA-9), n-Octyl-β-D-glucopyranoside (OG) was purchased from DOJINDO LABORATORIES (Kumamoto, Japan).

  Luciferase siRNA is described in a known paper (Elbashir, SM, Harborth, J., Lendeckel, W., Yalcin, A., Weber, K and Tuschl, T. (2001) Nature, 411 (6836), 494-498). The sequence (sense strand: CUUACGCUGAGUACUUCGAdTdT, antisense strand: UCGAAGUACUCAGCGUAAGdTdT, dT is deoxythymidine) was synthesized and used at GeneDesign, Inc. (Osaka, Japan). As siRNA for Negative control, siRNA purchased from Silencer Negative Control # 1 siRNA (Ambion, Applied Biosystems Japan Ltd. (Tokyo, Japan)) or scrambled sequence of luciferase siRNA (sense strand: UCGCGCGAUCAAUUAGUCUdTdT, antisense strand: AGACAUAUGUGCGCGCGAdTdT, dT deoxythymidine) was synthesized by B-Bridge International, Inc. (Mountain View, CA).

  For siRNA against GAPDH, Silencer GAPDH siRNA (Human) (Ambion) was purchased from Applied Biosystems Japan Ltd. (Tokyo, Japan). In this case, Silencer negative control # 1 siRNA (Ambion) was used as the negative control siRNA.

  Small DNA (sDNA) and 5'-carboxyfluoresceinlabeled-small DNA (FAM-sDNA) were designed as DNA sequences similar to luciferase siRNA (sense strand: CTTACGCTGAGTACTTCGATT or FAM-CTTACGCTGAGTACTTCGATT, antisense strand: TCGAAGTACTCAGCGTAAGTT), Sigma Aldrich Japan ( (Tokyo, Japan). The synthesized sense strand and antisense strand were heat denatured at 95 ° C., and then the temperature was gradually lowered to room temperature to form a double strand.

cell
HepG2 / luc (human hepatocellular carcinoma expressing firefly luciferase gene, obtained from S. Kuroda, Osaka University) cells, A549 / luc (human lung adenocarcinoma epithelial cell line expressing firefly luciferase gene, obtained from S. Kuroda, Osaka University) cells , HUH-7 (human hepatocellular carcinoma, assigned by Keio University) cells were cultured in Dulbecco's modified MEM medium supplemented with 10% fetal bovine serum (FBS) at 37 ° C in 5% CO ₂ .

Preparation of siRNA / BNC / liposome composite particles
The siRNA / BNC / liposome composite particles can be roughly divided into two methods. One is mixing liposome and BNC in the presence of surfactant, forming the BNC / liposome complex by removing the surfactant by dialysis, and adding siRNA to siRNA / BNC / liposome complex particles. This is called a surfactant method. Another method is to first encapsulate siRNA in liposomes (including commercially available introduction reagents) and then mix BNC to produce siRNA / BNC / liposome composite particles. Call it.

Particle Size and Surface Potential Analysis The particle size was measured at 25 ° C. using a dense particle size analyzer FPAR-1000 (Otsuka Electronics Co., Ltd., Osaka, Japan) and was based on cumulant analysis. The surface charge was measured at 25 ° C. using Zetasizer Nano-ZS (Malvern Instruments Ltd., UK).

BNC-liposome fusion analysis by density gradient centrifugation The BNC / liposome complex and unfused BNC are separated by cesium chloride density gradient centrifugation, and the BNC and lipid content of each fraction is detected by detecting the BNC and lipid content of each fraction. Fusion status was tested. Prepare a solution in which 10, 20, 30, 40% cesium chloride is pumped into HEPES buffer (10 mM HEPES, 100 mM NaCl, 100 mM sucrose), and 10-40% density gradient (10%; 2.6 ml, 20% 2.6 ml, 30%; 3 ml, 40%; 3 ml), and the sample was placed on the upper layer and centrifuged at 4 ° C. and 24,000 rpm for 16 hours (Himac CP 70MX; rotor P28S, Hitachi Koki Co., Ltd., Tokyo, Japan). From the upper layer, 1 ml was collected as one fraction, and the BNC amount and cholesterol amount of each fraction up to the 10th fraction were assayed using SDS-PAGE and colorimetric determination, respectively. Cholesterol E-test (Wako Pure Chemical Industries, Ltd., Osaka, Japan) was used for colorimetric determination of cholesterol, and absorbance at 600 nm was measured with a spectrophotometer (U-2810, Hitachi, Ltd., Tokyo, Japan). It measured using.

  In order to evaluate the inclusion state of siRNA, FAM-sDNA / liposome / BNC composite particles were formed using FAM-sDNA as a substitute for siRNA, and similarly subjected to cesium chloride density gradient centrifugation, and the fluorescence intensity of the fraction (excitation wavelength) 485 nm / fluorescence wavelength 520 nm) was measured using FLUOstar OPTIMA (BMG LABTEC, Offenburg, Germany) to detect FAM-sDNA.

