JP2009530377A - Glycosylated G-CSF - Google Patents

Abstract

  The present application relates to granulocyte colony-stimulating factors obtained from eggs produced by transgenic birds having the newly described G-CSF glycosylation pattern.

Description

RELATED APPLICATION INFORMATION This application claims the benefit of US Provisional Patent Application No. 60 / 783,6482006, filed Mar. 17, 2006; and US Provisional Patent Application No. 60 / 840,291, filed Aug. 25, 2006. Insist.

The present invention relates to the introduction of exogenous genetic material into avian cells and the expression of exogenous genetic material in avian cells. The invention particularly relates to transgenic bird species (including chickens, quails and turkeys) and birds that lay eggs containing exogenous proteins such as pharmaceutical proteins.

Background Many natural or synthetic proteins have been applied in diagnosis and therapy; many other proteins are in development or in clinical trials. State-of-the-art protein production methods include isolation from natural sources and recombinant production in bacterial and mammalian cells. However, due to the complexity and high cost of these protein production methods, efforts to develop alternative methods are ongoing. For example, methods for producing exogenous proteins in the milk of pigs, sheep, goats and cows have been reported. These approaches are based on long-term outbreaks between the founders and the generated transgenics, enormous costs for livestock and veterinarians, and the level of expression due to the position of the transgene in the genome at the site of insertion. Has certain limitations, including variation. Proteins are also produced from barley and rye using a grinding and malting process. However, plant post-translational modifications differ from animal post-translational modifications, which often have a significant effect on the function of exogenous proteins such as pharmaceutical proteins.

  Like tissue culture and mammary gland bioreactors, avian oviducts can serve as powerful bioreactors. A successful way to modify avian genetic material so that high levels of exogenous protein are secreted in the oviduct and enveloped in the egg would be mass production of inexpensive proteins. Some advantages of such an approach are: a) short generation time; b) easily increase or decrease product by increasing flock size to meet product needs; c) expressed 4) automated feeding and egg recovery; d) naturally sterile egg white; and e) reduced processing costs due to high concentrations of protein in egg white.

  The avian reproductive system, including the chicken reproductive system, is well documented. The hen's egg consists of several layers that are secreted onto the yolk during passage through the oviduct. Egg production begins with the formation of large yolks in the hen's ovary. Unfertilized oocytes are then located at the upper end of the yolk sac. Upon ovulation or release of yolk from the fallopian tube, the oocyte moves to the fallopian tube funnel where it is fertilized if sperm is present. The oocyte then moves to the tube of the oviduct that is connected to the tubular gland. These cells secrete egg white proteins, including ovalbumin, lysozyme, ovomucoid, conalbumin and ovomucin, into the lumen of the fallopian funnel, where these proteins deposit in avian embryos and yolk.

  The ovalbumin gene is a 45 kD protein that is specifically expressed in the tubular gland cells of the fallopian tube funnel (Beato Cell 56: 335-344 (1989)). Ovalbumin is the most abundant egg white protein and contains more than 50% of the total protein produced by tubular gland cells, or about 4 g per large grade A egg (Gilbert, “Egg albumen and its formation” in Physiology and Biochemistry of the Domestic Fowl, Bell and Freeman, eds., Academic Press, London, NY, pp. 1291-1329). The ovalbumin gene and the flanking adjacent regions of more than 20 kb have been cloned and analyzed (Lai et al., Proc. Natl. Acad. Sci. USA 75: 2205-2209 (1978); Gannon et al., Nature 278: 428-424 (1979); Roop et al., Cell 19: 63-68 (1980); and Royal et al., Nature 279: 125-132 (1975)).

  Much attention has been paid to the regulation of ovalbumin. The gene responds to steroid hormones such as estrogens, glucocorticoids and progesterone, about 70,000 ovalbumin mRNA transcripts per immature chick tubular cell, and 100,000 per mature avian hen tubular gland cells It induces the accumulation of ovalbumin mRNA transcripts (Palmiter, J. Biol. Chem. 248: 8260-8270 (1973); Palmiter, Cell 4: 189-197 (1975)). A 7.4 kb region containing the sequence required for the expression of the ovalbumin gene has been determined by DNAse hypersensitivity analysis and promoter-reporter gene assay in transfected tubular gland cells. This 5 'flanking region contains four DNAse I-hypersensitive sites that are concentrated at -0.25, -0.8, -3.2 and -6.0 from the transcription start site. These sites are called HS-I, -II, -III and -IV, respectively. These regions reflect changes in chromatin structure and are specifically associated with ovalbumin gene expression in oviduct cells (Kaye et al., EMBO 3: 1137-1144 (1984)). The hypersensitivity of HS-II and -III is estrogen inducible and directs the role of these regions in hormone induction of ovalbumin gene expression.

  Both HS-I and HS-II are required for steroid induction of transcription of the ovalbumin gene, and the 5 ′ region 1.4 kb containing these elements is responsible for steroid-dependent ovalbumin in explanted tubular gland cells. It is sufficient to drive expression (Sanders and McKnight, Biochemistry 27: 6550-6557 (1988)). HS-I is referred to as a negative response element (“NRE”) because it contains several negative regulatory elements that suppress ovalbumin expression in the absence of hormones (Haekers et al., Mol. Endo. 9: 1113-1126 (1995)). Protein factors, including several factors found only in the oviduct nucleus, bind to these elements, suggesting a role in tissue-specific expression. HS-II is referred to as a steroid-dependent response element (“SDRE”) because it is required to promote transcriptional steroids. HS-II binds to a protein or protein complex known as Chirp-I. Chirp-I is induced by estrogen and rapidly turns over in the presence of cyclohexamide (Dean et al., Mol. Cell. Biol. 16: 2015-2024 (1996)). Experiments using explanted tubular gland cell culture systems have determined an additional set of factors that bind to SDRE in a steroid-dependent manner, including NFκB-like factors (Nordstrom et al., J. Biol. Chem. 268: 13193-13202 (1993); Schweers and Sanders, J. Biol. Chem. 266: 10490-10497 (1991)).

  Little is known about the function of HS-III and -IV. HS-III contains a functional estrogen response element and confers estrogen inducibility to either ovalbumin proximal promoter or heterologous promoter when estrogen receptor cDNA is co-transduced into HeLa cells. These data imply that HS-III may play a functional role in the overall regulation of ovalbumin. Nothing is known about HS-IV except that it does not contain a functional estrogen response element (Kato et al., Cell 68: 731-742 (1992)).

  There is a great interest in modifying eukaryotic genomes by introducing foreign genetic material and / or disrupting specific genes. Certain eukaryotic cells have been shown to be excellent hosts for the production of exogenous eukaryotic proteins. The introduction of genes encoding specific proteins also allows for the creation of new phenotypes with increased economic value. Furthermore, the introduction of exogenous genes that allow genetically deficient cells to express proteins that would otherwise not be produced by these cells can treat some genetically-induced disease states . Finally, modification of the animal genome by insertion or removal of genetic material allows for basic research of gene function and can ultimately be used to treat disease states or result in improved animal phenotypes It may allow the introduction of genes.

  Genetic recombination has been accomplished in mammals by several different methods. First, in mammals including mice, pigs, goats, sheep and cows, the transgene is microinjected into the pronucleus of the fertilized egg and then put into the uterus of a foster mother where it enters the germline. A founder animal carrying the transgene is born. The transgene is engineered to carry a promoter with specific regulatory sequences that direct the expression of foreign proteins to specific cell types. Since the transgene is randomly inserted into the genome, positional effects on the site of insertion of the transgene into the genome can variably cause a decrease in the expression level of the transgene. This approach also determines the sequences required to direct transgene expression in the desired cell type and requires characterization of the promoter as contained in the transgene vector (Hogan et al. Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory, NY (1988)).

  A second method of effecting genetic recombination in animals is target gene disruption, where the targeting vector containing the sequence of the target gene adjacent to the selectable marker gene is an embryonic stem ("ES") Introduced into cells. By homologous recombination, the targeting vector replaces the target gene sequence at the chromosomal locus or is inserted into an internal sequence that suppresses the expression of the target gene product. ES cell clones with appropriately disrupted genes are selected and then injected into early blastocysts to produce chimeric founder animals, some of which have transgenes in germ cells. When the transgene deletes the target locus, the transgene is an exogenous DNA carrying the locus, a selectable marker useful for detecting transduced ES cells in culture. Which may further comprise a DNA sequence encoding a foreign protein inserted at the location of the deleted gene so that the promoter of the target gene drives the expression of the foreign gene) (US Pat. Nos. 5,464,764 and 5,487,992 (MP Capecchi and KR Thomas)). This approach is limited in that ES cells are not available in many mammals including goats, cows, sheep and pigs. Furthermore, this method is not useful when the deleted gene is required for the survival or proper development of the organism or cell type.

  Recent developments in avian gene recombination have allowed avian genome modification. Germline transgenic chickens can be produced by injecting replication-defective retroviruses into the subgerminal space of chicken blastoderm in freshly born eggs (US Pat. No. 5,162,215; Bosselman et al. , Science 243: 533-534 (1989); Thoraval et al., Transgenic Research 4: 369-36 (1995)). Retroviral nucleic acids carrying foreign genes are randomly inserted into embryonic cell chromosomes to give rise to transgenic animals, some of which have the transgene in their germ cells. The use of insulator sequences inserted into the 5 'or 3' region of the fusion gene construct to overcome position effects on the insertion site has been described (Chim et al., Cell 74: 504-514 (1993)).

  In another approach, the transgene is microinjected into the scutellum of the fertilized egg to produce a stable transduction foundry that allows the gene to span the F1 generation (Love et al., Bio / Technology 12:60 -63 (1994)). However, this method has several disadvantages. The hens must be sacrificed to collect the fertilized eggs, the percentage of transduction founders is small, and the injected eggs require in vitro hard culture in surrogate shells.

  In another approach, blastoderm cells containing hypothetical primordial germ cells (“PGC”) are excised from a donor egg, transduced with a transgene, and introduced into the subembryonic space of a recipient embryo. Transduced donor cells are incorporated into recipient embryos to generate transduced embryos, some of which are expected to have transgenes in germ cells. The transgene is inserted into a random chromosomal site by non-homologous recombination. However, this method has not resulted in a transduction foundry.

Lui, Poult. Sci. 68: 999-1010 (1995) uses a targeting vector containing the flanking DNA sequence of the vitellogenin gene to segment a resident gene in chicken blastoderm cells in culture. Is deleted. However, it has not been shown that these cells can contribute to germ cells and produce transduced embryos. Furthermore, this method is not useful when the deleted gene is required for survival or proper development of the organism or cell type.
Thus, it will be appreciated that there is a need for a method that consists of exogenous DNA operably linked to a suitable promoter and that can introduce DNA into the avian genome and achieve expression of the exogenous gene. In addition, there is a need to create a transgenic bird with a modified germ cell that expresses exogenous genes in the oviduct and secretes the expressed exogenous protein into the egg.

  When interferon was discovered in 1957, it was welcomed as an important antiviral agent. In the late 1970s, interferons were associated with recombinant gene technology. Currently, interferons are a symbol of the complexity of the biological process of cancer and the value of durability and persistence that addresses this complexity.

  Abnormal genes that cause cancer include at least three types: first, an oncogene that, when altered, promotes abnormal growth and differentiation that characterizes cancer. Second, if the tumor suppressor gene is changed, this abnormal growth and differentiation cannot be controlled. Thirdly, if the DNA repair gene is changed, the mutation that can induce cancer cannot be repaired. Researchers believe that there are about 30-40 tumor suppressor genes in the body, and each gene produces a protein. These proteins can be controlled by “major” tumor suppressor proteins such as Rb (initially associated with retinoblastoma) and p53 (associated with many different tumors). Research results suggest that returning only one of these tumor suppressor genes to normal function can substantially reduce the invasiveness of malignant tumors.

  The discovery that interferon inhibits cell growth has led scientists to be interested in interferon. In addition, interferons have been found that interferons have certain positive effects on the immune system. Interferons are currently thought to be similar to tumor suppressor proteins: interferons inhibit the growth of cells, particularly malignant cells; interferons block the effects of many oncogenes and growth factors; other organisms Unlike pharmacological agents, interferons suppress cell motility, which is important for the metastatic process.

  Intercellular communication depends on the normal functioning of all structural components of the tissue (matrix, cell membrane, cytoskeleton, and the cell itself) to which messages are transmitted. In cancer, the communication network between cells is destroyed. If the cytoskeleton is destroyed, the message does not reach the nucleus and the nucleus begins to function abnormally. Since the nucleus is the site where the oncogene or tumor suppressor gene is switched on or off, the cells can lead to this abnormal function leading to malignant tumors. When this occurs, the cells begin to grow irregularly and do not differentiate. These cells also begin to migrate and begin to destroy other cells. Interferons, in response to other extracellular and cellular substances, restore balance and homeostasis and ensure that messages reach normal. Interferon responds to its environment via adhesion molecules, stopping growth, stopping motility, and enhancing the ability of cells. Interferons also correct defects and injuries on the cytoskeleton. Interferons have been found to block the first step in angiogenesis, the formation of new blood vessels necessary for malignant tumor growth. In addition, interferon stimulates fibrosis, many different cell types, and blocks the response to injury that promotes cell proliferation (Kathryn L. Hale, Oncolog, Interferon: The Evolution of a Biological Therapy, Taking a New Look at Cytokine Biology).

  Interferons are produced when animal cells enter the virus and are released into the bloodstream or intercellular fluid, inducing healthy cells to make enzymes that resist infection. For many years, the supply of interferon for research has been limited by expensive extraction techniques. However, in 1980, proteins became available in high quality by genetic engineering (ie, recombinant forms of the protein). Scientists have also determined that the body makes three different types of interferons, referred to as α- (alpha), β- (beta), and γ- (gamma) interferons. Although interferons were initially thought to be highly species-specific, it is now known that each interferon can have a different range of activities in other species. Alpha interferon (α-IFN) is approved for therapeutic use against hairy cell leukemia, hepatitis C. α-IFN has also been found to be effective in treating major causes of chronic hepatitis B, liver cancer and cirrhosis, as well as genital warts and some rare blood and bone marrow cancers. Nasal drops containing α-IFN provide some protection against colds caused by rhinovirus. Human α-IFN is classified into a family of extracellular signaling proteins with antiviral, antiproliferative and immunomodulatory activities. The IFN-α protein is encoded by a multigene family that includes 13 genes clustered on human chromosome 9. Most of the IFN-α genes are expressed at the mRNA level in leukocytes induced by Sendai virus. In addition, at least nine different subtypes have been shown to be produced at the protein level. Although the biological significance of the expression of several similar IFN-α proteins is known, these IFN-α proteins have quantitatively different patterns of antiviral, antiproliferative and killer cell stimulating activities. It is thought to have. Currently, two IFN-α variants, IFN-α 2a and IFN-α 2b, are produced in large quantities in E. coli by recombinant techniques and are commercially available as drugs.

  Unlike native IFN-α, these recombinant IFN-α products have been shown to be immunogenic in some patients, due to the unnatural form of IFN-α protein. There is a possibility. Therefore, the development of IFN-α drugs requires not only identifying IFN-α subtypes and variants expressed in normal human leukocytes, but also characterizing their possible post-translational modifications (Nyman et al. (1998) Eur. J. Biochem. 253: 485-493).

  Nyman et al. (Supra) have studied glycosylation of natural human INF-α. They found that two of the nine subtypes produced by leukocytes after Sendai virus induction, namely IFN-α14c and INF-α2b, are glycosylated, which is consistent with earlier studies. Yes. IFN-α14 is the only IFN-α subtype with possible N-glycosylation sites, Asn2 and Asn72, and only Asn72 is actually glycosylated. IFN-α2 is O-glycosylated with threonine 106 (Thr106). Interestingly, other IFN-α subtypes do not contain Thr at this position. In this study, Nyman et al. Released oligosaccharide chains, isolated and analyzed by mass spectrometry and specific glycosidase digestion. Both IFN-α 2b and IFN-α14c were resolved into three peaks in reverse phase high performance liquid chromatography (RP-HPLC). Electrospray ionization mass spectrometry (ESI-MS) analysis of IFN-α 2b fractions derived from RP-HPLC revealed differences in their molecular weights, suggesting that they exhibit different glycoforms. This has been confirmed by mass spectrometry of free O-glycans in each fraction. IFN-α 2b was estimated to contain about 20% core-type-2 pentasaccharide, and 50% disialic acid addition and 30% monosialic acid core-type glycan. Nyman et al. Data is consistent with previous partial characterization of INF-α 2b glycosylation (Adolf et al. (1991) Biochem. J. 276: 511-518). The role of glycosylation in INF-α 14c and INF-α 2b has not been clearly established. According to Nyman et al. (Supra), glycosylation is not required for biological activity, but glycosylation can have an effect on protein pharmacokinetics and stability.

  There are at least 15 functional genes encoding proteins of the IFN-α family in the human genome. Amino acid sequence similarity is generally in the range of about 90%, and thus these molecules are closely related in structure. The IFN-α protein contains 166 amino acids (with the exception of IFN-α 2 with 165 amino acids) and is characterized by four conserved cysteine residues that form two disulfide bridges. The IFN-α species is somewhat acidic in character and lacks a recognition site for glycosylation attached to asparagine (with the exception of INF-α 14 which contains a recognition site for glycosylation attached to asparagine). ). Three variants of IFN-α2 differing in amino acids at positions 23 and 34 are known: IFN-α2a (Lys-23, His-34); IFN-α2b (Arg-23, His-34); And IFN-α 2c (Arg-23, Arg-34). IFN-α 2a and IFN-α 2c are allelic variants of IFN-α 2b. See Gewert et al (1993) J. Interferon Res. Vol 13, p 227-231. A slight difference in the amino acid content of the INF-α species is not expected to result in glycosylation of interferon. That is, the glycosylation pattern is essentially the same for each of INF-α 2a, 2b, and 2c. Two other human IFN species, IFN-ω1 and IFN-β, are N-glycosylated and are closely related to IFN-α: IFN-α, -β and -ω are collectively referred to as class I IFNs, It binds to the same high affinity cell membrane receptor (Adolf et al. (1991) Biochem. J. 276: 511-518).

  Adolf et al. (Supra) used the properties of monoclonal antibodies to isolate natural IFN-α2 from human leukocytes IFN. They obtained 95% pure protein by immunoaffinity chromatography in which the expected antiviral activity of IFN-α was confirmed. Analysis of native IFN-α 2 by reverse phase HPLC showed that the native protein could be broken down into two components, both more hydrophilic than EFN-α 2 from E. coli. SDS / PAGE revealed that the molecular weight of the protein was heterogeneous, resulting in three bands, all of which have a lower electrophoretic mobility than the equivalent E. coli derived protein.

