JP2009504567A - Compositions and methods for treating malaria with cupredoxins and cytochromes - Google Patents

Abstract

  The present invention relates to cupredoxins for inhibiting the spread of parasitemia in mammalian erythrocytes and other tissues infected by Plasmodium, and in particular for inhibiting parasitemia of human erythrocytes by Plasmodium falciparum. Cytochromes, and their use (separately or together). The present invention is useful for treating or preventing malaria infection in mammals, or a composition comprising cupredoxin or a cytochrome c variant, derivative or structural equivalent isolated peptide and cupredoxin and / or cytochrome c These variants, derivatives or structural equivalents are provided. Furthermore, the present invention provides a method of treating a mammal to prevent or inhibit the spread of malaria infection in the mammal. The present invention also provides a method for preventing the spread of malaria infection in vector insects.

Description

US patent application at USPTO

Related applications

  This application is a co-filed US Provisional Patent Application No. (), March 10, 2006, entitled “Compositions and Methods for Treating HIV Infection with Cupredoxin and Cytochrome c” filed in (). U.S. Provisional Patent Application No. 60 / 780,868, filed May 20, 2005, U.S. Provisional Patent Application No. 60 / 682,813, U.S. Patent Application No. 11 / filed on Oct. 6, 2005 No. 244,105 [This gives priority to US Provisional Patent Application No. 60 / 616,782 filed October 7, 2004, and US Provisional Patent Application No. 60 / 680,500 filed May 13, 2005. Claims and claims priority to US Provisional Patent Application No. 10 / 720,603, filed on November 11, 2003, which is US Provisional Patent Application No. 60 / 414,550, filed on August 15, 2003 And US patent application No. 10 / 047,710 filed on January 15, 2002 (this is a US provisional patent application filed on February 15, 2001) Claims priority to Patent 60 / 269,133.) Is a continuation-in-part application of. } Is a partial continuation application. Claim priority. The entire contents of these prior applications are fully incorporated herein by reference.

Statement of government interest

  The contents of this application are supported by research grants from the National Institutes of Health (NIH) in Bethesda, Maryland, USA (Grant numbers AI 16790-21, ES 04050-16, AI 45541, CA09432 and N01- CM97567). The United States government has certain rights in the invention.

Field of Invention

  The present invention relates to cupredoxin and cytochromes and their uses (separately or separately) which inhibit parasitemia of malaria parasites, in particular parasitemia of Plasmodium falciparum in mammalian erythrocytes. In combination). The invention also relates to cupredoxin and cytochrome variants and derivatives that retain the ability to inhibit parasitemia caused by Plasmodium. Finally, the present invention provides a method for inhibiting the spread of malaria infection in vector insects.

background

  About a quarter of the world's population is at risk of malaria, and more than one million people die each year from malaria. Of the four species of Plasmodium that infect humans, the two main species are Plasmodium falciparum and Plasmodium falciparum (P. vivax).

  P. falciparum blood stage merozoites use various surface proteins to bind and parasitize red blood cells (Cowman et al., FEBS Lett. 476: 84-88 (2000); Baum et al., J. Biol. Chem. 281: 5197-5208 (2006)). The major antigenic member of the surface protein is called merozoite surface protein 1 (MSP1) (195 kDa protein). MSP1 is present in all erythrocyte-invasive Plasmodium species and is immobilized on the merozoite surface by a glycosyl-phosphatidylinositol bond. The merozoite MSP1 protein undergoes proteolytic cleavage immediately after release from infected erythrocytes, the early stage of the erythrocyte invasion process, producing the C-terminal cleavage product MSP1-42. This continues to undergo a second cleavage, producing the 11 kDa peptide MSP1-19. This maintains adhesion to the parasitic surface as it enters the red blood cells. The formation of the cleavage product MSP1-19 is very important for full invasion by parasitism. Inhibition of its proteolytic formation by a monoclonal antibody or its neutralization prevents the onset of infestation on erythrocytes (Blackman et al., J. Exptl., Med. 180: 389-393 (1994)).

  The MSP1-19 peptide is one of the most important malaria vaccine candidates available. MSP1-19-specific antibodies from malaria-resistant human sera react with antigens and contain a major inhibitor of erythrocyte invasion (Holder & Riley, Parasitol. Today, 12: 173-174 (1996); O'Donnell et al ., J. Expt. Med. 193: 1403-1412 (2001)). Sera from donors in areas endemic to malaria usually demonstrate strong antibody reactivity to Pf MSP1-19 (Nwuba et al., Infect. Immun. 70: 5328-5331 (2002)).

  Monoclonal antibody (mAb) G17.12 is raised against recombinant Pf MSP1-19 and recognizes its epitope on the parasitic surface. It has been demonstrated that this region of the antigen is accessible on the native MSP1 polypeptide complex (Pizarro et al., J. Mol. Biol. 328: 1091-1103 (2003)). Interestingly, in vitro erythrocyte invasion studies show that infection is not inhibited even at a concentration of 200 μg / ml in the presence of G17.12 and that G17.12 does not inhibit the second processing of MSP1 in vitro. It was. The presence of antibodies that block invasive binding-inhibiting antibodies therefore facilitates the persistence of parasites and this has also been demonstrated (Guevara Patino et al., J. Expt. Med. 186: 1689-1699 (1997) ), May be due to a lack of G17.12 mAb that inhibits erythrocyte invasion by M. falciparum.

  Most drugs are unable to cross the blood-brain barrier to reach the brain capillaries, so brain malaria (rare limited to P. falciparum malaria parasite infestation due to the isolation of parasitic red blood cells And fatal infectious diseases) cannot be treated in many cases. Plasmodium falciparum-attachment of infected erythrocytes to brain capillaries is due to the parasitic ligand Pf Emp-1 family of proteins expressed on the surface of infected erythrocytes and ICAM-1 expressed on the surface of capillary endothelial cells in cerebral blood vessels And mediated by interaction with CD36 (Smith et al., Proc. Natl. Acad. Sci. USA 97: 1766-1771 (2000); Franke-Fayard et al., Proc. Natl. Acad. Sci. USA 102, 11468-11473 (2005)).