Analysis of siRNA encapsulation efficiency
The efficiency and amount of siRNA encapsulated in the BNC / liposome complex were determined using the Picogreen assay method described in a known paper (Ferrari ME, Nguyen CM, Zelphati O., Tsai Y., Felgner PL, Ferrari ME, Nguyen CM, Zelphati O , Tsai Y. and Felgner PL (1998) Hum. Gene Ther. 9 (3), 341-351). That is, liposomes or BNC / liposome complexes encapsulating siRNA or sDNA were diluted with HEPES buffer A (10 mM HEPES, 300 mM sucrose, pH 7.4) and HEPES buffer B (+ 0.1% Triton X-100), respectively. Quant-iT RiboGreen RNA reagent (Invitrogen Japan KK, Tokyo, Jpan) diluted 200-fold with HEPES buffer A was added to these dilutions (50 μl), and the fluorescence intensity (excitation wavelength 485) was measured using a 96-well plate. nm / fluorescence wavelength of 520 nm). FLUOstar OPTIMA (BMG LABTEC, Offenburg, Germany) was used for fluorescence measurement. The encapsulation efficiency (%) was calculated by the following formula.

Inclusion efficiency (%) = (B−A) / B × 100
A (Fluorescence intensity in the group without Triton X-100) B (Fluorescence intensity in the group with Triton X-100 added)
The amount of encapsulation was calculated by multiplying the amount of siRNA added by the encapsulation efficiency (%).

Analysis of Luciferase expression knockdown effect
day before HepG2 / luc cells the addition of siRNA / liposome / BNC complex, were seeded in 96-well plates A549 / luc cells at a density of each ^{1 × 10 4 / 100μl / well} . Two days after the addition of the siRNA / BNC / liposome complex, the medium was removed, washed three times with PBS, and the cells were lysed with 20 μl of Cell Culture Lysis Reagent (Promega KK, Tokyo, Japan). The luciferase enzyme activity was measured using a Luciferase assay system (Promega KK, Tokyo, Japan). 50 μl substrate solution was added to the cell lysate and the resulting chemiluminescence was measured using FLUOstar OPTIMA (BMG LABTEC, Offenburg, Germany). In addition, protein quantification (using Micro BCA protein assay reagent (Pierce, Rockford, IL)) was performed using a part of the cell lysate, and the specific activity (count / μg protein) was calculated based on this quantified value. . In addition, the specific activity of the experimental group using luciferase siRNA was calculated as a relative activity when the specific activity of the experimental group using negative control siRNA as 100% was taken as 100%, and used as an index of the knockdown effect.

Analysis of GAPDH expression knockdown effect by quantitative real-time PCR
The day before the addition of the GAPDH siRNA / liposome / BNC complex, HuH-7 cells were seeded in 24-well plates at a density of 4 × 10 ⁴ / well. Two days after the addition of the siRNA / BNC / liposome complex, the medium was removed, and the cells were lysed with 300 μl of Trizol Reagent (Invitrogen Japan KK, Tokyo, Jpan) to purify the RNA. 1 μg of RNA was reverse transcribed using ReverTra Ace qPCR RT kit (TOYOBO CO., LTD, Osaka, Japan) to synthesize cDNA. Real-time PCR was performed on GAPDH and Actin using LightCycler 2.0 (Roche Diagnostics KK, Tokyo, Japan) using the synthesized cDNA as a template. CYBBR Green real-time PCR Master Mix-plus (TOYOBO CO., LTD, Osaka, Japan) was used for the reaction. Primer sequences for GAPDH and Actin were GAPDH-F: GAGTCAACGGATTTGGTCGT, GAPDH-R: GATCTCGCTCCTGGAAGATG, Actin-F: TCCCTGGAGAAGAGCTACGA, Actin-R: AGCACTGTGTTGGCGTACAG, and the measurement conditions were 95 ° C, 1 min / (95 ° C, 5 sec / (55 ° C, 5 sec / 72 ° C, 15 sec) 40 cycles. The expression level of GAPDH was calculated by dividing the expression level of GAPDH by the expression level of Actin as a control (GAPDH / Actin), and the knockdown effect was evaluated.

Animals Animals purchased ICR mice 5 weeks old (Charles River Japan) for tests to check for blood retention, BALB / c nude mice 5 weeks old (Charles River Japan) for in vivo Luciferase assay Each was used after acclimatization for a certain period.

In vivo luciferase assay
Ten to the 5th power of a human-derived luciferase stable expression strain (HepG2 Luc) was transplanted to the mouse liver site with an injection needle and bred for 1 week. Then, it used for evaluation using the animal which was able to confirm stable engraftment by the following in vivo Luciferase assay.

  For in vivo luciferase asay, 400 μL (Pormega), a luminescent substrate, was administered intraperitoneally to mice, and chemiluminescence due to the luciferase-luciferin reaction was measured by IVIS (registered trademark) Imaging System (Xenogen). The measurement was performed under 2% isoflorane anesthesia, and the observed value was obtained by averaging the measured values for 10 to 15 minutes from 1 minute after administration of the substrate.