  Adolf et al. (Supra) also speculated that native IFN-α2 carries a carbohydrate residue attached to O. Their hypothesis was confirmed by cleavage of a putative peptide-carbohydrate bond with alkali; the resulting protein was homologous and showed the same molecular weight as the recombinant protein. Further comparison of natural and recombinant proteins by proteolytic cleavage, following separation and analysis of the resulting fragments, allowed the determination of candidate glycopeptides. Sequence analysis of this peptide identified Thr-106 as the O-glycosylation site. Comparison of the amino acid sequences of all published IFN-α 2 species revealed that this threonine residue is unique to IFN-α 2. In all other proteins, glycine, isoleucine or glutamic acid is present at the corresponding position (107).

  Preparations of INF-α2 produced in E. coli lack O-glycosylation and are registered as drugs in many countries. However, the immunogenicity of EFN-α2 from E. coli applied therapeutically must be affected by the lack of glycosylation. Studies show that 4 out of 16 patients who received recombinant human granulocyte macrophage colony stimulating factor produced in yeast developed antibodies against this protein. Interestingly, these antibodies are protected by O-linked glycosylation in endogenous human granulocyte-macrophage colony-stimulating factor but react with exposed epitopes in recombinant factors. Has been found (Adolf et al., Supra).

  Similarly, induction of antibodies to recombinant E. coli-derived INF-α 2 after prolonged patient treatment has been described, where native INF-α 2 is more immune than recombinant INF-α 2 protein. It has been speculated that the originality can be low (Galton et al. (1989) Lancet 2: 572-573).

  What is needed is an improved method for producing therapeutic or pharmaceutical proteins such as antibodies and cytokines including interferon, G-CSF and erythropoietin.

SUMMARY OF THE INVENTION The present invention stably introduces an exogenous nucleic acid sequence into the avian genome for the purpose of expressing the exogenous sequence to change the avian phenotype or to express a desired protein. Vectors and methods for doing so are provided. In particular, transgenic birds are produced that express exogenous sequences in their oviducts and deposit exogenous proteins such as pharmaceutical proteins in the egg. Avian eggs containing such exogenous proteins are included in the present invention. The present invention further provides novel novel therapeutic proteins (eg, human cytokines) including interferon, G-CSF, G-MCSF and erythropoietin that are efficiently expressed in and deposited in avian eggs. Provide form.

  One aspect of the present invention provides a method of producing exogenous proteins in specific tissues of birds. Exogenous proteins may be expressed in avian oviducts, blood and / or other cells and tissues. In one embodiment, for example, a transgene is introduced into embryonic blastoderm cells near stage X to produce a transgenic bird, and the protein of interest is expressed in tubular glandular cells of the oviduct tube to obtain a lumen. Secreted and deposited in the egg white of a hard shell egg. The transgenic bird prepared in this way carries the transgene in its germ cells. Thus, the exogenous gene is transmitted to the bird both by artificial introduction of the exogenous gene into the avian embryo cell and stable transmission of the exogenous gene to the bird's offspring in a manner that complies with Mendel's law. Can be done.

  The invention includes a method of producing exogenous protein in an avian oviduct. The method comprises, as a first step, providing a coding sequence and a vector comprising a promoter operably linked to the coding sequence (so that the promoter can effect expression of the nucleic acid in the avian oviduct). Transduced cells and / or tissues may then be produced (wherein the vector is freshly isolated in culture or introduced into avian embryonic blastoderm cells in the embryo). The vector sequence is inserted, eg, randomly inserted into the avian genome. Finally, mature transduced birds that express exogenous proteins in the oviduct may be obtained from transduced cells and / or tissues. This method also includes exogenous proteins such as pharmaceutical proteins (eg, cytokines) when exogenous proteins expressed in the oviduct are secreted into the oviduct lumen and deposited in the egg (eg, in the egg white of a hard egg). It can be used to produce avian eggs containing sex proteins.

  In one embodiment, generation of transgenic birds by chromosomal insertion of the vector into the avian genome may optionally include DNA transduction of embryonic blastoderm cells, which are then treated with the recipient blastoderm. Inject into the subembryonic space just below. The vectors used in such methods may have a promoter fused to the exogenous coding sequence and direct the expression of the coding sequence in oviduct tubular gland cells.

  In another embodiment of the present invention, random chromosomal insertion and generation of a transgenic bird is a replication deficient or replication competent that carries the genetic code of the transgene between the 5 ′ and 3 ′ LTRs of the retroviral director. This is accomplished by transduction of embryonic blastoderm cells with tent retroviral particles. For example, an avian leukocyte virus (ALV) retroviral vector or a murine leukocyte virus (MLV) retroviral vector containing a modified pNLB plasmid containing an exogenous gene inserted downstream of a promoter region segment may be used. . RNA copies of modified retroviral vectors packaged in virions may be used to infect embryonic blastoderm that develop in transgenic birds. Alternatively, helper cells that produce retroviral transduced particles may be delivered to the embryonic blastoderm.

  Another aspect of the invention provides a vector comprising a coding sequence and a promoter sequence that are in operative and positional relationship such that the coding sequence is expressed in the avian oviduct. Such vectors include, but are not limited to, avian leukocyte virus (ALV) retroviral vectors, murine leukocyte virus (MLV) retroviral vectors, and lentiviral vectors. Further, the vector may be a nucleic acid sequence comprising the LTR of an avian leukocyte virus (ALV) retroviral vector, a murine leukocyte virus (MLV) retroviral vector or a lentiviral vector. The promoter is sufficient to effect expression of the avian oviduct coding sequence. The coding sequence encodes an exogenous protein deposited in the egg white of a hard shell egg. Alternatively, coding sequences may include proteins from transgenic poultry such as interferon-α 2b (TPD IFN-α 2b) and erythropoietin from transgenic poultry (TPD EPO) and granulocyte colony-stimulating factor from transgenic poultry, etc. Of exogenous proteins. In one embodiment, the vector used in the method of the invention comprises a promoter that is particularly suitable for the expression of exogenous proteins in birds and their eggs. Alternatively, expression of exogenous coding sequences can occur in the oviduct of transgenic birds and the egg white of blood bird eggs. Examples of promoters include, but are not limited to, cytomegalovirus (CMV) promoter, MDOT promoter, Rous sarcoma virus (RSV) promoter, β-actin promoter (eg, chicken β-actin promoter), mouse leukocyte virus (MLV) Examples include promoters, mouse mammary tumor virus (MMTV) promoter, ovalbumin promoter, lysozyme promoter, conalbumin promoter, ovomucoid promoter, ovomucin promoter and ovotransferrin promoter. If desired, the promoter may be a segment of at least one promoter region, such as a segment of ovalbumin-, lysozyme-, conalbumin-, ovomucoid-, and ovotransferrin promoter regions. In one embodiment, the promoter is a combination or fusion of one or more promoters or a fusion of parts of one or more promoters, such as the ovalbumin-, lysozyme-, conalbumin-, ovomucoid-, and ovotransferrin promoters. .

  One aspect of the present invention is to provide an ovalbumin promoter so that it retains the elements required for expression in tubular glandular cells of the oviduct, but is small enough to be easily incorporated into a vector. Truncation and / or condensation of key regulatory elements of the ovalbumin promoter. For example, a segment of the ovalbumin promoter region may be used. This segment contains the 5 'flanking region of the ovalbumin gene. The overall length of the ovalbumin promoter segment is about 0.88 kb to about 7.4 kb in length, preferably about 0.88 kb to about 1.4 kb in length. The segment preferably includes both steroid-dependent and negative control elements of the ovalbumin gene. The segment also optionally includes residues from the 5 'untranslated region (5'UTR) of the ovalbumin gene. Alternatively, the promoter may be a segment of the promoter region of lysozyme-, conalbumin-, ovomucoid-, and ovotransferrin genes. An example of such a promoter is a synthetic MDOT promoter consisting of elements derived from the ovomucoid (MD) and ovotransferrin (OT) promoters.

  In another aspect of the invention, the vector that is integrated into the avian genome includes a constitutive promoter operably linked to an exogenous coding sequence (eg, cytomegalovirus (CMV) promoter, rous sarcoma virus (RSV) promoter). And mouse leukemia virus (MLV) promoter). Alternatively, non-constitutive promoters such as mouse breast cancer virus (MMTV) may be used.

  Another aspect of the invention provides a transgenic bird carrying a transgene in the genetic material of germ cell tissue. More particularly, a transgene expresses an exogenous gene, including exogenous genes and promoters in operational and positional relationship. Exogenous genes may be expressed in the blood of avian oviducts and transgenic birds. Exogenous genes encode exogenous proteins such as pharmaceutical proteins including TPD IFN-α (eg, IFN-α 2) and cytokines such as TPD EPO and TPD G-CSF. Exogenous proteins are deposited in the egg white of hard shell eggs.

  Another aspect of the invention provides an avian egg comprising a protein that is exogenous to the avian species. The use of the present invention allows the expression of exogenous proteins in oviduct cells with secretion of the protein into the lumen of the oviduct and the deposition of avian eggs on the egg white. The protein encapsulated in the egg may be present in an amount up to 1 g or more. Exogenous proteins include, but are not limited to, TPD IFN-α 2 and TPD EPO and TPD G-CSF.

  Yet another aspect of the present invention provides an optimized coding sequence for human interferon-α 2b (IFN-α 2b), ie, a gene encoding interferon-α 2b (TPD IFN-α 2b) derived from transgenic poultry. Provided is an isolated polynucleotide sequence comprising a recombinant sequence encoding interferon-α 2b from an introduced poultry. The present invention also includes an isolated protein comprising the polynucleotide sequence of TPD IFN-α 2b, wherein the protein is N-acetyl-galactose amine, galactose, N-acetyl-glucosamine, sial at Thr-106. O-glycosylated using acids and combinations thereof.

  The present invention further contemplates a pharmaceutical composition comprising the polypeptide sequence of TPD IFN-α 2b, wherein the protein is Thr-106, N-acetyl-galactose amine, galactose, N-acetyl-glucosamine, sialic acid And combinations thereof are O-glycosylated.

  One aspect of the invention provides a coding sequence for an exogenous protein made as disclosed herein, wherein the coding sequence is a codon that is optimized for expression in a bird, eg, a chicken. is there. Codon optimization may be determined from the use of at least one, preferably two or more codons of the protein expressed in avian cells. For example, codon usage may be determined from nucleic acid sequences encoding proteins such as chicken ovalbumin, lysozyme, ovomucin and ovotransferrin. For example, the DNA coding sequence of an exogenous gene can be found in Wisconsin Package's BACKTRANSLATE® program, version 9.1, along with codon usage tables generated from chicken (Gallus gallus) ovalbumin, lysozyme, ovomucoid and ovotransferrin proteins. Codon optimized using (Genetics Computer Group, Inc., Madison, Wis.).

  One aspect of the invention encodes an optimized coding sequence for human erythropoietin (EPO), ie, erythropoietin from transgenic poultry encoding erythropoietin from transgenic poultry (TPD EPO). An isolated polypeptide sequence comprising a recombinant sequence is provided.

  Another aspect of the invention provides a vector comprising first and second coding sequences, and a promoter that is operative and positional relative to the first and second coding sequences, wherein the first and second in avian oviducts A second coding sequence is expressed. In this embodiment, the vector may comprise an in-sequence ribosome entry site (IRES) element located between the first and second coding sequences, wherein the first coding sequence encodes protein X, and The two coding sequences encode protein Y, where one or both of protein X and protein Y are deposited in a hard shell egg (eg, egg white).

  For example, protein X may be the light chain (LC) of a monoclonal antibody, and protein Y may be the heavy chain (HC) of a monoclonal antibody. Alternatively, the protein (eg, an enzyme) encoded by the second coding sequence can provide a post-translational modification of the protein encoded by the first coding sequence. The vector optionally includes additional coding sequences and additional IRES elements so that each coding sequence in the vector is separated from the other coding sequence by the IRES element. Other examples using IRES intended for use in the present invention are disclosed, for example, in US patent application 11 / 047,184 filed January 31, 2005 (the entire disclosure is incorporated by reference). To do).

  The present invention also contemplates a method for producing avian eggs containing proteins, such as pharmaceutical proteins including monoclonal antibodies, enzymes and other proteins. Such methods provide a vector having a promoter, a coding sequence, and at least one IRES element; creating a transgenic cell or tissue by introducing the vector into an avian embryonic blastoderm cell, wherein Vector sequences are randomly inserted into the avian genome; birds are obtained from transgenic cells or tissues. The transgenic birds so obtained can express the coding sequence in the oviduct and the resulting protein secreted into the oviduct lumen is deposited in the egg white of the hard shell egg. In addition, the present invention includes transgenic bird offspring that produce eggs containing the recombinant protein. Typically, the offspring either contain the transgene in essentially all cells of the bird, or the offspring bird cells do not contain any transgene.

  One important aspect of the present invention relates to avian hard shell eggs (eg, chicken hard shell eggs) containing exogenous peptides or proteins including, but not limited to, pharmaceutical proteins. The exogenous peptide or protein may be encoded by the transgene of the transgenic bird. In one embodiment, the exogenous peptide or protein (eg, pharmaceutical protein) is glycosylated. The protein may be present in any useful amount. In one embodiment, the protein is present in an amount ranging between about 0.01 μg / hard shell egg to about 1 g / hard shell egg. In another embodiment, the protein is present in an amount ranging between about 1 μg / hard shell egg to about 1 g / hard shell egg. For example, the protein may be in an amount ranging from about 10 μg / hard shell egg to about 1 g / hard shell egg (eg, between about 10 μg / hard shell egg to about 400 mg / hard shell egg). May be present.

  In one embodiment, the exogenous protein (eg, exogenous pharmaceutical protein) is present in the egg white of the egg. In one embodiment, the protein is present in an amount ranging between about 1 ng / ml egg white and about 0.2 g / ml egg white. For example, the protein may be present in an amount ranging between about 0.1 μg / ml egg white and about 0.2 g / ml egg white (eg, the protein is about 1 μg / ml egg white to about 100 mg / ml egg white). May be present in amounts ranging between). In one embodiment, the protein is present in an amount ranging between about 1 μg / ml egg white and about 50 mg / ml egg white. For example, the protein may be present in an amount ranging between about 1 μg / ml egg white and about 10 mg / ml egg white (the protein in an amount ranging between about 1 μg / ml egg white and about 1 mg / ml egg white). May exist).

  The present invention contemplates the production of hard shell eggs containing any useful protein, including one or more pharmaceutical proteins. Such proteins include, but are not limited to, hormones, immunoglobulins or portions of immunoglobulins, cytokines (eg, GM-CSF, G-CSF, erythropoietin and interferon) and CTLA4. The present invention also includes, but is not limited to, the production of hard shell eggs containing a fusion protein comprising an immunoglobulin or immunoglobulin portion fused to a specific useful peptide sequence. In one embodiment, the present invention provides for the production of hard shell eggs comprising Fc fragments of antibodies. For example, an egg may contain an Fc-CTLA4 fusion protein according to the present invention. Birds generated from blastoderm cells into which a vector has been introduced are of the G0 generation and are referred to as “founders”. Founder birds are typically chimeras for each inserted transgene. That is, only some of the G0 transgenic bird cells contain the transgene. Alternatively, the G0 generation may be bred with a non-transgenic animal to generate a G1 gene introduced progeny that is hemizygous for the transgene and contains the transgene in essentially all avian cells. G1 hemizygous progeny may be mated with non-transgenic animals to produce G2 hemizygous progeny, or G2 progeny homozygous for the transgene may be produced together. Virtually all cells of the bird obtained from G1 progeny and positive for the transgene contain the transgene. In one embodiment, hemizygous G2 progeny from the same line are bred to produce G3 progeny that are homozygous for the transgene. In one embodiment, hemizygous G0 animals are mated to produce homozygous G1 progeny that contain two copies of the transgene in each cell of the animal. These are merely examples of specific useful breeding methods, and the present invention contemplates the use of any useful breeding method, such as any breeding method known to those skilled in the art.

  One aspect of the present invention relates to a composition comprising a protein produced by the present invention having a poultry derived glycosylation pattern, such as a chicken derived glycosylation pattern. For example, the invention includes pharmaceutical proteins having poultry derived glycosylation patterns, such as one or more of the glycosylation patterns disclosed herein. The present invention also includes pharmaceutical human proteins having a poultry derived glycosylation pattern, such as one or more of the glycosylation patterns disclosed herein.

  In one embodiment, the present invention comprises G-CSF, where G-CSF is a poultry derived glycosylation pattern, ie, transgenic poultry derived G-CSF or TPD G-CSF. In one embodiment, the glycosylation pattern is other than the glycosylation pattern of G-CSF produced in human cells and / or CHO cells. That is, the composition has a G-CSF molecule having a poultry-derived sugar chain (ie, a glycosylated structure), and the sugar chain or glycosylated structure is obtained from human cells and / or Cho cells. Not found on G-CSF. However, the composition may also comprise a G-CSF molecule having a glycosylation structure that is the same as that found on G-CSF obtained from CHO cells and / or human cells. Glycosylation of human G-CSF produced in CHO cells is disclosed in: Holloway, CJ, European J. of Cancer (1994) vol 30A, pS2-S6 (the entire disclosure is incorporated by reference). ); Oheda et al (1988) J. Biochem., V 103, p 544-546 (the entire disclosure is incorporated by reference), and Andersen et al (1994) Glycobiology, vol 4, p 459-467 (source) The entire disclosure is incorporated by reference). The structures such as A and G shown in Example 20 appear to be the same or similar to the glycosylation structure reported for G-CSF produced in CHO cells. In one embodiment, the glycosylation pattern of TPD G-CSF is other than the pattern of G-CSF produced in mammalian cells.

  In one embodiment, the present invention provides G-CSF to be isolated. That is, the G-CSF contained in the composition may be isolated G-CSF. For example, G-CSF may be isolated from egg white. The isolated G-CSF may be a G-CSF molecule having a different glycosylation structure among the G-CSF molecules, or the isolated G-CSF may be a G-CSF molecular species. It may be each isolated G-CSF species having only one specific glycosylation structure.

  In one embodiment, the G-CSF of the composition of the invention is present in a hard shell egg. For example, G-CSF is present in the egg white of hard shell eggs laid by the transgenic bird of the present invention. That is, in one embodiment, the present invention relates to egg whites of birds (eg, chickens) comprising the G-CSF of the present invention. In one embodiment, G-CSF is present in the egg white in an amount greater than about 1 μg / ml egg white. For example, G-CSF is present in egg white in an amount greater than about 2 μg / ml egg white (eg, present in an amount of about 2 μg to about 200 μg per ml of egg white).

  In one particular embodiment of the invention, G-CSF is glycosylated in avian oviduct cells (eg, glycosylated in chicken oviduct cells). For example, G-CSF can be produced and glycosylated in oviduct cells. In one embodiment, G-CSF is glycosylated in tubular gland cells (eg, G-CSF is produced and glycosylated in tubular gland cells).