  A few drugs, such as chloroquine, that target the heme detoxification pathway are used to treat malaria, but the phenomenon of increased parasitic resistance to drugs and resistance of vector mosquitoes to insecticides has occurred. Chloroquine antagonizes heme polymerization mediated by parasite-induced HRP (histidine-rich protein) so that heme monomers are highly toxic to malaria parasites. The polymerization of heme enables detoxification (these are reversed by chloroquine). Another drug (artemisinin) is effective against chloroquine-resistant P. falciparum in brain malaria. Artemisinin forms adducts with globin-binding heme within hemoglobin. This binds to HRP and prevents heme polymerization. There is an urgent need to develop new drugs for this terrible disease that is particularly prevalent in Africa and Asia. Current efforts in drug development are devoted to deciphering complete parasitic genome sequences, molecular modeling of malaria parasite proteins, and the search for new drug targets.

Summary of the Invention

  The present invention relates to cupredoxins and cytochromes that inhibit the spread of parasitemia in mammalian red blood cells and other tissues infected by malaria parasites, in particular the spread of human red blood cell parasitemia by Plasmodium falciparum and Relates to their use (separately or in combination).

  One embodiment of the present invention is an isolated peptide that is a variant, derivative or structural equivalent of cupredoxin or cytochrome; and can inhibit intracellular replication of Plasmodium in human erythrocytes infected with malaria Isolated peptide.

  Another aspect of the invention is an isolated peptide that is a variant, derivative or structural equivalent of a cupredoxin; and is capable of binding to a protein selected from the group consisting of PfMSP1-19 and PfMSP1-42. It is a released peptide.

  Another aspect of the present invention is an isolated peptide that is a variant, derivative or structural equivalent of cupredoxin or cytochrome, and is capable of inhibiting malaria parasitemia in erythrocytes infected with malaria It is a peptide. Specifically, the isolated peptide can inhibit parasitemia due to malaria in human erythrocytes infected with Plasmodium falciparum. In some embodiments, the cupredoxin is azurin, pseudo-azurin, plastocyanin, rusticyanin, Laz or auracyanin. Specifically, the cupredoxin may be rusticyanin, azurin or Laz. In some embodiments, the cupredoxin is Pseudomonas aeruginosa, Alcaligenes faecalis, Achromobacter xylosoxidan, Bordetella bronchiseptica, Methylomonas sp, Methylomonas sp. Neisseria meningitidis, Neisseria gonorrhea, Pseudomonas fluorescens, Pseudomonas chlororaphis, Xylella fastidiosa or Vibrio parahaemolyticus V. Specifically, the cupredoxin may be derived from Thiobacillus ferrooxidans, Pseudomonas aeruginosa, Neisseria gonorrhoeae or Neisseria meningitidis.

  In another embodiment of this aspect, the cytochrome is cytochrome c or cytochrome f. In particular, cytochrome c may be derived from human or Pseudomonas aeruginosa. Cytochrome f may be derived from cyanobacteria.

  In another embodiment of this aspect, the isolated peptide is a cleavage of a peptide selected from the group consisting of SEQ ID NOs: 1-20 and 22. In some embodiments, SEQ ID NOs: 1-20 or 22 have at least 90% amino acid sequence identity to the sequence of the isolated peptide.

  In some embodiments of this aspect, the isolated peptide is a cleavage of cupredoxin or cytochrome. In some embodiments, the isolated peptide is about 10-100 residues. The isolated peptide may contain azurin residues 36-89. Alternatively, the isolated peptide may consist of azurin residues 36-89. Alternatively, the isolated peptide may contain a cupredoxin residue equivalent to azurin 36-89.

  In other embodiments of this aspect, the isolated peptide is fused to the H.8 region of Laz. In other embodiments, the isolated peptide is a structural equivalent of monoclonal antibody G17.12.

  Another aspect of the present invention is a composition comprising at least one cupredoxin, cytochrome, or a cupredoxin capable of inhibiting parasemia caused by malaria in erythrocytes infected with malaria in a pharmaceutical composition or An isolated peptide that is a mutant, derivative or structural equivalent of cytochrome. Specifically, the pharmaceutical composition may be formulated for intravenous administration. The composition may include other antimalarial drugs or anti-HIV drugs.

  In some embodiments of the composition, the cupredoxin comprises Pseudomonas aeruginosa, Alcaligenes faecalis, Achromobacter xylosoxidan, Bordetella bronchiseptica, Methylomonas espe sp), Neisseria meningitidis, Neisseria gonorrhea, Pseudomonas fluorescens, Pseudomonas chlororaphis, Xylella fastidiosa (Xylella fastidiosa) or Vibrio parahaemolyticus Is from. Specifically, the cupredoxin may be derived from Thiobacillus ferrooxidans, Pseudomonas aeruginosa, Neisseria gonorrhoeae or Neisseria meningitidis.

  In some embodiments of the composition, the cytochrome is cytochrome c or cytochrome f. Specifically, cytochrome c may be derived from human or Pseudomonas aeruginosa. Cytochrome f may be derived from cyanobacteria. In some embodiments, the cupredoxin or cytochrome c is SEQ ID NO: 1-20 or 22.

  Another aspect of the present invention is a method of treating a patient suffering from an infection caused by Plasmodium by administering an effective amount of the composition of the present invention. In certain embodiments, the peptide inhibits malaria parasitemia in human erythrocytes infected with malaria in the patient. In some embodiments, the Plasmodium is a Plasmodium or Plasmodium falciparum. In some embodiments, the patient is further suffering from HIV infection. In some embodiments, the composition is administered in a second composition that may comprise an antimalarial agent and / or an anti-HIV agent. In some embodiments, the composition of the invention is administered within 0 minutes to 12 hours of administration of the second composition. In some embodiments, the composition of the invention is administered to a patient orally, by inhalation, intravenously, intramuscularly or subcutaneously; specifically, the composition is administered intravenously to a patient. Also good.

  Another aspect of the invention is a method of treating a patient suspected of being in contact with a malaria parasite comprising administering to the patient an effective amount of the composition of the invention.

