JP2009526020A - Secreted frizzled-related protein 4 (SFRP-4) protein binding agent - Google Patents

Abstract

  The present invention relates generally to the preparation of SFRP-4 binders and the use of the same. In particular, the present invention relates to the preparation of anti-SFRP-4 antibodies and their use for SFRP-4 detection and modulation of SFRP-4-mediated functions. The compositions and methods of the invention are used in various tissues to detect disorders manifested by altered SFRP-4 polypeptide expression, and therapeutically in subjects in need thereof with respect to such SFRP-4 polypeptide-related disorders Can affect preventive remedies.

Description

The present invention relates generally to immunoglobulins, antibodies and fragments thereof. In particular, the present invention relates to the preparation and use of secreted frizzled-related protein 4 (SFRP-4) binding agents.

BACKGROUND OF THE INVENTION The Wnt gene family encodes proteins that provide important roles in differentiation and development. Wnt proteins interact with the Frizzled family of seven transmembrane receptors and activate signaling pathways to the nucleus. Dennis et al., J. Cell Sci., 112 (21): 3815-20 (1999). The primary biochemical effect of Wnt-1 signaling is the stabilization of cytoplasmic (beta) catenin that regulates gene expression in association with the Lef / tcf family of transcription factors. A new class of secreted proteins similar to the extracellular ligand binding domain of Frizzled proteins, secreted frizzled-related proteins (SFRP), has recently been identified, suggesting that additional mechanisms may regulate Wnt signaling.

  SFRP-4 is a soluble extracellular glycoprotein that antagonizes the signaling function of the Wnt / frizzled pathway by binding to either Wnt or frizzled receptors. SFRP-4 is expressed in the brain, kidney, lung, ovary, prostate, mammary gland and endometrium and exhibits complex functions with respect to cell survival. Jones et al., Bioessays 24: 811-20 (2002). SFRP-4 is used for bone metabolism (Fujita et al., Geriat. And Gerontol. Intern. 4: 175-80 (2004)), ovulation (Drake et al., Apoptosis 8: 389-97 (2003)), tumor suppression ( Hrzenjak et al., J. Path. 204: 19-27 (2004); Horvath et al., Clin. Cancer Res. 10: 615-25 (2004)) and bone softening Has been characterized as a circulating phosphateuria factor expressed by tumors associated with the disease (Berndt et al., J Clin Invest 112: 785-94 (2003)). Because of their involvement in these biological processes, SFRP-4 is considered as a potential biomarker (ie, biological marker) in the fields of cancer, hormone-regulated reproductive tissue disease and neurodegeneration. Accordingly, there is a need in the art for additional agents that are useful for targeting (eg, binding) and / or modulating SFRP-4 polypeptides.

SUMMARY OF THE INVENTION The present invention provides agents that are useful for targeting and / or modulating SFRP-4 polypeptides. The present invention immunospecifically binds to an SFRP-4 polypeptide selected from the group consisting of SEQ ID NO: 3; SEQ ID NO: 4; and SEQ ID NO: 5; and is immunospecific for the polypeptide of SEQ ID NO: 2. An antibody composition is provided. The antibody can be a polyclonal antibody; a monoclonal antibody; a chimeric antibody; a humanized antibody, and an antibody-related polypeptide.

  The invention also provides methods for making and using the antibodies of the invention. Accordingly, the present invention provides a pharmaceutical composition comprising the antibody of the present invention in a pharmaceutically acceptable carrier. The present invention provides an isolated nucleic acid encoding an antibody or fragment thereof that immunospecifically binds to an SFRP-4 polypeptide. The present invention also provides vectors and host cells containing the nucleic acids of the present invention.

  The present invention further provides methods of treating or preventing secreted frizzled-related polypeptide type 4 related disorders. Disorders are brain cancer; breast cancer; prostate cancer; uterine cancer; spleen cancer; pancreatic cancer; colon cancer; rectal cancer; small intestine cancer; gastric cancer; esophageal cancer; apoptosis, heart failure; Neurodegenerative disorders; Huntington's disease; peripheral demyelinating disease; multiple sclerosis; Alzheimer's disease; amyotrophic lateral sclerosis; Parkinson's disease; trauma; coronary heart disease; The present invention provides a method of modulating the expression or activity of a polypeptide by administering the antibody of the present invention.

  The invention thus provides the use of an antibody composition for the manufacture of a medicament for the treatment of a secreted frizzled-related polypeptide type 4 related disorder.

BRIEF DESCRIPTION OF THE DRAWINGS The drawings represent preferred embodiments by way of illustration and not by way of limitation.
FIG. 1 shows Western blot analysis of His-tagged SFRP-4 polypeptide. Panel A shows immunoreactive His-tagged SFRP-4 polypeptide detected in 10 μl of culture supernatant after 48 hours (left lane) and 144 hours (right lane) of culture. Panel B shows the effect of deglycosylation of His-tagged SFRP-4 containing culture supernatant (48 hour sample). Lane 1: SFRP-4 immunoreactive protein observed in His-tagged SFRP-4-containing culture supernatant (48-hour sample); Lane 2: mock-treated His-tagged SFRP-4-containing culture supernatant (48-hour sample) SFRP-4 immunoreactive protein observed in lane; Lane 3: SFRP-4 immunoreactive protein observed in PNGase-treated His-tagged SFRP-4-containing culture supernatant (48 hour sample).

FIG. 2 is a graph showing an SFRP-4 ELISA standard curve.
FIG. 3 is a photograph of a high-throughput western blot with a chart showing the spot size in the tissue. The tissues tested are as follows: 1, placenta; 2, empty lanes; 3, fat; 4, bladder; 5, brain; 6, breast; 7, cerebellum; 8, cervix; 9, colon; 11, duodenum; 12, esophagus; 13, gallbladder; 14, heart; 15, ileum; 16, kidney; 18, kidney; 18, liver; 19, lung; 20, ovary; 21, pancreas; 22, placenta 24, skeletal muscle; 25, skin; 26, spleen; 27, stomach; 28, testis; 29, thymus; 30, thyroid gland; 31, tonsils; 32, uterus.

Detailed Description of the Invention
Naming and Definitions Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used herein and in the appended claims, the singular forms “a”, “an”, and “the” include a plurality of instructions unless the content clearly dictates otherwise. Includes subject. For example, reference to “a cell” includes a combination of two or more cells, and the like. In general, the nomenclature used herein and the experimental procedures in cell culture, molecular genetics, organic chemistry and nucleic acid chemistry and the hybridization described below are well known in the art and generally It is used. Standard techniques for nucleic acid and peptide synthesis are used. Also, the nomenclature used herein and the experimental procedures in analytical chemistry and organic synthesis described below are well known and commonly used in the art. Standard techniques or modifications thereof are used for chemical synthesis and chemical analysis. To the extent that each individual publication, patent, or patent application, specifically and individually, is incorporated herein by reference for all purposes, All references cited are incorporated herein by reference in their entirety and for all purposes.

The definitions of certain terms as used herein are provided below. Definitions of other terms can be found in the Illustrated Dictionary of Immunology, 2nd Edition, Cruse, JM and Lewis, RE, eds. (CRC Press, Boca Raton, Florida, 1995).
As used herein, the term “secreted frizzled-related protein 4” (SFRP-4) includes naturally occurring SFRP-4 and synthetic or recombinant SFRP-4. Furthermore, the term “secreted frizzled related protein 4” encompasses allelic variants, species variants, splice variants and conservative amino acid substitution variants. The expression of SFRP-4 gene expression increases SFRP-4 splice variants in mammals. Yam et al. Gene PMID: 16005582 (Epub ahead of print, July 7, 2005). The term also encompasses full length SFRP-4 and SFRP-4 fragments. SFRP-4 includes, but is not limited to, human SFRP-4 and murine SFRP-4.

  As used herein, administration of a drug or drug to a subject includes self-administration and administration by others. Various aspects of treatment or prevention of medical symptoms as described are intended to mean "substantial", including complete treatment or prevention, but also less than perfect It is also understood that any biologically or medically relevant result is achieved here.

  As used herein, the term “amino acid” includes naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, and those amino acids that are later modified, eg, hydroxyproline, γ-carboxyglutamic acid, and O-phosphoserine. Amino acid analogs refer to compounds having the same basic chemical structure as a naturally occurring amino acid, ie, the α-carbon bonded to hydrogen, carboxyl group, amino group and R group, such as homoserine, norleucine, methionine sulfoxide, methionine methylsulfonium. Such analogs have modified R groups (eg, norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid. Amino acids can be referred to herein either by their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Committee. Similarly, nucleotides can be referred to by their generally accepted single letter code.

  As used herein, the term “antibody” specifically refers to a polypeptide comprising a framework region from an immunoglobulin gene or fragment thereof that specifically binds and recognizes an antigen, eg, SFRP-4 poly. Means peptide. The use of the term antibody is meant to include whole antibodies, including single chain whole antibodies and antigen binding fragments thereof.

As used herein, the term “antibody-related polypeptide” refers to any of the variable regions alone or the following polypeptide elements: hinge region of antibody molecule, CH ₁ , CH ₂ and CH ₃ domains; Alternatively, it refers to an antigen-binding antibody fragment comprising a single chain antibody that may include a combination with a portion. Any combination of variable and hinge regions, CH ₁ , CH ₂ and CH ₃ domains is also included in the present invention. Antibody related molecules useful as binding agents of the present invention include, but are not limited to, Fab, Fab ′ and F (ab ′) ₂ , Fd, single chain Fv (scFv), single chain antibody, disulfide linked Fragments containing Fv (sdFv) and either _VL or _VH domains are included. Illustrative examples are: (i) Fab fragment, monovalent fragment consisting of V _L , V _H , C _L and CH ₁ domains; (ii) F (ab ′) ₂ fragment, two linked by a disulfide bridge at the hinge region A bivalent fragment comprising a Fab fragment; (iii) an Fd fragment consisting of the V _H and CH ₁ domains; (iv) an Fv fragment consisting of the single arm _VL and V _H domains of the antibody; (v) consisting of the V _H domains dAb fragments (Ward et al., Nature 341: 544-546 (1989)); and (vi) isolated complementarity determining regions (CDRs).

As used herein, the term “biological sample” refers to a sample derived from or in contact with viable cells. The term “biological sample” is intended to include tissues, cells and biological fluids isolated from the subject and tissues, cells and fluids present within the subject.
As used herein, the term “CDR grafted antibody” refers to a CDR “graft” from a “donor antibody” in which at least one CDR of the “acceptor” antibody possesses the desired antigen specificity. Refers to the antibody being replaced.

  As used herein, the term “chimeric antibody” refers to an Fc constant region of a monoclonal antibody from one species (eg, a mouse Fc constant region) that is different from that of another species using recombinant DNA technology. By an antibody is replaced an Fc constant region from an antibody (eg, a human Fc constant region). Commonly Robinson et al., PCT / US86 / 02269; Akira et al., European Patent Application No. 184187; Taniguchi, European Patent Application No. 17196; Morrison et al., European Patent Application No. 173494; Neuberger et al., WO 86/01533; Cabilly et al., US Pat. No. 4,816,567; Cabilly et al., European Patent Application No. 125023; Better et al., Science 240: 1041-1043 (1988); Liu et al Proc Natl Acad Sci USA 84: 3439-3443 (1987); Liu et al., J Immunol 139: 3521-3526 (1987); Sun et al., Proc Natl Acad Sci USA 84: 214-218 (1987). Nishimura et al., Cancer Res 47: 999-1005 (1987); Wood et al., Nature 314: 446-449 (1985); and Shaw et al., J Natl Cancer Inst 80: 1553; 1559, (1988).

As used herein, the term “comparison window” consists of 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 amino acids or nucleotides. Means any number of adjacent positions selected from the group, where two sequences can be optimally aligned and then compared to a reference sequence of the same number of adjacent positions.
As used herein, the term “consensus FR” refers to a framework (FR) antibody region in a consensus immunoglobulin sequence. The FR region of the antibody does not contact the antigen.
As used herein, the term “consensus sequence” refers to a sequence formed from the most frequently occurring amino acids (or nucleotides) in a family of related sequences (eg, Winnaker, From Genes to Clones (Verlagsgesellschaft , Weinheim, Germany 1987)). That is, in a protein family, each position in the consensus sequence is occupied by the amino acid that occurs most frequently at that position in the family. If the two amino acids are of equal frequency, either can be included in the consensus sequence.

  As used herein, the term “contacted” when applied to a cell, includes an SFRP-4 binding agent of the invention (eg, antibody, antibody composition, cytotoxic agent or moiety, gene, Protein and / or antisense sequence) refers to the process of being distributed to or placed in close proximity to a target cell. This partitioning can be in vitro or in vivo and can involve the use of a recombinant vector system.

As used herein, the term “cytotoxic moiety” means a moiety that is in close proximity to a cell or that prevents cell growth or promotes cell death when absorbed by a cell. To do. The cytotoxic moiety can be a non-limiting example, a chemotherapeutic agent, a photoactivated toxin or a radiopharmaceutical.
As used herein, the term “diabody” refers to a small antibody fragment having two antigen binding sites, the fragment comprising the light chain variable domain in the same polypeptide chain (V _H V _L ). A heavy chain variable domain (V _H ) linked to (V _L ). By using a linker that is very short and cannot be paired between two domains on the same chain, the domain is paired with the complementary domain of another chain and two antigen binding sites are created. Diabodies are more fully described, for example, in European Patent No. 404097; WO 93/11161; and Hollinger et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993).

  As used herein, the term “effector cells” refers to immune cells that participate in the effector phase of the immune response, as opposed to the recognition and activation phase of the immune response. Examples of immune cells include cells of myeloid or lymphoid organs such as lymphocytes (eg, T cells including B cells and cytolytic T cells (CTL)), killer cells, natural killer cells, macrophages, monocytes, Examples include eosinophils, neutrophils, polymorphonuclear cells, granulocytes, mast cells and basophils. Effector cells express specific Fc receptors and perform specific immune functions. Effector cells can induce antibody-dependent cell-mediated cytotoxicity (ADCC), for example neutrophils that can induce ADCC. For example, monocytes, macrophages, neutrophils, eosinophils and lymphocytes that express FcαR are specifically killed by target cells and presented to antigens to other components of the immune system, or to cells that present antigens. Involved in binding. Effector cells can also phagocytose target antigens, target cells, metastatic cancer cells or microorganisms.

  As used herein, the term “epitope” refers to a protein determinant capable of specific binding to an antibody. Epitopes usually consist of chemically active surface series of molecules such as amino acids or sugar side chains and usually have specific three-dimensional structural characteristics and specific charge characteristics. Conformational and non-conformational epitopes are distinguished in that binding to the former is lost in the presence of a denaturing solvent, whereas the latter is not lost.

  As used herein, the term “effective amount” of a composition is an amount sufficient to achieve the desired therapeutic and / or prophylactic effect, eg, the disease being treated, eg, as used herein. Is an amount that results in the prevention or reduction of symptoms associated with a disease associated with the target polypeptide listed in. The amount of the composition of the invention administered to a subject will depend on the type and severity of the disease and individual characteristics such as general health, age, sex, weight and drug resistance. It will also depend on the degree, severity and type of disease. The skilled artisan will be able to determine the appropriate dosage depending on these and other factors. The compositions of the invention can also be administered in combination with each other or with one or more additional therapeutic compounds.

  As used herein, “expression” includes, but is not limited to, one or more of the following: transcription of a gene into precursor mRNA; generation of mature mRNA Splicing and other processing of precursor mRNAs to achieve; mRNA stability; translation of mature mRNA into protein (including codon usage and tRNA availability); and translation product, if required for proper expression and function Glycosylation and / or other modifications.

As used herein, a “fusion polypeptide” is different from a polypeptide having an amino acid sequence corresponding to a polypeptide that is not substantially homologous to an SFRP-4 polypeptide, such as an SFRP-4 polypeptide, And SFRP-4 polypeptides operably linked to polypeptides derived from the same or different organisms.
As used herein, the term “gene” contains all information related to the regulated biosynthesis of RNA products, including promoters, exons, introns, and other untranslated regions that control expression. Means a segment of DNA

As used herein, the term “genotype” refers to the non-stepwise sequence of nucleotide pairs found at one or more polymorphisms or mutation sites at a locus on a pair of homologous chromosomes of an individual (Unphased) means 5 ′ to 3 ′ sequence. As used herein, genotype includes all genotypes or gene subtypes.
As used herein, the term “human sequence antibody” includes antibodies having variable and constant regions (if present) derived from human germline immunoglobulin sequences. Human sequence antibodies of the invention may contain amino acid residues that are not encoded by human germline immunoglobulin sequences (eg, mutations introduced in vitro by random or site-directed mutagenesis, or in vivo by somatic mutation). Such antibodies can be made in non-human transgenic animals as described, for example, in PCT Publication Nos. WO01 / 14424 and WO00 / 37504. However, as the term “human sequence antibody” is used herein, a CDR sequence derived from the reproductive system of another mammalian species, such as a mouse, is grafted onto a human framework sequence. It is intended not to include antibodies (eg, humanized antibodies).

  As used herein, the term “identical” or “percent identity”, when used in terms of two or more nucleic acid or polypeptide sequences, is a BLAST or BLAST 2.0 sequence. Identical, or a specific percentage, identical, as measured using the comparison algorithm at the default parameters described below, or by manual alignment and visual inspection (see eg NCBI website) A specific region (e.g., a nucleotide sequence encoding an antibody described herein when compared and aligned for maximal match over a comparison window or specified region, having amino acid residues or nucleotides Or the amino acid sequence of the antibody described herein. About 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even higher identity) refers to two or more sequences or subsequences. Such sequences are then said to be “substantially identical”. The term also refers to or can be applied to the complement of a test sequence. The term also includes sequences having deletions and / or additions, as well as those having substitutions. As described below, preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.

  An “isolated” or “purified” polypeptide or biologically active portion thereof is a cellular material or other contaminating polypeptide from a cell or tissue source from which the SFRP-4 binding agent is derived. Is substantially free of chemical precursors or other chemicals when chemically synthesized. An isolated SFRP-4 binding agent, eg, an anti-SFRP-4 antibody, does not include materials that interfere with the diagnostic or therapeutic use of the drug. Such interference materials may include enzymes, hormones and other proteinaceous and non-proteinaceous solutes.

As used herein, the term “intact antibody” has at least two heavy (H) chain polypeptides and two light (L) chain polypeptides interconnected by disulfide bonds. Refers to antibody.
As used herein, the term “immune response” refers to cancerous cells, metastatic tumor cells, malignant melanoma, invasive pathogens, cells or tissues infected with pathogens, or autoimmunity or pathology. In the case of experimental inflammation, lymphocytes, antigen-presenting cells, phagocytic cells, granulocytes and soluble macromolecules produced by said cells or liver that lead to selective damage, destruction or elimination from normal human cells or tissues Refers to the concerted action of antibodies, cytokines and complement).

As used herein, the terms “immunological cross-reactivity” and “immunologically reactive” are the same (“immunological reactivity”) or different (“immunological cross-reactivity”). “Reactive”) is used interchangeably to mean an antigen that specifically reacts with an antibody made using the antigen. Generally, the antigen is SFRP-4, a variant or partial sequence thereof.
As used herein, “immunological reaction conditions” are those in which an antibody made against a particular epitope of an antigen is detectable rather than the antibody binding to all other epitopes. To a greater extent, it generally means conditions that allow binding to the epitope at least 2-fold over background binding, preferably at least 5-fold over background. Immunological reaction conditions depend on the format of the antibody binding reaction and are typically those utilized in immunoassay protocols. See Harlow & Lane, Antibodies, A Laboratory Manual (Cold Spring Harbor Publications, New York, 1988) for a description of immunoassay formats and conditions.

As used herein, the term “lymphocyte” refers to any mononuclear, non-phagocytic leukocyte found in blood, lymph and lymphoid tissues such as B and T lymphocytes.
As used herein, the term “medical condition” includes, but is not limited to, one or more physical and / or psychological conditions for which treatment and / or prevention is desirable. Any symptom or disease that appears as a symptom is included, and previously and newly identified diseases and other disorders are included.