  G-CSF is thought to be glycosylated at threonine 133. However, the present invention is not limited to glycosylation at any particular site on the G-CSF molecule.

  Typically, the G-CSF of the present invention is human G-CSF. In one embodiment, mature G-CSF has the amino acid sequence of FIG. 18C.

でグリコシル化されているＧ−ＣＳＦを含む。 In one embodiment, the composition of the present invention comprises:

G-CSF which is glycosylated with

  The present invention also specifically relates to compositions comprising G-CSF molecules having one of these specific glycosylation structures. Such a composition may also include one or more G-CSF molecules having one or more other glycosylation structures.

を有するＧ−ＣＳＦ分子を含む組成物、および以下：

を有するＧ−ＣＳＦ分子を含む組成物、および以下：

を有するＧ−ＣＳＦ分子を含む組成物、および以下：

を有するＧ−ＣＳＦ分子を含む組成物、および以下：

を有するＧ−ＣＳＦ分子を含む組成物、および以下：

を有するＧ−ＣＳＦ分子を含む組成物、および以下：

［式中、Ｇａｌ＝ガラクトース、
ＮＡｃＧａｌ＝Ｎ−アセチル−ガラクロサミン、
ＮＡｃＧｌｕ＝Ｎ−アセチル−ガラクトサミンおよび
ＳＡ＝シアル酸］
を有するＧ−ＣＳＦ分子を含む組成物に関する。 That is, in one embodiment, the present invention specifically provides the following:

A composition comprising G-CSF molecules having the following:

A composition comprising G-CSF molecules having the following:

A composition comprising G-CSF molecules having the following:

A composition comprising G-CSF molecules having the following:

A composition comprising G-CSF molecules having the following:

A composition comprising G-CSF molecules having the following:

[Wherein Gal = galactose,
NAcGal = N-acetyl-galaclosamine,
NAcGlu = N-acetyl-galactosamine and SA = sialic acid]
Relates to a composition comprising G-CSF molecules having

  The present invention also relates to a method of increasing white blood cell count in a patient comprising administering to the patient a therapeutically effective amount of TPD G-CSF. Typically, a therapeutically effective amount is an amount of TOD G-CSF that increases the white blood cell count in the patient by the desired amount.

  Any useful combination of the features described herein is within the scope of the invention, provided that the features contained in any such combination are clear from the relevant, present specification and knowledge of those skilled in the art. include.

  Further objects and aspects of the present invention will become more apparent from the detailed description set forth below when taken in conjunction with the accompanying drawings, which are briefly described below.

DETAILED DESCRIPTION Certain definitions are set forth herein to provide and define the definitions and scope of the various terms used to describe the invention herein.

  “Nucleic acid or polynucleotide” includes, but is not limited to, eukaryotic mRNA, cDNA, genomic DNA, and synthetic DNA and RNA sequences, including the natural nucleoside bases adenine, guanine, cytosine, thymidine and uracil. Can be mentioned. The term also includes sequences that have one or more modified bases.

  “Therapeutic protein” or “pharmaceutical protein” includes amino acid sequences that constitute a drug in whole or in part. A “coding sequence” or “open reading frame” can be transcribed and translated (in the case of DNA) or translated into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences ( In the case of mRNA) refers to a polynucleotide or nucleic acid sequence. The boundaries of the coding sequence are determined by a translation start codon at the 5 '(amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. A transcription termination sequence is usually located 3 'to the coding sequence. A coding sequence may be flanked 5 'and / or 3' to an untranslated region.

  “Exon” refers to the portion of a gene that is expressed on cytoplasmic mRNA after the intron or inversion sequence has been removed by nuclear splicing when the gene is transcribed into a nuclear transcript.

  A nucleic acid “control sequence” or “regulatory sequence” is necessary and sufficient for transcription and translation of a given coding sequence in a defined host cell, promoter sequences, transcription initiation and termination codons, ribosome binding sites, polyadenylation signals, transcription Termination sequences, upstream regulatory domains, enhancers and the like. Examples of regulatory sequences suitable for eukaryotic cells are promoters, polyadenylation signals and enhancers. All of these regulatory sequences need to be present on the recombinant vector as long as it is necessary and sufficient for transcription and translation of the desired gene.

  “Operable or operably linked” refers to the arrangement of code and control sequences such that a desired function is performed. Thus, a control sequence operably linked to a coding sequence can effect the expression of the coding sequence. When a DNA polymerase binds to a promoter sequence and the coding sequence is transcribed into mRNA that can be transcribed into the encoded protein, the coding sequence is operably linked to or under control of the transcriptional regulatory region in the cell. is there. As long as the control sequence directs its expression, the control sequence needs to be close to the coding sequence. Thus, for example, a sequence that is not translated by inversion and that is not transcribed exists between the promoter sequence and the coding sequence, and the promoter sequence may still be considered “operably linked” to the coding sequence. .

  The terms “heterologous” and “exogenous” are not normally associated with a region of a recombinant construct or a specific chromosomal locus when these terms are associated with nucleic acid sequences such as coding and regulatory sequences, and / or specific Sequences not related to other cells are shown. Thus, an “exogenous” region of a nucleic acid construct can be said to be identical to a nucleic acid segment that is within or bound to another nucleic acid molecule that is not associated with other molecules in nature. For example, the exogenous region of the construct includes a coding sequence that flank a sequence that is not found to be associated with the natural coding sequence. Another example of an exogenous coding sequence is a construct in which the coding sequence itself is not found in nature (eg, a synthetic sequence having codons different from the natural gene). Similarly, for the purposes of the present invention, a host cell transformed with a construct or nucleic acid that is not normally present in the host cell is also considered exogenous.

  As used herein, an “exogenous protein” is a protein that is not naturally present in a particular tissue or cell, a protein that is the expression product of an exogenous expression construct or transgene, or a predetermined amount in a particular tissue or cell. It is a protein that does not exist in nature. Proteins that are exogenous to eggs are proteins that are not normally found in eggs. For example, a protein that is exogenous to an egg can be a protein that is present in the egg as a result of expression of a coding sequence that is present in the transgene of the laying animal.

  “Endogenous gene” refers to a naturally occurring gene or fragment thereof normally associated with a particular cell.

  The expression product described herein may consist of a proteinaceous material having a defined chemical structure. However, protein structure depends on a number of factors, particularly chemical modifications common to proteins. For example, since all proteins contain ionizable amino and carboxyl groups, proteins can be obtained in the form of acidic or basic salts, or in the form of neutral salts. Primary amino acid sequences can be derivatized using sugar molecules (glycosylation) or by other chemical derivatives, including, for example, covalent or ionic bonds with lipids, phosphates, acetyl groups, etc. Caused by association with sugars. These modifications can occur in vitro or in vivo and are performed in vivo by host cells through a post-translational processing system. Such modifications can increase or decrease the biological activity of the molecule, and it is contemplated that such chemically modified molecules are also within the scope of the present invention.

  Alternative methods of cloning, amplification, expression and purification will be apparent to those skilled in the art. Representative methods are disclosed in Sambrook, Fritsch, and Maniatis, Molecular Cloning, a Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory (1989).

  A “vector” is a polynucleotide composed of single-stranded, double-stranded, tubular or supercoiled DNA or RNA. A typical vector may consist of the following elements operably linked at appropriate distances for expression of the following functional genes: origin of replication, promoter, enhancer, 5 ′ mRNA leader sequence, ribosome binding site, nucleic acid cassette , Termination and polyadenylation sites, and selectable marker sequences. One or more of these elements may be omitted in certain applications. The nucleic acid cassette may contain restriction sites for insertion of the nucleic acid sequence to be expressed. In a functional vector, the nucleic acid cassette contains the nucleic acid sequence to be expressed, including translation initiation and termination sites. Introns can optionally be included in the construct, eg, 5 'to the coding sequence. The vector is constructed so that the particular coding sequence is placed in the vector with the appropriate regulatory sequences. The position and orientation of the coding sequence relative to the control sequence is such that the coding sequence is transcribed under “control” of the control or regulatory sequence. Modification of the sequence encoding the particular protein of interest is desirable to achieve the objectives of the present invention. For example, in some cases it may be necessary to modify the sequence so that the sequence can be attached to the control sequence with the proper orientation; or to maintain the reading frame. Control and other regulatory sequences can be linked to the coding sequence prior to insertion into the vector. Alternatively, the coding sequence can be cloned directly into an expression vector that has the regulatory control of the regulatory sequences and is under regulatory control and already contains the regulatory sequences and appropriate restriction sites within the reading frame.

  A “promoter” is a site on DNA where RNA polymerase binds and initiates transcription of a gene. In some embodiments, the promoter is modified by addition or deletion of sequences, or is replaced with another sequence, including sequences that can be natural and synthetic sequences and combinations of natural and synthetic sequences. Many eukaryotic promoters contain two types of recognition sequences, a TATA box and an upstream promoter sequence. An upstream promoter element located upstream of the transcription start site determines the rate of transcription and is apparently upstream of the TATA box, but is responsible for directing transcription initiation at the exact site of RNA polymerase is doing. Enhancer elements can also be stimulated to transcription from a linked promoter, but many function exclusively in certain cell types. Many enhancer / promoter elements from viruses such as the SV40 promoter, cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter and murine leukemia virus (MLV) promoter are totally active in a wide range of cell types, It is said to be “ubiquitous”. Alternatively, constitutive promoters such as the mouse mammary tumor virus (MMTV) promoter can also be used in the present invention. If the coding sequence encodes a polypeptide of interest, the coding sequence lacks a potential splice site that can block the production of the appropriate mRNA molecule and / or produces an mRNA molecule that is abnormally spliced or abnormal. Under certain conditions, the nucleic acid sequence inserted into the cloning site can have any open reading frame encoding the polypeptide of interest.

  The term “poultry derived” refers to a composition or material produced in or obtained from poultry. “Poultry” refers to birds that can be raised as livestock, including but not limited to chickens, ducks, turkeys, quails and migratory birds. For example, “from poultry” may refer to chicken origin, turkey origin and / or quail origin.

  A “marker gene” is a gene that encodes a protein that allows the identification and isolation of correctly transduced cells. Suitable marker sequences include, but are not limited to, green, yellow and blue fluorescent protein genes (GFP, YFP and BFP, respectively). Other suitable markers include thymidine kinase (tk), dihydrofolate reductase (DHFR) and aminoglycoside phosphotransferase (APH) genes. The latter provides resistance to aminoglycoside antibiotics such as kanamycin, neomycin and genethecin. These marker genes and other marker genes such as those encoding chloramphenicol acetyltransferase (CAT), β-lactamase, β-galactosidase (β-gal), together with genes that express the desired protein The main nucleic acid cassette can be incorporated, or the selectable marker can be included on a separate vector and co-transduced.

  A “reporter gene” is a marker gene that “reports” its activity in a cell by the presence of a protein encoded by the reporter gene.

  “Retroviral particles”, “transducing particles” or “transducing particles” refer to replication-deficient or replication-competent viruses that can transduce cells with non-viral DNA or RNA.

  The terms “transformation”, “transduction” and “transfection” all refer to the introduction of polynucleotides into avian blastoderm cells. The “tube” is the portion of the oviduct between the fallopian funnel and the isthmus that contains tubular gland cells that synthesize and secrete egg white protein.

  As used herein, “MDOT promoter” is a synthetic promoter that is active in tubular gland cells of the oviduct tube, among other tissues. MDOT consists of elements derived from the ovomucoid (MD) and ovotransferrin promoter (Figure 13).

  The term “optimization” is used in conjunction with “optimized coding sequence”, where the codon most frequently used for each specific amino acid found in egg white proteins ovalbumin, lysozyme, ovomucoid and ovotransferrin. Is used in the design of optimized human interferon-α 2b (IFN-α 2b) inserted into the vectors of the present invention. More specifically, the DNA sequence for the optimized human IFN-α 2b is based on the codon usage of the hen oviduct and is generated from chicken (Gallus gallus) ovalbumin, lysozyme, ovomucoid and ovotransferrin proteins. Using the Wisconsin Package's BACKTRANSLATE® program, version 9.1 (Genetics Computer Group, Inc., Madison, Wis.). For example, the percentage of usage of the four codons of the amino acid alanine in the four egg white proteins is 34% for GCU, 31% for GCC, 26% for GCA, and 8% for GCG. Thus, GCU has been used as a codon for most alanines in the optimized human IFN-α 2b coding sequence. Vectors containing genes for optimized human IFN-α 2b produce transduced birds expressing poultry-derived IFN-α 2b (TPD IFN-α 2b) transduced in poultry tissues and eggs Used for. Similarly, the methods described above are used to design other coding sequence proteins such as human erythropoietin (EPO) or other proteins that can be produced by the present invention.

  By the method of the present invention, the transgene is introduced into avian embryonic cells and carries the transgene in the genetic material of germline tissue, transgenic chicken, transgenic turkey, transgenic quail and other avian species Can be produced. The blastoderm cells are typically stage VII-XII cells or equivalents thereof, and in one embodiment, near stage X. Cells useful in the present invention include embryonic embryo (EG) cells, embryonic stem (ES) cells, and primordial germ cells (PGC). Embryonic blastoderm cells may be freshly isolated and maintained in culture or may be present in the embryo.

  Vectors useful for practicing the methods of the invention are described herein. These vectors can be used for the stable introduction of exogenous coding sequences into the avian genome. Alternatively, the vectors can be used to produce exogenous proteins in specific tissues of birds, for example, oviduct tissues of birds. Vectors can also be used in the methods to produce avian eggs containing exogenous proteins. In one embodiment, both the coding sequence and the promoter are located between the 5 'and 3' LTRs prior to introduction into blastoderm cells. In one embodiment, the vector is retroviral and the coding sequence and promoter are both located between the 5 'and 3' LTRs of the retroviral vector. In one useful embodiment, the LTR or retroviral vector is derived from avian leukemia virus (ALV), murine leukemia virus (MLV) or lentivirus.

  In one embodiment, the vector comprises a signal peptide coding sequence that is operably linked to the coding sequence, and upon translation in the cell, the signal peptide is of a hard shell egg of exogenous protein expressed by the vector. Directs secretion into egg white. The vector can include a marker gene, wherein the marker gene is operably linked to a promoter.

  In some cases, introduction of the vectors of the invention into embryonic blastoderm cells is performed using embryonic blastoderm cells that are either freshly isolated or in culture. The The transgenic cells are then typically injected into the subgerminal space below the recipient blastoderm in the egg. In some cases, however, the vector is delivered directly to cells of the blastoderm embryo.

  In one embodiment of the invention, the vector used to transfect blastoderm cells and produce stable integration into the avian genome is such that the coding sequence is expressed in tubular glandular cells of the avian oviduct tube. It includes coding sequences and promoters that are operatively and in positional relationship, where the coding sequence encodes an exogenous protein that is deposited on the egg white of a hard shell egg. The promoter may optionally be a segment of the region of the ovalbumin promoter that is large enough to direct expression of the coding sequence in tubular gland cells. The present invention cuts the ovalbumin promoter so that the sequence is small enough to be easily incorporated into the vector while retaining the sequence required for expression in the tubular glandular cells of the oviduct, and Or condensing key regulatory elements of the ovalbumin promoter. In one embodiment, segments of the ovalbumin promoter region can be used. This segment contains the 5 'flanking region of the ovalbumin gene. The total length of the ovalbumin promoter segment may be about 0.88 kb to about 7.4 kb in length, preferably about 0.88 kb to about 1.4 kb in length. The segment preferably includes both steroid-dependent and negative regulatory elements of the ovalbumin gene. The segment also optionally includes residues from the 5 'untranslated region (5'UTR) of the ovalbumin gene. Thus, the promoter may be derived from a promoter region derived from an ovalbumin-, lysozyme-, conalbumin-, ovomucoid-, ovotransferrin- or ovomucoid gene (FIG. 14). An example of such a promoter is a synthetic MDOT promoter consisting of elements derived from the ovomucoid and ovotransferrin promoters (FIG. 13). The promoter can also be a specific promoter, although not quite complete, such as a lysozyme promoter. The promoter may also be a mouse mammary tumor virus (MMTV) promoter. Alternatively, the promoter may be a constitutive promoter (eg, cytomegalovirus (CMV) promoter, MDOT promoter, Rous sarcoma virus (RSV) promoter, mouse leukocyte virus (MLV) promoter, etc.). In a preferred embodiment of the present invention, the promoter is a cytomegalovirus (CMV) promoter, MDOT promoter, Rous sarcoma virus (RSV) promoter, murine leukemia virus (MLV) promoter, mouse mammary tumor virus (MMTV) promoter, ovalbumin promoter, A lysozyme promoter, a conalbumin promoter, an ovomucoid promoter, an ovomucin promoter, and an ovotransferrin promoter. If desired, the promoter can be a segment of at least one promoter region, such as a segment of ovalbumin-, lysozyme-, conalbumin-, ovomucoid- and ovotransferrin-promoter regions. In one embodiment, the promoter is a CMV promoter.

  1A and 1B show examples of ovalbumin promoter expression vectors. Gene X is a coding sequence that encodes an exogenous protein. The curved arrow indicates the transcription start site. In one example, the vector contains 1.4 kb of the 5 'flanking region of the ovalbumin gene (Figure 1A). The sequence of the “1.4 kb promoter” in FIG. 1A corresponds to a sequence starting from about 1.4 kb upstream (1.4 kb) of the ovalbumin transcription start site and extending about 9 residues to the 5 ′ untranslated region of the ovalbumin gene. is doing. The approximately 1.4 kb long segment has two important regulatory sequences, a steroid-dependent regulatory element (SDRE) and a negative regulatory element (NRE). NREs are referred to as NREs because they contain several negative regulatory elements that block the expression of genes in the absence of hormones (eg, estrogen). A segment shorter than 0.88 kb also contains both elements. In another example, the vector contains about 7.4 kb of the 5 ′ flanking region of the ovalbumin gene, and may contain additional elements (HS-III and HS-IV, one of which is a functional element capable of inducing the gene by estrogen. (Figure IB). Segments shorter than 6 kb also include all four elements and may be used in the present invention if desired. Each vector used for random integration according to the present invention preferably has at least one 1.2 kb element from the chicken β-globin locus that insulates the gene from both activation and inactivation at the genomic insertion site. Including one. In one embodiment, two insulator sequences are added to one end of the ovalbumin construct. At the β-globin locus, the insulator sequence acts to inhibit the distal locus regulatory region (LCR) from activating the upstream gene of the globin gene domain. Insulator sequences have been shown to overcome position effects in transgenic flies, indicating that they can protect against both positive and negative effects on the insertion site. Insulator sequences are only required on either the 5 'or 3' side of a gene, since transgenes can be incorporated in multiple or tandem copies, creating a series of genes adjacent to adjacent transgene insulators It is said. In another embodiment, the insulator sequence is linked to the vector but is co-transfected with the vector. In this case, the vectors and sequences are connected in series in the cell by a random integration process into the genome.