  Another aspect of the present invention is a method for preventing malaria in a mammal comprising administering to a vector insect a certain amount of the composition of the present invention in a vector insect population that protects the parasite. . In some embodiments of this method, the composition is administered orally to the vector insect.

  These and other aspects, advantages, and features of the present invention will become apparent from the following drawings and detailed description of specific embodiments.

Brief description of the sequence number

  SEQ ID NO: 1 is the amino acid sequence of azurin from Pseudomonas aeruginosa.

SEQ ID NO: 2 is the amino acid sequence of cytochrome c ₅₅₁ derived from Pseudomonas aeruginosa.

  SEQ ID NO: 3 is the amino acid sequence of Laz from Neisseria meningitidis MC58.

  SEQ ID NO: 4 is the amino acid sequence of plastocyanin derived from Phormidium laminosum.

  SEQ ID NO: 5 is the amino acid sequence of rusticyanin derived from Thiobacillus ferrooxidans (Acidithiobacillus ferrooxidans).

  SEQ ID NO: 6 is the amino acid sequence of pseudoazurin derived from Achromobacter cycloclastes.

  SEQ ID NO: 7 is the amino acid sequence of azurin from Alcaligenes faecalis.

  SEQ ID NO: 8 is the amino acid sequence of azurin from Achromobacter xylosoxidans ssp. Denitrificans I.

  SEQ ID NO: 9 is the amino acid sequence of azurin from bronchial septic bacteria.

  SEQ ID NO: 10 is the amino acid sequence of azurin from Methylomonas sp. J.

  SEQ ID NO: 11 is the amino acid sequence of azurin from Neisseria meningitidis Z2491.

  SEQ ID NO: 12 is the amino acid sequence of azurin derived from Pseudomonas fluorescens.

  SEQ ID NO: 13 is the amino acid sequence of azurin from Pseudomonas chlororaphis.

  SEQ ID NO: 14 is the amino acid sequence of azurin from Xylella fastidiosa 9a5c.

  SEQ ID NO: 15 is the amino acid sequence of stellacyanin derived from Cucumis sativus.

  SEQ ID NO: 16 is the amino acid sequence of Auracyanin A from Chloroflexus aurantiacus.

  SEQ ID NO: 17 is the amino acid sequence of auracyanin B from Chloroflexus aurantiacus.

  SEQ ID NO: 18 is an amino acid sequence of a cucumber basic protein derived from Cucumis sativus.

  SEQ ID NO: 19 is the amino acid sequence of human-derived cytochrome c.

  SEQ ID NO: 20 is the amino acid sequence of cytochrome f derived from Phormidium laminosum.

  SEQ ID NO: 21 is the amino acid sequence of the H.8 region of Laz derived from Neisseria gonorrhoeae F62.

  SEQ ID NO: 22 is the amino acid sequence of Laz from Neisseria gonorrhoeae F62.

  SEQ ID NO: 23 is a forward primer for the Laz coding gene (laz) of Neisseria gonorrhoeae that undergoes PCR amplification.

  SEQ ID NO: 24 is a reverse primer for the Laz coding gene (laz) of Aspergillus oryzae that undergoes PCR amplification.

  SEQ ID NO: 25 is a forward primer for pUC18-laz of a 3.1 kb fragment to be amplified by PCR.

  SEQ ID NO: 26 is a reverse primer for puc18-laz of the 3.1 kb fragment to be amplified by PCR.

  SEQ ID NO: 27 is a forward primer for the 0.4 kb fragment pUC19-paz that undergoes PCR amplification.

  SEQ ID NO: 28 is a reverse primer for pUC19-paz of a 0.4 kb fragment that undergoes PCR amplification.

  SEQ ID NO: 29 is a forward primer for pGST-azu 36-128.

  SEQ ID NO: 30 is a reverse primer for pGST-azu 36-128.

  SEQ ID NO: 31 is a forward primer for pGST-azu 36-89.

  SEQ ID NO: 32 is a reverse primer for pGST-azu 36-89.

  SEQ ID NO: 33 is a forward primer for pGST-azu 88-113.

  SEQ ID NO: 34 is a reverse primer for pGST-azu 88-113.

  SEQ ID NO: 35 is an oligonucleotide for site-directed mutagenesis for the preparation of pGST-azu 88-113.

  SEQ ID NO: 36 is an oligonucleotide for site-directed mutagenesis for the preparation of pGST-azu 88-113.

Detailed Description of the Invention

Definitions As used herein, the term “cell” includes both term (s) unless specifically stated as “single cell”.

  As used herein, the terms “polypeptide”, “peptide” and “protein” are used interchangeably to refer to a polymer of amino acid residues. The term applies to amino acid polymers in which one or more amino acid residues are artificial chemical analogues of the corresponding naturally occurring amino acids. The term also applies to naturally occurring amino acid polymers. The terms “polypeptide”, “peptide” and “protein” also include, but are not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation. Is an inclusion body. It will be appreciated that polypeptides are not necessarily completely linear. For example, the polypeptide may be branched as a result of ubiquitination or may be cyclic (with or without branching). These generally occur as a result of post-translational modifications and include naturally occurring reactions and reactions brought about by non-naturally occurring human manipulations. Cyclic, branched and branched cyclic polypeptides may also be synthesized by untranslated natural processes and complete synthetic methods.

As used herein, the term “physiological state” includes anatomical and physiological deviations from a standard that constitutes a dysfunction of the normal state of one of the living animals or parts thereof. . This interferes with or modifies the performance of the body's functions and can be implemented by various factors (such as malnutrition, industrial disasters or climate), certain infectious agents (such as worms, parasitic protozoa, bacteria or viruses), A response to a defect (such as a genetic abnormality) or a combination of these factors.
As used herein, the term “condition” includes anatomical and physiological deviations from a standard that constitutes a dysfunction of the standard condition of one of the living animals or parts thereof. This impedes or modifies the performance of bodily functions.

  As used herein, the term “affected” includes actually presenting symptoms of a pathological condition. Pathological conditions also include pathological conditions without observable symptoms, during recovery from pathological conditions, or during recovery from pathological conditions.

  As used herein, the term “parasitemia” refers to the presence of parasites in the blood and other tissues, particularly with or without clinical symptoms. Used for.