Example 1 Preparation of BNC / liposome composite particles and its effect (surfactant method)
<Preparation of BNC / liposome composite particles and liposomes by surfactant method>
A lipid film was prepared by mixing DC-6-14, DOPE, and cholesterol in chloroform at a ratio of 4: 3: 3 (molar ratio) and drying in nitrogen while heating at 60 ° C. 1 ml of HEPES buffer (10 mM Hepes, 100 mM NaCl, 100 mM Sucrose, pH 7.4) was added to the prepared lipid film (total lipid 15 mg), hydrated, freeze-thawed (freeze with liquid nitrogen, thawed in a 37 ° C constant temperature water bath) ) Was repeated 5 times. The freeze-thawed liposome was sonicated for 15 minutes at an output of 4.8 kHz using an ultrasonic crusher (VC750, SONICS & MATERIALS, INC., CT, USA). CHAPS (final concentration 2%) and HEPES buffer were added to the sonicated liposomes to a lipid concentration of 3 mg / ml and incubated at 37 ° C. for 3 hours. BNC was dissolved in HEPES buffer containing 2% CHAPS and 20 mM DTT to 1 mg protein / ml, incubated at 60 ° C. for 10 minutes, and further incubated at 37 ° C. for 3 hours. After incubation, each was mixed and the size was adjusted using an extruder (Northern Lipid Inc., BC, Canada). A dialysis membrane (dialysis molecular weight 12,000 to 16,000, Sanko Junyaku Co. Ltd., Tokyo, Japan) was filled with the mixed solution, and dialyzed against HEPES buffer (5 L × 4 times) at room temperature for 24 hours. Control liposomes were prepared by the same method as above except that BNC was added (instead, HEPES buffer was added).

The BNC / liposome composite particles after dialysis were analyzed by cesium chloride density gradient centrifugation. As a result, BNC / liposome complexes were mainly confirmed in fraction 5-7 (FIG. 1A).
<SiRNA inclusion>
As a result of adding 1 μl of siRNA solution (50 pmol / μl) to 10 μl of the obtained BNC / liposome composite particles (liposome 15 μg, BNC 5 μg) and examining the efficiency of siRNA encapsulation by Ribogreen assay, 81.4-99.2 %Met. FAM-sDNA was added at the same ratio, and the distribution of FAM-sDNA was examined by cesium chloride density gradient centrifugation. As a result, FAM-sDNA was consistent with the fraction of BNC / liposome composite particles (fractions 4-7). (FIG. 1B).
<Knockdown effect>
The prepared siRNA / liposome / BNC complex 4 μl (6 μg liposome, 2 μg BNC, 20 pmol siRNA) and siRNA / liposome complex (6 μg liposome, 20 pmol siRNA) were added to HepG2 / luc cells and A549 / luc cells, respectively. As siRNA, luciferase siRNA or Silencer Negative Control # 1 siRNA was used, respectively. One hour after the addition, the medium was removed, and a new medium was added at 100 μl / well, followed by culturing at 37 ° C. for 2 days. The luciferase specific activity after 2 days is shown in FIG. The Luciferase siRNA / liposome complex inhibited luciferase activity by 61% and 57%, respectively, against HepG2 / luc cells and A549 / luc cells, and the expression suppression effect was almost the same (FIG. 2A). On the other hand, luciferase siRNA / liposome / BNC complex added with BNC suppressed luciferase activity, but the inhibition rate was 92% in HepG2 / luc cells and 34% in A549 / luc cells, and HepG2 / luc cells. Was particularly effective (FIG. 2B).

Example 2 Preparation of BNC / liposome composite particles and its effect (surfactant method) -2
Instead of the lipid composition shown in Example 1, DC-6-14, DOPE, cholesterol, DSPE-PG were prepared at a 3: 3: 3: 1 (molar ratio) BNC / liposome composite particle.
<Preparation of BNC / liposome composite particles by surfactant method>
DC-6-14, DOPE, cholesterol and DSPE-PG were mixed in chloroform at a ratio of 3: 3: 3: 1 (molar ratio) and dried in nitrogen while heating at 60 ° C. to prepare a lipid film. 1 ml of HEPES buffer (10 mM Hepes, 100 mM NaCl, 100 mM Sucrose, pH 7.4) is added to the prepared lipid film (total lipid 15 mg) to hydrate, and after freezing and thawing, the liposome is sonicated by an ultrasonic crusher (VC750, SONICS). & MATERIALS, INC., CT, USA) for 15 minutes at 4.8 kHz output. CHAPS (final concentration 2%) and HEPES buffer were added to the sonicated liposomes to a lipid concentration of 3 mg / ml and incubated at 37 ° C. for 3 hours. BNC was dissolved in HEPES buffer containing 2% CHAPS and 50 mM glutathione (reduced form) to 1 mg protein / ml, incubated at 60 ° C. for 10 minutes, and further incubated at 37 ° C. for 3 hours. After incubation, each was mixed and the size was adjusted using an extruder (Northern Lipid Inc., BC, Canada). A dialysis membrane (dialysis molecular weight 12,000 to 16,000, Sanko Junyaku Co. Ltd., Tokyo, Japan) was filled with the mixed solution, and dialyzed against HEPES buffer (5 L × 4 times) at 4 ° C. for 2 days.