  Each vector may also optionally include a marker gene to allow identification and enrichment of cell clones stably incorporating the expression vector. Marker gene expression is driven by a ubiquitous promoter that drives high levels of expression in a wide range of cell types. In one embodiment of the invention, the marker gene is human interferon driven by a lysozyme promoter. In another embodiment, the green fluorescent protein (GFP) reporter gene (Zolotukhin et al., J. Virol 70: 4646-4654 (1995)) is driven by the Xenopus elongation factor 1-α (ef-1-α) promoter. (Johnson and Krieg, Gene 147: 223-26 (1994)). The Xenopus ef-1-α promoter is a strong promoter that is expressed in a wide range of cell types. GFP contains mutations that enhance its fluorescence and is either humanized or modified so that the codon matches the codon usage profile of the human gene. Since bird codon usage is virtually the same as human codon usage, humanized forms of the gene are also highly expressed in avian blastoderm cells. In another embodiment, the marker gene is operably linked to one of a ubiquitous promoter, HSV tk, CMV, β-actin or RSV.

  While human and avian codon usage is well harmonized, if an invertebrate gene is used as the coding sequence in a transgene, the invertebrate gene sequence is modified so that the codon usage is human And change to an appropriate codon to resemble that of a bird.

  Transfection of blastoderm cells may be mediated by any number of methods known to those skilled in the art. Introduction of the vector into the cell can be facilitated by first mixing the nucleic acid with a polylysine or cationic lipid that serves to facilitate passage through the cell membrane. However, introduction of the vector into the cell is preferably accomplished by use of a delivery vehicle such as a liposome or virus. Viruses that can be used to introduce the vectors of the present invention into blastoderm cells include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes simplex viruses and vaccinia viruses. In one method of transfecting blastoderm cells, a packaged retrovirus-based vector is used to deliver the vector to embryonic blastoderm cells and integrate the vector into the avian genome.

  As an alternative to delivering retroviral transducing particles to embryonic blastoderm cells in the embryo, helper cells that produce retroviruses can be delivered to the blastoderm. Retroviruses useful for random introduction of transgenes into the avian genome are replication deficient avian leukemia virus (ALV), replication deficient murine leukemia virus (MLV) or lentivirus. In order to create a suitable retroviral vector, the pNLB vector inserts a region of one or more exogenous genes between the ovalbumin promoter and the 5 ′ and 3 ′ terminal repeats (LTR) of the retroviral genome. Modified by The present invention contemplates that any coding sequence placed downstream of a promoter that is active in tubular gland cells is expressed in tubular gland cells. For example, since the ovalbumin promoter drives the expression of the ovalbumin protein and is active in the oviduct tubular gland cells, the ovalbumin promoter is expressed in the ocular tube tubular gland cells. While the 7.4 kb ovalbumin promoter has been found to produce the most active construct when assayed in cultured oviduct tubular gland cells, the ovalbumin promoter is preferably shortened for use in retroviral vectors. Is done. In one embodiment, the retroviral vector comprises a 1.4 kb ovalbumin promoter segment; a 0.88 kb segment is also sufficient.

  Any of the vectors of the present invention may also optionally include a coding sequence encoding a signal peptide that directs secretion of a protein expressed by the coding sequence of the vector from oviduct tubular gland cells. This aspect of the present invention effectively extends the range of exogenous proteins that can be deposited in avian eggs using the methods of the present invention. If the exogenous protein is not secreted, the vector containing the coding sequence is modified to contain a DNA sequence comprising about 60 bp encoding a signal peptide derived from lysozyme. The DNA sequence encoding the signal peptide is inserted such that the signal peptide is located at the N-terminus of the protein encoded by the DNA.

  Figures 2A-2D show examples of suitable retroviral vector constructs. The vector construct is inserted into the avian genome with 5 'and 3' flanking LTRs. Neo is a neomycin phosphotransferase gene. The curved arrow indicates the transcription start site. 2A and 2B show LTR and oviduct transcripts with sequences encoding lysozyme signal peptide (LPS), while FIGS. 2C and 2D show transcripts that do not have such sequences. The retroviral vector strategy has two parts. Any protein containing a eukaryotic signal peptide can be cloned into the vectors shown in FIGS. 2B and 2D. Any protein that is not normally secreted can be cloned into the vector shown in FIGS. 2A and 2B to allow secretion from tubular gland cells.

  FIG. 2E shows a strategy for cloning an exogenous gene into a lysozyme signal peptide vector. To amplify a copy of the coding sequence, gene X, using a pair of oligonucleotide primers containing restriction enzyme sites that allow insertion of the amplified gene into a plasmid after digestion with the two enzymes The polymerase chain reaction method is used. The 5 'and 3' oligonucleotides contain Bsu36I and XbaI restriction sites, respectively. Another aspect of the invention involves the use of an in-sequence ribosome entry site (IRES) element in any vector of the invention to allow translation of two or more proteins from dicistronic or polycistronic mRNA. (Example 15). The IRES unit is fused to the 5 'end of one or more additional coding sequences and then inserted at the end of the first coding sequence of the vector so that the coding sequence is separated from the other coding sequence by the IRES. (FIGS. 2F, 15A and 15D). Since one coding sequence can encode an enzyme capable of modifying the product of the other coding sequence, following this aspect of the invention facilitates post-translational modification of the product. For example, a first coding sequence may encode a collagen that is hydroxylated and is activated by an enzyme encoded by a second coding sequence. In the example retroviral vector of FIG. 2F, an in-sequence ribosome entry site (IRES) element is located between the exogenous coding sequences (gene X and gene Y). IRES allows both protein X and protein Y to be translated from transcripts whose transcription is directed by a promoter such as the ovalbumin promoter. A curved arrow indicates a transcription start site. Expression of the protein encoded by gene X is expected to be highest in tubular gland cells, and gene X is specifically expressed but not secreted. The protein encoded by gene Y is also specifically expressed in tubular gland cells, but is secreted efficiently so that protein Y is packaged in the egg. In the retroviral vectors of FIGS. 15A and 15D, the human monoclonal antibody light chain (LC) and heavy chain (HL) are derived from encephalomyocarditis virus (EMCV) and a single vector, pCMV-LC-emcvIRES. -Expressed from HC. Transcription is driven by the CMV promoter (Murakami et al. (1997) “High-level expression of exogenous genes by replication-competent retrovirus vectors with an internal ribosomal entry site” Gene 202: 23-29; Chen et al. (1999 ) “Production and design of more effective avian replication-incompetent retroviral vectors” Dev. Biol. 214: 370-384; Noel et al. (2000) “Sustained systemic delivery of monoclonal antibodies by genetically modified skin fibroblasts” J. Invest. Dermatol 115: 740-745).

  In another aspect of the invention, the coding sequence of the vector used in any method of the invention is provided with a 3 ′ untranslated region (3′UTR) to confer stability to the RNA produced. . When the 3'UTR is added to a retroviral vector, the orientation of the promoter, gene X and 3'UTR must be reversed in the construct so that the addition of the 3'UTR does not interfere with transcription of the full-length genomic RNA . In one embodiment, the 3'UTR is of the ovalbumin or lysozyme gene, or may be any 3'UTR that is functional in the tubular cell, ie, the second half region of SV40.

  In another embodiment of the invention, a constitutive promoter (eg, CMV) is used to express the transgene coding sequence in the avian barrel. In this case, expression is not limited to the tube; expression also occurs in other tissues in the bird (eg, blood). The use of such transgenes, including constitutive promoters and coding sequences, is particularly suitable to effect or drive protein expression in the oviduct and subsequent secretion of the protein into the egg white (eg, in chickens). (See FIG. 8A, which is an example of a CMV-driven construct, such as the pNLB-CMV-IFN vector for expression of IFN-α 2b).

  FIG. 3A shows a schematic representation of a replication deficient avian leukemia virus (ALV) based vector pNLB, a vector suitable for use in the present invention. In the pNLB vector, the majority of the ALV vector genome is replaced by the neomycin resistance gene (Neo) and the lacZ gene encoding β-galactosidase. FIG. 3B shows the vector pNLB-CMV-BL where lacZ is replaced by the CMV promoter and β-galactamase coding sequence (β-La or BL). Vector construction is reported in the detailed examples (Example 1, see below). β-lactamase protein is a natural signal peptide; thus it is found in blood and egg white.

  Avian embryos are transfected with the pNLB-CMV-BL vector (Example 2, see below). The egg whites of the eggs derived from the stably transfected hens obtained contain up to 60 micrograms (μg) of β-lactamase that is secreted and active per egg (see Examples 2 and 3, see below).

  Figures 8A and 8B show the pNLB-CMV-IFN vector used to express interferon-α 2b (IFN-α 2b) and pNLB-MDOT used to express erythropoietin (EPO), respectively. -Shows the EPO vector. Both exogenous proteins (EPO, IFN) are expressed in birds, preferably chickens and turkeys.

  The pNLB-MDOT-EPO vector is made by replacing the BL coding sequence with the EPO coding sequence (Example 10, see below). In one embodiment, a synthetic promoter called MDOT is used to drive the expression of EPO. MDOT contains elements from both the ovomucoid and ovotransferrin promoters. The DNA sequence for human EPO is the Wisconsin Package's BACKTRANSLATE® program, version 9.1 (Genetics Computer) along with codon usage tables made from chicken (Gallus gallus) ovalbumin, lysozyme, ovomucoid and ovotransferrin proteins. Group, Inc., Madison, Wis.) Based on codon usage optimized for hen oviducts. The DNA sequence of EPO is synthesized and cloned into a vector, and the resulting plasmid is pNLB-MDOT-EPO (also referred to as pAVIJCR-A145.27.2.2). In one embodiment, transfection particles (ie, transfection particles) are made for the vector, and these transfection particles are dosed to determine the appropriate concentration that can be used for injection into the embryo. Is done. The eggs are then injected with transfection particles and the eggs hatch after 21 days.

  Exogenous protein levels such as EPO levels can then be measured by ELISA assay of serum samples collected from chicks one week after hatch. Male birds are selected for mating, where birds are screened for GO roosters that contain the EPO transgene in their serum. Preferably, a rooster having the highest level of the transgene in the serum sample is mated with a non-transgenic hen by artificial insemination. Blood DNA samples are screened for the presence of the transgene. Usually, a large number of chicks are found to be transgenics (G1 birds). Chick serum is tested for the presence of human EPO (eg, ELISA assay). Egg whites from eggs from G1 hens are also tested for the presence of human EPO. EPO present in the eggs of the present invention (ie, derived from the optimized coding sequence of human EPO) is biologically active (Example 11).

  Similarly, a pNLB-CMV-IFN vector (FIG. 8A) is generated by replacing the BL coding sequence with the IFN coding sequence (Example 12, see below). In one embodiment, a constitutive cytomegalovirus (CMV) promoter is used to drive the expression of IFN. More particularly, the IFN coding sequence is controlled by a cytomegalovirus (CMV) mediated immediate promoter and an SV40 poly A site. FIG. 8A shows pNLB-CMV-IFN used to express IFN in birds such as chickens and turkeys. A coding sequence optimized for human IFN-α 2b is generated, where the most frequently used codons of each specific amino acid found in egg white protein, ovalbumin, lysozyme, ovomucoid and ovotransferrin are determined according to the present invention. Used in the design of human IFN-α 2b sequences for insertion into vectors. More specifically, the DNA sequence for optimized human IFN-α 2b (FIG. 11A) is based on the optimized codon usage of the hen's oviduct, and the chicken (Gallus gallus) ovalbumin, lysozyme, ovomucoid And the BACKTRANSLATE® program, version 9.1 (Genetics Computer Group, Inc., Madison, WI) of Wisconsin Package with codon usage tables generated from ovotransferrin proteins. For example, the percentage of usage of the four codons of the amino acid alanine in the four egg white proteins is 34% for GCU, 31% for GCC, 26% for GCA, and 8% for GCG. Thus, GCU has been used as a codon for most alanines in the optimized human IFN-α 2b coding sequence. Vectors containing genes for optimized human IFN-α 2b sequences are used to generate transgenic birds that express TPD IFN-α 2b in tissues and eggs.

  Make transfection particles for the vector (ie, transfection particles) and do the dose setting to determine the appropriate concentration that can be used to inject into the embryo (Example 2, see below). Chimeric birds were prepared as described above (see also Example 13, see below). A window is made in the avian egg according to the Speksnijder procedure (US Pat. No. 5,897,998) and transfection particles are injected into the egg. Eggs hatch about 21 days after injection. HIFN levels were measured from serum samples collected from chicks one week after hatch (eg, ELISA assay). As with EPO (above), male birds are selected for mating. To screen for G0 roosters that contain an IFN transgene in their serum, DNA is extracted from rooster serum samples. Roosters with the highest level of transgene in their serum samples are mated with non-transgenic hens by artificial insemination. Blood DNA samples are screened for the presence of the transgene. Transgenic rooster sera are tested for the presence of hIFN (ie, an ELISA assay). If exogenous proteins are identified, non-transgenic hen sperm are used for artificial insemination. Here, a certain percentage of offspring contain the transgene (eg, 50% or more). If IFN (ie, from an optimized coding sequence of human IFN) is present in an egg of the invention, the IFN is tested for biological activity. Similar to EPO, such eggs typically contain biologically active IFN such as TPD IFN-α 2b (FIG. 11B).

  The method of the present invention, which provides for the production of exogenous protein in the avian oviduct and the production of an egg containing the exogenous protein, provides for an appropriate vector and introduces the vector into embryonic blastoderm cells, the vector into the avian genome. Further steps are included to be incorporated. Subsequent steps include obtaining mature transgenic birds from the transgenic blastoderm cells produced in the previous step. If desired, obtaining from a transgenic blastoderm cell transfers the transgenic blastoderm cell to the embryo, allowing the embryo to fully develop, and consequently allowing the embryo to develop, so that the cell Will be incorporated into the bird. As mentioned above, the resulting chick grows and matures. In one embodiment, blastoderm cells are transfected or transduced with the vector directly in the embryo (Example 2). The resulting embryo is developed and the chick is matured.

  In any case, transgenic birds made from transgenic blastoderm cells are known as founders. Some founders carry transgenes in tubular gland cells in the tube of the oviduct. These birds express exogenous proteins encoded by the transgene in the oviduct. Exogenous proteins can also be expressed in other tissues (eg, blood) in addition to the oviduct. If the exogenous protein contains the appropriate signal sequence, the exogenous protein is secreted into the oviduct lumen and the egg white of the egg. Some founders are germline founders (Examples 8 and 9). Germline founders can carry transgenes in the genetic material of germline tissue and can carry transgenes in tubular glandular cells of the oviduct that express exogenous proteins. Therefore, according to the present invention, the transgenic avian exogenous protein is expressed as a tubular gland cell, and the transgenic avian offspring also has an oviduct tubular tubular gland cell that expresses the exogenous protein. Alternatively, the offspring represent a phenotype determined by expressing an exogenous gene in a specific tissue of the bird (Example 6, Table 2). In an embodiment of the invention, the transgenic bird is a chicken or turkey.

  The present invention can be used to express desired proteins on a large scale at low cost, including proteins used as human and animal pharmaceuticals, diagnostics and livestock feed additives. For example, the present invention includes a transgenic bird that lays a protein and an egg laid by a transgenic bird containing the protein in egg white. The present invention contemplates use in the production of any desired protein, including pharmaceutical proteins, provided that the protein coding sequence can be introduced into oviductal cells according to the present invention. Indeed, all the proteins tested so far for the generation of heterogeneity according to the present invention, including interferon-α 2b, GM-CSF, interferon β, erythropoietin, G-CSF, CTLA4-Fc fusion protein and β-lactamase Have been successfully produced using the methods disclosed herein.

  The production of human proteins disclosed herein has a specific purpose. The human forms of each protein disclosed herein that exist in human forms are contemplated for production according to the present invention.

  Proteins contemplated for production disclosed herein include, but are not limited to, human growth hormone, interferon, lysozyme, and β-casein, albumin, α-1 antitrypsin, antithrombin III, collagen, Factor VIII, factor IX, factor X (etc.), fibrinogen, insulin, lactoferrin, protein C, erythropoietin (EPO), granulocyte colony stimulating factor (G-CSF), granulocyte macrophage colony stimulating factor fusion protein ( GM-CSF), tissue-type plasminogen activator (tPA), somatothrombin and chymotrypsin, growth hormones, cytokines, structural proteins and enzymes. Modified immunoglobulins and antibodies, including immunotoxins that bind to and destroy surface antigens on human tumor cells, can be produced as disclosed herein.

  Other detailed examples of therapeutic proteins that can be produced as disclosed herein include, but are not limited to, factor VIII, b domain deleted factor VIII, activated factor VII, factor IX Factors, anticoagulants; hirudin, alteplase, tpa, reteplase, tpa, tpa lacking three of the five domains, insulin, insulin lispro, insulin aspart, insulin glargine, long acting insulin analog, hgh , Glucagon, tsh, follitropin-β, fsh, gm-csf, pdgh, IFN-α 2, IFN-α 2a, IFN-α 2b, inf-α, inf-β 1b, ifn-β 1a, ifn-γ1b , Il-2, il-11, hbsag, ospa, mouse mab to T lymphocyte antigen, t mouse mab for g-72, tumor-associated glycoprotein, chimeric mab-derived fab fragment for platelet surface receptor gpII (b) / III (a), mouse mab fragment for tumor-associated antigen ca125, mouse mab fragment for human carcinoembryonic antigen, cea, mouse mab fragment for human myocardial myosin, mouse mab fragment for tumor surface antigen psma, mouse mab fragment for hmw-maa (fab / fab2 mixed), mouse mab fragment (fab) for carcinoma associated antigen, mab fragment for nca 90 ( fab), surface granulocyte non-specific cross-reactive antigen, cd20 antigen-derived chimeric mab found on the surface of B lymphocytes, against the α chain of the il2 receptor Humanized mab, chimeric mab for α2 chain of il2 receptor, chimeric mab for tnf-α, humanized mab for epitope on the surface of respiratory multinucleated virus, humanized mab for her 2, human epidermal growth factor receptor 2 , Cytokeratin tumor associated antigen, human mab for anti-ctla4, cd 20 surface antigen of b lymphocytes, chimeric mab for dornase-α, β-glucocerebrosidase, tnf-α, il-2-diphtheria toxin fusion protein, tnfr-lgg fragment Fusion proteins laronidase, DNase, alefacept, darbepoetin alfa (colony stimulating factor), tositumomab, mouse mab, alemtuzumab, rasburicase, agarsidase beta, teriparatide, parathyroid gland Mon derivative, adalimumab (lgg1), anakinra, biological variant, nesiritide, human B-type natriuretic peptide (hbnp), colony stimulating factor, pegvisomant, human growth hormone receptor antagonist, recombinant active protein C, omalizumab , Immunoglobulin e (lge) blocker, ibritumomab tiuxetane, ACTH, glucagon, somatostatin, growth hormone, thymosin, parathyroid hormone, pigment hormone, somatomedin, erythropoietin, lutein hormone, chorionic gonadotropin, hypothalamic release Factors, etanercept, antidiuretic hormone, prolactin and thyroid stimulating hormone.