  As used herein, the term “inhibition of parasitemia” means a decrease in the rate of increase in the presence of parasites in the blood of a mammal. Inhibition is any decrease in the rate of increase that is statistically significant when compared to control treatment.

  As used herein, the term “treatment” includes preventing, reducing, stopping, or reversing the progression or severity of a condition or symptom associated with the condition being treated. For example, the term “treatment” suitably includes medical, therapeutic and / or prophylactic administration.

  As used herein, “anti-malarial fever activity” includes any activity that reduces infectivity, reproduction, or inhibits the progression of the life cycle of the malaria parasite. “Anti-malarial fever activity” includes the inhibition of the spread of malaria infection by all means observed with anti-malarial fever drugs.

  As used herein, the term “antimalarial fever drug” is an antimalarial that may be used to reduce infectivity, reproduction, or inhibit the progression of the life cycle of a malaria parasite. A drug having thermal activity.

  As used herein, the term “anti-HIV agent” refers to an agent with anti-HIV activity that prevents, by any means, reducing or increasing the HIV infection in a mammal. Say. Optional means include, but are not limited to, inhibition of HIV genome replication, inhibition of HIV coat protein synthesis and / or assembly, and inhibition of HIV entry into uninfected cells.

The term “substantially pure” as used herein, when used to modify a polypeptide or other compound, is in a polypeptide or compound, eg, in substantially free form. Or a polypeptide isolated from a growth medium without mixing with an activity inhibitor. The term “substantially pure” refers to a compound in an amount of at least about 75% by dry weight or 75% substantially pure compound of the isolated fraction. More specifically, the term “substantially pure” refers to at least about 85%, active compound or “85% substantially pure” compound by dry weight. More specifically, the term “substantially pure” refers to at least about 95% compound, active compound, or “95% substantially pure” compound by dry weight. Substantially pure cupredoxin or cytochrome c _551, or variant or derivative thereof, may be used in combination with one or more other substantially pure compounds or other isolated cupredoxin or cytochrome.

  The terms “isolated”, “purified” or “biologically pure” are substantially or essentially from components normally associated with a substance when it is found in its natural state. A substance that is in a free state. Thus, an isolated peptide according to the present invention preferably does not normally contain substances associated with the peptide in its in situ environment. An “isolated” region refers to a region that does not include the entire sequence of the polypeptide from which the region was derived. An “isolated” nucleic acid, protein, or respective fragment thereof, is substantially removed from its in vivo environment so that it can be manipulated by one of ordinary skill in the art. For example, without limitation, the protein or protein fragment is obtained in substantially pure quantities, such as, but not limited to, nucleotide sequencing, restriction digests, site-directed mutagenesis, and subcloning into expression vectors for nucleic acid fragments.

  The term “variant”, as used herein with respect to a peptide, refers to an amino acid sequence variant that has an amino acid substituted, deleted, or inserted when compared to the wild-type polypeptide. The variant may be a cleavage of the wild type peptide. Thus, variant peptides may be prepared by manipulation of the gene encoding the polypeptide. Variants may be prepared by changing the basic composition or characteristics of a polypeptide, but do not change at least some of its essential activities. For example, a “mutant” of azurin can be a mutant azurin that retains its ability to inhibit parasitemia in human erythrocytes infected with malaria. In some cases, mutant peptides are synthesized with unnatural amino acids, such as ε- (3,5-dinitrobenzoyl) -Lys residues (Ghadiri & Fernholz, J. Am. Chem. Soc., 112 : 9633-9635 (1990)). In some embodiments, the variant has no more than 20 amino acids substituted, deleted or inserted compared to the wild type peptide. In some embodiments, the variant has no more than 15, 14, 13, 12 or 11 amino acids substituted, deleted or inserted compared to the wild-type peptide. In some embodiments, the variant has no more than 10, 9, 8 or 7 amino acids substituted, deleted or inserted compared to the wild-type peptide. In some embodiments, the variant has 6 or fewer amino acids substituted, deleted or inserted compared to the wild-type peptide. In some embodiments, the variant has no more than 5 or 4 amino acids substituted, deleted or inserted compared to the wild-type peptide. In some embodiments, the variant has no more than 3, 2 or 1 amino acid substitutions, deletions or insertions compared to the wild-type peptide.

The term "amino acid" as used herein refers to any naturally occurring or non-naturally occurring or synthetic amino acid residue, i.e. 1, 2, 3 or more carbon atoms. Means any component comprising at least one carboxyl residue and at least one amino residue, typically linked directly by one (α) carbon atom.
The term “derivative” as used herein with respect to a peptide refers to a peptide derived from the subject peptide. Derivatives include chemical modifications of the peptide such that the peptide still maintains some of its essential activities. For example, a “derivative” of azurin can be a chemically modified azurin that retains the ability to inhibit parasitemia in erythrocytes infected with malaria. Chemical modifications of interest include, but are not limited to, amidation, acetylation, sulfation, polyethylene glycol (PEG) modification, peptide phosphorylation or glycosylation. In addition, a derivative peptide is a fusion of a polypeptide or fragment thereof with a chemical compound, such as, but not limited to, other peptides, drug molecules or other therapeutic or pharmaceutical agents or detectable probes. It may be a fusion.

The term “percent (%) amino acid sequence identity” is defined as the percentage of amino acid residues in a polypeptide that are identical to amino acid residues in a candidate sequence when the two sequences are aligned. To determine% amino acid identity, sequences are aligned and gaps are introduced as necessary to achieve maximum% sequence identity; conservative substitutions are not considered part of sequence identity. Amino acid sequence alignment procedures that determine percent identity are well known to those of skill in the art. Often publicly available computer software such as, for example, BLAST, BLAST2, ALIGN2 or Megalign (DNASTAR) software is used to align the peptide sequences. In certain embodiments, Blastp (available from the National Center for Biotechnology Information, Bethesda MD) is a long complexity filter, expect 10 (word 10), word size 3 (existence 11). And the default parameters of extension 1 are used.
When aligning amino acid sequences, a given amino acid sequence A and a given amino acid sequence B (alternatively, a given amino acid sequence A having a certain% amino acid sequence identity with a given amino acid sequence B can also be referred to. % Amino acid sequence identity with) can be calculated as follows:

% Amino acid sequence identity = X / Y x 100
Where
X is the number of amino acid residues scored as identical matches by alignment of A and B sequence alignment programs or algorithms.