  As used herein, the term “modulator” includes inhibitors and activators. Inhibitors, for example, bind and partially or totally stimulate, block, reduce, prevent, delay activation, inactivate, desensitize, or down regulate the activity of SFRP-4 polypeptide. A drug, for example an antagonist. An activator is, for example, an agent, such as an agonist, that binds to stimulate, elevate, release, activate, promote, enhance activation, sensitize or upregulate the activity of SFRP-4 polypeptide. Modulators include, for example, proteins, peptides, lipids, carbohydrates, polysaccharides or combinations of the foregoing, such as activators or inhibitors, including lipoproteins, glycoprotein sugars, protein binding to receptors and interaction of SFRP-4 polypeptides Including drugs that change Modulators include, for example, naturally occurring SFRP-4 polypeptide gene modifications with altered activity, as well as naturally occurring and synthetic ligands, antagonists, agonists, small chemical molecules, and the like.

  As used herein, the term “monoclonal antibody” means an antibody derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and It is not a generated method. A monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope. Monoclonal antibodies can be prepared using a wide variety of techniques known in the art, including but not limited to hybridomas, recombinants and phage display technologies.

As used herein, the term “neutralizing antibody” excludes or significantly reduces the biological function of at least one SFRP-4 polypeptide or SFRP-4-like polypeptide. Means an antibody molecule capable of
As used herein, the term “nucleotide pair” refers to two nucleotides joined together between two nucleotide chains.
As used herein, the term “pharmaceutically acceptable carrier” refers to any and all solvents, dispersion media, coatings, antibacterial and antifungal compounds that are compatible with pharmaceutical administration. Isotonic and absorption delaying compounds and the like.

As used herein, the term “polyclonal antibody” refers to a preparation of antibodies derived from at least two antibody producing cell lines. The use of this term includes preparations of at least two antibodies that contain antibodies that specifically bind to different epitopes or regions of the antigen.
As used herein, the term “polynucleotide” refers to any RNA or DNA that may be unmodified or modified RNA or DNA.

  As used herein, the terms “polypeptide”, “peptide” and “protein” are used interchangeably herein and are linked to each other by peptide bonds or modified peptide bonds. By means of a polymer containing two or more amino acids, ie a peptide isostere. Polypeptide refers to both short chains, commonly referred to as peptides, glycopeptides or oligomers, and to longer chains, commonly referred to as proteins. The polypeptide may contain amino acids other than the 20 gene-encoded amino acids. Polypeptides include amino acid sequences modified either by natural processes such as post-translational processing or by chemical modification techniques well known in the art. Such modifications are well documented in basic textbooks and more detailed monographs, as well as in a vast research literature.

As used herein, the term “recombinant” when used in reference to, for example, a cell, or a nucleic acid, protein, or vector, introduces a heterologous nucleic acid or protein into the cell, nucleic acid, protein, or vector, Or indicates that the material is derived from a cell that has been modified, or so modified, by a change in native nucleic acid or protein.
As used herein, the term “single chain antibody” or “single chain Fv (scFv)” refers to an antibody fusion molecule of the two domains V _L and V _{H of} an Fv fragment. Although the two domains _{V L} and _{V H} of the Fv fragment are coded for by separate genes, using recombinant methods, by pairing the _{V L} and _{V H} regions, known as single chain Fv (scFv) They can be joined by a synthetic linker that allows them to be made as single chain proteins that form monovalent molecules. See, for example, Bird et al., Science 242: 423-426 (1988); and Huston et al., Proc. Natl. Acad. Sci. USA, 85: 5879-5883 (1988). By reference to the term “antibody” fragment, such single chain antibodies are included and can be prepared by recombinant techniques or enzymatic or chemical cleavage of intact antibodies.

As used herein, the term “small molecule” refers to a composition having a molecular weight of less than about 5 kDa, and more preferably less than about 2 kDa. Small molecules can be, for example, nucleic acids, peptides, polypeptides, glycopeptides, peptide mimetics, carbohydrates, lipids, lipopolysaccharides, combinations thereof, or other organic or inorganic molecules.
As used herein, the term “specific binding” refers to contact between an SFRP-4 binding agent and an antigen with a binding affinity of at least 10 ⁻⁶ M. Preferred binding agents bind with an affinity of at least about 10 ⁻⁷ M, and preferably 10 ⁻⁸ M to 10 ⁻⁹ M, 10 ⁻¹⁰ M, 10 ⁻¹¹ M or 10 ⁻¹² M.

As used herein, the phrase “stringent hybridization conditions” means that a probe typically hybridizes to its target subsequence in a complex mixture of nucleic acids, while other sequences It means the condition that does not hybridize. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. Detailed guidance on nucleic acid hybridization can be found in Tijssen, “Overview of principles of hybridization and the strategy of nucleic acid assays”, Techniques in Biochemistry and Molecular Biology Hybridization with Nucleic Probes (1993). Generally, stringent conditions are selected to be about 5-10 ° C. lower than the thermal melting point (T _m ) for the specific sequence at a defined ionic strength pH. _Tm is 50% of the probe that is complementary to the target hybridizes to the target sequence at equilibrium (50% of the probe is occupied at equilibrium because the target sequence is in excess at _Tm ) ( At specified ionic strength, pH and nucleic acid concentration). Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least twice background, preferably 10 times background hybridization. An example of stringent conditions may be as follows: 50% formamide, 5 × SSC, and 1% SDS, 42 ° C. incubation, or 5 × SSC, 1% SDS, 65 ° C., 0.2 × SSC. With washing and with 0.1% SDS at 65 ° C.

As used herein, the term “subject” preferably refers to an animal, such as a domestic animal (eg, dog, cat, etc.), livestock (eg, Means cows, sheep, pigs, horses, etc.) and laboratory animals (eg monkeys, rats, mice, rabbits, guinea pigs, etc.).
As used herein, the term “target cell” refers to any cell in a subject (eg, a human or animal) that can be targeted by an SFRP-4 binding agent of the invention.
As used herein, the term “therapeutic agent” means a compound (eg, SFRP-4 binding agent) that, when present in an effective amount, produces a desired therapeutic effect in a subject in need thereof. It is intended.

  The details of one or more embodiments of the invention are set forth in the accompanying description below. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. Other features, objects, and advantages of the invention will be apparent from the description and from the claims. In general, enzymatic reactions and purification steps are performed according to the manufacturer's specifications. The techniques and procedures are generally performed according to conventional methods in the art and various general references. See generally Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d Edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989) (provided throughout this document).

Summary of the composition of the present invention :
The present invention provides SFRP-4 binding agents directed to SFRP-4 polypeptides, fragments and variants thereof. SFRP-4 is a member of the SFRP family that contains a cysteine-rich domain that is homologous to the putative Wnt binding site of the Frizzled protein. The Wnt network affects biological processes ranging from developmental cell fate, cell polarity and adhesion to tumorigenesis and apoptosis. Jones et al., Bioessays 24: 811-20 (2002). SFRP acts as a soluble modulator of Wnt signaling. Multiple protein products can be derived from mammalian expression of the SFRP-4 gene by alternative splicing mechanisms. Yam et al. Gene PMID: 16005582 (Epub ahead of print, July 7 (2005). The nucleotide sequence encoding human SFRP-4 (NM 003014.2; SEQ ID NO: 1) is shown in Table 1.

  The amino acid sequence of human SFRP-4 polypeptide (NP0030055.1; SEQ ID NO: 2) is shown in Table 2.

  In one embodiment, an object of the present invention is to provide an immunogenic composition useful for the preparation of the SFRP-4 binding agent of the present invention. To that end, the amino acid sequence of human SFRP-4 polypeptide was analyzed using Biobench2 (Novartis) and the BLAST network service of the National Center for Biotechnology Information to identify SFRP-4 domains useful as targets for the binding agents of the present invention. (See Example I). As a result of this analysis, four SFRP-4 domains were identified and are summarized in Table 3 below.

  Target domains can be prepared by any technique useful for producing polypeptides, such as chemical synthesis, molecular biology techniques, proteolytic or chemical degradation of SFRP-4 polypeptides. In one embodiment, the SFRP-4 target domain is prepared by chemical synthesis. Methods for chemical synthesis of peptides are well known in the art. In one embodiment, the SFRP-4 target domain is modified to facilitate conjugation to another compound, such as ovalbumin, keyhole limpet hemocyanin. See generally the preparation of polyclonal antisera and immunogens below. In another embodiment, a cysteine residue is incorporated at the C-terminus of the SFRP-4 target domain to facilitate conjugation of the SFRP-4 target domain to another compound. The sequences comprising target domains useful for conjugation of the present invention and to other compounds are set forth in Table 4 below.

  SFRP-4 target domains 1 to 4 are useful alone or in combination as immunogens to generate the SFRP-4 binding agents of the invention (see Example I). In one embodiment, the immunogenic composition of the invention comprises: SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 8; And at least one polypeptide selected from the group consisting of SEQ ID NO: 10.

  SFRP-4 is produced by many human and animal tumors, such as breast, prostate, uterus, spleen, colon and other tissues. Thus, SFRP-4 expression is the result of cancer (eg brain, breast, prostate, uterus, spleen, pancreas, gastrointestinal tract (eg colon, rectum, small intestine, stomach, esophagus)), ischemia (eg heart failure, myocardial infarction; stroke). Neurodegenerative diseases (eg Huntington's disease, peripheral demyelinating disease; multiple sclerosis; Alzheimer's disease; amyotrophic lateral sclerosis; Parkinson's disease; trauma); coronary heart disease, inflammation (eg inflammatory bowel) It is a biological marker of a disease state such as (disease). See generally Wong, S et al., J. Pathol. 196: 145-153 (2002); Schumann J et al., Cardiovascular Res. 45: 720-728 (2002); Jones et al., Bioessays 24: 811-20 (2002); Horvath LG et al., (2004) Clin. Cancer Res. 10: 615-25 (2004); Abuh Jawdeh et al. Lab Invest. 79: 439-47 (1999), and Examples See III. Accordingly, various aspects of the invention relate to the preparation, expression and characterization of SFRP-4 binding agents. SFRP-4 binding agents directed to each of the target binding domains 1 to 4 are used to detect SFRP-4 polypeptides (also referred to as target polypeptides) in a test sample (eg, a biological sample), and SFRP -4 are useful alone or in combination to modulate mediating functions. Thus, various aspects of the present invention further identify individuals who are predisposed to medical conditions using the SFRP-4 binding agents of the present invention, or identify individuals for drug responsiveness, side effects, or optimal drug dosage. Diagnostic / terranostic methods and kits for classification. SFRP-4 alone or other biological markers such as apoptosis or proliferation related markers (eg c-myc, cyclin D1); Wnt pathway markers (eg Etheredge et al., Stem Cells 22: 849-860 (2004) ))); Erb1; or can be used in combination with prostate specific antigen.

  In other aspects, the invention relates to SFRP-4 binding agents for preventing or treating SFRP-4-mediated disorders and for screening and / or identifying small molecules that bind to a ligand, eg, SFRP-4 polypeptide. Provide a method for use. Specifically, the SFRP-4 binding agents of the present invention may be altered by an alteration in SFRP-4 polypeptide expression, eg, a disorder manifested by an increase or decrease, such as cancer (eg, brain, breast, prostate, uterus, spleen, pancreas, gastrointestinal tract ( Eg colon, rectum, small intestine, stomach, esophagus)), apoptosis as a result of ischemia (eg heart failure, myocardial infarction; stroke); neurodegenerative diseases (eg Huntington's disease, peripheral demyelinating disease; multiple sclerosis; Alzheimer) Disease; amyotrophic lateral sclerosis; Parkinson's disease; trauma); useful for preventive or therapeutic treatment of coronary heart disease, inflammation (eg inflammatory bowel disease). Various specific embodiments illustrating these aspects are as follows.

SFRP-4 Binders of the Invention In one aspect, the invention provides a SFRP-4 binder composition, also referred to as a binder. A binding agent of the invention is recognized by an epitope or portion of a polypeptide of the invention that is recognized or specifically bound by the binding agent, eg a region of SFRP-4 polypeptide located on the surface of the polypeptide (eg hydrophilic Region) can be described or specified. As a means to target antibody production, a hydropathy plot showing hydrophilic and hydrophobic regions can be generated using, for example, the Kyte-Doolittle or Hopp-Woods method (eg, Hopp, with or without Fourier transform). & Woods, Proc. Nat. Acad. Sci. USA 78: 3824-3828 (1981); see Kyte & Doolittle, J. Mol. Biol. 157: 105-142 (1982)). It can be created by the method. An epitope or polypeptide moiety can be identified as described herein by the size of adjacent amino acid residues, eg, by N-terminal and C-terminal positions. The present invention includes binding agents that specifically bind to the polypeptides of the present invention and allow for the elimination of the same.

The binding agents of the invention can also be described or specified with respect to their cross-reactivity. Included are binding agents that do not bind to any other analog, ortholog or homologue of the target polypeptide of the invention. <95%, <90%, <85%, <80%, <75%, <70%, <65%, <60%, <55%, and <50% of the target polypeptide of the invention Binding agents that do not bind to polypeptides that have identity (as calculated using methods known in the art and described herein) are also included in the invention. Furthermore, binding agents that only bind to a polypeptide encoded by a polynucleotide that hybridizes to the polynucleotide of the invention under stringent hybridization conditions are included in the invention. The binding agents of the invention can also be described or specified with respect to their binding affinity. Preferred binding affinities are less than 10 ⁻⁶ M, 5 × 10 ⁻⁶ M, 10 ⁻⁷ M, 5 × 10 ⁻⁷ M, 10 ⁻⁸ M, 5 × 10 ⁻⁸ M, 10 ⁻⁹ M, 5 ×. 10 ⁻⁹ M, 10 ⁻¹⁰ M, 5 × 10 ⁻¹⁰ M, 10 ⁻¹¹ M, 5 × 10 ⁻¹¹ M, 10 ⁻¹² M, 5 × 10 ⁻¹² M, 10 ⁻¹³ M, 5 × 10 ⁻ Those having dissociation constants of ¹³ M, 10 ⁻¹⁴ M, 5 × 10 ⁻¹⁴ M, 10 ⁻¹⁵ M and 5 × 10 ⁻¹⁵ M, ie, Kd are included.

SFRP-4 binding agents within the scope of the present invention include, but are not limited to, monoclonal, polyclonal, chimeric, humanized, diabodies that bind specifically to the target polypeptide, homologues, derivatives or fragments thereof, and Human monoclonal and human polyclonal antibodies are included. As used herein, an “SFRP-4-like” polypeptide differs from an SFRP-4 polypeptide but includes a polypeptide that is immunologically reactive with an SFRP-4 binding agent of the invention. means. The SFRP-4-like polypeptide can be derived from the same organism or a different organism as the SFRP-4 polypeptide. The SFRP-4-like polypeptide can be encoded by the same or different gene as the SFRP-4 polypeptide. Antibodies useful as binding agents of the present invention include, but are not limited to, IgG (including IgG ₁ , IgG ₂ , IgG ₃ and IgG ₄ ), IgA (including IgA ₁ and IgA ₂ ), IgD, IgE Or IgM and IgY are included.

  In another embodiment, the binding agent of the invention is an antibody-related polypeptide directed against a SFRP-4 polypeptide, homologue or derivative thereof. Typically, the antigen binding region of a binding agent, such as the anti-SFRP-4 binding region, is of paramount importance in the binding specificity and affinity of the binding agent of the invention. In some embodiments, the SFRP-4 binding agent comprises, for example, an anti-SFRP-4 polypeptide monoclonal antibody, an anti-SFRP-4 polypeptide chimeric antibody that has been modified by deleting, adding, or replacing a portion of the antibody, and An anti-SFRP-4 polypeptide antibody, such as an anti-SFRP-4 polypeptide humanized antibody. For example, anti-SFRP-4 polypeptide antibodies can be modified to increase the antibody's half-life, eg, serum half-life, stability, or affinity.

  In one embodiment, the selection of antibodies that are specific for a particular domain of SFRP-4 polypeptide is facilitated by the production of hybridomas that bind to fragments of SFRP-4 polypeptide that possess such domain. Thus, an SFRP-4 binding agent that is an antibody that is specific for a desired domain within an SFRP-4 polypeptide, or derivative, fragment, analog or homologue thereof, is also provided herein.

  The invention further includes antibodies that are anti-idiotype to the binding agents of the invention. The binding agents of the present invention may be monospecific, bispecific, trispecific or of greater multispecificity. Multispecific binding agents may be specific for different epitopes of the SFRP-4 polypeptide of the invention or specific for both the polypeptide of the invention and a heterologous composition such as a heterologous polypeptide or solid support material. Good. For example, WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt et al., J. Immunol. 147: 60-69 (1991); US Pat. No. 5,573,920; No. 4474893, No. 5,601,819, No. 4,714,681, No. 4,925,648; No. 6,106,835; Kostelny et al., J. Immunol. 148: 1547-1553 (1992). The binding agents of the present invention may be derived from any animal origin including birds and mammals. Preferably, the binding agent is human, mouse, rabbit, goat, guinea pig, camel, horse or chicken.

  The binding agents of the present invention are suitable for administration to subjects where it is desirable to modulate SFRP-4 function, for example. Accordingly, it is a further object to provide SFRP-4 binding agent compositions that are SFRP-4 modulators, eg, functional antagonists or functional agonists of SFRP-4 polypeptides. It is also an object to provide SFRP-4 binding agent compositions that are partial antagonists and partial agonists of SFRP-4 polypeptides. Similarly, neutralizing an anti-SFRP-4 antibody that binds to an SFRP-4 polypeptide is also included. In a preferred embodiment, the binding agent of the invention comprises: (1) greater than 95% by weight of the antibody as determined by the Lowry method (Lowry et al., J. Biol. Chem. 193: 265 (1951)). And, most preferably, greater than 99% by weight, (2) to a degree sufficient to obtain an N-terminal or internal amino acid sequence of at least 15 residues by use of a spinning cup sequencer, or (3) Coomassie blue Alternatively, it is preferably purified to homogeneity by SDS-PAGE under reducing or non-reducing conditions using silver staining. Since at least one component of the antibody's natural environment is absent, the native polypeptide within the recombinant cell is included in the isolated binding agent. Ordinarily, however, an SFRP-4 binding agent, such as an isolated anti-SFRP-4 antibody, is prepared by at least one purification step.

The invention further relates to structure-based methods useful for identifying, designing and generating compounds that act as modulators of SFRP-4 polypeptides.
The binders of the present invention can be used either alone or in combination with other compositions. The SFRP-4 binding agents of the present invention may be further recombinantly fused to heterologous polypeptides at the N- or C-terminus, or chemically conjugated (covalently and non-covalently) to the polypeptide or other composition. Conjugation). For example, the SFRP-4 binding agents of the invention can be recombinantly fused or chemically conjugated to molecules useful as labels in detection assays and effector molecules such as heterologous polypeptides, drugs or toxins. it can. See, for example, WO 92/08495; WO 91/14438; WO 89/12624; US Pat. No. 5,314,995; and European Patent No. 0396387.

  In certain embodiments, an SFRP-4 binding agent of the invention is coupled or conjugated to one or more therapeutic or cytotoxic moieties to produce an SFRP-4 binding agent conjugate protein of the invention. An antibody or anti-SFRP-4 antibody-related polypeptide. A SFRP-4 binding agent-conjugated protein of the invention can be used to modify a given biological response or create a biological response (eg, reuse of effector cells). The therapeutic moiety should not be construed as limited to classical chemotherapeutic drugs. For example, the therapeutic moiety can be a protein or polypeptide that possesses the desired biological activity. Such proteins include, for example, enzymatically active toxins such as abrin, ricin A, Pseudomonas exotoxin or diphtheria toxin, or active fragments thereof; proteins such as tumor necrosis factor or interferon-alpha; or, for example, lymphokines, interleukins- 1 (“IL-1”), interleukin-2 (“IL-2”), interleukin-6 (“IL-6”), granulocyte macrophage colony stimulating factor (“GM-CSF”), granulocyte colony Biological response modifiers such as stimulatory factors ("G-CSF") or other growth factors may be included.

Process for preparing the SFRP-4 binding agent of the present invention
General Overview First, a target polypeptide that can raise a binding agent (eg, an anti-SFRP-4 antibody) is selected. Techniques for making binding agents directed to a target polypeptide are well known to those skilled in the art.
Suitable as binding agents for use in accordance with the present disclosure are not only naturally occurring antibodies, but also recombinantly engineered antibodies and antibody fragments directed to SFRP-4 polypeptides, such as antibody-related polypeptides. It should be understood that.