  The invention includes a method of producing a multimeric protein comprising an immunoglobulin such as an antibody and an antigen-binding fragment thereof. Thus, in one embodiment of the invention, the multimeric protein is an immunoglobulin and the first and second heterologous polypeptides are immunoglobulin heavy and light chains, respectively.

  In certain embodiments, the immunoglobulin polypeptide encoded by the transcription unit of at least one expression vector may be an immunoglobulin heavy chain polypeptide comprising a variable region or a variant thereof, wherein the D region, J region, It may further include a C region or a combination thereof. The immunoglobulin polypeptide encoded by the expression vector may be an immunoglobulin light chain polypeptide comprising a variable region or a variant thereof, and may further comprise a J region and a C region. The present invention also contemplates multiple immunoglobulin regions from the same animal species or mixture of species, including but not limited to humans, mice, rats, rabbits and chickens. In certain embodiments, the antibody is human or humanized.

  In another embodiment, the immunoglobulin polypeptide encoded by at least one expression vector forms an immunoglobulin heavy chain variable region, an immunoglobulin light chain variable region, and a single chain antibody capable of selectively binding to an antigen. Linker peptide to be included.

  Examples of therapeutic proteins that can be produced in the methods of the invention include, but are not limited to, HERCEPTIN ™ (Trastuzumab) (Genentech, CA) (for the treatment of patients with metastatic breast cancer). Humanized anti-HER2 monoclonal antibody); REOPRO ™ (Abciximab) (Centocor), which is against the glycoprotein IIb / IIIa receptor on platelets to inhibit clot formation; ZENAPAX ™ (Daclizumab) (Roche Pharmaceuticals, Switzerland) (this is an immunosuppressive humanized anti-CD25 monoclonal antibody to suppress acute allograft rejection); PANORX ™ (this is a mouse Anti-l7- A cell surface antigen IgG2a antibody) (Glaxo Wellcome / Centocor); BEC2 (which is a mouse anti-idiotype (GD3 epitope) IgG antibody (ImClone System)); IMC-C225 (which is a chimeric anti-EGFR IgG Antibody (ImClone System); VITAXIN ™ (which is a humanized anti-αVβ3 integrin antibody) (Applied Molecular Evolution / MedImmune); Campath; Campath 1H / LDP-03 (which is a humanized anti-CD52) It is an IgG1 antibody) (Leukosite); Smart M195 (this is a humanized anti-CD33 IgG antibody) (Protein Design Lab) Kanebo); RITUXAN ™ (which is a chimeric anti-CD2O IgG1 antibody) (IDEC Pharm / Genentech, Roche / Zettyaku); LYMPHOCIDE ™ (this is a humanized anti-CD22 IgG antibody) (Immunomedics) ICM3 is a humanized anti-ICAM3 antibody (ICOS Pharm); IDEC-114 is a primate anti-CD80 antibody (IDEC Pharm / Mitsubishi); ZEVALIN ™ is a radiolabeled mouse anti-CD20 antibody ( IDEC / Schering AG); IDEC-13l is a humanized anti-CD40L antibody (IDEC / Eisai); IDEC-151 is a primatized anti-CD4 antibody (IDEC); IDEC-1 2 is a primatized anti-CD23 antibody (IDEC / Seikagaku); SMART anti-CD3 is a humanized anti-CD3 IgG (Protein Design Lab); 5G1. l is a humanized anti-complement factor 5 (CS) antibody (Alexion Pharm); D2E7 is a humanized anti-TNF-α antibody (CATIBASF); CDP870 is a humanized anti-TNF-α Fab fragment (Celltech) IDEC-151 is a primatized anti-CD4 IgG1 antibody (IDEC Pharm / SmithKline Beecham); MDX-CD4 is a human anti-CD4 IgG antibody (Medarex / Eisai / Genmab); CDP571 is a humanized anti-TNF-α IgG4 LDP-02 is a humanized anti-α4β7 antibody (LeukoSite / Genentech); OrthoClone OKT4A is a humanized anti-CD4 IgG antibody (Ortho Biotech) ANTOVA (TM) is a humanized anti-CD40L IgG antibody (Biogen); ANTEGREN (TM) is a humanized anti-VLA-4 IgG antibody (Elan); CAT-152, human anti-TGF- [beta] 2 antibody (Cambridge Ab Tech) Cetuximab (BMS) is a monoclonal anti-EGF receptor (EGFr) antibody; Bevacizuma (Genentech) g is an anti-VEGF human monoclonal antibody; Infliximab (Centocore, JJ) is used to treat autoimmune disorders A chimeric (mouse and human) monoclonal antibody; Gemtuzumab ozogamicin (Wyeth) is a monoclonal antibody used for chemotherapy; and Ranibizum ab (Genentech) is a chimeric (mouse and human) monoclonal antibody used to treat macular degeneration.

  In one embodiment, the present invention includes G-CSF produced in poultry. In one aspect, the present invention comprises G-CSF having a glycosylation pattern derived from poultry (TPD G-CSF), wherein G-CSF is from avian cells, such as chicken, quail or turkey avian cells. can get. Also included in the present invention are human proteins present in pharmaceutical compositions comprising cytokines such as G-CSF produced in poultry, isolated or purified, and cytokines such as G-CSF produced in poultry. It is. Isolation of proteins containing G-CSF can be accomplished by methods readily apparent to the art. The preparation of formulations useful for the manufacture of pharmaceuticals is also well known in the art.

  The present invention includes poultry-derived therapeutic or pharmaceutical proteins having a glycosylation pattern from poultry derived from birds. For example, the present invention includes avian-derived interferon-α 2 (TPD IFN-α 2). TPD IFN-α 2 shows a new glycosylation pattern that is not normally found in human peripheral blood leukocyte-derived interferon-α 2 (PBL IFN-α 2b) and contains new glycoforms (band 4 and 5 is a disaccharide in which α-Gal is extended; see FIG. TPD IFN-α 2b is also similar to human PBL IFN-α 2b and contains an O-linked glycan structure that is more efficiently produced in chickens than the human form.

  The present invention contemplates an isolated polypeptide comprising an optimized polynucleotide sequence of a protein produced as disclosed herein. For example, the present invention includes a tricoding sequence optimized for human IFN-α 2b, ie, recombinant interferon-α 2b (TPD IFN-α 2b) (SEQ ID NO: 1) from transgenic poultry. The coding sequence for optimized human IFN-α 2b includes 498 nucleotides and 165 amino acids (see SEQ ID NO: 1 and FIG. 11A). Similarly, the coding sequence for native human IFN-α 2b includes 498 nucleotides (NCBI accession numbers AF405539 and GI: 15487879), 165 amino acids (NCBI accession numbers AAL01040 and GI: 15487990). The most frequently used codons for each specific amino acid found in egg white proteins ovalbumin, lysozyme, ovomucoid and ovotransferrin are used in the design of optimized human IFN-α 2b coding sequences that are inserted into the vectors of the invention. Is done. More specifically, the DNA sequence for optimized human IFN-α 2b is based on codon usage in the hen's oviduct and is generated from chicken (Gallus gallus) ovalbumin, lysozyme, ovomucoid and ovotransferrin proteins. Using the Wisconsin Package's BACKTRANSLATE® program, version 9.1 (Genetics Computer Group, Inc., Madison, Wis.). For example, the percentage of usage of the four codons of the amino acid alanine in the four egg white proteins is 34% for GCU, 31% for GCC, 26% for GCA, and 8% for GCG. Thus, GCU has been used as a codon for most alanines in the optimized human IFN-α 2b coding sequence. Vectors containing genes for optimized human IFN-α 2b produce transduced birds expressing poultry-derived IFN-α 2b (TPD IFN-α 2b) transduced in poultry tissues and eggs Used for.

  As discussed in Example 13 (see below), TPD IFN-α 2b is produced in chickens. However, TPD IFN-α 2b can also be produced in other bird species such as turkey and quail. In a preferred embodiment of the invention, TPD IFN-α 2b is expressed in chickens and turkeys and their hard shell eggs. Carbohydrate analysis including monosaccharide analysis and FACE analysis (Example 14, see below) reveals the sugar structure of a protein or a new glycosylation pattern. Alternatively, TPD IFN-α 2b shows the following monosaccharide residues: N-acetyl-galactosamine (NAcGal), galactose (Gal), N-acetyl-glucosamine (NAcGlu) and sialic acid (SA). However, there is no N-linked glycosylation in TPD IFN-α 2b. Instead, TPD IFN-α 2b is O-glycosylated at Thr-106. This type of glycosylation is similar to human IFN-α 2 and the Thr residue at position 106 is unique to IFN-α 2. TPD IFN-α 2b, which is similar to natural IFN-α, does not have a mannose residue. FACE analysis reveals 6 bands representing various sugar residues (FIG. 9), where bands 1, 2 and 3 are non-sialic, sialic and disialic acid added, respectively (FIG. 9). FIG. 10). Sialic acid (CA) linkages are alpha 2-3 for galactose (Gal) and alpha 2-6 for N-acetyl-galactosamine (NAcGal). Band 6 represents a non-sialic acid-added tetrasaccharide. Bands 4 and 5 are alpha-galactose (alpha-Gal) extended disaccharides not found in human PBL IFN-α 2b or natural human IFN (natural hIFN). FIG. 10 shows a comparison of TPD IFN-α 2b (egg white hIFN) and human PBL IFN-α 2b (native hIFN). Minor bands are present between bands 3 and 4 and between bands 4 and 5 in TPD IFN-α 2b (see below).

式（ｉｉ）：

式（ｉｉｉ）：

式（ｉｖ）：

式（ｖ）：

式（ｖｉ）：

［式中、Ｇａｌ＝ガラクトース、
ＮＡｃＧａｌ＝Ｎ−アセチル−ガラクトサミン、
ＮＡｃＧｌｕ＝Ｎ−アセチル−グルコサミンおよび
ＳＡ＝シアル酸］。 The present invention contemplates an isolated polypeptide sequence of TPD IFN-α 2b (SEQ ID NO: 2) (see also FIG. 11B) and pharmaceutical compositions thereof, wherein the protein is disclosed herein. O-glycosylated at Thr-106 with one or more of the following glycan structures:
Formula (i):

Formula (ii):

Formula (iii):

Formula (iv):

Formula (v):

Formula (vi):

[Wherein Gal = galactose,
NAcGal = N-acetyl-galactosamine,
NAcGlu = N-acetyl-glucosamine and SA = sialic acid].

が約２０％であって；
式（ｉｉ）：

が約２９％であって；
式（ｉｉｉ）：

が約９％であって；
式（ｉｖ）：

が約６％であって；
式（ｖ）：

が約２０％であって；
式（ｖｉ）：

が約１２％である。 In one embodiment of the invention, the ratio is
Formula (i):
Formula (i):

Is about 20%;
Formula (ii):

Is about 29%;
Formula (iii):

Is about 9%;
Formula (iv):

Is about 6%;
Formula (v):

Is about 20%;
Formula (vi):

Is about 12%.

  A minute band exists between bands 3 and 4 and between bands 4 and 5 and accounts for about 17% in TPD IFN-α 2b.

  In one embodiment, the present invention relates to a human protein having a glycosylation pattern derived from poultry. In one embodiment, the poultry-derived glycosylation pattern is obtained from avian oviduct cells, eg, tubular gland cells. For example, disclosed herein are glycosylation patterns that have been shown to be present on human proteins produced in chicken oviduct cells by the present invention.

  In one embodiment, the present invention relates to human G-CSF produced in birds (eg, avian oviduct cells) such as chickens, turkeys and quails having a glycosylation pattern from poultry. The mature hG-CSF amino acid sequence is shown in FIG. 18C. The nucleotide sequence used herein to produce G-CSF is shown in FIG. 18A and NCBI Accession NM172219. Nucleotide sequences optimized for avian (eg, chicken) codon usage are also contemplated for use to produce G-CSF and other proteins such as the human protein produced by the present invention.

で表す糖鎖付加構造１つ以上を含む本発明のＧ−ＣＳＦ分子を含む、卵および卵を産むトリ（例えば、ニワトリ、シチメンチョウおよびウズラ）を含む： The present invention includes the following:

Including eggs and egg-laying birds (eg, chickens, turkeys and quails) comprising a G-CSF molecule of the invention comprising one or more glycosylation structures represented by:

  In one embodiment, the present invention comprises a mixture of G-CSF molecules, wherein the mixture is selected from one or more of Structure A, Structure B, Structure C, Structure D, Structure E, Structure F and Structure G G-CSF molecules having a glycosylation structure. The present invention also includes a mixture of G-CSF molecules, wherein the mixture is a glycosylation selected from one or more of Structure A, Structure B, Structure C, Structure D, Structure E, Structure F, and Structure G. The mixture comprises a G-CSF molecule having a structure and the mixture is isolated or purified, for example purified from eggs or egg whites produced according to the present invention. Also included is a mixture of G-CSF molecules, wherein the mixture is two, three, four, of structure A, structure B, structure C, structure D, structure E, structure F and / or structure G, G-CSF molecules with 5 or 6 are included. Also included is a mixture of G-CSF molecules, wherein the mixture is two, three, four, of structure A, structure B, structure C, structure D, structure E, structure F and / or structure G, G-CSF molecules having 5 or 6 and the mixture is isolated or purified, for example purified from eggs or egg whites produced according to the present invention.

  The present invention also includes individual G-CSF molecules comprising structure A. The present invention also includes individual G-CSF molecules comprising structure B. The present invention also includes individual G-CSF molecules comprising structure C. The present invention also includes individual G-CSF molecules comprising structure D. The present invention also includes individual G-CSF molecules comprising structure E. The present invention also includes individual G-CSF molecules comprising structure F. The present invention also includes individual G-CSF molecules comprising structure G. The present invention also includes individual G-CSF molecules comprising structure A. In one embodiment, each G-CSF molecule is in a G-CSF mixture (the mixture is purified from an egg or egg white produced by the present invention), which can be a mixture of isolated or purified G-CSF molecules. Can exist. In one embodiment, each G-CSF molecule is isolated or purified, eg, purified as disclosed herein (eg, by HPLC as disclosed in Example 20).

  The embodiments of the invention detailed herein with respect to G-CSF, eg, a mixture of G-CSF molecules and individual G-CSF molecules (upper two paragraphs) are also generally produced by the invention. And the corresponding glycosylation structure derived from poultry.

  It is also contemplated that glycosylation structures that have been shown to be present on one protein of the invention can be present on another protein of the invention. For example, glycosylation structures that have been shown to be present on TPD G-CSF can also be present on TPD GM-CSF, TPD EPO, TPD IFN and / or other TPD proteins. In another example, glycosylation structures that have been shown to be present in TPD IFNα2 are on TPD G-CSF, TPD GM-CSF, TPD EPO and / or other transgenic poultry-derived (TPD) proteins. It is intended that In particular, the present invention also generally contemplates human proteins having one or more of the TPD glycosylation structures disclosed herein.

  For therapeutic use, the therapeutic protein produced by the present invention may be administered as is, but it is preferred to administer the therapeutic protein as part of a pharmaceutical formulation.

  Accordingly, the present invention further contemplates a glycosylated therapeutic protein from poultry or a pharmaceutically acceptable carrier thereof, together with one or more pharmaceutically acceptable carriers and optionally other therapeutic and / or prophylactic ingredients. Provided are pharmaceutical formulations comprising acceptable derivatives, as well as methods of administering such pharmaceutical formulations. The carrier must be acceptable in the sense of being compatible with the other ingredients of the formulation and not injurious to the recipient thereof. Methods for treating a patient using the pharmaceutical composition of the present invention (eg, the amount of medicinal protein to be administered, the frequency of administration and the duration of treatment) are known to those skilled in the art using standard methods. Can be determined.

  Pharmaceutical formulations include those suitable for oral, rectal, nasal, topical (including buccal and sublingual), vaginal or parenteral. Pharmaceutical formulations include those suitable for administration by injection, including intramuscular, subcutaneous and intravenous administration. Pharmaceutical formulations also include those for administration by inhalation or insufflation. The formulation can suitably be present in discrete dosage units as appropriate and can be prepared by any method well known in the art. Methods for producing pharmaceutical formulations typically include adding therapeutic protein to a liquid carrier or finely divided solid carrier or both, and then forming the product into the desired formulation, if necessary. .

  Pharmaceutical formulations suitable for oral administration are preferably as discrete units, such as capsules, cachets or tablets, each containing a pre-metered amount of active ingredient; as a powder or granules; as a solution; As an object; or as an emulsion. The active ingredient can also be present as a bolus, electuary or paste. Tablets and capsules for oral administration may contain conventional excipients such as binders, fillers, lubricants, disintegrants, or wetting agents. The tablets can be coated according to methods known in the art. Oral liquid preparations may be in the form of aqueous solutions, oily suspensions, solutions, emulsions, syrups or elixirs, etc., or for constitution in water or other suitable vehicle prior to use. It may be prepared as a dried product. Such liquid preparations may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous vehicles (including edible oils) or preservatives.

  The therapeutic proteins of the invention can also be formulated for parenteral administration (eg, by injection such as bolus injection or continuous infusion), ampoules, pre-filled syringes, unit doses in small infusions, or Can be prepared in multi-dose containers with preservatives added. The therapeutic protein can be injected, for example, by subcutaneous injection, intramuscular injection, and intravenous infusion or injection.

  The medical protein can be in the form of a suspension, solution or emulsion in an oily or aqueous vehicle, and can include prescription drugs such as suspending, stabilizing and / or dispersing agents. The therapeutic protein is in powder form and is obtained by sterile isolation of a sterile solid or lyophilization of the solution, and may be for construction in a suitable vehicle such as sterile, pyrogen-free water.

  For topical administration to the epidermis, the therapeutic protein produced by the present invention may be formulated as an ointment, cream or lotion, or transdermal patch. For example, ointments and creams can be formulated with an aqueous or oily base in addition to thickeners and / or gelling agents. Lotions may be formulated with an aqueous or oily base and will in general contain one or more of emulsifying agents, stabilizing agents, dispersing agents, suspending agents, thickening agents, or coloring agents.

  Formulations suitable for topical administration in the mouth are typically medicinal candy containing the active ingredient in a flavored base such as sucrose and gum arabic or tragacanth; in an inert base such as gelatin and glycerin or sucrose and gum arabic And a mouthwash containing the active ingredient in a suitable liquid carrier.

  Pharmaceutical formulations suitable for rectal administration (the carrier is a solid) are most preferably represented as unit dose suppositories. Suitable carriers include cocoa butter and other materials commonly used in the art, and suppositories may suitably be formed by a mixture of the active compound with a softened or melted carrier, of the type Cool and mold in.