  Y is the total number of amino acid residues of B.

  When the length of amino acid sequence A is not equal to the length of amino acid sequence B, the% amino acid sequence identity of A to B will not be equal to the% amino acid sequence identity of B to A. When comparing longer sequences to shorter sequences, the shorter sequence will be the “B” sequence, unless otherwise noted. For example, when comparing a cleaved peptide to the corresponding wild-type polypeptide, the cleaved peptide will be a “B” sequence.

  “Therapeutically effective amount” refers to the prevention or delay of progression or partial or total alleviation of symptoms present in a particular condition, pathological condition or other condition for which the patient is treated. Is an effective amount. Determination of a therapeutically effective amount is well possible within the ability of those skilled in the art.

Summary The present invention is a mammal infected with red blood cells and body tissues in malaria, inhibit parasitemia of example brain tissue and bone tissue, provides compositions and methods of using the cupredoxin and / or cytochrome.

For some time, cupredoxin, called a hepatite-containing protein, or some bacterial redox proteins from the cytochrome family, called iron-containing proteins, enter mammalian cells, including cancer cells, and induce apoptotic cell death. Or caused growth inhibition through G1 restriction of the cell cycle (Yamada et al., Cell Cycle 3: 752-755 (2004); Yamada et al., Cell Cycle 3: 1182-1187 (2004 )). A single bacterial protein such as cupredoxin azurin or cytochrome c ₅₅₁ synthesized by Pseudomonas aeruginosa can demonstrate its hydrophobicity-based activity. Thus, while wild body (wt) azurin induces apoptosis in mouse J774 cells (Yamada et al., Infection and Immunity 70: 7054-7062 (2002)), mutant M44KM64E azurin is in G1 phase in J774 cells. Cause inhibition of the cell cycle (Yamada et al., PNAS 101: 4770-4775 (2004)). In contrast, wt cytochrome c ₅₅₁ causes cell cycle inhibition at G1 phase in J774 cells, whereas mutant V23DI59E cytochrome c ₅₅₁ induces apoptosis (Hiraoka et al., PNAS 101: 6427-6432 (2004 )).

  The present invention surprisingly revealed that cupredoxins and cytochromes would inhibit in vitro parasitemia in human erythrocytes by Plasmodium (P. falciparum). In particular, cupredoxins azurin and Laz inhibit parasitemia in Plasmodium falciparum by about 50% and about 75%, respectively. See Example 6. Furthermore, rusticyanin and cytochrome c and f inhibited parasitemia by 20-30%. See Example 1. Furthermore, azurin, when conjugated to the Pf MSP1-19 fragment of the Plasmodium falciparum MSP1 surface protein, has a distinct structural homology to the Fab fragment of the G17.12 mouse monoclonal antibody. Became. See Example 2. Regardless of the mode of inhibition, azurin is thought to inhibit parasitemia of P. falciparum by interacting with the MSP1 protein on the surface of the parasite.

  Surprisingly, azurin and Laz were found to bind in vitro to both PfMSP1-19 and PfMSP1-42 P. falciparum surface proteins. In addition, azurin amino acid residues 36-89 are required for binding to PfMSP1-19 and PfMSP1-42. In addition, the H.8 domain of Laz from Neisseria gonorrhoeae was found to increase both the binding of fusion azurin to PfMSP1-19 and the inhibition of parasitemia by Plasmodium falciparum. See Examples 5 and 6.

  Due to the high structural homology between cupredoxins, it is expected that other cupredoxins will have the same antimalarial activity as azurin, rusticyanin or Laz. In some embodiments, the cupredoxin is, but is not limited to, azurin, pseudo-azurin, plastocyanin, auracyanin, Laz or rusticyanin. In certain embodiments, the cupredoxin is Laz, azurin or rusticyanin. In other embodiments, the cupredoxin is derived from a pathogen. In a more particular embodiment, the cupredoxin is azurin. In particular embodiments, azurin is selected from Pseudomonas aeruginosa, Alcaligenes faecalis, Achromobacter xylosoxidans ssp. Denitrificans I, Bordetella bronchiseptica, Methylomonas sp, Neisseria meningitidis Z2491, Neisseria meningitidis Z2491, Pseudomonas fluorescens, Pseudomonas chlororaphis, Xylella idira 5 It is derived from a fungus (Vibrio parahaemolyticus). In the most specific embodiment, azurin is derived from Pseudomonas aeruginosa. In other specific embodiments, the cupredoxin comprises an amino acid sequence that is SEQ ID NO: 1, 2-18, or 21.

The present invention revealed that Pseudomonas aeruginosa cytochrome c ₅₅₁ , human cytochrome c and cyanobacterial cytochrome f would inhibit parasitemia in human erythrocytes infected with malaria. In certain embodiments, the cytochrome is cytochrome c ₅₅₁ , human cytochrome c or cytochrome f from Pseudomonas aeruginosa. In other specific embodiments, the cytochrome comprises an amino acid sequence that is SEQ ID NO: 2, 19, or 20.

Due to the structural homology between cytochrome c, it is expected that other cytochromes will have the same antimalarial fever activity as Pseudomonas aeruginosa cytochrome c ₅₅₁ and human cytochrome c. In some embodiments, the cytochrome is derived from a pathogen. In another specific embodiment, the cytochrome inhibits parasitemia in red blood cells infected with malaria, more specifically human red blood cells. In another specific embodiment, the cytochrome inhibits cell cycle progression in mammalian cancer cells, and more specifically J774 cells.