As a result of adding 1 μl of siRNA solution (50 pmol / μl) to 10 μl of BNC / liposome composite particles after dialysis (liposome 15 μg, BNC 5 μg) and examining the efficiency of siRNA encapsulation by Ribogreen assay, 64.7-69.2 %Met.
<Knockdown effect>
The prepared siRNA / liposome / BNC complex 4 μl (6 μg liposome, 2 μg BNC, 20 pmol siRNA) was added to HepG2 / luc cells and A549 / luc cells, respectively. As the siRNA, luciferase siRNA or netative control siRNA was used. One hour after the addition, the medium was removed, and a new medium was added at 100 μl / well, followed by culturing at 37 ° C. for 2 days. The luciferase specific activity after 2 days is shown in FIG. The luciferase siRNA / liposome / BNC complex suppressed luciferase activity in any cell, but the inhibition rate was 62% for HepG2 / luc cells and 13% for A549 / luc cells, which was particularly effective in HepG2 / luc cells. (Figure 3).

Example 3 Preparation of BNC / liposome composite particles and their effects (direct fusion method)
<Preparation of siRNA / BNC / liposome composite particles>
Coatsome EL-01-D, a commercially available liposome for gene transfer, was dissolved in 1 ml of sterile distilled water to adjust the lipid concentration to 1.5 mg / ml. 270 μl of luciferase siRNA (5 nmol / ml) or Silencer Negative Control # 1 siRNA (5 nmol / ml) solution was added to 540 μl of this liposome solution and mixed. Add 54 μl each of BNC solution (1, 0.5, 0.25 mg / ml in HEPES buffer (10 mM HEPES, 100 mM NaCl, pH 7.4)) to this siRNA / liposome solution (54 μl) and incubate at room temperature for 15 minutes. BNC / liposome composite particles were formed.

<Knockdown effect>
72 μl of low-serum medium Opti-MEM I (Invitrogen Japan KK, Tokyo, Japan) was mixed with 108 μl of siRNA / BNC / liposome complex solution, and 20 μl per well (lipid 6 μg, siRNA 10 pmol, BNC 1.5-6) μg) was added to the cells. One hour after the addition, the medium was removed, and a new medium was added at 100 μl / well, followed by culturing at 37 ° C. for 2 days. The specific activity and relative activity of luciferase after 2 days are shown in FIG. 28-47% remarkable luciferase activity only in HepG2 / luc cells in any of the three siRNA / BNC / liposome complex solutions (liposome: BNC = 4: 1, 2: 1, 1: 1) with different fusion ratios A549 / luc cells did not decrease at all, or the decrease was not significant (110-77%). From the above results, it can be said that the BNC / liposome composite particles prepared by the direct fusion method show a knockdown effect selectively in hepatocytes (FIG. 4).

Example 4 Preparation of BNC / liposome (cholesterol / DOTAP) composite particles (direct fusion method) and effects thereof <Preparation of siRNA / BNC / liposome composite particles>
A lipid film was prepared by mixing DOTAP and cholesterol in chloroform at a 1: 1 ratio (molar ratio) and drying in nitrogen while heating at 60 ° C. The prepared lipid film (total amount of lipid 11.6 mg) was hydrated by adding 2 ml of sterile distilled water, and the size of the liposome after freeze-thawing was adjusted using an extruder. The prepared liposomes were diluted to 3.2 mg / ml with sterile distilled water, 34 μl of 50 pmol / μl siRNA solution was added to 108.5 μl of diluted liposome solution, and the siRNA was encapsulated in the liposomes by incubating at room temperature for 5 minutes. . As siRNA, luciferase siRNA or negative control siRNA was used. A siRNA / liposome / BNC complex was formed by mixing 323.4 μl of a 1 mg / ml BNC solution with 142.5 μl of siRNA-encapsulated liposomes and incubating at room temperature for 5 minutes.
<Knockdown effect>
The prepared siRNA / liposome / BNC complex was added to cells at 20, 10, 5 pmol / well as siRNA amounts. One hour after the addition, the medium was removed, and a new medium was added at 100 μl / well, followed by culturing at 37 ° C. for 2 days. The specific activity of luciferase after 2 days is shown in FIG. The luciferase siRNA / liposome / BNC complex suppresses luciferase activity to 27-47% in HepG2 / luc cells at any added amount (5-20 pmol siRNA / well), and 85-90% remains in A549 / luc cells However, no significant suppression was observed (Fig. 5).

Example 5 Preparation of BNC / liposome composite particles and their effects (direct fusion method, target gene: GAPDH)
<Preparation of siRNA / BNC / liposome composite particles>
Coatsome EL-01-D, a commercially available liposome for gene transfer, was dissolved in 1 ml of sterile distilled water to adjust the lipid concentration to 1.5 mg / ml. 40 μl of this liposome solution was dispensed and lyophilized. Lyophilized liposomes were hydrated with 40 μl GAPDH siRNA solution or negative control siRNA solution (12.5 pmol / μl) and incubated at room temperature for 15 minutes. siRNA / liposome / BNC complex was formed by mixing 120 μl of BNC solution (500, 125, 62.5, 31.25 μg / ml) with siRNA-encapsulated liposomes and incubating at room temperature for 15 minutes.