  Formulations suitable for vaginal administration are given as vaginal suppositories, tampons, creams, gels, pastes, foams or sprays that contain, in addition to the active ingredient, such carriers known to be suitable in the art. May be.

  For intranasal administration, the therapeutic proteins of the invention may be used as liquid sprays or dispersible powders or in the form of drops.

  The drop may be formulated with an aqueous or non-aqueous base containing one or more dispersants, solubilizers or suspending agents. The liquid spray is suitably delivered from a pressurized pack.

  For administration by inhalation, the therapeutic protein according to the invention can be suitably delivered from conventional means of delivering inhalers, nebulizers or pressurized packs or aerosol sprays. The pressurized pack may contain a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage unit can be determined by providing a valve to deliver a metered amount.

  For administration by inhalation or insufflation, the therapeutic proteins according to the invention may be in the form of a dry powder composition such as a powder mixture of the compound and a suitable powder base such as lactose or starch. The powder composition can be given in unit dosage form, such as in a capsule or cartridge, or in gelatin or blister pack form where the powder can be administered using, for example, an inhaler or nebulizer.

  If necessary, the above formulations adapted to give sustained release of the active ingredient may be used.

  The pharmaceutical composition according to the invention may also contain other active ingredients such as antimicrobial agents or preservatives.

  Furthermore, the therapeutic protein of the present invention may be used in combination with other therapeutic agents.

  The compositions or compounds of the invention can be used to treat a variety of conditions. For example, the methods of treatment are known to those skilled in the art, and there are many conditions that use therapeutic proteins obtained from cell cultures (eg, CHO cells). The present invention contemplates that therapeutic proteins produced in avian systems, including poultry-derived glycosylation patterns, may be used to treat such conditions. That is, the present invention contemplates the treatment of conditions known to be treatable by conventionally produced therapeutic proteins by using the therapeutic proteins produced by the present invention. As will be appreciated in the art, for example, erythropoietin produced by the present invention may be used to treat human conditions such as anemia and kidney disorders (eg, chronic renal failure) The G-CSF produced by the invention may be used to treat cancer patients.

  In general, the dosage administered will vary depending on the age, health and weight of the recipient, the type of combination treatment, the frequency of treatment, and the like. Usually, the dosage of the active ingredient can be about 0.0001 to about 10 mg / kg body weight. The exact dosage, frequency of administration, and duration of treatment can be determined by one skilled in the art of administering each therapeutic protein.

  The following detailed examples are intended to illustrate the present invention and are not intended to limit the scope of the invention.

Example 1
Vector Construction Replace the lacZ gene of pNLB, a replication-deficient avian leukemia virus (ALV) -based vector (Cosset et al., 1991) with an expression cassette consisting of a cytomegalovirus (CMV) promoter and reporter gene, β-lactamase To do. The pNLB and pNLB-CMV-BL vector constructs are shown schematically in FIGS. 3A and 3B, respectively.

  In order to efficiently replace the lacZ gene of pNLB with the transgene, an intermediate adapter plasmid, pNLBAdapter, was first prepared. pNLBAdapter was created by inserting the chewed back ApaI / ApaI fragment of pNLB into the chewed-back KpnI / SacI site of pBluescriptKS (-) (in pNLB, the 5'-side ApaI is located upstream of lacZ at 28 ' Side ApaI is present on the 3 ′ side of the 3 ′ LTR and Gag segments) (Cosset et al., J. Virol. 65: 3388-94 (1991)). The filled-in MluI / XbaI fragment (Moore et al., Anal. Biochem. 247: 203-9 (1997)) of pCMV-BL was inserted into the chewed-back KpnI / NdeI site of pNLB-Adapter and lacZ was inserted into the CMV promoter and Replacement with the BL gene (in pNLB, KpnI is present 67 bp upstream of lacZ and NdeI is present 100 bp upstream of the lacZ stop codon), thereby creating pNLB-Adapter-CMV-BL. To create pNLB-CMV-BL, the HindIII / BlpI insert of pNLB (including lacZ) was replaced with the HindIII / BlpI insert of pNLB-Adapter-CMV-BL. For unknown reasons, this two-step cloning is necessary because direct ligation of blunt-ended fragments to the HindIII / BlpI site of pNLB results in a largely rearranged subclone.

Example 2
Generation of pNLB-CMV-BL Founders Sentas and Isoldes were treated with F10 (Gibco), 5% newborn calf serum (Gibco), 1% chicken serum (Gibco), 50 μg / ml phleomycin (Cayla Laboratories) and 50 μg / ml hygromycin Cultured in (Sigma). Cosset et al. , 1993 (incorporated herein by reference), transduced particles were made. Two days after transfection of 9 × 10 ⁵ Sentas of the retroviral vector pNLB-CMV-BL (from Example 1 above), the virus was collected in fresh medium for 6-16 hours and filtered. All media were used to transduce 3 × 10 ⁶ Isoldes on three 100 mm plates with polybrene added to a final concentration of 4 microg / ml. The next day, the medium was replaced with a medium containing 50 μg / ml phleomycin, 50 μg / ml hygromycin and 200 μg / ml G418 (Sigma). After 10-12 days, a single colony resistant to G418 was isolated and transferred to a 24-well plate. Seven to 10 days later, titers from each colony were determined by Sentas transduction and G418 selection was performed. Typically, 2 out of 60 colonies had a titer of 1-3 × 10 ⁵ . Allioli et al. Dev. Biol. These colonies were expanded and the virus was concentrated to 2-7 × 10 ⁶ as described in 165: 30-7 (1994) (incorporated herein by reference). The integrity of the CMV-BL expression cassette was confirmed by assaying for β-lactamase in the medium of cells transduced with NLB-CMV-BL transduced particles.

The transduction vector, pNLB-CMV-BL, was injected into the subembryonic space of 546 non-incubated SPF white leghorn embryos. Of these 126 chicks hatched and assayed for secretion of β-lactamase (lactamase) into the blood. To determine the active lactamase concentration in unknown samples, kinetic colorimetry was used, in which PADAC (purple substance) was specifically converted by lactamase to a yellow compound. By monitoring the decrease in OD ₅₇₀ during standard reaction times, the activity of lactamase was quantified and compared to a standard curve with varying levels of purified lactamase (referred to as “lactamase assay”). The presence or absence of lactamase in the sample was also determined by visual scoring for purple to yellow conversion in the test sample overnight or for several days (“overnight lactamase assay”). The latter method was suitable for detecting very low levels of lactamase or screening a large number of samples. At 1 to 4 weeks of age, chick serum samples were tested for the presence of lactamase. Twenty-seven chicks had very low levels of lactamase in the serum and could only be detected after an overnight lactamase assay, and when these birds matured, lactamase was no longer detectable. As shown in Table 1 below and FIG. 4A, additional birds (3 males and 6 females) produced lactamase serum in the range of 11.9 to 173.4 ng / ml at 6-7 months after hatching. It was a level.

Example 3
Expression of β-lactamase in G0 hen egg white 57 young hens transduced with the pNLB-CMV-BL retroviral vector were raised to sexual maturity, and at 8 months of age, active β-lactamase (lactamase) ) Was tested for egg white from each hen. Of the 57 birds, 6 had significant lactamase levels ranging from 56.3 to 250.0 ng / ml (Table 1, above). Even after incubating PADAC with the sample for several days, the other hens in this group did not have detectable levels of lactamase in egg white. Lactamase could not be detected in egg whites from 24 hens that were sham-injected and in 42 hens transduced with the NLB vector not carrying the lactamase transgene. Stable expression was still detectable in the egg whites of 6 expressing hens 6 months after the first assay (Table 1, above).

  Lactamase was detected in the egg white of all six hens by Western blot assay using anti-β-lactamase antibody. The egg white lactamase was the same size as the bacterially produced and purified lactamase used as a standard. The amount detected in egg white by Western analysis was consistent with the amount determined by enzyme assay, indicating that a significant percentage of egg white lactamase was biologically active. The activity of lactamase in egg white produced by hens and stored at 4 ° C. was not impaired and showed no change in molecular weight after several months of storage. This observation allowed storage of eggs containing lactamase for a period extended to analysis.

Example 4
Germline transmission and serum expression of β-lactamase in G1 and G2 transgenic chickens DNA was extracted from spermatozoa recovered from 56 GO roosters, among 56 birds, measured by quantitative PCR, and sperm DNA Three birds that had a significant level of the transgene in were selected for breeding. These roosters had the same three birds with the highest blood β-lactamase (lactamase) levels (roosters 2395, 2421 and 2428). Rooster 2395 gave rise to 3 G1 transgenic progeny (out of 422 offspring), while the remaining 2 did not produce transgenic offspring (out of a total of 650 offspring). Southern analysis of blood DNA from each of the three G1 transgenic chickens confirmed that the transgene was intact and integrated into a unique, random locus. In the cages 6-11 weeks, G1 transgenic chick, 5308, 5657, and 4133 sera contained 0.03, 2.0, and 6.0 μg / ml lactamase, respectively. When chickens were assayed again at 6-7 months of age, lactamase levels were reduced to levels of 0.03, 1.1 and 5.0 μg / ml (FIG. 4A).

  Hen 5657 and rooster 4133 were mated with non-transgenic chickens to obtain offspring that were hemizygous for the transgene. FIG. 5 shows the transgenic chicken lines derived from the male bird 4133 and the female bird 5657, and the subsequent generations. Transgenic rooster 5308 was also bred, but the avian offspring showed a lactamase concentration that was either very low or undetectable in serum and egg white. The concentration of active lactamase in the serum of randomly selected G2 transgenic chicks was measured 3 to 90 days after hatching. All five of the GO transgenics born from hen 5657 had active lactamase at a concentration of 1.9-2.3 μg / ml (compared to 1.1 μg / ml of parental expression, FIG. 4B). All samples were collected during the same period. Therefore, since the concentration in hen 5657 decreased in proportion to maturity, the lactamase concentration in the offspring serum was expected to be higher than the parental concentration. Similarly, all 5 randomly selected from transgenic chicks born from rooster 4133 all had similar serum lactamase concentrations, but higher serum (FIG. 4B).

Example 5
Expression of β-lactamase in egg whites of transgenic hens Eggs derived from G1 hen 5657, containing 1 ng of active β-lactamase (lactamase) per ml of egg white (FIG. 6A). The concentration of lactamase was higher in some eggs laid first and then reached a stable period that was stable for at least 9 months. Eggs from transgenic hens born from hen 5357 and non-transgenic roosters had lactamase concentrations similar to their parents (FIG. 6A). Hen 6978 was born from G2 hen 8617 and sibling G2 rooster 8839 and was determined to be homozygous for the transgene by quantitative PCR and Southern analysis. As expected, lactamase concentrations in avian 6978 eggs were almost twice as high as hemizygous parents (FIG. 6B). Since hen 6978 is the only female chick of hen 5657, the G3 hen born from hen 5657 has not been analyzed elsewhere. Eggs from hens 8867, 8868 and 8869 have been recovered 11 months apart, have similar lactamase concentrations, indicating that expression levels in egg white are consistent throughout the egg-laying period It is important to keep in mind. Rooster 4133 was crossed with non-transgenic birds to obtain hemizygous G2 hens. All 15 transgenic hens analyzed had lactamase in egg white at concentrations ranging from 0.47 to 1.34 μg / ml. Four representative hens are shown in FIG. 7A. When assayed after 6 months, the average expression level was reduced to approximately 1.0 μg / ml to 0.8 μg / ml (FIG. 7A). Expression levels were high in the first egg and were stable over several months. Thereafter, the lactamase level in the egg remained constant.

  G2 hens and brother G2 rooster 8191 were mated to give rise to hemizygous and homozygous G3 hens. All transgenic G3 hens expressed lactamase in egg white at concentrations ranging from 0.52 to 1.65 μg / ml (FIG. 7B). Mean expression for homozygous G3 hens was 47% higher than hemizygous G2 and G3 hens. While the amount of lactamase in eggs from G2 and G3 hens born from rooster 4133 and its offspring varied significantly (FIGS. 7A and 7B), the levels in eggs from any given hen of that group were relatively constant. there were. The average expression of lactamase was expected to be twice that of the homozygous genotype. Western blot analysis confirmed that the transgene correctly produced intact lactamase in the G2 transgenic egg. The lactamase level detected by Western blot is also closely related to that determined by the enzyme activity assay, indicating that an important part of egg white lactamase is bioactive. Thus, the retroviral vector can be successfully used to perform stable and reliable expression of the transgene in chickens.

  Lactamase deposition in egg yolk was detectable but lower than that in egg white. Seven G2 or G3 hens of line 4133 were analyzed, with concentrations ranging from 107 to 375 ng / ml in egg yolk and about 20% of the concentration in egg white. There was no association between egg yolk and egg white lactamase levels in a given hen (Harvey et al., “Expression of exogenous protein in egg white of transgenic chickens” (April 2002) Nat. Biotechnol. 20: 396-399).

Example 6
Generation of female founders Newly born fertilized white leghorn eggs were used for pNLB-CMV-BL transduction. 7-10 μl of concentrated particles were injected into the subembryonic space of the egg that made the window, and the window was sealed before hatching in chicks. 546 eggs were injected. Blood DNA was extracted and analyzed for the presence of the transgene using a probe primer set designed to detect neo resistance via the Taqman assay. As can be seen in Table 3 below, approximately 25% of all chicks had detectable levels of transgene in blood DNA.

Example 7
Percent germline transmission of the transgene Southern blot analysis was performed on DNA from G1 and G2 recombination to confirm the integration and integrity of the inserted vector sequence. Blood DNA is digested with HindIII and hybridized to a neo-resistant probe to produce a junction created by the internal HindIII site found in the pNLB-CMV-BL vector and the genomic site adjacent to the integration site. Partial fragment was detected (FIG. 3B). Each of the three G1 birds carrying NLB-CMV-BL has a unique size of the junction fragment, suggesting that the transgene is integrated into three different genomic sites. G1 was mated with a non-transgenic hen to obtain hemizygous G2. As can be seen in Table 2 (above), 50.8% of offspring from G1 roosters with NLB-CMV-BL as predicted for Mendelian segregation of an integrated single transgene Was the introduction of genetic selection. Southern analysis of DNA derived from G2 progeny and digested with HindIII detected a junction fragment similar in size to that generated from the transgenic parent, indicating that the transgene was transmitted intact. It was.

Example 9
Screening for G3 offspring homozygous for the transgene To obtain transgenic chickens that are homozygous for the transgene, a G2 hemizygous bird with an NLB-CMV-BL integrated at the same site (eg, , The same G1 male offspring) were mated. Two groups were born: the first group was hens and roosters originating from G1 4133, and the second group was from G1 5679 hens. A Taqman assay was used to quantitatively detect neo resistant transgenes in G3 progeny using a standard curve. A standard curve was constructed using the amount of genomic DNA known from the G1 transgenic 4133 male that is hemizygous for the transgene as determined by Southern analysis. The standard curve ranged from a total transgene copy number of 10 ^{3 to} 1.6 × 10 ⁴ or a transgene copy number per diploid genome of 0.2 to 3.1. Since the reaction components were limited during the log phase, amplification was very efficient and gave reproducible values for a given copy number. There was a reproducible one-cycle difference between calibration curves that differed in copy number by two times.

  To determine the number of transgene alleles in G3 progeny, DNA was amplified and compared to a standard. Non-genetical recombination-derived DNA was not amplified. Birds that were homozygous for the transgene allele produced plots that started amplification one cycle earlier than those that were hemizygous for the allele. The sequence detection program can produce the number of alleles in an unknown sample based on a calibration curve and cycle threshold (Ct) where the amplification plot of the sample shows a significant increase. The data is shown in Table 3 below.

  To confirm Taqman copy number analysis, DNA of selected birds was analyzed by Southern blotting using PstI digested DNA and a probe complementary to the neo resistance gene to detect a 0.9 kb fragment. . Since the movement of small DNA gels to membranes is more quantitative, the detection of small fragments was also chosen. The signal intensity of the 0.9 kb band corresponded well to the copy number of the G3 transgenic bird determined by Taqman assay. The copy number of an additional 18 G3 transgenic birds analyzed by Southern blotting was also consistent with that determined by Taqman. For the 4133 strain, all 33 offspring were analyzed, 9 (27.3%) were non-transgenic, 16 (48.5%) were hemizygous and 8 (24 .2%) were homozygous. For the 5657 strain, all 10 offspring were analyzed and 5 (50.0%) were non-transgenic, 1 (10.0%) were hemizygous and 4 (40 0.0%) was homozygous. For the 4133 line G3 progeny, the observed ratio of non-GMO, hemizygote and homozygote was substantially different from the expected ratio of 1: 2: 1 determined by the χ2 test (P Is 0.05 or less). The 5657 offspring did not have the expected distribution, which may be attributed to the small number of offspring tested (Harvey et al., “Consistent production of transgenic chickens using replication deficient retroviral vectors and high-throughput screening procedures "(February 2002) Poultry Science 81: 202-212).

Example 10
Vector Construction for pNLB-MDOT-EPO Vector In accordance with the teachings of Example 1 (Vector Construction) herein, the EPO coding sequence was replaced with a BL coding sequence to create a pNLB-MDOT-EPO vector (FIG. 8B). . Instead of using the CMV promoter, MDOT was used (Figure 13). MDOT is a synthetic promoter containing elements from both ovomucoid (MD) and ovotransferrin (TO) promoters (pNLB-MDOT-EPO vector, also known as pAVIJCR-A145.27.2.2).

  The BACKTRANSLATE® program of Wisconsin Package, version 9.1 (Genetics Computer Group, Inc., Inc., Inc., Inc., Inc., Inc., Inc., Inc., Inc., Inc., Inc., Inc., Inc.). ) Was used to generate a DNA sequence for human EPO based on the optimized codon usage of the hen oviduct. The DNA sequence was synthesized and cloned into the 3 'overhang T of pCRII-TOPO (Invitrogen) by contract-based Integrated DNA Technologies, Coralville, Iowa. The EPO coding sequence was then removed from pEpoMM using Hind III and Fse I, purified from 0.8% agarose-TAE gel, digested with Hind III and Fse I, and ligated into pCMV-IFNMM treated with alkaline phosphatase did. The resulting plasmid is pAVIJCR-A137.43.2.2, which contains the EPO coding sequence controlled by the cytomegalovirus immediate promoter / enhancer and the SV40 polyA site. Plasmid pAVIJCR-A137.43.2.2 is digested with NcoI and FseI, the appropriate fragment is ligated to a fragment of pMDOTIFN digested with NcoI and FseI, and pAVIJCR-A137.87 containing EPO driven by the MDOT promoter. Obtained 2.1. In order to clone the EPO coding sequence controlled by the MDOT promoter into the NLB retroviral plasmid, the plasmids pALVMDOTIFN and pAVIJCR-A137.87.2.1 were digested with KpnI and FseI. Appropriate DNA fragments were purified from a 0.8% agarose-TAE gel, then ligated and transformed into DH5α cells. The resulting plasmid is pNLB-MDOT-EPO (also known as pAVIJCR-A145.27.2.2).