Compositions of the Invention The present invention provides peptides that are variants, derivatives or structural equivalents of cupredoxin or cytochrome. In some embodiments, the peptide is substantially pure. In other embodiments, the peptide is isolated. In some embodiments, the peptide is a less than full length cupredoxin or cytochrome and retains some functional characteristics of the cupredoxin or cytochrome. In some embodiments, the peptide retains the ability to inhibit parasitemia in erythrocytes infected with malaria, and more specifically retains the ability to inhibit P. falciparum infection in human erythrocytes. In certain embodiments, the cytochrome is Pseudomonas aeruginosa cytochrome c ₅₅₁ , human cytochrome c, or cyanobacterial cytochrome f, and specifically SEQ ID NOs: 2, 19, and 20. In other specific embodiments, the peptide does not elicit an immune response in mammals, and more specifically in humans.

  The present invention also provides a composition comprising at least one peptide that is cupredoxin, cytochrome or a variant, derivative or structural equivalent thereof. The invention also provides a composition comprising at least one peptide that is a cupredoxin or a variant, derivative or structural equivalent thereof. The invention also provides a composition comprising at least one peptide that is cytochrome or a variant, derivative or structural equivalent thereof. In other embodiments, the composition consists primarily of peptides. The present invention also provides a composition comprising at least one peptide in a pharmaceutical composition that is cupredoxin, cytochrome, or a variant, derivative or structural equivalent thereof.

  Due to the high structural homology between cupredoxins, other cupredoxins will have the same antimalarial fever activity as Pseudomonas aeruginosa azurin in inhibiting parasitemia in erythrocytes infected with malaria Is expected. In some embodiments, the cupredoxin is, but is not limited to, azurin, pseudoazurin, plastocyanin, rusticyanin, Laz or auracyanin. In particular embodiments, the cupredoxin may be Pseudomonas aeruginosa, Alcaligenes faecalis, Achromobacter xylosoxidans Ssp. Denitrificans I, Bordetella septic bacteria (Bordet bronchiseptica, Methylomonas sp, Meningococcus Z2491 (Neisseria meningitidis Z2491), Neisseria gonorrhea, Pseudomonas fluorescens, Pseudomonas ylra phas fastidiosa 9a5) or Vibrio parahaemolyticus. In the most specific embodiment, the cupredoxin is azurin from Pseudomonas aeruginosa. In other specific embodiments, the cupredoxin comprises an amino acid sequence that is SEQ ID NO: 1, 3-18, or 22. In another specific embodiment, the cupredoxin is a Laz protein from Neisseria meningitidis or Neisseria gonorrhoeae.

  The present invention provides amino acid sequence variants of cupredoxin or cytochrome that have amino acid substitutions, deletions or insertions compared to the wild-type polypeptide. The mutant of the present invention may be a truncated form of a wild type polypeptide. In some embodiments, the composition comprises a peptide consisting of a region of cupredoxin or cytochrome that is shorter than the full-length wild-type polypeptide. In some embodiments, the composition comprises a peptide consisting of a truncated cupredoxin or cytochrome of about 10 residues or more, about 15 residues or more, or about 20 residues or more. In some embodiments, the composition comprises a peptide consisting of truncated cupredoxins or cytochromes of about 100 residues or less, about 50 residues or less, about 40 residues or less, or about 30 residues or less. In some embodiments, the composition comprises cupredoxin or cytochrome, and more specifically at least about 90% amino acid sequence identity to SEQ ID NO: 1-20 or 22, at least about 95% amino acid sequence Peptides having identity or at least about 99% amino acid sequence identity are included.

In certain embodiments, the cupredoxin variant comprises Pseudomonas aeruginosa azurin residues 36-89. In another embodiment, the cupredoxin variant consists of P. aeruginosa azurin residues 36-89. In other specific embodiments, the variant consists of the equivalent residues of a cupredoxin other than azurin.
It is expected that other cupredoxin variants can be designed to have similar activity to azurin residues 36-89. To do this, the subject cupredoxin amino acid sequence is aligned to the Pseudomonas aeruginosa azurin sequence using BLAST, BLAST2, ALIGN2 or Megalign (DNASTAR). Here, the relevant residues are placed on the Pseudomonas aeruginosa azurin amino acid sequence and equivalent residues are found on the subject cupredoxin sequence, resulting in the identification of the equivalent residue of the cupredoxin.

  Variants also include peptides made with synthetic amino acids that do not occur in nature. For example, non-naturally occurring amino acids may be integrated into the variant peptide to extend or optimize the half-life of the composition in the bloodstream. Such variants include, but are not limited to, D, L-peptide (diastereomers) (Futaki et al., J. Biol. Chem. 276 (8): 5836-40 (2001); Papo et al. al., Cancer Res. 64 (16): 5779-86 (2004); Miller et al, Biochem. Pharmacol. 36 (1): 169-76, (1987)); peptides containing unusual amino acids (Lee et al. , J. Pept. Res. 63 (2): 69-84 (2004)), and insertion of olefin-containing unnatural amino acids by hydrocarbon concatenation (Schafmeister et al., J. Am. Chem. Soc. 122: 5891 -5892 (2000); Walenski et al., Science 305: 1466-1470 (2004)) and peptides containing ε- (3,5-dinitrobenzoyl) -Lys residues.

  In other embodiments, the peptide of the invention is a derivative of cupredoxin or cytochrome. Cupredoxin or cytochrome derivatives are chemical modifications of peptides that still retain some of their essential activities. For example, a “derivative” of azurin can be a chemically modified azurin that retains its ability to inhibit malaria parasitemia in mammalian cells. Chemical modifications of interest include, but are not limited to, amidation, acetylation, sulfation, polyethylene glycol (PEG) modification additions, peptide phosphorylation and glycosylation. In addition, derivative peptides may be cupredoxin or cytochrome fusions, or variants, derivatives or structural equivalents thereof and chemical compounds (eg, other peptides, drug molecules or other therapeutic or pharmaceutical agents or detections). A possible probe). Derivatives of interest include chemical modifications that can extend or optimize the half-life in the bloodstream of the peptides and compositions of the invention. For example, circulating peptides (Monk et al., BioDrugs 19 (4): 261-78, (2005); DeFreest et al., J. Pept. Res. 63 (5): 409-19 (2004)) , N- and C-terminal modifications (Labrie et al., Clin. Invest. Med. 13 (5): 275-8, (1990)), and insertion of olefin-containing unnatural amino acids by hydrocarbon conjugation (Schafmeister et al. al., J. Am. Chem. Soc. 122: 5891-5892 (2000); Walenski et al., Science 305: 1466-1470 (2004)). Some well known to those skilled in the art including, but not limited to: Depending on the method.