Binding agents that can be subjected to the techniques presented herein, such as anti-SFRP-4 antibodies, include monoclonal and polyclonal antibodies, and Fab, Fab ′, F (ab ′) ₂ , Fd, scFv, diabodies, antibodies Antibody fragments such as light chains, antibody heavy chains and / or antibody fragments are included. Methods useful for high yield production of antibody Fv-containing polypeptides, such as Fab ′ and F (ab ′) ₂ antibody fragments, have been described. See U.S. Pat. No. 5,648,237.
The derived species is any species that has been useful in creating a binding agent or binding agent library of the invention, such as a rat, mouse, rabbit, chicken, monkey, human, and the like.

  In a preferred embodiment, the SFRP-4 binding agent is an anti-SFRP-4 antibody. Phage or phagemid display technology is a useful technique for deriving the binding agents of the present invention. Anti-SFRP-4 antibodies useful in the present invention are “human antibodies” (eg, antibodies isolated from humans) or “human sequence antibodies”. Human antibodies can be made by a variety of methods known in the art, including phage display methods. U.S. Pat. Nos. 4,444,887, 4,716,111, 5,545,806 and 5,814,318; and WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, See WO96 / 33735 and WO91 / 10741. Useful methods for identifying nucleic acid sequences encoding members of multimeric polypeptide complexes by screening polyphage particles have been described. Rudert et al., US Pat. No. 6,667,150. Recombinant immunoglobulins can also be produced. Cabilly, US Pat. No. 4,816,567; Cabilly et al., US Pat. No. 6,331,415 and Queen et al., Proc. Nat'l Acad. Sci. USA 86: 10029-10033 (1989). Techniques for making and cloning monoclonal antibodies are well known to those skilled in the art. Preferably, the SFRP-4 binding agents of the invention have a high immunoreactivity, i.e. a proportion of antibody molecules that are correctly folded so that they can specifically bind to their target antigen. Expression of binding agents, such as sequences encoding antibodies of the invention, can be performed in E. coli as described below. Such expression usually results in at least 80%, 90%, 95% or 99% immunoreactivity.

Preparation of Polyclonal Antisera and Immunogens Methods for making antibodies or antibody fragments of the present invention typically involve purified SFRP-4 polypeptides or cells that express SFRP-4 polypeptides (generally Specifically immunizing non-human subjects such as mice or rabbits). Any immunogenic portion of SFRP-4 can be used as the immunogen. Suitable immunogenic preparations can contain, for example, a recombinantly expressed SFRP-4 polypeptide or a chemically synthesized SFRP-4 polypeptide. Using standard techniques for polyclonal and monoclonal antibody preparation, the isolated SFRP-4 polypeptide or a portion or fragment thereof is used as an immunogen to produce an SFRP-4 polypeptide or a portion or fragment thereof. An SFRP-4 binder that binds can be made. Can full length SFRP-4 polypeptide be used? Alternatively, the present invention provides the use of SFRP-4 polypeptide fragments as immunogens. The SFRP-4 polypeptide contains at least 4 amino acid residues of the amino acid sequence shown in SEQ ID NO: 1, and raised antibodies against the peptide form a specific immune complex with the SFRP-4 polypeptide. Include epitopes of the SFRP-4 polypeptide. Preferably, the antigenic peptide comprises at least 5, 8, 10, 15, 20 or 30 amino acid residues. Longer antigenic peptides are sometimes preferred over shorter antigenic peptides, which depend on the use and follow methods well known to those skilled in the art. Typically, the immunogen is at least about 8 aminoacyl residues in length and preferably at least about 10 acyl residues in length. Multimers of a given epitope are sometimes more effective than monomers.

  If necessary, the immunogenicity of SFRP-4 (or a fragment thereof) can be increased by fusing or conjugating to a hapten such as keyhole limpet hemocyanin (KLH) or ovalbumin (OVA). Many such haptens are known in the art. SFRP-4 polypeptides can also be combined with conventional adjuvants such as Freund's complex or incomplete adjuvants to increase the immune response to the polypeptide of interest. Various adjuvants used to increase the immunological response include, but are not limited to, Freund (complete and incomplete), mineral gels (eg, aluminum hydroxide), surfactants (eg, lysolecithin, pluronic polyols, Polyanions, peptides, oil emulsions, dinitrophenol, etc.), human adjuvants such as bacilli Calmette Guerin and Corynebacterium parvum, or similar immunostimulatory compounds. These techniques are standard in the art.

  Following appropriate immunization, an SFRP-4 binding agent, such as an anti-SFRP-4 polyclonal antibody, can be prepared from the serum of the subject. If desired, antibody molecules directed against the SFRP-4 polypeptide are isolated from the mammal (eg, from the blood) and further purified by well-known techniques such as polypeptide A chromatography to obtain IgG fractions. be able to.

Monoclonal antibodies In one embodiment of the invention, the binding agent is an anti-SFRP-4 monoclonal antibody. In one embodiment of the invention, the anti-SFRP-4 monoclonal antibody is a human anti-SFRP-4 monoclonal antibody. Any technique that provides for the production of antibody molecules by continuous cell line culture can be utilized to prepare monoclonal antibodies directed against a particular SFRP-4 polypeptide or derivative, fragment, analog or homologue thereof. Such techniques include, but are not limited to, hybridoma technology (see, eg, Kohler & Milstein, Nature 256: 495-497 (1975)); trioma technology; human B cell hybridoma technology (eg, Kozbor, et al., Immunol. Today). 4:72 (1983)) and EBV hybridoma technology for generating human monoclonal antibodies (see, eg, Cole, et al., Monoclonal Antibodies and Cancer Therapy (see Alan R. Liss, Inc., 1985) 77-96). Is included. Human monoclonal antibodies can be utilized in the practice of the present invention and by using human hybridomas (see, eg, Cote, et al., Proc Natl Acad Sci USA 80: 2026-2030 (1983)) or in vitro. Human B cells can be generated by transforming with Epstein-Barr virus (see, eg, Cole, et al., Monoclonal Antibodies and Cancer Therapy (Alan R. Liss, Inc., 1985) pages 77-96). Alternatively, hybridomas expressing anti-SFRP-4 monoclonal antibodies can be prepared by immunizing a subject using routine methods and then isolating the hybridoma from the subject's spleen. See, for example, Galfre & Milstein, Methods Enzymol 73: 3-46 (1981). Hybridomas are screened using standard methods to generate monoclonal antibodies of various specificities (ie, for various epitopes) and affinity. Selected monoclonal antibodies with desirable properties, such as SFRP-4 binding, as expressed by the hybridoma can be used or conjugated to molecules such as polyethylene glycol (PEG) to alter their properties. Or the cDNA encoding it can be isolated, sequenced and manipulated in various ways. Hybridoma technology includes those known in the art, and Harlow et al., Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 349 (1988); Hammerling et al., Monoclonal Antibodies And T-Cell Includes those taught in Hybridomas, 563-681 (1981). Other methods for generating hybridomas and monoclonal antibodies are well known to those skilled in the art.

Phage display technology As described above, the binding agents of the present invention can be produced by application of recombinant DNA and phage display technology. For example, various phage display methods known in the art can be used to prepare the binding agents of the invention, such as anti-SFRP-4 antibodies. In phage display methods, functional antibody domains are displayed on the surface of phage particles carrying the polynucleotide sequences that encode them. Phage having the desired binding properties are selected from a repertoire or combinatorial antibody library (eg, human or murine) by direct selection with an antigen, typically an antigen bound or captured to a solid surface or bead. The phage used in these methods is typically a filamentous phage containing fd and M13, and the Fab, Fv or disulfide stabilized Fv antibody domain is recombinantly fused to either the phage gene III or gene VIII protein. ing. In addition, methods are applied to the construction of Fab expression libraries (see, eg, Huse, et al., Science 246: 1275-1281 (1989)) SFRP-4 polypeptides, eg, polypeptides or derivatives, fragments, analogs thereof Allows the rapid and effective identification of monoclonal Fab fragments with the desired specificity for the body or homologue. Other examples of phage display methods that can be used to make the binding agents of the present invention include Huston et al., Proc. Natl. Acad. Sci USA, 85: 5879-5883 (1988); Chaudhary et al., Proc Natl. Acad. Sci USA, 87: 1066-1070 (1990); Brinkman et al., J. Immunol. Methods 182: 41-50 (1995); Ames et al., J. Immunol. Methods 184: 177- 186 (1995); Kettleborough et al., Eur. J. Immunol. 24: 952-958 (1994); Persic et al., Gene 187: 9-18 (1997); Burton et al., Advances in Immunology 57: 191-280 (1994); PCT / GB91 / 01134; WO90 / 02809; WO91 / 10737; WO92 / 01047; WO92 / 18619; WO93 / 11236; WO95 / 1. WO95 / 020401; WO96 / 06213; WO92 / 01047 (Medical Research Council et al.); WO97 / 08320 (Morphosys); WO92 / 01047 (CAT / MRC); WO91 / 17271 (Affymax); and US Pat. Nos. 5,698,426, 5,223,409, 5,403,484, 5,580,717, 5,427,908, 5,750,753, 5,821,047, 5,571,698, 5,427,908, 5,516,637 No. 5,780,225, No. 5658727, and No. 5,733,743. A useful method for displaying a polypeptide on the surface of a bacteriophage by attaching the polypeptide via a disulfide bond is described in Lohning, US Pat. No. 6,753,136. As described in the above references, after phage selection, an antibody coding region is isolated from the phage and used to generate a whole antibody, including human antibodies, or any other desired antigen-binding fragment, and It can be expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast and bacteria. See, eg, WO 92/22324; Mullinax et al., BioTechniques 12: 864-869 (1992); and Sawai et al., AJRI 34: 26-34 (1995); and Better et al., Science 240: 1041-1043. Techniques for recombinantly generating Fab, Fab ′ and F (ab ′) ₂ fragments using methods known in the art such as those disclosed in (1988) can also be used.

  In general, antibodies or antibody fragments are present on the surface of phage or phagemid particles, so hybrid antibodies or hybrid antibody fragments cloned into a display vector are suitable for identifying variants that maintained good binding activity. Can be selected against different antigens. See, for example, Barbas III et al., Phage Display, A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001). However, other vector formats can be used in this method, such as cloning antibody fragment libraries into lytic phage vectors (modified T7 or lambda Zap system) for selection and / or screening.

Library of nucleic acids encoding an SFRP-4 binding agent As a result of the above method, an SFRP-4 binding agent having specific affinity for an SFRP-4 polypeptide or an SFRP-4-like polypeptide, eg an anti-SFRP-4 antibody chain Leading to a library of nucleic acid sequences encoding. A library of nucleic acids typically has at least 5, 10, 20, 50, 100, 1000, 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ or 10 ⁹ different members. Usually a single member in a library does not constitute more than 25% or 50% of the total sequence. Typically, at least 25%, 50%, 75%, 90%, 95%, 99% or 99.9% of library members have specific affinity for SFRP-4 polypeptides or SFRP-4-like polypeptides. Encodes SFRP-4 binding agent. In the case of a double-stranded anti-SFRP-4 antibody library, a pair of nucleic acid segments encoding each of heavy and light chains are considered library members. The nucleic acid library can be present in free form as a component of any vector or as a component of a vector transfected into a host cell. Methods useful for generating libraries of genes encoding antigen combination molecules or antibodies that are not required by in vivo procedures are described in Wigler et al., US Pat. Nos. 6,303,313; 6,479,243.

Expression of Recombinant SFRP-4 Binding Agents As described above, the binding agents of the present invention can be produced by application of recombinant DNA technology. Recombinant polynucleotide constructs encoding SFRP-4 binding agents of the invention are typically operable on the coding sequence of an anti-SFRP-4 antibody chain comprising a naturally associated or heterologous promoter region. Expression control sequences linked in this manner are included. As such, another aspect of the present invention includes a vector containing one or more nucleic acid sequences encoding the SFRP-4 binding agent of the present invention. Nucleotide sequences encoding SFRP-4 binding agents for recombinant expression of one or more polypeptides of the invention, by recombinant DNA techniques well known in the art, and as detailed below. A nucleic acid containing all or part of is inserted into an appropriate cloning or expression vector (ie, a vector containing the elements necessary for transcription and translation of the inserted polypeptide coding sequence). Methods for generating diverse populations of vectors are described in Lerner et al., US Pat. Nos. 6,291,160; 6,680,192.

  In general, expression vectors useful in recombinant DNA technology are often in the form of plasmids. Once the vector is incorporated into a suitable host, the host is subjected to conditions suitable for high level expression of nucleotide sequences encoding SFRP-4 binding agents and collection and purification of SFRP-4 binding agents, eg, cross-reactive SFRP-4 antibodies. To maintain. See generally U.S. Patent Application No. 20020199213. The vector can also encode a signal peptide useful for directing secretion of extracellular antibody fragments, such as pectate lyase. See U.S. Pat. No. 5,576,195.

  The recombinant expression vector of the present invention comprises a nucleic acid encoding a compound having SFRP-4 binding properties in a form suitable for expression of the nucleic acid in a host cell, which is based on the host cell in which the recombinant expression vector is used for expression. Means to include one or more regulatory sequences operably linked to the nucleic acid sequence to be selected. Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology, 185 (Academic Press, San Diego, Calif., 1990). In one embodiment, a polynucleotide encoding a SFRP-4 binding agent of the invention is operably linked to a B promoter and can be expressed in a host cell. See U.S. Pat. No. 5,028,530. An expression vector of the invention can be introduced into a host cell, thereby producing a polypeptide or peptide comprising a fusion polypeptide encoded by a nucleic acid as described herein.

  Another aspect of the invention pertains to SFRP-4 binding agent-expressing host cells that contain nucleic acids encoding one or more SFRP-4 binding agents. The recombinant expression vectors of the invention can be designed for the expression of SFRP-4 binding agents in prokaryotic or eukaryotic cells. For example, SFRP-4 binding agents can be expressed in bacterial cells such as E. coli, insect cells (using baculovirus expression vectors), fungal cells such as yeast, yeast cells or mammalian cells. Suitable host cells are further discussed in Goeddel, Gene Expression Technology: Methods in Enzymology, 185 (Academic Press, San Diego, Calif., 1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro using T7 promoter regulatory sequences and T7 polymerase. Methods have been described that are useful for the screening of preparations of polypeptides, eg, SFRP-4 binding agents, having predetermined properties through the expression of stochastically generated polynucleotide sequences. See U.S. Patent Nos. 5,763,192; 5,723,323; 5,814,476; 5,817,483; 5,824,514; 5,976,862; 6,492,107;

  Expression of the polypeptide in prokaryotic cells is most often performed using a vector containing a constitutive or inducible promoter that directs the expression of either a fused or unfused polypeptide in E. coli. Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith & Johnson, Gene 67), which fuses each of glutathione S-transferase (GST), maltose E-binding polypeptide or polypeptide A to a target recombinant polypeptide. 31-40 (1988)), pMAL (New England Biolabs, Beverly, Mass.) And pRIT5 (Pharmacia, Piscataway, NJ).

  Examples of suitable induced non-fused E. coli expression vectors include pTrc (Amrann et al., Gene 69: 301-315 (1988)) and pET 11d (Studier et al., Gene Expression Technology: Methods in Enzymology, 185 (Academic Press, San Diego, Calif., 1990) 60-89). Methods for targeted assembly of distinct active peptides or protein domains to generate multifunctional polypeptides via polypeptide fusion are described in Pack et al. US Pat. Nos. 6,294,353; 6692935 . One plan to maximize recombinant polypeptide expression in E. coli, eg, SFRP-4 binding agent, is to express the polypeptide in host bacteria that have lost the ability to cleave the recombinant polypeptide by proteolysis. See, eg, Gottesman, Gene Expression Technology: Methods in Enzymology, 185 (Academic Press, San Diego, Calif., 1990), pages 119-128. Another strategy is to change the nucleic acid sequence of the nucleic acid that is inserted into the expression vector so that the individual codons for each amino acid are preferentially utilized in an expression host, eg, E. coli. (See, for example, Wada, et al., Nucl. Acids Res. 20: 2111-2118 (1992)). Such changes in the nucleic acids of the invention can be performed by standard DNA synthesis techniques.

  In another embodiment, the SFRP-4 binding agent expression vector is a yeast expression vector. Examples of vectors for expression in Saccharomyces cerevisiae include pYepSec1 (Baldari, et al., EMBO J. 6: 229-234 (1987)), pMFa (Kurjan & Herskowitz, Cell 30: 933-943, 1982), pJRY88. (Schultz et al., Gene 54: 113-123 (1987)), pYES2 (Invitrogen Corporation, San Diego, Calif.) And picZ (InVitrogen Corp, San Diego, Calif.). Alternatively, SFRP-4 binding agents can be expressed in insect cells using baculovirus expression vectors. Baculoviruses available for expression of polypeptides, eg, SFRP-4 binding agents, in cultured insect cells (eg, SF9 cells) include the pAc series (Smith, et al., Mol. Cell. Biol. 3: 2156-2165 ( 1983)) and the pVL series (Lucklow & Summers, Virology 170: 31-39 (1989)).

  In yet another embodiment, a mammalian expression system is used to express a nucleic acid encoding the SFRP-4 binding agent of the invention in mammalian cells. Examples of mammalian expression vectors include, but are not limited to, pCDM8 (Seed, Nature 329: 840 (1987)) and pMT2PC (Kaufman et al., EMBO J. 6: 187-195 (1987)). Can be mentioned. When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus and simian virus 40. For other expression systems suitable for both prokaryotic and eukaryotic cells useful for expression of the SFRP-4 binding agents of the invention. See, eg, chapters 16 and 17 of Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989).

  In another embodiment, the recombinant mammalian expression vector can preferentially direct expression of the nucleic acid in a particular cell type (eg, use a tissue-specific regulatory element to express the nucleic acid). Tissue specific regulatory elements are known in the art. Non-limiting examples of suitable tissue specific promoters include albumin promoters (liver specific; Pinkert, et al., Genes Dev. 1: 268-277 (1987)), lymphoid system specific promoters (Calame & Eaton , Adv. Immunol. 43: 235-275 (1988)), especially the T cell receptor promoter (Winoto & Baltimore, EMBO J. 8: 729-733 (1989)) and immunoglobulins (Banerji, et al., Cell). 33: 729-740 (1983); Queen & Baltimore, Cell 33: 741-748 (1983)), neuron specific promoters (eg neurofilament promoters; Byrne & Ruddle, Proc. Natl. Acad. Sci. USA 86: 5473). -5477 (1989)), pancreas specific promoter (Edlund et al., Science 230: 912-916 (1985)) and mammary gland specific promoter. (Eg, whey promoter; US Pat. No. 4,873,316 and European Patent Application Publication No. 264166). Developmentally regulated promoters such as the murine hox promoter (Kessel & Gruss, Science 249: 374-379 (1990)) and the alpha-fetoprotein promoter (Campes & Tilghman, Genes Dev. 3: 537-546 (1989)) Are also included.

  Another aspect of the invention pertains to host cells into which a recombinant expression vector of the invention has been introduced. The host cell can be any prokaryotic or eukaryotic cell. For example, the SFRP-4 binding agent can be expressed in bacterial cells such as E. coli, insect cells, yeast or mammalian cells. Mammalian cells are the preferred host for expressing nucleotide segments encoding immunoglobulins or fragments thereof. See Winnacker, From Genes To Clones, (VCH Publishers, NY, 1987).

Suitable methods for transforming or transfecting host cells include Sambrook, et al., Molecular Cloning: A Laboratory Manual 2nd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) and other laboratory manuals. Can be found in
Purification of recombinant polypeptides is well known in the art and includes ammonium sulfate precipitation, affinity chromatography purification techniques, column chromatography, ion exchange purification techniques, gel electrophoresis, etc. (generally Scopes, Protein Purification, Springer-Verlag , NY, 1982).

Expression of nucleic acids to provide a library of polyclonal anti-SFRP-4 antibodies Expressing a nucleic acid library to have a specific affinity for an SFRP-4 polypeptide or SFRP-4-like polypeptide, For example, a polyclonal library of anti-SFRP-4-binding antibodies can be created. The composition of such a library is determined from the composition of the nucleotide library. Thus such libraries typically have at least 5, 10, 20, 50, 100, 1000, 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ , or 10 ⁹ members with different amino acid compositions. . Usually in a library no single member comprises more than 25% or 50% of the total polypeptide. The proportion of anti-SFRP-4 antibodies in an anti-SFRP-4 antibody chain library having specific affinity for an SFRP-4 polypeptide or SFRP-4-like polypeptide typically corresponds to an anti-SFRP-4 antibody chain encoding Lower than the percentage of nucleic acids The difference is due to the fact that not all polypeptides are folded into a structure suitable for binding, despite having the appropriate primary amino acid sequence to support proper folding. In some libraries, at least 25%, 50%, 75%, 90%, 95%, 99% or 99.9% anti-SFRP-4 antibody chains have specific affinity for the target molecule. Furthermore, in a library of multi-chain antibodies, each anti-SFRP-4 antibody (eg, Fab or intact antibody) is considered a library member. Various anti-SFRP-4 antibody chains differ from each other in terms of delicate binding specificity and affinity for the target. Some such libraries contain members that bind to different epitopes on the same antigen, eg, SFRP-4 polypeptide. Such a library may contain at least two members that bind to the same antigen without competing with each other.