<Knockdown effect>
840 μl of OptiMEM I was added to 160 μl of the prepared siRNA / liposome / BNC complex solution to make a total volume of 1 ml. The diluted solution was added to HUH-7 cells at 60 μl / well, and RNA was purified from the cells two days after the addition to synthesize cDNA. As a result of analyzing the expression of the GAPDH gene using the quantitative real-time PCR method with the expression level of the Actin gene as a control, GAPDH siRNA / liposome / BNC was added to the expression level of the control group to which the negative control siRNA / liposome was added. In the ward, the expression level of GAPDH gene decreased to 40.4-54.4%.

Example 6
For siRNA / BNC / liposome composite particles using surfactant method and direct fusion method, including those described in Example 1-5, siRNA inclusion efficiency of siRNA / BNC / liposome composite particles prepared under various conditions The knockdown effect is shown in Table 1.

  As can be seen from the table, in the surfactant method, high encapsulation efficiency was obtained at various concentrations of various surfactants, and as a result of in vitro evaluation, a knockdown effect was also obtained in all cases. On the other hand, in the direct fusion method, a high knockdown effect was obtained at various mixing ratios of Lipid and BNC having various lipid compositions. In addition, although the value of the commercially available introduction reagent for siRNA is shown as reference, it turns out that the knockdown effect of BNC and a Liposome complex shows an effect | action equivalent to a commercially available reagent.

Example 7 Effect of BNC on blood retention
<Preparation of doxorubicin (DXR) / BNC / liposome (BNC-D)>
DPPC, DPPE, DPPG-Na and Cholesterol dissolved in chloroform were mixed at a ratio of 15: 15: 30: 40 (molar ratio) and dried in nitrogen while heating at 60 ° C. to prepare a lipid film. . The prepared lipid film was hydrated with 10 mM Hepes buffer / 120 mM ammonium sulfate (pH 4), and freeze-thawed and an extruder was used to produce Liposome containing 120 mM ammonium sulfate. DXR was added to the prepared Liposome at a ratio of lipid: DXR of 15: 1.2 (weight ratio), and doxorubicin was encapsulated inside Liposome by a pH gradient method (Liposome-D). The produced Liposome-D was subjected to gel filtration to remove unencapsulated DXR.

BNC was mixed with the prepared Liposome-D at a certain ratio to prepare BNC-D.
<Confirmation of blood retention>
Administration samples were doxorubicin (DXR), Liposome-D, BNC-D, and commercially available DXR-encapsulated PEG-modified liposomes (DOXIL). These characteristics are shown in Table 2.

5-week-old ICR mice were administered DXR, Liposome-D, BNC-D and DOXIL as DXR at a dose of 8 mg / kg from the tail vein. Blood collection was performed under anesthesia at 30, 60, 120 and 180 minutes after administration, and the collected blood was performed at 4 ° C., 3000 rpm, 10 min to obtain plasma, and blood DXR concentration was measured by HPLC method. The change in DXR concentration was used as an indicator of blood retention. FIG. 6 shows the blood concentration over time in each administration sample. In the case of single administration of DXR, the blood DXR concentration rapidly decreased immediately after administration, and almost disappeared from the blood 30 minutes after administration. Liposome-D disappeared later than DXR alone, but almost disappeared from the blood 120 minutes after administration. The blood concentrations of BNC-D and DOXIL were high up to 180 minutes after administration. From these results, the retention of DXR in the blood was higher in the order of DOXIL> BNC-D >> Liposome-D >> DXR alone. This result indicates that BNC has an action to improve the blood retention because BNC is fused with Liposome-D to increase the blood concentration.
When the particle size of BNC-D was 185 nm and the surface charge was approximately −1.0 mV, the blood retention was low, and it became 1.0 μg / ml or less 120 minutes after administration. From the above, it can be seen that surface charge and particle size are important for blood retention.

Example 8
Safety data
In vitro safety of BNC-liposome encapsulating siRNA was confirmed. BNC-liposome encapsulating siRNA targeting luciferase (direct fusion method, DC-6-14 containing 10% polyglycerol, DOPE, cholesterol was fused to liposomes with a composition of 4: 3: 3 (molar ratio). ), BNC-liposome (surfactant method, DC-6-14 containing 10% polyglycerol, DOPE, BNC-liposome prepared by adding surfactant to liposomes with cholesterol), and liposome (DC containing 10% polyglycerol) -6-14, liposomes with DOPE and cholesterol composition) was added to the two types of cells that stably expressed luciferase, A549 and HepG2 cells in the range of 0.375 to 6.0 μg of lipid, and the cells were washed 1 hour after addition. The protein after 48 hours was confirmed. As a result, it was confirmed that the amount of protein when Blank added with vehicle alone was 100 was in the range of about 80% to 120% in any group, and there was almost no cytotoxicity due to BNC-liposome or liposome. It was done.