  In one embodiment, the cupredoxin or cytochrome, or a variant, derivative, structural equivalent thereof, is fused to the H.8 region of Laz from Neisseria meningitidis or Neisseria gonorrhoeae. An example of such a peptide is the H.8-Paz fusion protein described in Example 4. In certain embodiments, H.8 is fused to the C-terminus of cupredoxin or cytochrome, or a variant, derivative or structural equivalent thereof. In other specific embodiments, the H.8 region is SEQ ID NO: 21 or a variant, derivative or structural equivalent thereof.

  It is anticipated that the peptides of the compositions of the present invention may be one or more cupredoxin or cytochrome mutants, derivatives or structural equivalents. For example, the peptide may be a cleavage of azurin that is PEGylated, resulting in both a variant and a derivative. In one embodiment, the peptides of the present invention are synthesized with α, α-disubstituted unnatural amino acids containing olefin-supported tethers and followed by “joint” of all hydrocarbons by ruthenium-catalyzed olefin transfer. (Scharmeister et al., J. Am. Chem. Soc. 122: 5891-5892 (2000); Walensky et al., Science 305: 1466-1470 (2004)). In addition, peptides that are structural equivalents of azurin may be fused to other peptides, making it possible to create peptides that are both structural equivalents and derivatives. These examples are merely illustrative and do not limit the invention. A cupredoxin or cytochrome variant, derivative or structural equivalent may or may not bind copper.

In other embodiments, the peptide may be a structural equivalent of cupredoxin or cytochrome. Examples of studies that determine significant structural homology between cupredoxins and cytochromes and other proteins include Toth et al. (Developmental Cell 1: 82-92 (2001)).
Specifically, significant structural homology between cupredoxins or cytochromes and their structural equivalents is determined using the VAST algorithm (Gibrat et al., Curr Opin Struct Biol 6: 377-385 ( 1996); .Madej et al., Proteins 23: 356-3690 (1995)). In certain embodiments, the VAST p value from a structural analogue to structural equivalent of cupredoxin or cytochrome is less than about 10 ^−3, less than about 10 ⁻⁵ , or less than about 10 ⁻⁷ . In other embodiments, significant structural homology between cupredoxin or cytochrome and its structural equivalents uses the DALI algorithm (Holm & Sander, J. Mol. Biol. 233: 123-138 (1993)). To be determined. In certain embodiments, the DALI Z score for a paired structural analog is at least about 3.5, at least about 7.0, or at least about 10.0.

In other embodiments, the variant or derivative of the cupredoxin has significant structural homology to the Fab fragment of the G17.12 mouse monoclonal antibody. An example of how this structural similarity can be determined can be found in Example 3. Specifically, significant structural homology between cupredoxin and the Fab fragment of the G17.12 mouse monoclonal antibody can be determined by using the VAST algorithm (Gibrat et al., Id .; Madej et al., id.). In certain embodiments, the VAST p-value from a structural comparison of cupredoxin and Fab fragments of the G17.12 mouse monoclonal antibody is less than about 10 ^−4, less than about 10 ^−5, less than about 10 ⁻⁶ , or about 10 It is less than ^-7 . In other specific embodiments, the VAST score from the structural comparison of the Fab fragment of cupredoxin and G17.12 mouse monoclonal antibody can be about 9 or more, about 10 or more, about 11 or more, or about 12 or more. .
In some embodiments, the variant, derivative or structural equivalent has some functional characteristics of Pseudomonas aeruginosa azurin, Pseudomonas aeruginosa cytochrome c ₅₅₁ , human cytochrome c or cyanobacterial cytochrome f. Yes. In certain embodiments, the peptides of the invention inhibit parasitemia due to malaria in erythrocytes infected with malaria, and more specifically, parasitism due to P. falciparum in human erythrocytes infected with P. falciparum. Inhibits insectemia. The present invention also provides a cupredoxin that retains the ability to inhibit parasitemia in erythrocytes infected with malaria, more specifically, parasitemia due to P. falciparum in human erythrocytes infected with P. falciparum. Cytochrome c ₅₅₁ variants, derivatives and structural equivalents are provided. Inhibition of parasitemia by P. falciparum in human erythrocytes infected with P. falciparum may be determined by the method described in Example 6.

Designed mutants, derivatives and structural equivalents of cupredoxins and cytochromes that retain antimalarial fever activity as it was found that cupredoxins and cytochromes can inhibit parasitemia in erythrocytes infected with malaria can do. Such variants and derivatives can be prepared, for example, by creating a “library” of various variants and derivatives of cupredoxin and cytochrome. Each is then tested for antimalarial activity using one of many methods known in the art (eg, the exemplary method in Example 6). The resulting cupredoxin and cytochrome mutants, derivatives and structural equivalents with antimalarial activity are used in the methods of the invention in place of or in addition to the cupredoxin and cytochrome referred to herein. Expected to be able to. This method of selecting variants and derivatives may be adapted to any of the activities of Pseudomonas aeruginosa azurin, Pseudomonas aeruginosa cytochrome c ₅₅₁ , human cytochrome c or cyanobacterial cytochrome f disclosed herein.

  In other embodiments, the peptides of the invention inhibit intracellular replication of Plasmodium in human erythrocytes. Methods for determining intracellular responses of Plasmodium are well known in the art, and one such method is described in Example 2.

  In some embodiments, the peptides of the present invention bind to PfMSP1-19 and / or PfMSP1-42 P. falciparum surface proteins with relative binding affinity that are statistically larger non-binding control proteins To do. Peptides can be tested for this activity by using surface plasmon resonance analysis as described in Example 5. Other methods of determining whether one protein binds to another are well known in the art and may be used as well.

  In other embodiments, the peptides of the invention bind to ICAM-3 or NCAM with relative binding affinity, which is a statistically larger non-binding control protein. Peptides can be tested for this activity by using surface plasmon resonance analysis as described in Examples 7 and 5. Other methods of determining whether one protein binds to another are well known in the art and may be used as well.