The polyclonal library of human anti-SFRP-4 antibodies resulting from the above method is due to the high percentage of the high affinity binders of the library, and the library is typically present in the natural population. It is distinguished from the natural population of human antibodies both in that it does not exhibit the same diversity of antibodies. A library of reduced diversity can be derived from non-human transgenic animals that provide a source that does not include all human immunoglobulin genes. For example, some polyclonal antibody libraries do not include an anti-SFRP-4 antibody with a lambda light chain. Some anti-SFRP-4 polyclonal antibody libraries of the invention have antibody heavy chains encoded by fewer than 10, 20, 30 or 40 _VH genes. Some polyclonal anti-SFRP-4 antibody libraries of the invention have antibody light chains encoded by fewer than 10, 20, 30 or 40 _VL genes.

Single chain antibodies In one embodiment, the binding agent of the invention is a single chain anti -SFRP-4 antibody. According to the present invention, the technique can be applied to the generation of single chain antibodies specific for SFRP-4 polypeptides (see, eg, US Pat. No. 4,946,778). Examples of techniques that can be used to generate single chain Fv and antibodies of the invention include US Pat. Nos. 4,946,778 and 5,258,498; Huston et al., Methods in Enzymology, 203: 46-88 (1991); Shul, L. et al., Proc. Natl. Acad. Sci. USA 90: 7995-7999 (1993); and Skerra et al., Science 240: 1038-1040 (1988).

Chimeric and humanized antibodies In one embodiment, the binding agent of the invention is a chimeric anti-SFRP-4 antibody. In one embodiment, the binding agent of the invention is a humanized anti-SFRP-4 antibody. In one embodiment of the invention, the donor and acceptor antibodies are monoclonal antibodies from different species. For example, the acceptor antibody is a human antibody (to minimize antigenicity in humans), in which case the resulting CDR grafted antibody is referred to as a “humanized” antibody.

  Recombinant anti-SFRP-4 antibodies such as chimeric and humanized monoclonal antibodies containing both human and non-human portions can be made using standard recombinant DNA techniques and are within the scope of the present invention . For some uses, including in vivo use of the binding agents of the invention in humans and use of these binding agents in in vitro detection assays, it is preferred to use chimeric, humanized or human anti-SFRP-4 antibodies. Such chimeric and humanized monoclonal antibodies can be generated by recombinant DNA techniques known in the art. Such useful methods include, but are not limited to, International Application PCT / US86 / 02269; US Patent No. 5225539; European Patent Application No. 184187; European Patent Application No. 171496; European Patent Application No. 173494; International Publication No. WO 86/01533; US Pat. No. 4,816,567; No. 5,225,539; European Patent Application No. 1,25023; Better, et al., Science 240: 1041-1043 (1988); Liu, et al., Proc. Natl Acad. Sci. USA 84: 3439-3443 (1987); Liu, et al., J. Immunol. 139: 3521-3526 (1987); Sun, et al., Proc. Natl. Acad. Sci. : 214-218 (1987); Nishimura, et al., Cancer Res. 47: 999-1005 (1987); Wood, et al., Nature 314: 446-449 (1985). Shaw, et al., J. Natl. Cancer Inst. 80: 1553-1559 (1988); Morrison, Science 229: 1202-1207 (1985); Oi, et al., BioTechniques 4: 214 (1986); , et al., Nature 321: 552-525 (1986); Verhoeyan, et al., Science 239: 1534 (1988); Morrison, Science 229: 1202 (1985); Oi et al., BioTechniques 4: 214 (1986) Gillies et al., J. Immunol. Methods, 125: 191-202 (1989); US Pat. No. 5,807,715; and Beidler, et al., J. Immunol. 141: 4053-4060 (1988). Methods are included. For example, CDR grafting (European Patent No. 0239400; WO91 / 09967; U.S. Pat. No. 5,530,101; No. 5,585,089; No. 5859205; No. 6,248,516; resurfacing) (European Patent No. 592106; European Patent No. 0519596; Padlan EA, Molecular Immunology, 28: 489-498 (1991); Studnicka et al., Protein Engineering 7: 805-814 (1994); Roguska et al. , PNAS 91: 969-973 (1994)) and chain shuffling (US Pat. No. 5,565,332) can be used to humanize antibodies. In one embodiment, cDNA encoding a murine anti-SFRP-4 monoclonal antibody is digested with a restriction enzyme selected to specifically remove sequences encoding the Fc constant region and encodes a human Fc constant region. Replace equivalent parts of the cDNA (Robinson et al., PCT / US86 / 02269; Akira et al., European Patent Application No. 184187; Taniguchi, European Patent Application No. 17196; Morrison et al., European Patent Application No. 173494; Neuberger et al., WO 86/01533; Cabilly et al., US Pat. No. 4,816,567; Cabilly et al., European Patent Application No. 125503; Better et al., Science 240: 1041-1043 (1988) ); Liu et al., Proc Natl Acad Sci USA 84: 3439-3443 (1987); Liu et al., J Immunol 139: 3521-3526 ( 987); Sun et al., Proc Natl Acad Sci USA 84: 214-218 (1987); Nishimura et al., Cancer Res 47: 999-1005 (1987); Wood et al., Nature 314: 446-449 ( 1985); and Shaw et al., J Natl Cancer Inst 80: 1553-1559 (1988)); U.S. Patent No. 6180370; U.S. Patent No. 6300064; No. 6696248; No. 6706484; ).

In one embodiment, the binding agent of the invention is an anti-SFRP-4 CDR antibody. Generally, the donor and acceptor antibodies used to make the anti-SFRP-4 CDR antibodies are monoclonal from different species. Typically, the acceptor antibody is a human antibody (to minimize antigenicity in humans), in which case the resulting CDR grafted antibody is referred to as a “humanized” antibody. The graft may be a single CDR (or even a part of a single CDR) within a single V _H or V _L of the acceptor antibody, or a plurality of one or both of V _H and V _L CDR (or part thereof). Often all three CDRs of all variable domains of the acceptor antibody are replaced with the corresponding donor CDRs, but what is necessary to allow sufficient binding of the resulting CDR grafted antibody to MetAp3 It is necessary to replace only the same number as. Methods for making CDR grafted and humanized antibodies are described by Queen et al., US Pat. No. 5,585,089, US Pat. No. 5,693,761; US Pat. No. 5,693,762; and Winter, US Pat. Taught by US Pat. No. 6,082,040. Useful methods for preparing _VH and _VL polypeptides include Winter et al., U.S. Patent Nos. 4,816,397; 6,291,158; 6,291,159; 6,291,161; 6,545,142; European Patent No. 3,368,684; No. 0451216; taught by EP 0120694.

  After selecting appropriate framework region candidates from the same family and / or the same family member, either or both heavy and light chain variable regions by grafting CDRs from the derived species to the hybrid framework regions Is generated. The assembly of hybrid antibodies or hybrid antibody fragments having a hybrid variable chain region with respect to any of the above embodiments can be accomplished using conventional methods known to those skilled in the art. For example, oligonucleotide synthesis and / or PCR can generate a DNA sequence that encodes the hybrid variable domain described herein (ie, a framework based on CDRs from the target and derived species). Nucleic acids encoding CDR regions can be isolated from the seed antibody derived using appropriate restriction enzymes and ligated to the target species framework by ligation with an appropriate ligation enzyme. Alternatively, the framework region of the variable chain of the derived seed antibody can be altered by site-directed mutagenesis.

  Since hybrids are constructed from selections among multiple candidates corresponding to nucleic acid framework regions, there are many combinations of sequences that are easy to construct according to the principles described herein. Thus, a hybrid library can be assembled having members with various combinations of individual framework regions. Such a library may be an electronic database collection of sequences or a physical collection of hybrids.

  This process typically does not change the FR of the acceptor antibody that flanks the grafted CDR. However, substituting certain residues of a given FR to make it more similar to the corresponding FR of the donor antibody can sometimes improve the antigen binding affinity of the resulting anti-SFRP-4 CDR grafted antibody. . Preferred positions for substitution include amino acid residues that are adjacent to or capable of interacting with the CDRs (see, eg, US Pat. No. 5,585,089, particularly paragraphs 12-16). Alternatively, one can start with a donor FR and modify it to be more similar to an acceptor FR or a human consensus FR. Techniques for making these modifications are known in the art. In particular, if the resulting FR fits a human consensus FR at that position, or is at least 90% or more identical to such a consensus FR, doing so is equivalent to the same antibody with a fully human FR. In comparison, it may not significantly increase the antigenicity of the resulting modified anti-SFRP-4 CDR antibody.

Deimmunization of therapeutic proteins by T cell epitope modification Many therapeutic proteins have been shown to elicit undesired antibody responses in clinical use, which may lead to side effects. In one embodiment of the invention, the recombinant anti-SFRP-4 antibody, SFRP-4 polypeptide or SFRP-4 binding agent comprises one or more potential epitopes for a T cell of a given species in its amino acid sequence. And altering the amino acid sequence to eliminate at least one T cell epitope renders the given species non-immunogenic or hypoimmunogenic. This eliminates or reduces the immunogenicity of the polypeptide or protein when exposed to the immune system of a given species. In particular, it can benefit from deimmunizing monoclonal antibodies and other immunoglobulin-like molecules in this manner, for example, immunoglobulins derived from mice can be deimmunized for human therapeutic use. A method for deimmunizing a polypeptide or protein in the art. For example, Carr, et al., US Patent Application No. 20030153043; and De Groot, et al., AIDS Res. And Human Retroviruses 13: 539-541 (1997); Schafer, et al., Vaccine 16: 1880-1884 ( 1998); De Groot, et al., Dev. Biol. 112: 71-80 (2003); De Groot, et al., Vaccine 19: 4385-4395 (2001); Reijonen and Kwok Methods 29: 282-288; See Novak, et al., J. Immunology 166: 6665-6670 (2001).

Without being limited to idiotype antibodies : (i) F (ab ′) ₂ fragments produced by pepsin digestion of antibody molecules; (ii) created by reducing disulfide bridges of F (ab ′) ₂ fragments Containing an idiotype for the SFRP-4 polypeptide by techniques known in the art including: (iii) Fab fragments generated by treatment of antibody molecules with papain and reducing compounds; and (iv) Fv fragments; Antibody fragments can be generated. See, for example, Greenspan et al., FASEB J. 7: 437-444 (1993) and Nissinoff, J. Immunol. 147: 2429-2438 (1991). For example, using antibodies that bind and competitively block polypeptide multimerization and / or binding of a polypeptide of the invention to a ligand, “mimic” the polypeptide multimerization and / or binding domain; As a result, an anti-idiotype can be created that binds to and neutralizes the target polypeptide and / or its ligand. Such neutralization of an anti-idiotype or such anti-idiotype Fab fragment can be used in a therapeutic regimen to neutralize the target polypeptide ligand. For example, such anti-idiotypic antibodies are used to bind to a polypeptide of the invention and / or bind to its ligand / receptor and thereby the level of biological activity observed in the absence of the anti-idiotypic antibody In contrast, the target polypeptide biological activity can be modulated, eg, increased or decreased.

Fusion protein In one embodiment, the binding agent of the invention is a fusion protein. The addition of peptide moieties to facilitate handling of polypeptides is well known in the art and is a routine technique. The SFRP-4 binding agents of the invention can be fused to a marker sequence such as a peptide that facilitates purification of the fused polypeptide. In a preferred embodiment, the marker amino acid sequence is a hexahistidine peptide, such as the tag provided in the pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, Calif., 91311), many of which are commercially available. It is. For example, hexahistidine provides convenient purification of the fusion protein as described in Gentz et al., Proc. Natl. Acad. Sci. USA 86: 821-824 (1989). Another peptide tag useful for purification, the “HA” tag, corresponds to an epitope derived from influenza hemagglutinin protein. Wilson et al., Cell 37: 767 (1984).

Thus, any of these aforementioned fusions can be manipulated using the polynucleotides or polypeptides of the invention. Also, the fusion protein can show an extended in vivo half-life.
Fusion proteins (with IgG) having a disulfide-linked dimeric structure may be more effective in binding and neutralizing molecules other than monomeric secreted proteins or protein fragments alone. Fountoulakis et al., J. Biochem. 270: 3958-3964 (1995).

  Similarly, EP-A-O 464533 (Canadian counterpart 2045869) discloses a fusion protein comprising various portions of the constant region of an immunoglobulin molecule together with another human protein or portion thereof. In many cases, the Fc portion of the fusion protein is advantageous for therapy and diagnosis and can thus lead to, for example, improved pharmacokinetic properties. See European Patent Application No. 0232262 (A). Alternatively, deletion of the Fc portion after the fusion protein has been expressed, detected and purified is desirable. For example, when a fusion protein is used for immunization as an antigen, the Fc portion can interfere with therapy and diagnosis. In drug discovery, human proteins such as hIL-5 are fused with the Fc portion for the purpose of high-throughput screening assays to identify antagonists of hIL-5. Bennett et al., J. Molecular Recognition 8: 52-58 (1995); K. Johanson et al., J. Biol. Chem., 270: 9459-9471 (1995).

  In one embodiment, a SFRP-4 binding agent of the invention is prepared using genomic DNA or EST encoding a candidate binding agent as part of a fusion protein that forms inclusion bodies upon expression in a host cell. Methods useful for preparing genomic DNA or ESTs encoding candidate binding agents as part of a fusion protein that forms inclusion bodies upon expression in host cells have been described. See U.S. Patent No. 6,653,068; U.S. Patent Application No. 20040157291. For example, inclusion bodies are useful for making binding partners, such as SFRP-4 binding agents, that specifically bind to a target (poly) peptide.

SFRP-4 Binding Agent Conjugated Protein As noted above, in certain preferred embodiments, the SFRP-4 binding agent of the present invention is used for one or more therapeutic purposes to produce the SFRP-4 binding agent conjugated protein of the present invention. Or an anti-SFRP-4 antibody coupled or conjugated to a cytotoxic moiety. In some cases, the SFRP-4 binding agents of the invention are useful as SFRP-4 binding agent-cytotoxin conjugate molecules, as exemplified by administration for the treatment of neoplastic diseases. It will be apparent to those skilled in the art that a variety of bifunctional or multifunctional reagents, both homologous and heterofunctional, such as those described in the catalog of Pierce Chemical Co., Rockford, IL can be used as linker groups. Will. For example, coupling can be affected by amino groups, carboxyl groups, sulfhydryl groups or oxidized carbohydrate residues (see, eg, US Pat. No. 4,671,958).

  Alternative coupling methods include coupling a moiety to the SFRP-4 binding agent of the present invention, as described in US Pat. Nos. 5,057,313 and 5,156,840, for example, by an oxidized carbohydrate group at the glycosylation site. can do. Yet another alternative method of coupling the SFRP-4 binding agent to a moiety is by use of a non-covalent binding pair such as streptavidin / biotin or avidin / biotin. In these embodiments, one member of the pair is covalently coupled to the SFRP-4 binding agent, and the other member of the binding pair is covalently coupled to the moiety.

A cleavable linker , which can be cleaved during or at the time of internalization into a cell, if the cytotoxic or therapeutic moiety is more potent in the absence of the SFRP-4 binding agent portion of the immunoconjugate of the invention, or It may be desirable to use a linker group that can be cleaved gradually over time in the extracellular environment. Many different cleavable linker groups have been described. Illustrative examples of intracellular release of cytotoxic moieties from these linker groups include, but are not limited to, irradiation of photosensitive linkages (eg, US Pat. No. 4,462,014) by reduction of disulfide bonds (eg, US Pat. No. 4,489,710). ) By serum complement mediated hydrolysis (eg US Pat. No. 4,671,958) and acid-catalyzed hydrolysis (eg US Pat. No. 4,569,789) by hydrolysis of derivatized amino acid side chains (eg US Pat. No. 4,638,045). Cutting included.

  In one embodiment, the SFRP-4 binding agents of the invention are coupled to more than one therapeutic, cytotoxic and / or imaging moiety. By poly-derivatizing the SFRP-4 binding agent of the present invention, several cytotoxicity schemes can be performed simultaneously, or the SFRP-4 binding agent is useful as a contrast agent for some visualization techniques The therapeutic antibody can be labeled for tracking by visualization techniques. In one embodiment, multiple molecules of cytotoxic moieties are coupled to a single SFRP-4 binding agent. In one embodiment, the SFRP-4 binding agent of the invention is coupled to a mixture of at least two parts selected from the group consisting of: a cytotoxic moiety; a therapeutic moiety; and a label / imaging moiety. That is, more than one type of moiety can be coupled to the SFRP-4 binder. For example, therapeutic moieties such as polynucleotides or antisense sequences can be conjugated to SFRP-4 binding agents linked to chemical or radiotoxic moieties to increase the effectiveness of chemical or radiotoxic treatments and are desirable. The required dosage required to obtain a therapeutic effect can be reduced. Regardless of the particular embodiment, immunoconjugates with more than one moiety can be prepared in a variety of ways. For example, more than one moiety can be coupled directly to the SFRP-4 binding agent, or linkers (eg, dendrimers) that provide multiple sites for attachment can be used. Alternatively, a carrier that maintains the ability to retain more than one cytotoxic moiety can be used.

  As explained above, SFRP-4 binding agents can carry moieties in a variety of ways, including covalent and non-covalent associations either directly or via a linker group. In one embodiment, the SFRP-4-binding coupled protein can be combined with an encapsulated carrier. This can allow the therapeutic composition to gradually release the SFRP-4 binding agent toxic moiety over time while approaching and concentrating the target cells, particularly in performing chemotoxic therapy. Useful in embodiments.

SFRP-4 binding agents conjugated with radionuclides In one embodiment, the SFRP-4 binding agents of the invention are coupled to a cytotoxic moiety that is a radionuclide. Preferred radionuclides for use as the cytotoxic moiety of the present invention are those that are suitable for pharmacological administration.
Chemotoxic moiety In one embodiment, the SFRP-4 binding agent of the invention is coupled with a chemical toxic moiety. Preferred chemical toxicants useful in the present invention include, but are not limited to, small molecule drugs such as methotrexate as well as pyrimidine purine analogs.

Protein toxins In one embodiment, the SFRP-4 binding agent of the invention is coupled to a protein toxin moiety. Preferred toxin proteins for use as the cytotoxic moiety of the present invention include, but are not limited to, actinomycetes or streptomyces antibodies, duocarmycin, taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, Mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracin dione (anthracin didne), mitoxantrone, mitramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoid, procaine, tetracaine, lidocaine , Propranolol and puromycin and analogs or homologues thereof. Preferred toxin proteins for use as cytotoxic moieties further include ricin, abrin, diphtheria toxin, cholera toxin, gelonin, Pseudomonas exotoxin, Shigella toxin, pokeweed antiviral protein and others known in the field of pharmaceutical biochemistry Of toxin protein. Because these toxin agents elicit an undesirable immune response in a subject, they are particularly useful when injected intravascularly into SFRP-4 binding agents of the invention, such as anti-FRP-4 antibodies and antibody-related polypeptides of the invention. It is preferably encapsulated in a carrier for the coupling of

Enzymatically active toxin In one embodiment, the SFRP-4 binding agent of the invention is coupled to an enzymatically active toxin. Enzymatically active toxins can be of bacterial or plant origin, or enzymatically active fragments of such toxins ("A chain"). Enzymatically active toxins and fragments thereof useful in the present invention include diphtheria A chain, non-binding active fragment of diphtheria toxin, exotoxin A chain (derived from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin ) A chain, alpha-sarcin, Sinabragiri protein, dianthin protein, pokeweed protein (PAPI, PAPII and PAP-S), vine reinhibitor, krusin, crotin, sapaonaria officinalis inhibitor , Gelonin, mitogellin, restrictocin, phenomycin and enomycin. Various bifunctional protein coupling agents are used to make conjugates with the cytotoxin portion of the SFRP-4 binding agent of the present invention. Examples of such reagents are SPDP, IT, bifunctional derivatives of imide esters such as dimethyl adipoimidate HCl, active esters such as disuccinimidyl suberate, aldehydes such as glutaraldehyde, bis (p-azidobenzoyl) hexane Bis-azide compounds such as diamines, bis-diazonium derivatives such as bis- (p-diazoniumbenzoyl) -ethylenediamine, diisocyanates such as tolylene 2,6-diisocyanate, and 1,5-difluoro-2 Bis-active fluorine compounds such as 1,4-dinitrobenzene. The lytic portion of the toxin can be conjugated to an antibody, eg, a Fab fragment of an SFRP-4 binding agent.