Example 11
Production of transgenic chickens that express EPO and fully transgenic G1 chickens
Generation of NLB-MDOT-EPO transfected particles was performed as described for NLB-CMV-BL (see Example 2). Windows were made in about 300 white leghorn eggs according to the Speksnijder procedure (US Pat. No. 5,897,998), and then about 7 × 10 ⁴ transduced particles per egg were injected. Eggs hatched 21 days after injection. Serum samples were collected from chicks one week after hatch and EPO levels were measured by EPO ELISA. To screen for GO roosters containing the EPO transgene in their sperm, DNA was extracted from rooster serum samples by Chelex-100 extraction (Walsh et al., 1991). Next, “neo for-1” (5′-TGGATTGCACGCCAGGGTCT-3 ′; SEQ ID NO: 5) and “neo rev-1” (5′-TGCCCAGTCATAGCCGAAT-3 ′; SEQ ID NO: 6) primer and FAM-labeled NEO-PROBE1 ( Using 5′-CCTCTCCCACCCAAGCGGCCG-3 ′; SEQ ID NO: 7), the DNA sample was subjected to Taqman® analysis on a 7700 Sequence Detector (Perkin Elmer) to detect the transgene. Eight G0 roosters with the highest transgene level in the sperm sample were mated by artificial insemination with non-transgenic SPAFAS (white leghorn) hens. Blood DNA samples were screened for the presence of the transgene by Taqman® analysis as described above.

  Of the 1054 offspring, 16 chicks were found to be transgenic (G1 birds). Chicken serum was tested for the presence of human EPO by EPO ELISA. EPO was present at about 70 ng / ml. Egg whites from eggs from G1 hens were also tested for the presence of human EPO by EPO ELISA and found to contain about 70 ng / ml human EPO. When testing human EPO-responsive cell lines (HCD57 mouse red blood cells) in a cell culture assay, EPO present in the egg (ie, derived from an optimized coding sequence for human EPO) is biologically active. I found out.

Example 12
Vector Construction for pNLB-CMV-IFN According to the teaching of Example 1, the IFN coding sequence was replaced with the BL coding sequence of Example 1 to create a pNLB-CMV-IFN vector.

  An optimized coding sequence is generated where the most frequently used codons for each of the specific amino acids found in egg white proteins ovalbumin, lysozyme, ovomucoid and ovotransferrin are inserted into the vectors of the invention. Used in the design of human IFN-α 2b coding sequences. More specifically, the DNA coding sequence for optimized human IFN-α 2b is based on optimized codon usage of the hen oviduct and is characterized by chicken (Gallus gallus) ovalbumin, lysozyme, ovomucoid and ovotransferrin. It was generated using the BACKTRANSLATE (R) program of Wisconsin Package, version 9.1 (Genetics Computer Group, Inc., Madison, WI) with a codon usage table generated from proteins. For example, the percentage of usage of the four codons of the amino acid alanine in the four egg white proteins was 34% for GCU, 31% for GCC, 26% for GCA, and 8% for GCG. Therefore, GCU was used as a codon for most alanines in the optimized human IFN-α 2b coding sequence. Vectors containing genes for optimized human IFN-α 2b produce transduced birds that express IFN-α 2b from poultry transduced in poultry tissues and eggs (TPD IFN-α 2b) Used for.

  In Table 4 below by PCR using Pfu polymerase (Stratagene, La Jolla, Calif.) (94 ° C., 1 minute; 50 ° C., 30 minutes; and 72 ° C., 1 minute for 20 cycles and 10 seconds) The listed template and primer oligonucleotides were amplified. The PCR product was purified from a 12% polyacrylamide-TBE gel by the “milling and soaking” method (Maniatis et al. 1982) and then only IFN-1 and IFN-8 (see Table 4) as primers. It was incorporated as a template in the amplification reaction used. The resulting PCR product was digested with Hind III and Xba I, purified from a 2% agarose-TAE gel and then ligated into pBluescript KS (Stratagene) digested with Hind III and Xba I and treated with alkaline phosphatase The plasmid pBluKSP-IFNMagMax was generated. Both strands were sequenced by cycle sequencing on an ABI PRISM 377 DNA sequencer (Perkin-Elmer, Foster City, Calif.) Using universal T7 and T3 primers. Mutations on pBluKSP-IFN derived from the original oligonucleotide primer template were corrected by site-directed mutagenesis using the Transformer Site-Directed Mutagenesis Kit (Clontech, Palo Alto, Calif.). The IFN coding sequence was then removed from the corrected pBluKSP-IFN using Hind III and Xba 1, purified from 0.8% agarose-TAE gel, digested with Hind III and Xba I, and treated with alkaline phosphatase Ligated to pCMV-BetaLa-3B-dH. The resulting plasmid was pCMV-IFN, which contained a cytomegalovirus (CMV) mediated immediate promoter and an IFN coding sequence controlled by the SV40 polyA site. To clone the IFN coding sequence controlled by the CMV promoter / enhancer into the NLB retroviral plasmid, pCMV-IFN was first digested with ClaI and XbaI and then the Klenow fragment of DNA polymerase (New England BioLabs, Beverly , Mass.) Was used to fill both ends. NDL and KpnI were used to digest pNLB-adapter and both ends were blunted with T4 polymerase (New England BioLabs). Appropriate fragments were purified on a 0.8% agarose-TAE gel, then ligated and transformed into DH5α cells. The resulting plasmid is pNLB-adapter-CMV-IFN. The plasmid was then digested with MluI, partially digested with BlpI, and the appropriate fragment was gel purified. PNLB-CMV-EGFP was digested with MluI and BlpI, then treated with alkaline phosphatase and gel purified. The MluI / BlpI partial fragment of pNLB-adapter-CMV-IFN was ligated to a large fragment derived from MluI / BlpI digestion of pNLB-CMV-EGFP to generate pNLB-CMV-IFN.

Example 13
Preparation of transgenic chicken expressing IFN and complete transgenic G1 chicken Transduced particles of pNLB-CMV-IFN were prepared according to the procedure of Example 2. According to the Specksnijder procedure (US Pat. No. 5,897,998), approximately 300 white leghorn (line 0) eggs were windowed and then 7 × 10 ⁴ transducing particles were injected per egg. Eggs hatched 21 days after injection. Serum samples were collected from chicks one week after hatch and human IFN levels were measured by IFN ELISA.

  To screen for GO roosters containing the EPO transgene in their sperm, DNA was extracted from rooster serum samples by Chelex-100 extraction (Walsh et al., 1991). Next, “neo for-1” (5′-TGGATTGCACGCCAGGGTCT-3 ′; SEQ ID NO: 5) and “neo rev-1” (5′-TGCCCAGTCATAGCCGAAT-3 ′; SEQ ID NO: 6) primer and FAM-labeled NEO-PROBE1 ( Using 5′-CCTCTCCCACCCAAGCGGCCG-3 ′; SEQ ID NO: 7), the DNA sample was subjected to Taqman® analysis on a 7700 Sequence Detector (Perkin Elmer) to detect the transgene. Eight G0 roosters with the highest transgene level in the sperm sample were mated by artificial insemination with non-transgenic SPAFAS (white leghorn) hens.

  Blood DNA samples were screened for the presence of the transgene by the Taqman® analysis described above. Of the 1597 offspring, one rooster was found to be a transgenic (also called “Alphie”). Alphae was tested by hIFN ELISA for the presence of hIFN and hIFN was present at 200 ng / ml.

  Alphie sperm were used for artificial insemination of non-transgenic SPAFAS (white leghorn) hens. Tagman® analysis detected that 106 of the 202 offspring contained the transgene. According to Mendel's mode of inheritance, it was shown that Alphae is a transgenic.

Example 14
Carbohydrate analysis of transgenic poultry-derived interferon-α 2b (TPD IFN-α 2b) Experimental evidence reveals a new glycosylation pattern in avian-derived interferon-α 2b (ie, TPD IFN-α 2b) Became. TPD IFN-α 2 shows a new glycosylation pattern not usually found in human peripheral blood leukocyte-derived interferon-α 2 (PBL IFN-α 2b) or natural human interferon-α 2 (natural hIFN) Containing new glycoforms (bands 4 and 5 are disaccharides with extended α-Gal; see FIG. 9). TPD IFN-α 2b is also similar to human PBL IFN-α 2b and contains an O-linked glycan structure that is more efficiently produced in chickens than the human form. Shows a new glycosylation pattern that is not normally seen and contains a new glycoform (bands 4 and 5 are disaccharides with extended α-Gal; see FIG. 9). TPD IFN-α 2b was also found to be similar to human PBL IFN-α 2b and contain an O-linked glycan structure that is more efficiently produced in chickens than the human form.

  The coding sequence for human IFN-α 2b was optimized (Example 12, above) to generate a recombinant IFN-α 2b coding sequence. TPD IFN-α 2b was then produced in chickens (Example 13, above). Carbohydrate analysis, including monosaccharide analysis and FACE analysis, revealed sugar structures and glycosylation patterns of proteins. Alternatively, TPD IFN-α 2b shows the following monosaccharide residues: N-acetyl-galactosamine (NAcGal), galactose (Gal), N-acetyl-glucosamine (NAcGlu) and sialic acid (SA). However, there is no N-linked glycosylation in TPD IFN-α 2b. Instead, TPD IFN-α 2b is O-glycosylated at Thr-106. This type of glycosylation is similar to human IFN-α 2 and the Thr residue at position 106 is unique to IFN-α 2. TPD IFN-α 2b, which is similar to natural IFN-α, does not have a mannose residue. FACE analysis reveals 6 bands representing various sugar residues (FIG. 9), where bands 1, 2 and 3 are non-sialic, sialic and disialic acid added, respectively (FIG. 9). FIG. 10). Sialic acid (CA) linkages are alpha 2-3 for galactose (Gal) and alpha 2-6 for N-acetyl-galactosamine (NAcGal). Band 6 represents a non-sialic acid-added tetrasaccharide. Bands 4 and 5 are alpha-galactose (alpha-Gal) extended disaccharides not found in human PBL IFN-α 2b or natural human IFN (natural hIFN). FIG. 10 shows a comparison of TPD IFN-α 2b (egg white hIFN) and human PBL IFN-α 2b (native hIFN). Minor bands are present between bands 3 and 4 and between bands 4 and 5 in TPD IFN-α 2b (see below).

式（ｉｉ）：

式（ｉｉｉ）：

式（ｉｖ）：

式（ｖ）：

式（ｖｉ）：

［式中、Ｇａｌ＝ガラクトース、
ＮＡｃＧａｌ＝Ｎ−アセチル−ガラクトサミン、
ＮＡｃＧｌｕ＝Ｎ−アセチル−グルコサミンおよび
ＳＡ＝シアル酸］。 We found that the protein was O-glycosylated at Thr-106 at the following specific residues:
Formula (i):

Formula (ii):

Formula (iii):

Formula (iv):

Formula (v):

Formula (vi):

[Wherein Gal = galactose,
NAcGal = N-acetyl-galactosamine,
NAcGlu = N-acetyl-glucosamine and SA = sialic acid].

が約２０％であって；
式（ｉｉ）：

が約２９％であって；
式（ｉｉｉ）：

が約９％であって；
式（ｉｖ）：

が約６％であって；
式（ｖ）：

が約２０％であって；
式（ｖｉ）：

が約１２％であった。 The ratio is
Formula (i):

Is about 20%;
Formula (ii):

Is about 29%;
Formula (iii):

Is about 9%;
Formula (iv):

Is about 6%;
Formula (v):

Is about 20%;
Formula (vi):

Was about 12%.

  Minor bands were present between bands 3 and 4 and between bands 4 and 5 and accounted for about 17% in TPD IFN-α 2b.

Example 15
Expression of MAbs from plasmid transfection and retroviral transduction using EMCV IRES in avian cells. By placing an IRES from encephalomyocarditis virus (EMCV) between the LC and HC coding sequences, The chain (LC) and heavy chain (HC) were expressed from a single vector, pCMV-LC-emcvIRES-HC (Jang et al. (1988) “A segment of the 5 ′ nontranslated region of encephalomyocarditis virus RNA directs internal See also entry of ribosomes during in vitro translation ”J. Virol. 62: 2636-2643).

  To test the expression of monoclonal antibodies from two separate vectors, LC or HC linked to the CMV promoter was cotransfected into LMH / 2a cells, an estrogen-responsive chicken liver cell line (Binder et al. ( 1990) "Expression of inherent and transfected apolipoprotein II and vitellogenin II genes in an estrogen responsive chicken liver cell line" Mol. Endocrinol. 4: 201-208). Detection by MAb ELISA that co-transfection of pCMV-LC and pCMV-HC resulted in 392 ng / ml MAbs, whereas transfection of pCMV-LC-emcvIRES-HC resulted in 185 ng / ml MAbs did.

  A CMV-LC-emcv-HC cassette was inserted into a retroviral vector based on Moloney murine leukemia virus (MLV) to prepare pL-CMV-LC-emcvIRES-HC-RN-BG. LMH cells (see also Kawaguchi et al. (1987) “Establishment and characterization of a chicken hepatocellular carcinoma cell line, LMH” Cancer Res. 47: 4460-4464), although the parental line of LMH / 2a was used as the target cell. This is because these cells are not resistant to neomycin. LMH cells were transduced with the L-CMV-LC-emcvIRES-HC-RN-BG retroviral vector, selected with neomycin and passaged for several weeks. LMH cells were transduced separately and neomycin selected using the parent MLV vector, LXRH. The medium from LXRH cells was negative for MAb, whereas the medium from cells transduced with L-CMV-LC-emcvIRES-HC-RN-BG contained 22 ng / ml MAb.

Example 16
Generation of Transduced and Fully Transduced G1 Chickens Expressing MAbs By replacing the CMV-LC-emcv-HC cassette of Example 15 with the CMV-BL cassette of pNLB-CMV-BL of Example 1, pNLB -A CMV-LC-emcv-HC vector was prepared.

According to the procedure of Example 2, transduced particles of pNLB-CMV-LC-emcv-HC were prepared. Windows were made in about 300 white leghorn eggs according to the Speksnijder procedure (US Pat. No. 5,897,998), and then about 7 × 10 ⁴ transduced particles per egg were injected. Eggs hatched 21 days after injection. Serum samples were collected from chicks one week after hatch and EPO levels were measured by EPO ELISA.

  Taqman® analysis identified G0 roosters containing the EPO transgene in sperm. Roosters with the highest level of transgene in their serum samples were mated with non-transgenic SPAFAS (white leghorn) hens by artificial insemination.

  Screening for 1000 offspring, we found that more than 10 chicks were transgenic (G1 birds). Chick serum was tested by ELISA for the presence of MAbs. It is found that MAb is present in an amount greater than 10 μg / ml serum. Egg white from G1 hens is also tested by ELISA for the presence of MAb and found to be present in an amount greater than 10 μg / ml serum.

Example 17
Construction of pNLB-CMV-hG-CSF This vector efficiently replaces the IFN coding region of the pNLB-CMV-IFN vector of Example 12 with the coding sequence of G-CSF. Using primers 5'GCSF (gggggggaagctttcaccatgggctggacctgcca; SEQ ID NO: 32) and 3'GCSF (actagacttttcagggctgggcacagtgtgcg; SEQ ID NO: 33), pORF9-hGpGfGfVfGf (A human granulocyte colony stimulating factor reading frame) was amplified to produce a PCR product of 642 base pairs (bp). To provide a pNLB-CMV-hG-CSF construct with a 3 'coding sequence of the G-CSF coding sequence that matches that found in pNLB-CMV-IFN alpha-2b, primer 5'GCSF-NLB (ccagcccctgaaaagtcttagggtggtgt A 86 bp fragment of pNLB-CMV-IFN alpha-2b (adjacent to the 3 'end of the IFN coding sequence) by PCR using SEQ ID NO: 34) and 3'GCSF-NLB (ggggggggctctagctggaattccgcc; SEQ ID NO: 35) Was amplified. The two PCR products (642 bp and 86 bp) were mixed and fused by PCR amplification with primers 5′GCSF and 3′GCSF-NLB. The PCR product was cloned into pCR® 4 Blunt-TOPO® plasmid vector (Invitrogen) according to instructions and electroporated into DH5α-E cells to generate pFusion-hG-CSF-NLB. PFusion-hG-CSF-NLB was digested with Hind III and Blp I and the 690 bp G-CSF fragment was gel purified. The IFN alpha-2b coding sequence was removed from pNLB-CMV-IFN alpha-2b by digestion with BlpI. Subsequently, the vector was digested again, and a clone lacking the insertion part encoding IFN was selected to prepare pNLB-CMV-delta hIFN alpha-2b. PNLB-CMV-delta IFN alpha-2b was digested with Blp I, partially digested with Hind III, and the 8732 bp Blp I-Hind III vector fragment was gel purified. The 8732 bp fragment was ligated to the 690 bp Hind III / Blp IG G-CSF fragment to generate pNLB-CMV-G-CSF. The G-CSF ORF was confirmed by sequencing.

Example 18
Production of transgenic chickens expressing human granulocyte colony stimulating factor (hG-CSF) NLB-CMV-hG-CSF transduced particles were produced as described for NLB-CMV-BL in Example 2. ⁷ μl of NLB-CMV-hG-CSF transduced particles were injected into 277 embryos of stage X eggs (titer was 2.1 × 10 ^{7 to} 6.9 × 10 ⁷ ). 86 chicks were raised until they hatched and became sexually mature. Sixty chicks were positive for G-CSF and separated by sex: 30 males and 30 females. For hG-CSF, egg whites from 21 hens were assayed by ELISA. We found that 5 hens had significant levels of hG-CSF protein ranging from 0.05 μg / ml to 0.5 μg / ml.

  DNA was extracted from rooster serum samples by Chelex-100 extraction (Walsh et al., 1991). Next, use the primers SJ-G-CSF (cagagttccctgctcaagtgctta) and SJ-G-CSF rev (ttgtagggtaqetq) and SJ-G-CSF probe (agacagtaggag) The transgene was detected for (registered trademark) analysis. Eight G0 roosters with the highest transgene level in the sperm sample were mated by artificial insemination with non-transgenic SPAFAS (white leghorn) hens.

  Blood DNA samples were screened for the presence of the transgene by the Taqman® analysis described above. Of 2264 offspring, 13 roosters were found to be transgenic and each was positive for the presence of G-CSF and as measured by ELISA, one hen was found to have a serum of about 136.5 ng / It had 5.6 μg / ml G-CSF in ml G-CSF, egg white.