Example 9 in vivo Luciferase assay
<Preparation of siRNA / BNC / liposome composite particles>
DC-6-14, DOPE, and cholesterol were mixed in chloroform at a ratio of 4: 3: 3 (molar ratio) and dried in nitrogen while heating at 40 ° C. to prepare a lipid film. The prepared lipid film (total amount of lipid 60.32 mg) was hydrated by adding 8 ml of sterile distilled water, and the size of the liposomes after freeze-thawing was adjusted using an extruder. The prepared liposomes were diluted to 1.5 mg / ml with sterilized distilled water, 800 μl of 5 pmol / μl siRNA solution was added to 1600 μl of the diluted liposome solution, and the siRNA was encapsulated in the liposomes by incubating at room temperature for 5 minutes. As siRNA, luciferase siRNA or Scrambled sequence siRNA was used as a negative control. 2400 μl of siRNA-encapsulated liposome solution was mixed with 2400 μl of BNC solution (2 mg / ml) and allowed to stand on ice to form a siRNA / liposome / BNC complex. The prepared complex was concentrated by centrifugation using Amicon Ultracel-100k (Millipore), and filtered through Millex-HV (Millipore, 0.45 μm). FIG. 7 shows a graph of the average particle diameter value by cumulant analysis and the scattering intensity distribution by histogram analysis (Marquadt), and Table 3 shows the characteristics.

<Confirmation of effects in cultured cells>
The siRNA / BNC / liposome complex was compared in gene expression knockdown effect with HepG2 Luc (human hepatocytes) and A549 Luc (human lung epithelial cells). As a control, siRNA / liposome added with BNC dilution buffer was used instead of BNC.

As a cell, HepG2 Luc and A549 Luc were both seeded in a 96-well plate at 1.0 × 10 ⁴ cells / 100 μL, and the following operation was performed one day after the culture. That is, siRNA / liposome / BNC (equivalent to siRNA 10 pmol / well) was added to the medium, and the medium was changed after 1 hour. Two days after the addition, the medium was removed, the cells were lysed after washing with PBS, luciferase activity measurement and protein mass measurement were performed, and the luciferase specific activity was evaluated. Luc siRNA / liposome resulted in a weak decrease in luciferase activity in both cells, but the effect of siRNA / BNC / liposomes with BNC added was strong in human hepatocytes (FIG. 8).
<Confirmation of siRNA introduction effect in vivo>
The luminescence intensity of the HepG2 Luc transplanted tissue before administration of the transplanted mice was observed using an in vivo imaging system, and immediately after that, an siRNA / BNC / liposome complex was administered as an siRNA amount from the tail vein at a dose of 36 μg / mouse. Two days after administration, the luminescence intensity of the transplanted tissue was measured under the same conditions as before administration. FIG. 9 shows a photograph of the luminescence intensity before administration and 2 days after the administration, and the change rate of the luminescence intensity.

In animals treated with the control siRNA / BNC / liposome complex, the intensity of luminescence by the in vivo Luciferase Assay was almost the same as before administration, but in animals treated with the Luc siRNA / BNC / liposome complex. The luminescence intensity decreased 2 days after administration. 2 days after administration, the Luc activity was 46%, and 54% suppression was observed. When the same experiment was performed using the surfactant method, the Luc activity 2 days after administration had a knockdown effect of 64% compared to the control group.
<Examination of duration of effect of siRNA>
The duration of the in vivo siRNA knockdown effect upon administration of the Luc siRNA / BNC / liposome complex was examined. Luc siRNA / BNC / liposome complex was intravenously administered to HepG2-transplanted mice, and the luminescence intensity was measured 3 days, 6 days, 9 days and 12 days after the administration, and the rate of change was shown (FIG. 10). On the 3rd and 6th days after administration of the Luc siRNA / BNC / liposome complex, the luminescence intensity by the in vivo Luciferase Assay is clearly lower than the pre-dose value compared to the pre-dose value, and the knockdown effect by Luc siRNA was observed. It has been. The luminescence intensity increased after the 9th day of administration, which is considered to be a result of the growth of the transplanted human liver tumor.

参考文献
特開２００７−２０９３０７（Ｐ２００７−２０９３０７Ａ）
（Kuroda, S., Otaka, S., Miyazaki, T., Nakao, M., and Fujisawa, Y. (1992) J. Biol. Chem. 267 (3), 1953-1961）
（Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K and Tuschl, T. (2001) Nature 411 (6836), 494-498）
(Ferrari M. E., Nguyen C. M., Zelphati O., Tsai Y., Felgner P. L., Ferrari M. E., Nguyen C. M., Zelphati O., Tsai Y. and Felgner P. L. (1998) Hum. Gene Ther. 9 (3), 341-351)

Sato Y, Murase K, Kato J, Kobune M, Sato T, Kawano Y, Takimoto R, Takada K, Miyanishi K, Matsunaga T, Takayama T, Niitsu Y.
Resolution of liver cirrhosis using vitamin A-coupled liposomes to deliver siRNA against a collagen-specific chaperone.
Nat Biotechnol. 2008 Apr;26(4):431-42.