Therapeutic moiety In one embodiment, the SFRP-4-binding agent of the present invention is coupled to a therapeutic moiety. Techniques for conjugating such therapeutic moieties to the SFRP-4 binding agents of the present invention are well known in the art. For example, Arnon et al., “Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy”, in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (Eds.), Pages 243-56 (Alan R. Liss, Inc. 1985); et al., "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review, in Monoclonal Antibodies 84: Biological And Clinical Applications, Pinchera et al. (Eds.), 475-506 (1985); “Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy ", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (Eds.), Pages 303-16 (Academic Press 1985), and Thorpe et al.," The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates ", See Immunol. Rev., 62: 119-58 (1982).

Labeled SFRP-4 Binding Agent In one embodiment, the SFRP-4 binding agent of the invention is coupled to a label moiety, ie a detectable group. The particular label or detectable group conjugated to the SFRP-4-binding agent of the present invention is significantly different from the specific binding of the SFRP-4-binding agent of the present invention to the SFRP-4 polypeptide or SFRP-4-like polypeptide. As long as they do not interfere with this, it is not an important aspect of the present invention. The detectable group may be any material having a detectable physical or chemical property. Such detectable labels have been well developed in the fields of immunoassay and imaging, and most any label that is generally useful in such methods can be applied to the present invention. Thus, a label is any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means. Labels useful in the present invention include magnetic beads (eg, Dynabeads ™), fluorescent dyes (eg, fluorescein isothiocyanate, Texas red, rhodamine, etc.), radioactive labels (eg, ³ H, ¹⁴ C, ³⁵ S, ¹²⁵ I, ¹²¹ I, ¹¹² In, ⁹⁹ mTc), other contrast agents such as microbubbles (for ultrasound contrast), ¹⁸ F, ¹¹ C, ¹⁵ O (for positron emission tomography), ⁹⁹ mTC, ¹¹¹ In (single) Single electron emission tomography), enzymes (eg horseradish peroxidase, alkaline phosphatase and others commonly used in ELISA) and colloidal gold or colored glass or plastic (eg polystyrene, polypropylene, latex, etc.) beads Includes calorimetric signs such as . Patents describing the use of such labels include U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241 (each of which is in its entirety) And for all purposes are hereby incorporated by reference). See also Handbook of Fluorescent Probes and Research Chemicals (6th Ed., Molecular Probes, Inc., Eugene OR.).

  The label can be coupled directly or indirectly to the desired component of the assay by methods well known in the art. As indicated above, the label can be selected depending on the sensitivity required, ease of conjugation with the compound, stability requirements, available equipment and disposal regulations, and a wide variety of labels can be selected. Can be used.

  Non-radioactive labels are often attached by indirect means. Generally, a ligand molecule (eg, biotin) is covalently bound to the molecule. The ligand is then bound to an anti-ligand (eg streptavidin) molecule that is either inherently detectable or covalently attached to a signal system such as a detectable enzyme, fluorescent compound or chemiluminescent compound. Let Many ligands and anti-ligands can be used. If the ligand has a natural anti-ligand, such as biotin, thyroxine, and cortisol, it can be used in conjunction with a labeled naturally occurring anti-ligand. Alternatively, any haptenic or antigenic compound can be used in combination with an antibody, such as an anti-SFRP-4 antibody.

  For example, the molecule can be conjugated directly to the signal generating compound by conjugation with an enzyme or fluorophore. The enzyme of interest as a label will be primarily hydrolases, especially phosphatases, esterases and glycosidases, or oxidoreductases, especially peroxidases. Fluorescent compounds useful as labeling moieties include, but are not limited to, fluorescein and its derivatives, rhodamine and its derivatives, dansyl, umbelliferone, and the like. Chemiluminescent compounds useful as labeling moieties include, but are not limited to, luciferin and 2,3-dihydrophthalazinediones, such as luminol. See US Pat. No. 4,391,904 for a review of various labels or signal generation systems that can be used.

  Means of detecting labels are well known to those skilled in the art. Thus, for example, where the label is a radioactive label, means for detection include photographic film such as in a scintillation counter or autoradiography. If the label is a fluorescent label, it can be detected by exciting the fluorescent dye with the appropriate wavelength of light and detecting the resulting fluorescence. Photographic films can be used to visually detect fluorescence by using an electrical detector such as a charge coupled device (CCD) or a photomultiplier tube. Similarly, an enzyme label can be detected by providing a suitable substrate for the enzyme and detecting the resulting reaction product. Finally, a simple colorimetric label can be easily detected by observing the color associated with the label. Hence, conjugated gold in various dipstick assays often appears pink, while various conjugated beads appear bead color.

  Some assay formats do not require the use of labeled components. For example, an agglutination assay can be used to detect the presence of a target antibody, such as an anti-SFRP-4 antibody. In this case, the antigen-coated particles are aggregated by the sample containing the target antibody. In this format, there are no components that need to be labeled and the presence of the target antibody is detected by simple visual inspection.

Pharmaceutical Composition Formulations The SFRP-4 binding agents of the invention can be incorporated into pharmaceutical compositions suitable for administration. In general, a pharmaceutical composition comprises at least one SFRP-4 binding agent and a pharmaceutically acceptable carrier in a form suitable for administration to a subject. This will be determined in part by the particular composition being administered a pharmaceutically acceptable carrier and the particular method used to administer the composition. Accordingly, there are a wide variety of pharmaceutical composition formulations suitable for administering antibody compositions (see, eg, Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing Co., Easton, Pennsylvania, 1990). Pharmaceutical compositions are generally sterilized, substantially isotonic, and formulated in full compliance with US Food and Drug Administration Good Manufacturing Practice (GMP) regulations.

  The terms “pharmaceutically acceptable”, “physiologically resistant” and grammatical variations thereof are used interchangeably when referring to compositions, carriers, diluents and reagents, and the materials Represents that administration to or in a subject is possible without producing undesirable physiological effects to the extent that prohibiting administration of the composition. For example, a “pharmaceutically acceptable excipient” means an excipient that is generally safe, non-toxic, and useful for preparing desirable pharmaceutical compositions, and is used in vertebrates. And excipients acceptable for human pharmaceutical use. Such excipients can be solids, liquids, semi-solids, or gases in the case of aerosol compositions. “Pharmaceutically acceptable salts and esters” means salts and esters that are pharmaceutically acceptable and have the desired pharmacological properties. Appropriate times, sequences and dosages for administration of particular drugs and compositions of the invention will be determined without difficulty by those skilled in the art.

  Preferred examples of such carriers or diluents include, but are not limited to water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. Nonaqueous vehicles such as liposomes and fixed oils can also be used. The use of such media and compounds for pharmaceutically active substances is well known in the art. Except insofar as any conventional medium or compound is incompatible with the SFRP-4 binding agent, its use in the composition is contemplated. Supplementary active compounds can also be incorporated into the compositions.

  In one embodiment, the SFRP-4 binding agent is prepared with a carrier that protects the SFRP-4 binding agent against rapid elimination from the body, such as a controlled release formulation that includes an implant and a microencapsulated distribution system. Biodegradable, biocompatible polymers can be used such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for the preparation of such formulations will be apparent to those skilled in the art. The material can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in US Pat. No. 4,522,811.

  It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically distinct units suitable as unit dosages for the subject to be treated; each unit with the required pharmaceutical carrier. A predetermined amount of binder calculated to produce the desired therapeutic effect. The specification regarding the dosage unit form of the present invention is determined by the unique characteristics of the binder and the specific therapeutic effect to be achieved, as well as limitations inherent in the field of formulating such SFRP-4 binders for the treatment of subjects, And it depends directly on it.

  The nucleic acid molecules of the invention can be inserted into vectors and used as gene therapy vectors. For example, by intravenous injection, local administration (see, eg, US Pat. No. 5,328,470) or by stereotaxic injection (see, eg, Chen, et al., Proc. Natl. Acad. Sci. USA 91: 3054-3057 (1994)) The therapeutic vector can be distributed to the subject. The pharmaceutical formulation of the gene therapy vector can include the gene therapy vector in an accessible diluent or can include a release-retarding matrix in which the gene distribution vehicle is embedded. Alternatively, if a complete gene distribution vector can be produced intact from a recombinant cell, eg, a retroviral vector, the pharmaceutical formulation can include one or more cells that produce a gene distribution system. The pharmaceutical composition can be included in a container, pack or dispenser together with instructions for administration.

Identification and characterization of SFRP-4 binding agents of the invention
Methods for Identifying and / or Screening Binding Agents of the Invention Identifying and binding agents that possess desirable specificity for SFRP-4 polypeptides, such as anti-SFRP-4 antibodies and anti-SFRP-4 antibody-related polypeptides and Useful methods for screening include any immunology-mediated technique known in the art. The components of the immune response can be detected in vitro by various methods well known to those skilled in the art. For example, (1) cytotoxic T lymphocytes can be incubated with radioactively labeled target cells and lysis of these target cells can be detected by the release of radioactive; (2) helper T cells can be detected as antigens and antigens. Incubate with presenting cells and measure cytokine synthesis and secretion by standard methods (Windhagen A; et al., Immunity, 2: 373-80 (1995)); (3) antigen presenting cells Incubation with the total protein antigen and presentation of that antigen on MHC can be detected by either T lymphocyte activation assay or biophysical methods (Harding et al., Proc. Natl. Acad. Sci 86, 4230-4 (1989)); (4) Incubation with reagents that crosslink mast cells with their Fc-epsilon receptor. And down, and it can be measured histamine release by enzyme immunoassay (Siraganian et al, TIPS, 4:. 432-437 (1983)); and (5) enzyme-linked immunosorbent assay (ELISA).

Similarly, the product of an immune response in either a model organism (eg, a mouse) or a human subject can be detected by various methods well known to those skilled in the art. For example, (1) the production of antibodies in response to vaccination can be easily detected by standard methods currently used in clinical laboratories, such as ELISA; (2) the surface of the skin is scratched and the scratched site is By placing a sterile container that captures cells that migrate beyond, migration of immune cells to the site of inflammation can be detected (Peters et al., Blood, 72: 1310-5 (1988)); (3 ) Peripheral blood mononuclear cell proliferation or mixed lymphocyte reaction in response to mitogens can be measured using ³ H-thymidine; (4) by placing PBMC together with labeled particles in wells The phagocytic ability of PBMC granulocytes, macrophages and other phagocytic cells can be measured (Peters et al., Blood, 72: 1310-5 (1988)); It can be measured differentiation of immune system cells (5) PBMC were labeled with antibodies to CD molecules such as CD4 and CD8, and by measuring the fraction of PBMC expressing these markers.

  In one embodiment, the SFRP-4 binding agents of the invention are selected using a candidate binding agent representation on the surface of a replicable gene package. US Pat. Nos. 5,514,548; 5,837,500; 5,871,907; 5,858,793; 5,969,108; 6,225,447; 6,291,650; 6,492,160; European Patent 585,287; European Patent 605,522; See European Patent No. 614640; European Patent No. 10241191; European Patent No. 589877; European Patent No. 774511; European Patent No. 844306. A useful method for generating / selecting filamentous bacteriophage particles containing a phagemid genome encoding a binding molecule with a desired binding specificity has been described. See, for example, European Patent No. 774511; US Pat. No. 5,871,907; US Pat. No. 5,969,108; US Pat. No. 6,225,447; US Pat. No. 6,291,650;

In one embodiment, the SFRP-4 binding agent of the present invention is selected using a candidate binding agent representation on the surface of a yeast host cell. A useful method for isolating scFv polypeptides by yeast surface display is described by Kieke et al., Protein Eng. 10 (11): 1303-10 (1997 Nov).
In one embodiment, ribosome display is used to select SFRP-4 binding agents of the invention. Useful methods for identifying ligands in peptide libraries using ribosome display are described by Mattheakis et al., Proc. Natl. Acad. Sci. USA 91: 9022-26 (1994); and Hanes et al., Proc. Natl. Acad. Sci. USA 94: 4937-42 (1997).

In one embodiment, the SFRP-4 binding agent of the invention is selected using the tRNA representation of the candidate binding agent. A useful method for in vitro selection of ligands using tRNA display is described by Merryman et al., Chem. Biol., 9: 741-46 (2002).
In one embodiment, RNA display is used to select SFRP-4 binding agents of the invention. Useful methods for selecting peptides and proteins using RNA display libraries are Roberts et al. Proc. Natl Acad. Sci. USA, 94: 12297-302 (1997); and Nemoto et al., FEBS Lett. 414: 405-8 (1997). A useful method for selecting peptides and proteins using non-natural RNA display libraries is described by Frankel et al., Curr. Opin. Struct. Biol., 13: 506-12 (2003).

  In one embodiment, the SFRP-4 binding agents of the invention are expressed in the periplasm of Gram negative bacteria and mixed with a labeled SFRP-4 polypeptide. See WO02 / 34886. In clones expressing recombinant polypeptides with affinity for the SFRP-4 polypeptide, the concentration of labeled SFRP-4 binding to the binding agent is increased and Harvey et al., Proc. Natl Acad. Sci. 22: 9193-98 (2004) and US 2004/0058403, allowing cells to be isolated from the rest of the library.

  After selection of the desired SFRP-4 binding agent, it is contemplated that it can be produced in large volumes by any technique known to those skilled in the art, such as prokaryotic or eukaryotic cell expression. Species antibody from which the CDRs required to retain the original species antibody binding specificity (as manipulated according to the techniques described herein) and, if necessary, the minimal portion of the variable region framework are derived And the remainder of the antibody is derived from the target species immunoglobulin and can be manipulated as described herein to produce a vector for expression of the hybrid antibody heavy chain, By using conventional techniques for constructing expression vectors encoding body weight chains, for example, but not limited to, anti-SFRP-4 hybrid antibodies or fragments thereof, SFRP-4 binding agents can be generated.

Measurement of SFRP-4 Binding In one embodiment, an SFRP-4 binding assay comprises SFRP-4 polypeptide and SFRP-4 binding agent for binding between SFRP-4 polypeptide and SFRP-4 binding agent. Refers to an assay format that mixes under appropriate conditions and evaluates the amount of binding between the SFRP-4 polypeptide and the SFRP-4 binding agent. The amount of binding in the absence of SFRP-4 polypeptide, the amount of binding in the presence of a non-specific immunoglobulin composition, or the amount of binding with an appropriate control, which may be both, is compared. The amount of binding can be assessed by any suitable method. Binding assay methods include, for example, ELISA, radioreceptor binding assay, scintillation proximity assay, cell surface receptor binding assay, fluorescence energy transfer assay, liquid chromatography, membrane filtration assay and the like. Biophysical assays for direct measurement of SFRP-4 binding to SFRP-4 binding agents are, for example, nuclear magnetic resonance, fluorescence polarization, surface plasmon resonance (BIACOR chip) and the like. Specific binding is determined by standard assays known in the art, such as radioligand binding assays, ELISA, FRET, immunoprecipitation, SPR, NMR (2D-NMR), mass spectrometry, and the like. A candidate SFRP-4 binding agent is useful as a SFRP-4 binding agent of the present invention if the specific binding of the candidate SFRP-4 binding agent is at least 1% greater than the binding observed in the absence of the candidate SFRP-4 binding agent It is.

  Co-crystals of SFRP-4 polypeptides and SFRP-4 binding agents are also provided by the present invention as a method for determining molecular interactions. Suitable conditions for binding between the SFRP-4 binding agent and SFRP-4 depend on the compound and its ligand and can be readily determined by one skilled in the art.

Measurement of SFRP-4 binding agent biological activity SFRP-4 binding agents of the invention, such as anti-SFRP-4 antibodies and anti-SFRP-4 antibody-related polypeptides, are organisms comprising the specific activities disclosed herein. Can be identified as agonists or antagonists with respect to biological activity. For example, SFRP-4 agonists and antagonists that are SFRP-4 binding agents can be made using methods known in the art. See, for example, WO 96/40281; US Pat. No. 5811097; Deng et al., Blood 92: 1981-1988 (1998); Chen et al., Cancer Res., 58: 3668-3678 (1998); Harrop et al. 161: 1786-1794 (1998); Zhu et al., Cancer Res., 58: 3209-3214 (1998); Yoon et al., J. Immunol., 160: 3170-3179 (1998). Prat et al., J. Cell. Sci., 111: 237-247 (1998); Pitard et al., J. Immunol. Methods, 205: 177-190 (1997); Liautard et al., Cytokinde, 9; : 233-241 (1997); Carlson et al., J. Biol. Chem., 272: 11295-11301 (1997); Taryman et al., Neuron, 14: 755-762 (1995); Muller et al., Structure, 6: 1153-1167 (1998). ; Bartunek et al, Cytokinem, 8:. 14-20 (1996) refer to. Characterization of the biological activity, primarily agonist or antagonist properties, of SFRP-4 binding agents using any conventional in vivo and in vitro assays developed to measure the biological activity of SFRP-4 polypeptides can do.

Summary of use of the SFRP-4 binding agent of the present invention :
The binding agents of the invention can be used in methods known in the art relating to the localization and / or quantification of SFRP-4 polypeptides (eg for use in measuring the level of SFRP-4 polypeptide in a suitable physiological sample, Useful for diagnostic methods, for use in imaging of polypeptides, etc.). In one embodiment, SFRP-4 binding agents containing antibodies derived from binding domains are useful as pharmacologically active compositions. The binding agents of the invention are useful for isolating SFRP-4 polypeptides by standard techniques such as affinity chromatography or immunoprecipitation. The FRP-4 binding agents of the present invention can be obtained by recombinant expression expressed in a biological sample, eg, a natural immunoreactive SFRP-4 polypeptide or immunoreactive SFRP-4-like polypeptide from a cell, and a host system. Purification of the generated immunoreactive SFRP-4 polypeptide or SFRP-4-like polypeptide can be facilitated. In order to further evaluate the abundance and pattern of expression of the immunoreactive polypeptide, an immunoreactive SFRP-4 polypeptide or immunoreactive SFRP (eg, in a cell lysate or cell supernatant) using an SFRP-4 binding agent A 4-like polypeptide can be detected. The SFRP-4 binding agents of the present invention can be used for diagnosis to monitor immunoreactive SFRP-4 polypeptide levels and / or immunoreactive SFRP-4-like polypeptide levels in tissues as part of a clinical laboratory procedure. Thus, for example, the effect of a predetermined treatment regimen can be determined. As described above, detection can be facilitated by coupling (ie, physically linking) the SFRP-4 binding agent of the present invention to a detectable substance.

Detection of SFRP-4 polypeptide expression An example of a method for detecting the presence or absence of a SFRP-4 polypeptide or a SFRP-4-like polypeptide in a biological sample is to obtain a biological sample from a test subject. And SFRP-4 of the invention capable of detecting SFRP-4 polypeptide or SFRP-4-like polypeptide such that the presence of SFRP-4 polypeptide or SFRP-4-like polypeptide is detected in a biological sample Involving contacting the binding agent with the biological sample. An example of an SFRP-4 binding agent is an antibody raised against SEQ ID NO: 1 that can bind to an SFRP-4 polypeptide or an SFRP-4-like polypeptide, preferably an antibody with a detectable label. The term “labeled” with respect to a binding agent refers to direct labeling of the binding agent by coupling (ie, physically linking) a detectable substance to the binding agent and reaction with another compound that is directly labeled. It is intended to include indirect labeling of the binder by sex. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end labeling of a DNA probe with biotin such that it can be detected with fluorescently labeled streptavidin.

  The detection methods of the invention can be used to detect SFRP-4 polypeptides or SFRP-4-like polypeptides in biological samples in vitro and in vivo. In vitro techniques for detection of SFRP-4 polypeptides or SFRP-4-like polypeptides include enzyme linked immunosorbent assays (ELISA), Western blots, immunoprecipitations and immunofluorescence. Furthermore, in vivo techniques for the detection of SFRP-4 polypeptides or SFRP-4-like polypeptides include introducing a labeled SFRP-4 binding agent, such as an anti-SFRP-4 antibody, into the subject. For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques. In one embodiment, the biological sample contains polypeptide molecules from the test subject.