  Two G1 roosters (QGF910 and DD9027) of the same strain as XGF498 (thus having the same transgene inserted at the same position in the genome) are mated with non-transgenic hens to produce G- Female offspring that lay eggs containing CSF were made. Egg whites were collected from eggs of QGF910 and DD9027 progeny and milligram quantities of G-CSF were purified. A representative glycosylation pattern of G-CSF from poultry obtained as disclosed in Example 20 was determined.

Example 19
Production of transgenic chicken expressing human cytotoxic antigen 4-Fc fusion protein (CTLA4-Fc) US patent application Ser. No. 11 / 047,184 filed Jan. 31, 2005 (incorporated in its entirety by reference) PNLB-1.8OM-CTLA4Fc and pNLB-3.9OM-CTLA4Fc were constructed as disclosed in the specification. Generation of pNLB-1.8OM-CTLA4Fc and pNLB-3.9OM-CTLA4Fc transduced particles was performed as described for pNLB-CMV-BL in Example 2. 7 μl of pNLB-1.8OM-CTLA4Fc transduced particles were injected into 193 white Leghorn eggs (titer was ˜4 × 10 ⁶ ) and 72 chicks hatched. 7 μl of pNLB-3.9OM-CTLA4Fc transduced particles were injected into 199 white Leghorn eggs (titer was ˜4 × 10 ⁶ ) and 20 chicks hatched.

  Egg whites from 30 hens made with pNLB-1.8OM-CTLA4Fc particles were assayed for the presence of CTLA4-Fc by ELISA. One hen was found to have significant CTLA4-Fc protein levels in egg white at an average level of 0.132 μg / ml (5 eggs assayed). Egg whites from 7 hens made with pNLB-3.9OM-CTLA4Fc particles were assayed for the presence of CTLA4-Fc by ELISA. Two hens had an average level of 0.164 μg / ml for one hen (5 eggs assayed) and an average level of 0.123 μg / ml for the other positive hen (5 eggs assayed) And found to have significant CTLA4-Fc protein levels in egg white.

Example 20
Carbohydrate analysis of transgenic poultry derived G-CSF The oligosaccharide structure of TPD G-CSF was determined by using the following analytical techniques well known to those skilled in the art. After release from the peptide backbone, MALDI-TOF-MS (Matrix Assisted Laser Desorption / Ionization Time-of-Flight Mass Spectrometry) analysis and ESI MS / MS (Electrospray ionization tandem mass spectrometry) were performed on the oligosaccharide. O-linked oligosaccharides were chemically released from the protein, permethylated using the NaOH method involving reaction with methyl iodide under anhydrous DMSO, and extracted with chloroform just prior to analysis. Direct mass spectrometry was performed on intact glycosylated G-CSF. Analysis was also performed on the polysaccharide structure using HPLC analysis. That is, after release from the protein backbone, the structure was separated using HPLC. A sample of each polysaccharide species was digested with a specific enzyme and the digestion product was analyzed by HPLC to provide a structure determination understood by those skilled in the art.

である。興味深いことに、構造Ｃおよび構造Ｄは、図において示す構造Ｅの前駆体形態であり得る。限定するものではないが、構造Ａは家禽由来のグリコシル化されたＧ−ＣＳＦ上に約２０％〜約４０％の確率で存在し、構造Ｂは家禽由来のグリコシル化されたＧ−ＣＳＦ上に約５％〜約２５％の確率で存在し、構造Ｃは家禽由来のグリコシル化されたＧ−ＣＳＦ上に約１０％〜約２０％の確率で存在し、構造Ｄは家禽由来のグリコシル化されたＧ−ＣＳＦ上に約５％〜約１５％の確率で存在し、構造Ｅは家禽由来のグリコシル化されたＧ−ＣＳＦ上に約１％〜約５％の確率で存在し、構造Ｆは家禽由来のグリコシル化されたＧ−ＣＳＦ上に約１０％〜約２５％の確率で存在し、構造Ｇは家禽由来のグリコシル化されたＧ−ＣＳＦ上に約２０％〜約３０％の確率で存在すると推定された。 The determined structure is as follows:

It is. Interestingly, structure C and structure D can be the precursor form of structure E shown in the figure. Without limitation, structure A is present on poultry-derived glycosylated G-CSF with a probability of about 20% to about 40%, and structure B is on poultry-derived glycosylated G-CSF. There is a probability of about 5% to about 25%, structure C is present on glycosylated G-CSF from poultry with a probability of about 10% to about 20%, and structure D is glycosylated from poultry. There is a probability of about 5% to about 15% on G-CSF, and structure E is present on poultry-derived glycosylated G-CSF with a probability of about 1% to about 5%. There is a probability of about 10% to about 25% on glycosylated G-CSF from poultry, and structure G has a probability of about 20% to about 30% on glycosylated G-CSF from poultry. Presumed to exist.

  Using methods readily available to those skilled in the art, GC against poultry-derived G-CSF spiked with albitol (internal standard), hydrolyzed, N-acetylated and TMS derivatized. Monosaccharide analysis was performed by / MS (gas chromatography mass spectrometry). The derivatized sample was compared to a standard mixture of similarly derivatized samples. After spiked with ketodeoxynonurosonic acid, lyophilized, then hydrolyzed, desalted and lyophilized again, sialic acid analysis of poultry-derived G-CSF was performed. Sample analysis was performed on a Dionex BioLC system using the appropriate standards. As can be seen in Table 5, these analyzes indicated the presence of galactose, glucose, N-acetylgalactosamine, N-acetylglucosamine and sialic acid (N-acetylacetylneuraminic acid). The data in Table 5 replaces the preliminary data obtained by HPAEC-PAD analysis (determined that a significant proportion of N-acetylglucosamine is present).

Binding analysis was performed on per-methylated glucan samples of poultry-derived G-CSF that had been hydrolyzed in TFA and reduced in sodium borodeuteride. Boric acid was removed by adding methanol: glacial acetic acid (9: 1) three times, lyophilized and then acetylated with acetic anhydride. After purification by extraction with chloroform, the samples were tested by GC / MS. A standard mixture was also run under the same conditions. Binding was determined as follows:
i. Sialic acid bonds are 2-3 for galactose and 2-4 for N-acetylgalactosamine;
ii. There are 2-3 galactose bonds for N-acetylgalactosamine and 2-4 for N-acetylglucosamine;
iii. There are 2 to 6 N-acetylglucosamine bonds to N-acetylgalactosamine.

Example 21
In vitro cell proliferation activity of poultry derived G-CSF (TPD G-CSF) The NFS-60 cell proliferation assay was used to demonstrate the in vitro biological activity of TPD G-CSF. That is, NFS-60 cells were maintained in a medium containing GM-CSF. Confluent cells were harvested, washed and plated at a cell density of 10 ⁵ per well containing medium alone. TPD G-CSF and bacteria-derived human G-CSF (ie, Neupogen®) were serially diluted in media and added to triplicate separate wells. Cell growth was determined by metabolic reduction of 3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide (MTT) and quantified spectrophotometrically. Specific activity of avian-derived G-CSF was determined by comparing Neupogen® ED ₅₀ with purified avian-derived G-CSF. Over 14 days, the specific activity of TPD G-CSF was determined to be well above the activity of bacterial G-CSF Neupogen®. See FIG.

  All references (eg, US patents, US patent applications, publications) mentioned herein are incorporated by reference. Various modifications and variations of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with preferred embodiments of the invention, the claimed invention is not limited to such specific embodiments. Further, various modifications of the embodiments described herein and which are apparent to those skilled in the art are intended to be included within the scope of the following claims.

FIGS. 1A and 1B show an ovalbumin promoter expression vector comprising an ovalbumin promoter segment and coding sequence, gene X (which encodes exogenous protein X). X indicates either the exogenous gene or exogenous protein of interest. Figures 2A, 2B, 2C and 2D show a retroviral vector comprising the ovalbumin promoter and coding sequence, gene X, which encodes exogenous protein X. X indicates either the exogenous gene or exogenous protein of interest. FIG. 2E shows a method for amplifying exogenous genes for insertion into 2A and 2B vectors. FIG. 2F shows a retroviral vector comprising a coding sequence, an ovalbumin promoter that controls the expression of gene X, and a second coding sequence, an in-sequence ribosome entry site (IRES) element that allows expression of gene Y; Genes X and Y indicate any gene of interest. Figures 3A and 3B show schematic representations of ALV derived vectors, pNLB and pNLB-CMV-BL, respectively. Since NLB is not fully sequenced, bp (base pair) measurements are derived from published data (Cosset et al., 1991; Thoraval et al., 1995) and the data discussed herein. Is estimated. While the vector is evident from these figures, it is integrated into the chicken genome. 4A and 4B show the amount of β-lactamase (lactamase) in the sera of chimeric and transgenic chickens. In FIG. 4A, the concentration of bioactive lactamase in the serum of GO chickens transduced with the NLB-CMV-BL transgene was measured 8 months after patching. Shows generation, gender and number of wing bands. The serum concentration of lactamase was measured for G1 transgenic chickens 6-7 months after patching. The arrow indicates a G1 chicken born from rooster 2395. In FIG. 4B, the serum concentration of lactamase was measured for G1 and G2 transgenic chickens. The arrow indicates G2 born from hen 5657 or rooster 4133. Samples from chickens 4133, 5308 and 5657 are the same as described in FIG. 4A. Samples from G2 birds born from 5657 were collected 3-60 days after patching. Samples derived from G2 birds born from 4133 were collected 3 months after patching. 4A and 4B show the amount of β-lactamase (lactamase) in the sera of chimeric and transgenic chickens. In FIG. 4A, the concentration of bioactive lactamase in the serum of GO chickens transduced with the NLB-CMV-BL transgene was measured 8 months after patching. Shows generation, gender and number of wing bands. The serum concentration of lactamase was measured for G1 transgenic chickens 6-7 months after patching. The arrow indicates a G1 chicken born from rooster 2395. In FIG. 4B, the serum concentration of lactamase was measured for G1 and G2 transgenic chickens. The arrow indicates G2 born from hen 5657 or rooster 4133. Samples from chickens 4133, 5308 and 5657 are the same as described in FIG. 4A. Samples from G2 birds born from 5657 were collected 3-60 days after patching. Samples derived from G2 birds born from 4133 were collected 3 months after patching. FIG. 5 shows a pedigree of a chicken containing a transgene locus possessed by hen 5657 (FIG. 5A) or rooster 4133 (FIG. 5B). 2395 was a rooster carrying multiple transgene loci. 2395 was mated with a non-transgenic hen to give rise to three offspring each carrying the transgene at a unique location in the chicken genome. For simplicity, transgenic and non-transgenic progeny for which no expression data was shown have been removed from the genealogy. The number of bands indicates the following symbols: ○ Hen; □ rooster; ● Hen carrying the NLB-CMV-BL transgene; ■ Hen carrying NLB-CMV-BL. FIG. 6 shows β-lactamase (lactamase) in the egg white of hen 5657 and its offspring. In FIG. 6A, egg white from hen 5657 and its transgenic offspring is assayed for active lactamase. The control is an untreated hen and the mating partner is non-transgenic G2 born from hen 5657. Collected in March 2000. The arrow indicates G2 born from hen 5657. In FIG. 6B, an egg white sample from a G2 transgenic hen carrying 1 copy of the transgene (hemizygous) is compared to a G3 hen 6978 having 2 copies (homozygous). Eggs were collected in February 2001. The generation and number of wing bands are shown on the left. FIG. 7 shows β-lactamase (lactamase) in eggs of G2 and G3 hens born from rooster 4133. In FIG. 7A, egg whites from four representative hemizygous hens born from rooster 4133 are assayed for active lactamase. Eggs were collected in October 1999 and February 2001, and after each set was collected, a minimum of 4 eggs were assayed per hen. The control shows egg white from an untreated hen. The number of bands is shown on the left. The average of 4 hens for each period is calculated. In FIG. 7B, egg whites from hemizygous G2 transgenic hens were compared to egg whites of hemizygous and homozygous transgenic G3 hens. Eggs were collected in February 2001. The number of generations and the number of copies of the transgene are shown in the data bar for each hen. Average concentrations for hens carrying 1 or 2 copies are shown below the table. Figures 8A and 8B show the pNLB-CMV-IFN vector for IFN-α 2b expression in chickens; and pNLB-MDOT-EPOwp for erythropoietin (EPO) expression in chickens, respectively. FIG. 9 shows a novel glycosylation pattern of interferon-α 2b derived from transgenic poultry (TPD IFN-α 2b) containing all 6 bands. FIG. 10 shows a comparison between human peripheral blood leukocyte-derived interferon-α 2b (PBL IFN-α 2b or native hIFN) and transgenic poultry-derived interferon-α 2b (TPD IFN-α 2b or egg white hIFN). . FIG. 11A represents an optimized human interferon-α 2b (IFN-α 2b), ie, a synthetic nucleic acid sequence (cDNA, residues 1-498) of recombinant TPD IFN-α 2b (SEQ ID NO: 1). FIG. 11B represents the synthetic amino acid sequence (residues 1 to 165) of interferon-α 2b (TPD IFN-α 2b) (SEQ ID NO: 2) derived from transgenic poultry. FIG. 12A represents the synthetic nucleic acid sequence (cDNA, residues 1-579) of optimized human erythropoietin (EPO), ie recombinant TPD EPO (SEQ ID NO: 3). FIG. 12B represents the synthetic amino acid sequence (residues 1-193) of erythropoietin (TPD EPO) (SEQ ID NO: 4) from transgenic poultry (see also NCBI accession number NP000790 for native human EPO) ). FIG. 13 shows a synthetic MDOT promoter linked to an IFN-MM CDS. The MDOT promoter contains elements from the chick ovomucoid gene (ovomucoid promoter) ranging from -435 to 166 bp and the chicken albumin gene (ovotransferrin promoter) ranging from -251 to +29 bp (NCBI accession numbers Y00497, M11862 and See X01205). FIG. 14 provides an overview of the main egg white proteins. FIGS. 15A and 15D show the pCMV-LC-emcvIRES-HC vector, where the light chain of human monoclonal antibody (EMCV) by placement of an IRES from encephalomyocarditis virus (EMCV) to test the expression of the monoclonal antibody. LC) and heavy chain (HC) were expressed from this single vector. For comparison, FIGS. 15B and 15C show separate vectors pCMV-HC and pCMV-LC, respectively, where these vectors were also used to test the expression of monoclonal antibodies. FIG. 16 shows silver stained SDS PAGE of Neupogen® (lane A) and TPD G-CSF (lane B). FIG. 17 represents the increase in absolute neutrophil count of TPD G-CSF compared to bacterial-derived human G-CSF over 14 days. FIG. 18A (SEQ ID NO: 39) shows the nucleotide sequence encoding the amino acid sequence of FIG. 18B. FIG. 18B (SEQ ID NO: 40) (corresponding to NCBI accession number NP7577373) shows the amino acid sequence of G-CSF, including the natural signal sequence that is cleaved to form mature G-CSF during cell secretion. Show. FIG. 18C (SEQ ID NO: 41) shows the amino acid sequence of the mature G-CSF protein produced by the present invention.

Claims (45)

  A composition comprising G-CSF having a poultry-derived glycosylation pattern, wherein the glycosylation pattern is other than the glycosylation pattern of G-CSF produced in CHO cells .   The composition of claim 1, wherein G-CSF is isolated.   The composition of claim 1, wherein G-CSF is present in a hard shell egg.   2. The composition of claim 1, wherein the G-CSF is glycosylated in avian oviduct cells.   6. The composition of claim 5, wherein the oviduct cell is a tubular gland cell.   2. The composition of claim 1, wherein G-CSF is glycosylated in chicken oviduct cells.   The composition of claim 1, wherein G-CSF is glycosylated at threonine 133.   The composition of claim 1, wherein the composition is a pharmaceutical composition.   The composition of claim 1, wherein G-CSF has the amino acid sequence of SEQ ID NO: 41.   The composition according to claim 1, wherein the glycosylation pattern is other than the glycosylation pattern of G-CSF produced in human cells. A composition comprising G-CSF, wherein G-CSF is:

A composition that is glycosylated with.   12. A composition according to claim 11 wherein G-CSF is obtained from hard shell eggs.   12. A composition according to claim 11 wherein G-CSF is isolated.   The composition of claim 11, wherein G-CSF is glycosylated at threonine 133.   12. The composition of claim 11, wherein G-CSF has the amino acid sequence of SEQ ID NO: 41. Less than:

A composition comprising a G-CSF molecule that is glycosylated with.   17. A composition according to claim 16, wherein G-CSF is present in a hard shell egg.   17. A composition according to claim 16, wherein G-CSF is isolated.   The composition of claim 16, which is glycosylated at threonine 133.   17. The composition of claim 16, wherein G-CSF has the amino acid sequence of SEQ ID NO: 41. Less than:

A composition comprising a G-CSF molecule that is glycosylated with.   24. The composition of claim 21, wherein the G-CSF is present in a hard shell egg.   The composition of claim 21, wherein G-CSF is isolated.   24. The composition of claim 21, wherein the composition is glycosylated at threonine 133.   The composition of claim 21, wherein G-CSF has the amino acid sequence of SEQ ID NO: 41. Less than:

A composition comprising a G-CSF molecule that is glycosylated with.   27. The composition of claim 26, wherein the G-CSF is present in a hard shell egg.   27. The composition of claim 26, wherein G-CSF is isolated.   27. The composition of claim 26, wherein the composition is glycosylated at threonine 133.   27. The composition of claim 26, wherein G-CSF has the amino acid sequence of SEQ ID NO: 41. Less than:

A composition comprising a G-CSF molecule that is glycosylated with.   32. The composition of claim 31, wherein G-CSF is present in a hard shell egg.   32. The composition of claim 31, wherein G-CSF is isolated.   32. The composition of claim 31, wherein the composition is glycosylated at threonine 133.   32. The composition of claim 31, wherein G-CSF has the amino acid sequence of SEQ ID NO: 41. Less than:

A composition comprising a G-CSF molecule that is glycosylated with.   40. The composition of claim 36, wherein G-CSF is present in a hard shell egg.   40. The composition of claim 36, wherein G-CSF is isolated.   40. The composition of claim 36, wherein the composition is glycosylated at threonine 133.   37. The composition of claim 36, wherein G-CSF has the amino acid sequence of SEQ ID NO: 41.   A composition comprising G-CSF comprising a glycosylation pattern, wherein the glycosylation pattern is other than the glycosylation pattern of G-CSF produced in CHO cells, and G-CSF is A composition produced in chicken oviduct cells.   43. The composition of claim 42, wherein G-CSF is isolated.   42. The composition of claim 41, wherein the oviduct cell is a tubular gland cell.   A method of increasing white blood cell count in a patient comprising administering to the patient a therapeutically effective amount of TPD G-CSF.   45. The method of claim 44, wherein the therapeutically effective amount is an amount that increases the white blood cell count by a desired amount in the patient.

Images