Soutschek J, Akinc A, Bramlage B, Charisse K, Constien R, Donoghue M, Elbashir S, Geick A, Hadwiger P, Harborth J, John M, Kesavan V, Lavine G, Pandey RK, Racie T, Rajeev KG, Rohl I, Toudjarska I, Wang G, Wuschko S, Bumcrot D, Koteliansky V, Limmer S, Manoharan M, Vornlocher HP.
Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs.
Nature. 2004 Nov 11;432(7014):173-8.

Peer D, Park EJ, Morishita Y, Carman CV, Shimaoka M.
Systemic leukocyte-directed siRNA delivery revealing cyclin D1 as an anti-inflammatory target.
Science. 2008 Feb 1;319(5863):627-30.

References JP2007-209307 (P2007-209307A)
(Kuroda, S., Otaka, S., Miyazaki, T., Nakao, M., and Fujisawa, Y. (1992) J. Biol. Chem. 267 (3), 1953-1961)
(Elbashir, SM, Harborth, J., Lendeckel, W., Yalcin, A., Weber, K and Tuschl, T. (2001) Nature 411 (6836), 494-498)
(Ferrari ME, Nguyen CM, Zelphati O., Tsai Y., Felgner PL, Ferrari ME, Nguyen CM, Zelphati O., Tsai Y. and Felgner PL (1998) Hum. Gene Ther. 9 (3), 341-351 )

Sato Y, Murase K, Kato J, Kobune M, Sato T, Kawano Y, Takimoto R, Takada K, Miyanishi K, Matsunaga T, Takayama T, Niitsu Y.
Resolution of liver cirrhosis using vitamin A-coupled liposomes to deliver siRNA against a collagen-specific chaperone.
Nat Biotechnol. 2008 Apr; 26 (4): 431-42.

Soutschek J, Akinc A, Bramlage B, Charisse K, Constien R, Donoghue M, Elbashir S, Geick A, Hadwiger P, Harborth J, John M, Kesavan V, Lavine G, Pandey RK, Racie T, Rajeev KG, Rohl I , Toudjarska I, Wang G, Wuschko S, Bumcrot D, Koteliansky V, Limmer S, Manoharan M, Vornlocher HP.
Therapeutic silencing of an inherent gene by systemic administration of modified siRNAs.
Nature. 2004 Nov 11; 432 (7014): 173-8.

Peer D, Park EJ, Morishita Y, Carman CV, Shimaoka M.
Systemic leukocyte-directed siRNA delivery revealing cyclin D1 as an anti-inflammatory target.
Science. 2008 Feb 1; 319 (5863): 627-30.

Cesium chloride density gradient centrifugation analysis of liposome (DC-6-14, DOPE, cholesterol = 4: 3: 3) / BNC complex prepared in the presence of 2% CHAPS. (A) liposome / BNC complex (B) 1/10 volume of FAM-sDNA (50 pmol / μl) was added to the liposome / BNC complex. The cholesterol content (absorbance at 600 nm), the fluorescence intensity of FAM-sDNA (EX 485 nm / EM 520 nm) and the BNC content (SDS-PAGE) of each fraction were measured. Liposome (DC-6-14, DOPE, cholesterol = 4: 3: 3) and liposome (DC-6-14, DOPE, cholesterol = 4: 3: 3) / BNC complex prepared by surfactant method The gene expression knockdown effect in HepG2 / luc cells and A549 / luc cells was assayed. A: siRNA was encapsulated in liposome and added to both cells (6 μg phosphor, 20 pmol siRNA). B: siRNA was encapsulated in a leiosome / BNC complex and added to both cells (6 μg phosphor, 2 μg BNC, 20 pmol siRNA). One hour after the addition, the medium was removed, and a new medium was added at 100 μl / well, followed by culturing at 37 ° C. for 2 days. Boxes are luciferase siRNA inclusion (black), negative control Silencer Negative Control # 1 siRNA inclusion (gray), no addition (white), values are luciferase specific activity ± SD (n = 4) 2 days after addition Indicates. SiRNA / liposome prepared by detergent method (DC-6-14, DOPE, cholesterol, DSPE-PG10G = 3: 3: 3: 1) / BNC complex was added to HepG2 / luc cells and A549 / luc cells (6 μg phosphor, 2 μg BNC, 20 pmol siRNA). One hour after the addition, the medium was removed, and a new medium was added at 100 μl / well, followed by culturing at 37 ° C. for 2 days. The boxes indicate the luciferase siRNA inclusion (black), negative control Scrambled sequence siRNA inclusion (grey), and no addition (white), respectively, and the values indicate luciferase specific activity ± SD (n = 4) 2 days after addition. SiRNA / liposome / BNC was prepared using Coatsome EL-01-D, a commercially available liposome, and added to HepG2 / luc cells and A549 / luc cells (lipid 6μg, siRNA 10 pmol, BNC 1.5-6μg / well) . Boxes are luciferase siRNA inclusion (black), negative control Silencer Negative Control # 1 siRNA inclusion (grey), no addition (white), values are luciferase specific activity ± SD (n = 4) 2 days after addition Indicates. The gene expression knockdown effect of siRNA / liposome (DOTAP, cholesterol = 1: 1) / BNC complex in HepG2 / luc cells and A549 / luc cells was assayed. SiRNA was encapsulated in the prepared liposome, and BNC was fused to prepare a siRNA / liposome / BNC complex, which was added to both cells (siRNA 5-20 pmol / well). Each box shows the luciferase siRNA inclusion (black), negative control scrambled sequence siRNA inclusion (gray), no addition (white), and the value shows luciferase specific activity ± SD (n = 5) 2 days after addition. Doxorubicin (DXR), doxorubicin / BNC / liposome (BNC-D), doxorubicin / liposome (Liposome-D) and commercially available PEG-modified doxorubicin / liposome (DOXIL) are administered from the tail vein of mice, and 30, 60, Blood was collected over time at 120 and 180 minutes, and the amount of DXR in the blood was measured. Each measurement point is indicated by DXR concentration ± SD (N = 3). Particle size distribution of siRNA / BNC / liposome for in vivo evaluation The particle size distribution analysis of siRNA / BNC / liposome used in the in vivo luciferase assay is shown. The numerical value in parentheses of each measurement sample name indicates the average particle diameter in nm unit. Knockdown effect of siRNA / BNC / liposomes in cultured cells for in vivo evaluation. Specific activity of luciferase in vitro when siRNA / BNC / liposomes are applied. In vivo effect (comparison with negative control siRNA) Before and after administration of Luc siRNA / BNC / liposome or negative control siRNA / BNC / liposome intravenously administered to luciferase stable expression strain (HepG2) transplanted mice 2 Comparison of daily luciferase luminescence. Comparison of in vivo effects (comparison with negative control siRNA) When Luc siRNA / BNC / liposome or negative control siRNA / BNC / liposome is intravenously administered to luciferase stable expression strain (HepG2) transplanted mice, 100 Change in luminescence intensity after 2 days of administration when%. Duration of knockdown effect after siRNA / liposome / BNC administration 100 before administration when Luc siRNA / BNC / liposome or negative control siRNA / BNC / liposome was intravenously administered to luciferase stable expression strain (HepG2) transplanted mice Change in luminescence intensity after 3, 6, 9 and 12 days after administration.