Immunoassays and imaging Using the SFRP-4 binding agents of the present invention, SFRP-4 protein levels or SFRP-4-like protein levels in a biological sample can be assayed using antibody-based techniques. For example, protein expression in tissues can be studied by classical immunohistological methods. Jalkanen, M. et al., J. Cell. Biol. 101: 976-985 (1985); Jalkanen, M. et al., J. Cell. Biol. 105: 3087-3096 (1987). Other antibody-based methods useful for detecting protein gene expression include immunoassays such as enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA). Suitable antibody assay labels are known in the art, and the enzyme-labeled, and iodine, such as glucose oxidase ^{(125 I, 121 I),} carbon ⁽¹⁴ C), sulfur ⁽³⁵ S), tritium ⁽³ H), indium ^{(112 an in)} and technetium ^{(99 mTc)} radioisotopes or other radioactive agent, such as, and fluorescein and fluorescent labels, such as rhodamine, as well as biotin.

  In addition to assaying secreted SFRP-4 protein levels or SFRP-4-like protein levels in a biological sample, secreted SFRP-4 protein levels or SFRP-4-like protein levels can also be detected by in vivo imaging. . SFRP-4 binding agents for in vivo imaging of SFRP-4 protein levels or SFRP-4-like protein levels, such as anti-SFRP-4 antibody labels or markers, include those detectable by X-ray examination, NMR or ESR It is. Suitable labels for X-ray examination include radioactive isotopes such as barium or cesium that emit detectable radiation but are not harmful to the subject. Suitable markers for NMR and ESR include detectable features such as deuterium that can be incorporated into SFRP-4 binding agents by labeling nutrients for related clones that express SFRP-4 binding agents. That have a specific spin.

SFRP-4 binding agents labeled with a suitable detectable contrast moiety such as a radioisotope (eg ¹³¹ I, ¹¹² In, ⁹⁹ mTc), a radiopaque material or a material detectable by nuclear magnetic resonance. Introduce into the subject (eg parenterally, subcutaneously or intraperitoneally). It will be understood in the art that the size of the object and the contrast system used will determine the amount of contrast portion required to produce a diagnostic image. In the case of a radioisotope moiety, the amount of radioactivity injected for a human subject usually ranges from about 5 to 20 millicuries of ⁹⁹ mTc. The labeled SFRP-4 binding agent is then preferentially accumulated at the location of the cell containing the specific target polypeptide. For example, in vivo tumor imaging is described in SW Burchiel et al., Tumor Imaging: The Radiochemical Detection of Cancer 13 (1982).

  The present invention therefore comprises (a) assaying the expression of a polypeptide by measuring the binding of an SFRP-4 binding agent of the present invention in an individual's cells or body fluids; (b) An increase or decrease in the assayed SFRP-4 polypeptide expression level compared to the SFRP-4 polypeptide expression level and thereby compared to the standard expression level is indicative of a medical condition; Methods of diagnosing medical conditions such as SFRP-4-related disorders are provided.

Diagnostic Uses The SFRP-4 binding compositions of the present invention are useful in diagnostic methods. As such, the present invention provides methods of using the binding agents of the present invention useful for diagnosing SFRP-4-related medical conditions in a subject. The binding agents of the invention can be selected to have any level of epitope binding specificity and very high binding affinity for the SFRP-4 polypeptide. In general, the higher the binding affinity of the binding agent, the more stringent wash conditions can be performed in the immunoassay to remove non-specific binding material without removing the target polypeptide. Thus, SFRP-4 binding agents of the invention useful in diagnostic assays usually have a binding affinity of at least 10 ⁸ , 10 ⁹ , 10 ¹⁰ , 10 ¹¹ or 10 ¹² M ⁻¹ . In addition, the SFRP-4 binding agent used as a diagnostic reagent should have a sufficient rate of kinetics to reach equilibrium in at least 12 hours, preferably at least 5 hours, and more preferably at least 1 hour under standard conditions. .

  Some of the methods of the present invention use polyclonal preparations of the anti-SFRP-4 antibody and anti-SFRP-4 antibody-related polypeptide compositions of the present invention as diagnostic reagents, and others use monoclonal isolates. The use of a polyclonal mixture has many advantages compared to a composition made from a single monoclonal anti-SFRP-4 antibody. Due to the binding of the SFRP-4 polypeptide to multiple sites, polyclonal anti-SFRP-4 antibodies or other polypeptides can be made more than monoclonals that bind to a single site of the SFRP-4 polypeptide or SFRP-4-like polypeptide. A strong signal (for diagnosis) can be created. In addition, polyclonal preparations can bind to a large number of variants of the original target sequence (eg, allelic variants, species variants, strain variants, drug-induced escape variants), whereas monoclonal antibodies have a narrower range to the original sequence or to it. Can only be joined to a variant. However, monoclonal anti-SFRP-4 antibodies are advantageous for detecting a single antigen in the presence or potential presence of closely related antigens.

  In methods using polyclonal human anti-SFRP-4 antibodies prepared according to the methods described above, the preparation typically contains a combination of SFRP-4 binding agents, eg, antibodies having different epitope specificities for the target polypeptide. . In some methods using monoclonal antibodies, it is desirable to have two antibodies with different epitope binding specificities. Differences in epitope binding specificity can be determined by competitive binding assays.

  SFRP-4 binding agents that are human antibodies can be used as diagnostic reagents for any type of sample, but are most useful as diagnostic reagents for human biological samples. SFRP-4 binding agents can be used to detect a given SFRP-4 polypeptide in a variety of standard assay formats. Such formats include immunoprecipitation, Western blotting, ELISA, radioimmunoassay and immunoassay assays. Harlow & Lane, Antibodies, A Laboratory Manual (Cold Spring Harbor Publications, New York, 1988); U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,879,262; 3839153; 3850752; 3850578; 3853987; 3867517; 3879262; 39901654; 3935074; 3998433; 39996345; 4034074; and 4098876 See Biological samples can be obtained from any tissue or body fluid of interest.

  Immunoassays or sandwich assays are the preferred format for the diagnostic methods of the present invention. See U.S. Pat. Nos. 4,376,110, 4,486,530, 5,914,241, and 5,965,375. Such an assay uses one SFRP-4 binding agent immobilized on a solid phase, eg, a population of anti-SFRP-4 or anti-SFRP-4 antibodies, and another population of anti-SFRP-4 or anti-SFRP-4 antibodies. To do. Typically, an anti-SFRP-4 antibody or a solution of a population of anti-SFRP-4 antibodies is labeled. When using antibody populations, the populations typically contain antibodies that bind to different epitope specificities within the target polypeptide. Thus, the same population can be used for both the solid phase and the antibody solution. When using anti-SFRP-4 monoclonal antibodies, first and second SFRP-4 monoclonal antibodies with different binding specificities are used in the solid and solution phases. The solid phase and antibody solution can be contacted with the target antigen either sequentially or simultaneously. If a solid phase antibody is first contacted, the assay is referred to as a forward assay. Conversely, if the antibody solution is contacted first, the assay is referred to as a reverse assay. If the target is contacted with both antibodies simultaneously, the assay is referred to as a simultaneous assay. After contacting the SFRP-4 polypeptide with the anti-SFRP-4 antibody, the sample is typically varied from about 10 minutes to about 24 hours, and is typically about 1 hour, and the sample is incubated. A washing step is then performed to remove sample constituents that do not specifically bind to the anti-SFRP-4 antibody used as a diagnostic reagent. If the solid phase and the antibody solution are bound in separate steps, a washing step can be performed after either or both binding steps. After the washing step, binding is quantified by detecting the label linked to the solid phase, typically via binding of a labeled antibody solution. A standard curve is usually prepared from a sample containing a known concentration of target antigen for a given antibody pair or population of antibodies and given reaction conditions. The concentration of SFRP-4 polypeptide in the sample to be tested is then read by interpolation from the calibration curve. Measuring the analyte either from the amount of labeled antibody solution bound at equilibrium or by measuring the kinetics of the labeled antibody solution bound at a series of time points before equilibrium is reached. it can. The slope of such a curve is a measure of the concentration of SFRP-4 polypeptide in the sample.

  Suitable supports for use in the above methods include, for example, nitrocellulose membranes, nylon membranes and derivatized nylon membranes, and agarose, dextran-based gels, dipsticks, microparticles, microspheres, magnetic particles, test tubes, microtiters. Also included are particles such as wells, SEPHADEX ™ (Amersham Pharmacia Biotech, Piscataway NJ) and the like. It may be fixed by absorption or covalent bond. In some cases, an anti-SFRP-4 antibody can be conjugated to a linker molecule such as biotin for attachment to a surface-bound linker such as avidin.

Predictive Medicine The present invention also relates to the field of predictive medicine using diagnostic assays, prognostic assays, pharmacogenomics and clinical trial monitoring for prognostic (predictive) purposes to treat a subject prophylactically. Accordingly, one aspect of the invention provides a biological sample (in order to determine whether a subject suffers from or is at risk of developing a disorder associated with abnormal SFRP-4 polypeptide expression). For example, diagnostic assays for determining SFRP-4 polypeptide expression in blood, serum, cells, tissues).

  The invention also provides a prognostic (or predictive) assay for determining whether an individual is at risk of developing a disorder associated with SFRP-4 polypeptide expression or activity. Such assays can be used for prognostic or predictive purposes to characterize SFRP-4 polypeptides or thereby prophylactically treat an individual prior to the onset of a disorder associated therewith. Furthermore, if the SFRP-4 binding agent of the invention has greater affinity for the SFRP-4 polypeptide (and vice versa) due to its polymorphic form, and vice versa, It can also be assessed whether it is expressed or a polymorphic form of SFRP-4.

  The level of a polypeptide in a particular tissue (or blood) of a subject can be indicative of the toxicity, effect, clearance rate or metabolic rate of a given drug when administered to the subject. The methods described herein can also be used to determine the level of such polypeptides in a subject to help predict the response of such subjects to these drugs. Another aspect of the present invention provides a method for determining SFRP-4 expression in an individual, thereby selecting an appropriate therapeutic or prophylactic compound for that individual (referred to herein as “pharmacogenomics”). ). Pharmacogenomics allows a compound (eg, drug) for therapeutic or prophylactic treatment of an individual based on the genotype of the individual (eg, the genotype of the individual tested to determine the ability of the individual to respond to a particular compound). ) Can be selected.

  The binding of the SFRP-4 binding agent of the present invention to SFRP-4 polypeptide or SFRP-4-like polypeptide, eg, disorders associated with SFRP-4 polypeptide or SFRP-4-like polypeptide expression or activity as described above Can be used to identify subjects who have or are at risk of developing it. Alternatively, prognostic assays can be utilized to identify subjects with or at risk for developing a disease or disorder. Thus, the present invention provides a method for identifying a disease or disorder associated with abnormal SFRP-4 polypeptide or SFRP-4-like polypeptide expression or activity, wherein a test sample is obtained from the subject and SFRP-4 Binding agent binding is detected, wherein the presence of a change in SFRP-4 polypeptide or SFRP-4-like polypeptide is indicative of a disease or disorder associated with abnormal SFRP-4 polypeptide or SFRP-4-like polypeptide expression or activity. Diagnose a subject who has or is at risk of developing it. As used herein, “test sample” refers to a biological sample obtained from a subject of interest.

  In addition, the prognostic assays described herein can be used to treat a compound (eg, agonist, antagonist) with a subject to treat a disease or disorder associated with abnormal SFRP-4 polypeptide or SFRP-4-like polypeptide expression or activity , Peptidomimetics, polypeptides, peptides, nucleic acids, small molecules or other candidate drugs) can be determined. For example, such methods can be used to determine whether a subject can be effectively treated with a compound for a SFRP-4 polypeptide or a SFRP-4-like polypeptide related disorder. Thus, the present invention relates to SFRP-4 polypeptide or SFRP-4-like polypeptide expression in which a test sample is obtained and SFRP-4 polypeptide or SFRP-4-like polypeptide is detected using an SFRP-4 binding agent. Or a method for determining whether a subject can be effectively treated with a compound for a disorder associated with abnormal activity (eg, the presence of a SFRP-4 polypeptide or a SFRP-4-like polypeptide wherein SFRP- 4) or a subject to whom a compound can be administered to treat a disorder associated with abnormal expression or SFRP-4-like polypeptide expression or activity).

  The level of SFRP-4 polypeptide or SFRP-4-like polypeptide in a blood or tissue sample obtained from a subject is determined and found in a blood sample obtained from a disease-free individual or a sample from the same tissue type Compare with level. SFRP-4 polypeptide or SFRP-4-like in a sample obtained from a subject suspected of having a SFRP-4 polypeptide or SFRP-4-like polypeptide related disease compared to a sample obtained from a healthy subject Polypeptide excess (or deficiency) is an indication of SFRP-4 polypeptide or SFRP-4-like polypeptide-related disease in the subject being treated. Further testing may be needed to make a positive diagnosis.

  The degree of overexpression (or underexpression) of an SFRP-4 polypeptide or SFRP-4-like polypeptide molecule is an indicator of whether a subject with a disease may respond to a particular type of therapy or treatment There are many diseases that are known to be. Thus, a method of detecting SFRP-4 polypeptide or SFRP-4-like polypeptide in a sample can be used as a prognostic method, for example, to assess the likelihood that a subject will respond to therapy or treatment. Determine the level of the relevant prognostic polypeptide in the appropriate tissue or blood sample from the subject and compare to the level of an appropriate control, eg, a subject having the same disease but responding favorably to treatment . The degree to which a prognostic polypeptide in a sample is overexpressed (or underexpressed) compared to a control can predict the likelihood that a subject will not respond favorably to treatment or therapy. The greater the overexpression (or underexpression) relative to the control, the less likely the subject will respond to treatment.

  Diseases referred to herein as “predicted polypeptides” where the degree of overexpression (or underexpression) of a target polypeptide is known to be an indicator of whether the subject develops the disease There are many. Thus, a method of detecting SFRP-4 polypeptide or SFRP-4-like polypeptide in a sample can be used as a method of predicting whether a subject will develop a disease. Determine the level of the relevant predicted polypeptide in an appropriate tissue or blood sample from a subject at risk of developing the disease, and an appropriate control, such as a level in a subject not at risk of developing the disease, Compare. The extent to which a predicted polypeptide in a sample is overexpressed (or underexpressed) compared to a control can predict the likelihood that a subject will develop a disease. The greater the overexpression (or underexpression) relative to the control, the more likely the subject will develop the disease.

  For example, the methods described herein can be performed by utilizing a prepackaged diagnostic kit that includes at least one probe reagent, eg, an SFRP-4 binding agent described herein, Can be conveniently used to diagnose a subject presenting with a symptom or family history of a disease or condition associated with, for example, a SFRP-4 polypeptide or a SFRP-4-like polypeptide in a clinical setting. In addition, any cell type or tissue in which an SFRP-4 polypeptide or SFRP-4-like polypeptide is expressed can be utilized in the prognostic assays described herein.

Prophylactic and therapeutic use summary of SFRP-4 binding agents :
The SFRP-4-binding agent of the present invention is useful for preventing or treating diseases. In particular, the present invention provides both prophylactic and therapeutic methods for treating subjects who are at risk (or susceptible) or have a disorder associated with abnormal SFRP-4 binding agent expression or activity. To do. Accordingly, the present invention involves administering an effective amount of an SFRP-4 binding agent to a subject in need thereof, including SFRP-4 related medical conditions in a subject, such as associated prevention of EFRP-4 disorders and / or Provide a method for treatment. The activity of a polypeptide (eg, an oncogene) to compensate for the absence or reduced level of a different polypeptide (eg, an anti-SFRP-4 antibody), eg, to replace the absence or reduced level of an SFRP-4 polypeptide (eg, insulin) Compete with free ligand (eg, soluble TNF receptor used to reduce inflammation) to activate SFRP-4 polypeptide activity (eg, by binding to the receptor) In order to reduce the activity of the membrane-bound receptor, or to produce a desired response (eg, blood vessel growth), the subject can be administered the SFRP-4 binding agent composition of the invention.

  The SFRP-4 binding agents of the present invention include, but are not limited to: those involving bone cell development, differentiation and activation; in diseases or pathologies of cells in the blood circulation such as red blood cells and platelets; various immunology Disorders and / or pathologies; pulmonary diseases and disorders; autoimmune and inflammatory diseases; cardiovascular diseases; metabolic diseases; genital diseases, kidney diseases, diabetes, brain trauma, cancer growth and metastasis (eg brain, breast, prostate, Cancer of the uterus, spleen, pancreas, gastrointestinal tract (eg colon, rectum, small intestine, stomach, esophagus); viral infection, cancer treatment, periodontal disease; tissue regeneration (eg nerve and bone); acute lymphoblastic leukemia; Glioma; nervous system disease; neurodegenerative disorder; hematopoietic disorder; apoptosis resulting from ischemia (eg heart failure, myocardial infarction; stroke); neurodegenerative disease (eg Huntington's disease, peripheral demyelinating disease, multiple occurrences) Prophylactic and potentially involved in a variety of disorders in subjects including sclerosis, Alzheimer's disease, amyotrophic lateral sclerosis, Parkinson's disease; trauma); coronary heart disease; and inflammation (eg inflammatory bowel disease) Useful for therapeutic applications.

  When used in vivo for therapy, an SFRP-4 binding agent, eg, an anti-SFRP-4 antibody of the invention, is administered to the subject in an effective amount (ie, an amount that has the desired therapeutic effect). It is usually administered parenterally. The dose and dosing regimen will depend on the extent of the SFRP-4-related disease or disorder, the characteristics of the particular SFRP-4-binding agent used, such as its therapeutic index, and the subject's medical history. Advantageously, the SFRP-4 binding agent is administered continuously over a period of 1-2 weeks intravenously to treat cells of the vasculature and subcutaneously and intraperitoneally to treat regional lymph nodes. is there. In some cases, administration occurs during the course of adjuvant therapy such as radiation, chemotherapy treatment, or a combined cycle of administration of tumor necrosis factor, interferon or other cytoprotective or immunomodulatory agent.

  For parenteral administration, the SFRP-4 binding agent is formulated into a unit dosage injectable form (solution, suspension, emulsion) with a pharmaceutically acceptable parenteral vehicle. Such vehicles are essentially non-toxic and non-therapeutic.

  Although the use of anti-SFRP-4 IgM antibodies is preferred for certain applications, IgG molecules can be further miniaturized to further localize to certain types of infected cells than IgM molecules. It is clear that in vivo complement activation leads to various biological effects including induction of inflammatory response and macrophage activation. Unanue & Benecerraf, Textbook of Immunology, 2nd Edition (Williams & Wilkins 1984), p. 218. An increase in vasodilation that accompanies inflammation can increase the ability of various drugs to localize to infected cells. Accordingly, SFRP-4 antibody combinations of the type specified herein can be used therapeutically in a number of ways. In addition, antigens such as purified SFRP-4 polypeptides, fragments or analogs thereof (Hakomori, Ann. Rev. Immunol. 2: 103 (1984)) or anti-idiotypic antibodies related to such antigens (Nepom et al , Proc. Natl. Acad. Sci. USA 81: 2864 (1985); Koprowski et al., Proc. Natl. Acad. Sci. USA 81: 216 (1984)) to generate an active immune response in human subjects. Can be induced. Such responses include desirable biological effects such as the formation of antibodies that can activate human complement for target cell destruction.

Diseases and disorders Diseases and disorders characterized by increased SFRP-4 polypeptide levels or biological activity (relative to subjects not suffering from the disease or disorder) can be administered in a therapeutic or prophylactic manner, It can be treated with an SFRP-4-binding agent-based therapeutic compound that antagonizes (ie, reduces or prevents) activity. The therapeutic compounds that can be utilized include, but are not limited to: (i) a SFRP-4 binding agent as described above; and (ii) a nucleic acid encoding the SFRP-4 binding agent.

  Diseases and disorders characterized by decreased levels of SFRP-4 polypeptide or biological activity (relative to subjects not suffering from the disease or disorder) can be associated with increased SFRP-4 activity (ie, are agonists) SFRP. Can be treated with -4 binder based therapeutic compounds. A therapeutic agent that upregulates activity can be administered in a therapeutic or prophylactic manner. Available therapeutic agents include, but are not limited to, SFRP-4-binding agents that increase bioavailability.

  Quantifying SFRP-4 binding agent-induced peptide and / or RNA, obtaining a tissue sample of interest (eg, from a biopsy tissue) and expressing it in vitro at the RNA or peptide level, SFRP-4 polypeptide expressed By assaying the structure and / or activity levels of (or the polypeptide mRNA described above), elevated or decreased levels can be readily detected. Methods well known in the art include, but are not limited to, immunoassays (eg Western blot analysis, immunoprecipitation followed by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis, immunocytochemistry, etc.) and / or mRNA. Hybridization assays to detect expression (eg, Northern assay, dot blot, in situ hybridization, etc.) are included.

SFRP-4 is associated with numerous diseases and disorders, all of which can be affected by the development of SFRP-4 binding agents.
The present invention provides methods for the use of SFRP-4-binding agents to detect, prevent or treat SFRP-4-mediated disorders. In particular, the SFRP-4 binding agents of the present invention may be altered by an alteration in SFRP-4 polypeptide expression, eg, a disorder manifested by an increase or decrease, such as cancer (eg, brain, breast, prostate, uterus, spleen, pancreas, gastrointestinal tract (eg, colon, rectum). , Small intestine, stomach, esophagus)); apoptosis resulting from ischemia (eg heart failure, myocardial infarction; stroke); neurodegenerative diseases (eg Huntington's disease, peripheral demyelinating disease, multiple sclerosis, Alzheimer's disease, muscle atrophy) Useful in the preventive or therapeutic treatment of lateral sclerosis, Parkinson's disease; trauma); coronary heart disease, inflammation (eg inflammatory bowel disease).

  The SFRP-4-binding agent of the present invention is useful for the detection, prevention or therapeutic treatment of breast cancer. Wong and coworkers examined the role of SFRP in breast cancer and its relationship to the Wnt-signaling pathway. In situ hybridization and immunohistochemical analysis of SFRP, Wnt-1, APC, beta-catenin and its target genes c-myc and cyclin D1 were performed on 70 specimens of human breast invasive ductal carcinoma. Compared to adjacent normal tissue, SFRP mRNA was down-regulated in 62 and elevated in 8 tumor specimens. However, during the course of tumor progression, SFRP mRNA increased steadily in both the tumor and adjacent tissues. Interestingly, the number of cases with axillary lymph node metastasis was significantly lower in the higher SFRP group than in the decreased SFRP group, suggesting that SFRP may contribute as a prognostic factor in invasive breast cancer is doing. Wong et al., J. Pathol. 196: 145-153 (2002).

  The SFRP-4 binding agents of the present invention are useful for the detection, prevention or therapeutic treatment of apoptosis in a subject having a myocyte phenotype susceptible to overload-induced heart failure, myocardial hypertrophy and apoptosis. Schumann and coworkers compared SFRP myocardial mRNA expression and soluble beta-catenin levels in heart samples without heart failure and tissue samples from one heart. Schumann, et al. Cardiovascular Res 45: 720-728 (2002). Proapoptotic sFRP3 and 4 mRNA levels but not sFRP1 and 2 were elevated in failing ventricles compared to donor hearts. There was no significant difference between patients with dilated cardiomyopathy or coronary heart disease. sFRP3 and 4 were expressed in cardiomyocytes and its expression correlated with mRNA expression of the proapoptotic Fas / Fas-antagonist ratio, but was inversely proportional to anti-apoptotic bcl-xL mRNA levels. The results support the hypothesis that in human myocardial failure, the Wnt / beta-catenin pathway is weakened by enhanced expression of two endogenous Wnt antagonists. This may contribute to a phenotype prone to apoptosis of overloaded human myocardium.

  The SFRP-4-binding agent of the present invention is useful for the detection, prevention or therapeutic treatment of uterine cancer, such as endometrial cancer. Hrzenjak and coworkers observed an inverse correlation of secreted frizzled-related protein 4 and beta-catenin expression in endometrial stromal sarcoma. Hrzenjak et al., J Pathol. 204 (1): 19-27 (2004). After cDNA array analysis, more than 300 genes deregulated in endometrial stromal sarcoma were selected and sequenced. Among them, the most significantly deregulated gene was that of SFRP, particularly SFRP4. Compared to normal endometrium, the expression of SFRP4 is reduced in both low-grade endometrial stromal sarcoma (ESS; n = 10) and undifferentiated endometrial sarcoma (UES; n = 4); It was lower in the more invasive form of the latter. These results were confirmed by quantitative real-time PCR analysis and in situ hybridization in paraffin wax embedded tissues. In addition, the expression of beta-catenin, an important component of the Wnt-signaling pathway, was regulated in the opposite manner to SFRP4 and was elevated, especially in anaplastic sarcomas. Activation of the Wnt-signaling pathway was further supported by immunohistochemical demonstration that beta-catenin was translocated to the UES nucleus. Thus, SFRP4 may be a putative tumor suppressor involved in deregulation of the Wnt pathway and pathogenesis of ESS and UES.

  The SFRP-4 binding agents of the present invention are useful for the detection, prevention or therapeutic treatment of uterine cancers such as endometrial cancer and breast cancer. Abuh-Jawdeh and co-workers used differential display technology to identify genes that are differentially expressed in human endometrial cancer compared to normal endometrium and cloned SFRP. Abuh-Jawdeh, G et al., Lab Invest. 79: 439-47 (1999). In situ hybridization was used to determine that SFRP is expressed by mesenchymal cells but not by epithelial cells. SFRP expression was regulated during the endometrial cycle: it is expressed in the proliferative endometrial stroma and is not significantly detected in the secreted or menstrual endometrium, which indicates that SFRP is hormonally regulated Suggests that it is below. In addition, SFRP mRNA expression was markedly upregulated in endometrial thickening and carcinoma stroma, and in situ and invasive breast cancer stroma. These results indicated that SFRP functions as a regulator of the Wnt-frizzled signaling pathway and is involved in endometrial physiology and carcinogenesis.

  The SFRP-4-binding agent of the present invention is useful for the detection, prevention or therapeutic treatment of prostate cancer. Horvath and co-workers have demonstrated that membrane expression of secreted frizzled-related protein 4 peptide predicts a good prognosis of localized prostate cancer and blocks in vitro PC3 cell proliferation. Horvath et al., Clin. Cancer Res. 10: 615-25 (2004). Since SFRP-4 mRNA is overexpressed in prostate cancer (PC), the goal of Horvath's study is to define the pattern of SFRP-4 protein expression in normal and malignant human prostate tissue, and changes in expression may be associated with disease progression and It was to determine if the prognosis was related and to define the SFRP-4 overexpression phenotype in an in vitro model of PC. Kaplan-Meier analysis showed that PCs expressed membranous SFRP-4 in> 20% of the cells improved recurrence-free survival compared to those with // = 20% membranous expression (P = 0.002). Furthermore, membranous SFRP-4 expression (P = 0.04) is relapsed (P = 0.006), pathological stage (P = 0.002) and preoperative prostate specific antigen when modeled with Gleason score It was a predictive judgment material of the recurrence independent of the level (P = 0.004). In addition, in vitro studies demonstrated a decrease in the proliferation rate of PCRP cells transfected with SFRP-4 when compared to control PC3 empty vector cells (P <0.0001). Decreased levels of phosphorylated glycogen synthase kinase 3 beta in PC3-SFRP-4 cells suggested that this phenotype is mediated by the “Wnt / beta-catenin” pathway. These data suggest that, as a result of the inhibitory effect on PC cell proliferation, SFRP4 expression may be a prognosis for localized PC.

Prophylactic methods In one embodiment, the present invention provides for the administration of SFRP-4 expression or SFRP-4 polypeptide in a subject by administering to the subject an SFRP-4 binding agent that modulates SFRP-4 polypeptide expression or at least one SFRP-4 polypeptide activity. Methods are provided for preventing diseases or symptoms associated with abnormal activity.

  Identifying a subject at risk for a disease caused by or contributed to by an abnormality in SFRP-4 polypeptide expression or activity, eg, by any or a combination of diagnostic or prognostic assays as described herein Can do. In prophylactic applications, a pharmaceutical composition or medicament of SFRP-4-binding agent is subject to a disease, its complications and disease in a subject prone to or otherwise at risk of a disease or symptom (ie, immune disease). Eliminate or reduce risk, reduce severity, or delay development, including biochemical, histological and / or behavioral symptoms of intermediate pathological phenotype presenting during development Administer in an amount sufficient to Administration of a prophylactic SFRP-4-binding agent can be performed prior to the manifestation of abnormally characteristic symptoms so that the disease or disorder is prevented or alternatively delayed in its progression . Depending on the type of abnormality, for example, an SFRP-4 binding agent that acts as an SFRP-4 agonist or SFRP-4 antagonist can be used to treat the subject. The appropriate compound can be determined based on the screening assays described herein.

Therapeutic Methods Another aspect of the invention includes a method of modulating SFRP-4 polypeptide expression or activity in a subject for therapeutic purposes. The modulating methods of the present invention involve contacting a cell with an SFRP-4 binding agent of the present invention that modulates one or more of the SFRP-4 polypeptide activities associated with the cell. In therapeutic applications, subjects who are suspected of having or already suffering from such a composition or medicinal product may have symptoms of the disease, including its complications in the development of the disease and an intermediate pathological phenotype ( (Biochemical, histological and / or behavioral) is administered in an amount sufficient to cure or at least partially cease. An amount adequate to effect a therapeutic or prophylactic treatment is defined as a therapeutically or prophylactically effective dose.

  Compounds that modulate SFRP-4 polypeptide activity are described herein and can include, for example, a nucleic acid encoding a SFRP-4 binding agent or a SFRP-4 binding agent polypeptide. In one embodiment, the SFRP-4 binding agent stimulates one or more SFRP-4 polypeptide activities. Examples of such stimulatory compounds include SFRP-4 binding agents and nucleic acid molecules (ie, polynucleotides) that encode SFRP-4 binding agents that have been introduced into cells. In another embodiment, the SFRP-4 binding agent blocks one or more SFRP-4 polypeptide activities. These adjustment methods can be performed in vitro (eg, by culturing cells with an SFRP-4 binding agent) or alternatively in vivo (eg, by administering an SFRP-4 binding agent to a subject). As such, the present invention provides a method of treating an individual suffering from an SFRP-4 related disease or disorder characterized by abnormal expression or activity of SFRP-4 polypeptide or nucleic acid molecule encoding SFRP-4 polypeptide. In one embodiment, the method comprises a SFRP-4 binding agent (eg, a compound identified by the screening described herein) or a SFRP- that modulates SFRP-4 expression or activity (eg, upregulation or downregulation). It involves administering a combination of four binders. In another embodiment, the method involves administering a SFRP-4 binding agent or nucleic acid molecule encoding a SFRP-4 binding agent as a treatment to compensate for decreased or abnormal SFRP-4 expression or activity. Stimulation of SFRP-4 activity is desirable in situations where the SFRP-4 polypeptide is abnormally down-regulated.

Determining the biological effects of SFRP-4-binding agent-based therapies In various embodiments of the invention, appropriate in vitro or in vivo assays are performed to address the effects of SFRP-4-binding agent-based therapies and their administration. To determine whether it is indicated for the treatment of affected tissues.
In various embodiments, in vitro assays are performed on representative types of cells involved in the subject's disorder to determine whether a given SFRP-4 binding agent-based treatment will have the desired effect on that cell type. can do. Prior to testing SFRP-4 binding agents for use in therapy in human subjects, it may be tested in a suitable animal model system including, but not limited to, rat, mouse, chicken, cow, monkey, rabbit, and the like. it can. Similarly, for in vivo testing, any animal model system known in the art can be used prior to administration to a human subject.

Treatment regimens and effective dosages Some compositions comprise a plurality (eg, two or more) of the SFRP-4 binding agents of the invention. In some compositions, each of the SFRP-4 binding agents of the composition is a monoclonal or human sequence antibody that binds to a distinct, preselected epitope of the SFRP-4 polypeptide.
An effective dose of an SFRP-4 binding agent of the present invention, eg, an anti-SFRP-4 antibody or anti-SFRP-4 antibody cytotoxin conjugate, for the treatment of SFRP-4-related conditions and diseases described herein is administered It depends on many different factors, including the means, target site, subject's physiological condition, whether the subject is a human or animal, and whether other medications and treatments administered are prophylactic or therapeutic. Usually, the subject is a human, but non-human mammals including transgenic mammals can also be treated. Treatment dosages need to be dosed to optimize safety and efficacy.

  Typically, an effective amount of a composition of the present invention sufficient to achieve a therapeutic or prophylactic effect ranges from about 0.000001 mg / kg body weight / day to about 10,000 mg / kg body weight / day. Preferably, the dosage range is from about 0.0001 mg / kg body weight / day to about 100 mg / kg body weight / day. For administration with an SFRP-4 binding agent, such as an anti-SFRP-4 antibody, the dosage is about 0.0001 to 100 mg / kg of host body weight, more usually 0.01 to 5 mg / kg / day. Span a range. For example, the dosage can be in the range of 1 mg / kg body weight or 10 mg / kg body weight / day, or 1-10 mg / kg body weight / day. Examples of treatment regimes require administration once every two weeks or once a month or once every 3 to 6 months. In some methods, two or more SFRP-4 binding agents with different binding specificities are administered simultaneously, in which case the dosage of each antibody administered falls within the indicated range. SFRP-4 binding agents, such as anti-SFRP-4 antibodies, are usually administered multiple times. The interval between single doses can be weekly, monthly or yearly. The interval may be irregular as indicated by measuring blood levels of antibody in the subject. In some methods, dosage is adjusted to achieve a plasma SFRP-4 binding agent, eg, anti-SFRP-4 antibody concentration, of 1-1000 μg / ml, and in some methods 25-300 μg / ml. Alternatively, an SFRP-4 binding agent, such as an anti-SFRP-4 antibody, can be administered as a sustained release formulation, in which case less frequent administration is required. Dosage and frequency will vary depending on the half-life of the SFRP-4 binding agent in the subject. In general, human anti-SFRP-4 antibodies exhibit the longest half-life, followed by humanized anti-SFRP-4 antibodies, chimeric anti-SFRP-4 antibodies, and non-human anti-SFRP-4 antibodies. The dosage and frequency of administration can vary depending on whether the treatment is therapeutic or prophylactic. In prophylactic applications, relatively low dosages are administered over long periods at relatively infrequent intervals. Some subjects continue to receive treatment for the rest of their lives. In therapeutic applications, relatively high dosages are often required at relatively short intervals until disease progression is reduced or stopped, and preferably until the subject exhibits partial or complete remission of disease symptoms It is said. Thereafter, the patient can be administered a prophylactic regime. Doses for nucleic acids encoding SFRP-4 immunogens range from about 10 ng to 1 g, 100 ng to 100 mg, 1 μg to 10 mg, or 30-300 μg DNA per subject. The dose for infectious viral vectors varies from 10-100 virions per dose or more.

Toxicity Preferably, an effective dose of the SFRP-4-binding agent described herein provides a therapeutic benefit without causing substantial toxicity to the subject. The toxicity of the SFRP-4 binding agents described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example LD ₅₀ (dose lethal to 50% of the population) or LD ₁₀₀ ( _{100 of the} population). % Lethal dose). The dose ratio between toxic and therapeutic effects is the therapeutic index. The data obtained from these cell culture assays and animal studies can be used to formulate a dosage range that is non-toxic for use in humans. The dosage of the SFRP-4 binding agent described herein is preferably within a range of circulating concentrations that include an effective dose with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. Individual physicians can select the exact formulation, route of administration and dosage in light of the subject's symptoms. See, for example, Chapter 1 of Fingl et al., In: The Pharmacological Basis of Therapeutics (1975).

Kits comprising FRP-4 binding agent compositions of the invention (eg, antibody cytotoxin conjugates, monoclonal antibodies, human sequence antibodies, human antibodies, multispecific and bispecific molecules) and instructions for use are also included. It is within the scope of the present invention. The kit is useful for detecting the presence of a SFRP-4 polypeptide or a SFRP-4-like polypeptide in a biological sample. For example, the kit: a labeled SFRP-4 binding agent capable of detecting an SFRP-4 polypeptide or SFRP-4-like polypeptide in a biological sample; an SFRP-4 polypeptide or SFRP-4-like polypeptide in a sample Means for determining the amount; and means for comparing the amount of SFRP-4 polypeptide or SFRP-4-like polypeptide in the sample to a standard. The compound or compound can be packaged in a suitable container. The kit can further comprise instructions for using the kit to detect a SFRP-4 polypeptide or a SFRP-4-like polypeptide.

  The following examples are presented in order to more fully illustrate the preferred embodiments of the invention. This example should in no way be construed as limiting the scope of the invention as defined in the appended claims.

Example
Example 1
Anti-SFRP-4 antibody preparation
The cDNA clones encoding the SFRP-4 polypeptide cloning full-length human SFRP-4 polypeptide antigen was obtained (OriGene Rockville, MD; 10K selection B061-B064 O09 gi | 8400733 | ref | NM 003014.2). An open reading frame without a stop codon was amplified at 65 ° C. using high-fidelity DNA polymerase from Hoffmann-La Roche Inc. (Nutley, NJ; product number 1732650). Nucleic acid encoding human SFRP-4 polypeptide was amplified using the following primers: sense primer 5'CCCAAGCTTGCAGTGCCATGTTCCTCTCCATCC3 '(SEQ ID NO: 11); The amplicon was gel purified (Qiagen Inc., Valencia, CA; product number 28704) and ligated into pCR-XL-TOPO according to the manufacturer's instructions (Invitrogen, Carlsbad, CA; product number 45-0008). Sequence fidelity was confirmed by Solvias AG (Basel, Switzerland). The TOPO construct was amplified in the host strain E. coli Top10 (Invitrogen, Carlsbad, CA; product no. 44-0301). The insert was cut with HindIII and XbaI, purified, and ligated into pRS5a (source: Novartis) using T4 DNA ligase (Roche Pharmaceuticals, Inc., Nutley, NJ; product number 481220). The pRS5a construct was designated “pSFRP4fullHis” (PlasNova entry no .: NPL006815). The pSFRP4fullHis construct encoded the native Kozac and leader sequence, with the complete coding sequence (CDS) and His tag attached directly to the last amino acid of the human SFRP-4 polypeptide. DNA and amino acid sequences were analyzed using the BLAST network service of the National Center for Biotechnology Information.
Transfection and expression of SFRP-4 antigen HEK293 Ebna cells are seeded into 6-well clusters (10 ⁶ cells / well) under standard growth conditions and incubated overnight; according to manufacturer's instructions using Lipofectamine 2000 (Invitrogen, Carlsbad, CA; product number 11668-027) Cells in each well were transfected with 2 μg of pSFRP4fullHis or pRS5a control at 95% confluence. Each well contained 2.5 ml of medium. For transient production, cells were transferred 48 hours later to FCS-free DMEM (Invitrogen-Gibco, Carlsbad, CA; product no. 31966-021). Culture supernatants were sampled every 72 hours and analyzed for His-tagged recombinant SFRP-4 by Western blot. Proteins were detected using HRP-labeled anti-His tag antibody (Quiagen, # 34460) and chemiluminogenic substrate (Roche, # 2015196) according to the manufacturer's instructions. To select stable cell lines, cells were transferred 48 hours later to Dulbecco's modified Eagle medium (DMEM) containing 10% (volume / volume) FCS and 250 μg / ml zeocin. Recombinant SFRP-4 product was analyzed as described above. Control transfections were performed with pRK-LacZ-1 (Novartis Pharma AG) encoding β-galactosidase. After 48 hours, enzyme activity was visualized at the cellular level by staining with a colourigenic substrate (Stratagene, La Jolla, Calif .; product no. 200384-2).

SFRP-4-producing Hek293Ebna cells were transfected with pRK-LacZ-1, pRS5a or pSFRP4fullHis. The transfection efficiency was approximately 60% as estimated by in situ β-galactosidase staining of the pRK-LacZ-1 control. Cells transfected with pSFRP4fullHis showed altered growth behavior. They formed aggregates and died from 72 hours after transfer to FCS-free medium. After 8-10 weeks of selection, only a few stable cell lines were obtained. In contrast, controls containing vector alone showed normal growth behavior.

  Western blot analysis of FCS-free culture supernatants showed that recombinant SFRP-4 was successfully produced and secreted by the transfected cells. A band was observed at 55 kD, corresponding to the molecular weight of the glycosylated protein. (FIG. 1, panel A, 48 hour lane; see also FIG. 1, panel B, lane 1) SFRP-4 polypeptide production levels decline after 72 hours and range from 55 to 40 kDa in size. The protein was detected as a smear (Figure 1, Panel A, 144 hour lane).