Claims (13)

siRNA-encapsulated BNC liposome composite particles in which siRNA is encapsulated in composite particles of hollow bio-nanoparticles (BNC) and liposomes containing hepatitis B virus protein or a variant thereof. 2. The siRNA-encapsulated BNC liposome composite particle according to claim 1, wherein the particle diameter of the composite particle is 70 nm to 300 nm. The siRNA-encapsulated BNC liposome composite particle according to claim 1 or 2, wherein the hepatitis B virus protein or a variant thereof includes a targeting portion of a cell, organ or tissue. The siRNA-encapsulated BNC liposome composite particle according to any one of claims 1 to 3, wherein a surface charge of the composite particle is within a range of -5 mV to +5 mV. The siRNA-encapsulated BNC liposome composite particle according to any one of claims 1 to 4, wherein BNC comprises hepatitis B virus protein as a component and siRNA is specifically introduced into hepatocytes. The siRNA-encapsulated BNC liposome composite particle according to any one of claims 1 to 5, wherein the hepatitis B virus protein is HBsAg (Q129R, G145R). The siRNA introduction | transduction agent with respect to the target cell which consists of the composite particle in any one of Claims 1-6, a structure | tissue, and an organ. A method for producing siRNA-encapsulated BNC liposome composite particles, wherein siRNA-encapsulated liposomes and hollow bio-nanoparticles (BNC) comprising hepatitis B virus protein or a variant thereof as a constituent element are complexed. A siRNA-encapsulated BNC comprising a complex of a hollow bio-nanoparticle (BNC) comprising liposome and hepatitis B virus protein or a variant thereof in the presence of a surfactant, and adding siRNA to the complex. A method for producing liposome composite particles. The method for producing siRNA-encapsulated BNC liposome composite particles according to claim 8 or 9, wherein the composite particles have a particle diameter of 70 nm to 300 nm, and a surface charge of the composite particles is within a range of -5 mV to +5 mV. Surfactant is MEGA-8, Triton X-100, Tween 20, Tween 80, N-lauroyl sarcosine-sodium salt, lithium dodecyl sulfate, sodium cholate, sodium deoxycholate, SDS, cetylpyridinium chloride, CTAB, CHAPS, 10. The method of claim 9, selected from the group consisting of CHAPSO, sulfobetaine SB10 and sulfobetaine SB16. The composite particle according to any one of claims 1 to 6, wherein the hepatitis B virus protein or a variant thereof is a hepatitis B virus protein having a PreS1 region or a variant thereof, and the siRNA introduction agent according to claim 7. The manufacturing method in any one of Claims 8-11. The composite particle according to any one of claims 1 to 6, wherein the hepatitis B virus protein or a variant thereof is a hepatitis B virus protein having a PreS1 region and an S region or a variant thereof. The production method according to any one of claims 8 to 11, which is a siRNA introduction agent.

Images