To investigate whether the formation of SFRP-4 deglycosylated low molecular weight fragments with PNGase F is due to partial glycosylation or protein lysis, the FCS-free culture supernatants of SFRP-4-producing cell cultures are cultured for 48 hours. And sampled at 144 hours. The supernatant was treated with peptide: N-glycosidase F (PNGase F) (New England Biolabs, Ipswich, Massachusetts, product no. P0704L) according to the manufacturer's instructions (see FIG. 1). In the deglycosylation experiment, a 48 hour sample was treated with PNGase F (Figure 1, Panel B, lanes 1 to 3). Peptide: N-glycosidase F, also known as PNGase F, is an amidase that cleaves between the innermost GlcNAc and asparagine residues of high mannose, hybrid and complex oligosaccharides from N-linked glycoproteins (Maley et al Anal. Biochem., 180, 195-204 (1989)). PNGase F treatment of SFRP-4-containing culture supernatant converted the 55 kDa band and SFRP-4 immunoreactive polypeptide into a peptide that migrated as a 40 kDa distinct band (Figure 1, Panel B, Lane 1 and Lane 2). Vs. Lane 3). This experiment showed that fragment formation that occurs over time is due to partial glycosylation and not proteolysis.

  The hypothesis was that observed partial glycosylation of secreted SFRP-4 could reflect cellular physiology. Stable cell lines produced little SFRP-4. Thus, materials for ELISA development were produced in a transient system. Here SFRP-4 was produced by Hek293 Ebna cells transfected for 72 hours. Antibiotic selective pressure was not used. A total yield of 50 μg of fully glycosylated native SFRP-4 polypeptide was obtained from 200 ml of culture supernatant.

Purification and quantification of SFRP-4 polypeptide antigen After culture for 72 hours, the culture supernatant of SFRP-4-producing cells was collected in a medium containing no FCS. Recombinant SFRP-4 was purified from the 200 ml supernatant by a 1.25 ml Ni-NTA column (Sigma-Aldrich, USA; product number H8286). The column was equilibrated with phosphate buffer (pH 8) containing 10 mM imidazole. Culture supernatant was applied with a syringe at a flow rate of approximately 2 ml / min. Recombinant SFRP-4 was eluted with a phosphate buffer (pH 8) containing 250 mM imidazole. The eluent was concentrated to 300 μl using 0.5 ml Microcon YM-30 (Millipore Corporation, Bedford, MA; product number 42409).

  Protein concentration was determined by the BCA method (Pierce Chemical Co., Rockford, IL, product no. 23235). Protein purity was determined on a NuPAGE 4-12% Bis-Tris gel (Invitrogen, Carlsbad, CA, product number NP0323BOX) with 10% beta-mercaptoethanol in Laemmli sample buffer (Bio-Rad, Hercules, CA, product number 161-0737) , NuPAGE running buffer (Bio-Rad, Carlsbad, CA; product number NP0002) and Coomassie Brilliant Blue R-250 (BioRad Laboratories, Hercules, CA, product number 161-0436). Gels were run on a NuPAGE electrophoresis system (Invitrogen, Carlsbad, CA).

Preparation of SFRP-4 peptide for polyclonal antibody preparation The amino acid sequence of SFRP-4 was analyzed using Biobench2 (Novartis) and the BLAST network service of the National Center for Biotechnology Information. Two peptides of human SFRP-4 corresponding to amino acid residues 292-305 and amino acids 305-319 were selected based on their potential antigenicity, hydrophobicity, surface probability, glycosylation potential and specificity. It was Hara. The selected peptides were identical in human and Macaca fascicularis SFRP-4.

Peptide Synthesis and Coupling Selected peptides H ₂ NQEQRTTVQDKKKTAC-CONH ₂ (also referred to as EP040756; SEQ ID NO: 8) and H ₂ N-AGRTSRSNPPKKGKG-CNH ₂ (also referred to as EP040755; SEQ ID NO: 7) And conjugated to keyhole limpet hemocyanin (KLH) or ovalbumin (OVA) at Eurogentec GmbH (Liege, Belgium).

Antibody generation Two New Zealand white rabbits (Eurogentec, Liege, Belgium) SZ2067 and SZ2068 were immunized with mixtures of 200 μg / ml KLH-conjugated EP040755 and EP040756 on days 0, 14, 28 and 56, respectively. Immune serum was collected on day 87. For each peptide, 10 ml of immune serum from day 87 (5 ml from each rabbit) was affinity purified on a resin column (Eurogentec GmbH, Liege, Belgium).

Column preparation and antibody purification (Eurogentec, Liege, Belgium)
A small affinity column (1 ml of resin) was prepared for each peptide by conjugating 5 mg of each free peptide (EP040755 or EP040756) to AF-amino TOYOPEARL 650M (Tosoh) via cysteine according to standard procedures. 0.2 g of NaCl was added to 10 ml of antiserum. Prior to use, the affinity column was washed twice with 5 ml of 100 mM glycine (pH 2.5) followed by 3 times with 5 ml of PBS supplemented with 20 g / l NaCl. Serum was applied to the column and the flow-through was collected. This was repeated 5 times. The column was washed 3 times with 5 ml PBS supplemented with 20 g / l NaCl and eluted with 1 ml 100 mM glycine (pH 2.5). The antibody was recovered in a tube containing 100 μl of 1M Tris buffer (pH 8.5). The eluate was dialyzed twice against 4 liters of PBS for 4 hours each. BSA was added to 1% and sodium azide to a final concentration of 0.1%.

Detection of antibody production Anti-SFRP-4 antibody production was analyzed by direct ELISA using standard methods. Briefly, OVA-conjugated peptides EP040755 and EP040756 were separately coated on Maxisorb ™ (Nunc) at a concentration of 1 μg / ml. Plates were washed and blocked with Superblock ™ (Pierce) blocking medium. Serum samples and affinity purified antibodies were added at various dilutions and incubated for 3 hours at room temperature. The bound rabbit antibody was conjugated to an HRP-conjugated goat anti-rabbit IgG Fc antibody (Jackson ImmunoResearch, West Grove, Penn .; product number 111-035-046) and a colorigenic substrate (also called Roche Diagnostics (Roche Molecular Systems, Inc.)). ), Almeda, Calif .; product number 1484281). The signal intensity was detected with a Molecular Devices Thermomax microplate reader and the data analyzed using Softmax Pro 3.1.

Antibody characterization Antibody quality was analyzed by direct ELISA using standard methods. Recombinant SFRP-4 was coated on Maxisorb ™ (Nunc) at a concentration of 0-300 ng / ml. Plates were washed and blocked with Superblock ™ (Pierce) blocking medium. Serum samples and affinity purified antibodies were added at various dilutions and incubated for 3 hours at room temperature. The bound rabbit antibody was treated with HRP-conjugated goat anti-rabbit IgG Fc antibody (Jackson ImmunoResearch, West Grove, PA .; product number 111-035-046) and chromigenic substrate (also referred to as Roche Diagnostics (Roche Molecular Systems, Inc.)). ), Almeda, Calif .; product number 1484281). The signal intensity was detected with a Molecular Devices Thermomax microplate reader and the data analyzed using Softmax Pro 3.1.

  In addition, anti-EP040755 was detected by Western blot (WB) for detection of HRP-conjugated goat anti-rabbit IgG Fc antibody (Jackson ImmunoResearch, West Grove, Pennsylvania; product no. 111-035-046) and colorigenic substrate (Hoffmann- La Roche Inc., Nutley, New Jersey; product number 2015196).

The ability of rabbit antisera and affinity purified anti-EP040755 and anti-EP040756 to detect each OVA-coupled peptide in a polyclonal antibody-directed direct ELISA was compared to preimmune sera. Both rabbit antisera detected both antigen and recombinant SFRP-4 polypeptide. The affinity purified antibody detected its respective antigen. However, only purified EP040755 also detected recombinant SFRP-4 polypeptide. Based on the known serum / plasma concentration of 5.5-80 ng / ml SFRP-4 polypeptide in humans, this antibody was considered sensitive enough to measure SFRP-4 in monkey plasma. An anti-SFRP-4 ELISA in monkey plasma was set up using affinity purified anti-EP040755. In Western blot analysis, the detection limit of SFRP-4 using anti-EP040755 was 75 ng absolute.

Conclusions Native recombinant SFRP-4 and SFRP-4-specific polyclonal antibodies were generated. As detailed in Example II below, the material was successfully used to set up an ELISA to measure cynomolgus monkey plasma samples of the AFI030 study (BMD R0250936-04).

Example II
Development of SFRP-4 ELISA for the quantification of SFRP-4 useful for the quantification of immunoreactive SFRP-4 in biological samples The purpose of this study is to determine the SFRP-4 immunoreactive poly in biological samples It was to construct a SFRP-4 ELISA assay useful for detecting peptides. Specifically, an SFRP-4 ELISA assay was developed and used to detect SFRP-4 immunoreactive polypeptides in the serum of female ovariectomized cynomolgus monkeys (Macaca fascicularis) over a period of 4 weeks.

Quantification of SFRP-4 in plasma by ELISA SFRP-4 was determined using a specific sandwich ELISA assay. The sandwich ELISA for SFRP-4 is composed of two specific polyclonal antibodies for this protein, an affinity purified rabbit antibody against the SFRP-4 peptide EP040755 as detailed in Example I above, and a goat anti-SFRP from R & D Systems (Catalog No. A1827). -4 antibody was utilized. Calibration standards containing known concentrations of SFRP-4 polypeptide were performed on each microplate. The concentration of the unknown sample was obtained from the calibration curve (see FIG. 2). The reagents and assay parameters are detailed in Tables 5-7 below.

Blood was collected from each female ovariectomized cynomolgus monkey at the beginning of the sample preparation test period (1 day) and immediately before necropsy (29 days or 30 days). Plasma was obtained from each test sample and frozen until use. Frozen plasma samples (heparin-containing tubes) were thawed at room temperature on the day of the SFRP-4 ELISA assay. All samples were analyzed undiluted. Calibration standards and unknowns were run in duplicate and the arithmetic mean was calculated for each value.

Assay Procedure After each incubation step, the microtiter plate is automatically washed for 3 cycles with wash buffer (see Table 6).

The accuracy with respect to the SFRP-4 ELISA calibration standard was checked and met our acceptance criteria (see Table 7).

It was confirmed that the accuracy for all standards met our acceptance criteria.
Summary of Results A sandwich ELISA with a sensitivity of 15.7 ng / ml was developed to determine SFRP-4 in undiluted cynomolgus monkey plasma. SFRP-4 was detected in the plasma of all animals (see Table 8).

  We have successfully developed a sandwich ELISA to quantify SFRP-4 in cynomolgus monkey plasma. Reference proteins and anti-SFRP-4 antibodies have been previously developed in-house (BMD R0250936-03; see generally Example I). The assay was sensitive enough to be applied to SFRP-4 immunoreactive polypeptide analysis in biological samples such as plasma.

Example III
Quantification of SFRP-4 immunoreactive protein in selected tissues by high-throughput Western blot analysis
High Throughput Western Blot High Throughput Western Blot-31 Human Adult Normal Tissues (Cat. No. W824344-B) was performed according to manufacturer's instructions (BioCAT GmbH, Heidelberg, Germany). 2 μg / ml affinity purified rabbit anti-SFRP4 EP040755 (see Example I) was used as the primary antibody. 20 ng / ml goat anti-rabbit IgG (H + L) -HRP (Pierce catalog number 34075) was used for antibody detection. See FIG.

High-throughput western blots in human tissues of 31 different individuals showed the highest levels of SFRP-4 protein in the heart. This is useful for detection of SFRP-4 as a disease biomarker (diagnosis, prognosis, staging, drug effect) for myocardial infarction, myopathy or coronary heart disease.
High-throughput Western blots showed high levels of SFRP-4 in the colon, rectum, and duodenum, and less than average expression in the ileum, jejunum, and esophagus. As a disease biomarker (diagnosis, prognosis, staging, drug effect) for colorectal cancer and other cancers of the gastrointestinal tract, and as a marker for the malignancy of inflammatory diseases of the gastrointestinal tract, Useful for detection.

High-throughput western blot showed SFRP-4 above average levels in the spleen and pancreas. This is useful for the detection of SFRP-4 as a disease biomarker (diagnosis, prognosis, staging, and drug effects) for spleen or pancreatic cancer.
High-throughput western blot showed SFRP-4 above average levels in the uterus. This is useful for the detection of SFRP-4 as a disease biomarker (diagnosis, prognosis, staging, and drug effects) for uterine cancer.
High throughput Western blot showed SFRP-4 above the mean level in the brain. This is SFRP-4 as a neurodegenerative disease (eg Huntington, ALS, Alzheimer's disease, MS, Parkinson, peripheral demyelinating disease) and disease biomarkers (diagnosis, prognosis, staging, and drug effects) for brain tumors It is useful for detection.

Equivalently, the present invention should not be limited to the specific embodiment terms described in this application, but is intended merely as an illustration of individual aspects of the invention. Many modifications and variations of this invention can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. In addition to those enumerated herein, functionally equivalent methods and apparatus within the scope of the invention will be apparent to those skilled in the art from the foregoing description. Such modifications and variations are intended to fall within the scope of the appended claims. The present invention is limited only by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled. It is to be understood that the present invention is not limited to a particular method, reagent, compound, composition or biological system, which can of course vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

Figure 2 shows Western blot analysis of His-tagged SFRP-4 polypeptide. Panel A shows immunoreactive His-tagged SFRP-4 polypeptide detected in 10 μl of culture supernatant after 48 hours (left lane) and 144 hours (right lane) of culture. Panel B shows the effect of deglycosylation of His-tagged SFRP-4-containing culture supernatant (48 hour sample). Lane 1: SFRP-4 immunoreactive protein observed in His-tagged SFRP-4-containing culture supernatant (48-hour sample); Lane 2: mock-treated His-tagged SFRP-4-containing culture supernatant (48-hour sample) SFRP-4 immunoreactive protein observed in lane; Lane 3: SFRP-4 immunoreactive protein observed in PNGase-treated His-tagged SFRP-4-containing culture supernatant (48 hour sample). It is a graph which shows a SFRP-4 ELISA standard curve. FIG. 6 is a photograph of a high-throughput western blot with a chart showing the spot size in the tissue. The tissues tested are as follows: 1, placenta; 2, empty lane; 3, fat; 4, bladder; 5, brain; 6, breast; 7, cerebellum; 8, neck; 9, colon; 11, duodenum; 12, esophagus; 13, gallbladder; 14, heart; 15, ileum; 16, kidney; 18, kidney; 18, liver; 19, lung; 20, ovary; 21, pancreas; 22, placenta 24, skeletal muscle; 26, spleen; 27, stomach; 28, testis; 29, thymus; 30, thyroid gland; 31, tonsil; 32, uterus.

Claims (19)

  Binds immunospecifically to at least one polypeptide selected from the group consisting of SEQ ID NO: 3; SEQ ID NO: 4; and SEQ ID NO: 5; and immunospecifically binds to the polypeptide of SEQ ID NO: 2. Antibody composition.   2. The antibody of claim 1, wherein the antibody is selected from the group consisting of a polyclonal antibody; a monoclonal antibody; a chimeric antibody; a humanized antibody and an antibody-related polypeptide.   A pharmaceutical composition comprising the antibody of claim 1 and a pharmaceutically acceptable carrier.   Binds immunospecifically to at least one polypeptide selected from the group consisting of SEQ ID NO: 3; SEQ ID NO: 4; and SEQ ID NO: 5; and immunospecifically binds to the polypeptide of SEQ ID NO: 2. An isolated nucleic acid encoding an antibody or fragment thereof.   A vector comprising the nucleic acid according to claim 4.   6. The vector of claim 5, further comprising a promoter operably linked to the nucleic acid molecule.   A host cell comprising the vector of claim 5. (A) culturing cells containing the vector of claim 6 under conditions that provide for expression of the antibody or fragment thereof; and (b) recovering the expressed antibody or fragment thereof;
Immunospecifically binds to at least one polypeptide selected from the group consisting of SEQ ID NO: 3; SEQ ID NO: 4; and SEQ ID NO: 5; and immunospecifically to the polypeptide of SEQ ID NO: 2 A method for preparing an antibody or fragment thereof that binds. (A) providing a sample;
(B) contacting the sample with the antibody composition of claim 1; and (c) determining the presence or amount of the antibody composition that binds to the immunoreactive polypeptide, thereby immunoreactivity in the sample. Determining the presence or amount of a polypeptide;
A method for determining the presence or amount of an immunoreactive polypeptide in a sample comprising.   Secretion comprising administering an effective amount of the antibody composition of claim 1 to a subject where such treatment or prevention is desired in an amount sufficient to treat or prevent a secreted frizzled-related polypeptide type 4 related disorder in the subject. A method of treating or preventing a type frizzled related polypeptide type 4 related disorder.   Secreted frizzled-related polypeptide type 4 related disorder is the result of brain cancer; breast cancer; prostate cancer; uterine cancer; spleen cancer; pancreatic cancer; colon cancer; rectal cancer; small intestine cancer; Apoptosis, heart failure; myocardial infarction; stroke; neurodegenerative disorder; Huntington's disease; peripheral demyelinating disease; multiple sclerosis; Alzheimer's disease; amyotrophic lateral sclerosis; Parkinson's disease; 11. A method according to claim 10 selected from the group consisting of inflammatory bowel disease.   Secretion comprising administering to a subject where such treatment or prevention is desired in an amount effective to treat or prevent a medical condition associated with expression of the polypeptide of SEQ ID NO: 2 in the subject. A method of treating or preventing a type frizzled related polypeptide type 4 related disorder.   Secreted frizzled-related polypeptide type 4 related disorder is the result of brain cancer; breast cancer; prostate cancer; uterine cancer; spleen cancer; pancreatic cancer; colon cancer; rectal cancer; small intestine cancer; Apoptosis, heart failure; myocardial infarction; stroke; neurodegenerative disorder; Huntington's disease; peripheral demyelinating disease; multiple sclerosis; Alzheimer's disease; amyotrophic lateral sclerosis; Parkinson's disease; 13. A method according to claim 12 selected from the group consisting of inflammatory bowel disease.   A method for adjusting the expression or activity of a polypeptide with an amino acid sequence comprising the sequence of SEQ ID NO: 2 in a mammal comprising administering at least one antibody of claim 1 to the mammal.   Use of the antibody composition for the manufacture of a medicament for the treatment of a secreted frizzled related polypeptide type 4 related disorder, wherein the antibody composition is the antibody composition of claim 1.   A kit comprising in one or more containers the pharmaceutical composition of claim 3 and instructions for using its contents.   A kit comprising the pharmaceutical composition of claim 5 and instructions for using its contents in one or more containers. (A) providing a test sample;
(B) tested under conditions where the antibody is complexed with a secreted frizzled-related polypeptide type 4 polypeptide biological marker to form an antibody / secreted frizzled-related polypeptide type 4 polypeptide biological marker complex Contacting the sample with the antibody of claim 1;
(C) detecting an antibody / secreted frizzled-related polypeptide type 4 polypeptide biological marker complex; and (d) an antibody / secreted frizzled-related polypeptide type 4 polypeptide biological marker in the test sample. Quantifying the complex;
A method for detecting a secreted frizzled related polypeptide type 4 polypeptide biological marker. (A) providing a test sample from a first mammalian subject;
(B) under conditions where the antibody is complexed with a secreted frizzled-related polypeptide type 4 polypeptide biological marker to form an antibody / secreted frizzled-related polypeptide type 4 polypeptide biological marker complex. Contacting a test sample from one mammalian subject with the antibody of claim 1;
(C) detecting the level of an antibody / secreted frizzled-related polypeptide type 4 polypeptide biological marker complex;
(D) quantifying the level of expression of the secreted frizzled-related polypeptide type 4 polypeptide in the sample from the first mammalian subject; and (e) the secreted frizzled-related poly in the sample of step (a). Levels of secreted frizzled-related polypeptide type 4 polypeptide present in a control sample from a second mammalian subject known to have no level of disease or no predisposition to the level of peptide type 4 polypeptide To compare with;
Wherein a change in the expression level of the secreted frizzled-related polypeptide type 4 polypeptide in the first subject as compared to a control sample from a second mammalian subject is indicative of the presence or predisposition to the disease A method for determining the presence or predisposition to a disease associated with a level change in a secreted frizzled-related polypeptide type 4 polypeptide in the first mammalian subject shown.

Images