In some specific embodiments, the peptides of the invention induce apoptosis in mammalian cancer cells, more specifically J774 cells. The ability of peptides to induce apoptosis may be observed by the mitsensor ApoAlert ™ confocal microscope, MITOSENSOR ™ APOLERT ™ mitochondrial membrane sensor kit (Clontech Laboratories, Inc., Palo Alto, California, USA ) To measure caspase-8, caspase-9 and caspase-3 activity using the method described in Zou et al. (J. Biol. Chem. 274: 11549-11556 (1999)) For example, APOLERT ™ DNA fragmentation kit (Clontech Laboratories, Inc., Palo Alto, California, USA) is used to detect apoptosis-induced nuclear DNA fragmentation.
In another specific embodiment, the peptides of the invention induce cell growth arrest in mammalian cancer cells, more specifically J774 cells. The arrest of cell proliferation can be determined, for example, by measuring the degree of inhibition of cell cycle progression by the method found in Yamada et al. (PNAS 101: 4770-4775 (2004)). In another specific embodiment, the peptides of the invention inhibit cell cycle progression in mammalian cancer cells, more specifically J774 cells.

Cupredoxins These small kyanite proteins (cupredoxins) are electron transfer proteins (10-20 kDa) that participate in bacterial electron transport chains or have unknown functions. Copper ions are bound exclusively by the protein substrate. Two histidines and one cysteine ligand around copper in a specific distorted triangular plane configuration produce an electron configuration with very unique electronic properties and emits a strong blue color. A number of cupredoxins have been crystallographically characterized in the medium at high resolution.

Cupredoxins generally show low sequence homology but high structural homology (Gough & Clothia, Structure 12: 917-925 (2004); De Rienzo et al., Protein Science 9: 1439-1454 (2000).). For example, the amino acid sequence of azurin has 31% identity with the sequence of auracyanin B, 16.3% identity with the sequence of rusticyanin, 20.3% identity with the sequence of plastocyanin, and 17.3% with the sequence of pseudoazurin. Shows the identity. See Table 1. However, the structural similarity of these proteins is more obvious. The VAST p value for the comparison of the structures of azurin and auracyanin is 10 ^-7.4 , 10 ^-5 for azurin and rustcyanin, 10 ^-5.6 for azurin and plastocyanin, and 10 ^-4.1 for azurin and pseudoazurin. is there.

¹アライメント長：2つの構造物間で重ね合わされたC-α原子の等価対の数、すなわち、どれだけの残基が３D重ね合わせを計算するために使用されるかである。 All cupredoxins have an eight-stranded Greek key β-barrel or β-sandwich fold and have a highly conserved positional structure (De Rienzo et al., Protein Science 9: 1439-1454 (2000). ). Due to the presence of many long-chain fatty residues such as methionine and leucine, significant hydrophobic sites exist around the position of the copper atom in azurin, amicyanine, cyanobacterial plastocyanin, cucumber basic protein, Pseudoazurin and eukaryotic plastocyanin are in a closer range. Hydrophobic sites are also found in areas closer to the position of the stellacyanin and rusticyanin copper atoms, but with different characteristics.

¹ Alignment length: the number of equivalent pairs of C-α atoms superimposed between two structures, ie how many residues are used to calculate the 3D superposition.

² P-VAL: VAST p-value is a measure of similar saliency expressed as an establishment. For example, if the p-value is 0.001, it is 1000-1 for this quality match by pure opportunity. The p-value from VAST is adjusted for the effects of multiple comparisons using the assumption that there are 500 independently unrelated types of domains in the MMDB database. The p-value thus shown is divided by 500 and corresponds to the p-value for the comparison of each pair of domain pairs.

³ score: VAST structural similarity score. This number is related to the number of second structural elements superimposed and the quality of the overlay. A higher VAST score correlates with a higher similarity.

⁴ RMSD: The root mean square superposition residual in angstroms. This number is calculated after the optimal superposition of the two constructs as the square root of the average square distance between equivalent C-α atoms. Note that the RMSD value corresponds to the range of structural alignment, and this size must be taken into account when using RMSD as a measure of overall structural similarity.

⁵ The major sperm protein of C. elegans was found to be an ephrin antagonist in egg maturation (Kuwabara, 2003 “The multifaceted C. elegans major sperm protein: an ephrin signaling antagonist in oocyte maturation” Genes and Development, 17 : 155-161.

Azurin azurin are copper containing proteins of amino acid residues 128 belonging to the family of cupredoxins involved in electron transfer in plants and certain bacteria. Azurins include those from Pseudomonas aeruginosa (PA) (SEQ ID NO: 1), A. xylosoxidans and A. denitrificans (SEQ ID NO: 8) (Murphy et al. al., J. Mol. Biol. 315: 859-871 (2002)). The amino acid sequence identity between azurins varied between 60-90%, and these proteins showed strong structural homology. All azurins have a characteristic β-sandwich that contains a Greek key motif. A single copper atom is always placed in the same region of the protein. In addition, azurin has a substantially neutral hydrophobic site surrounding the copper site.

Plastocyanin Plastocyanin is a soluble protein of cyanobacteria, algae and plants that contains one molecule of copper per molecule and is blue in its oxidized form. These occur in the chloroplast and function as electron carriers. Since the determination of the structure of poplar plastocyanin in 1978, the structure of plastocyanins in algae (Scenedesmus, Enteromorpha, Chlamydomonas) and plants (Spodoptera) has been determined by crystallographic or NMR methods, and the structure of poplar is 1.33 mm. Refined to the resolution. SEQ ID NO: 4 shows the amino acid sequence of plastocyanin derived from Phormidium laminosum, a thermophilic cyanobacteria.

  Despite the sequence diversity between algae and vascular plant plastocyanins (eg, 62% sequence identity between Chlamydomonas and poplar proteins), the three-dimensional structure is preserved (eg between Chlamydomonas and poplar proteins). 0.76 Årms deviation at the Cα position). Structural features include an eight-stranded antiparallel β-barrel, a sharp negative site, and a distorted tetrahedral copper binding site at one end of a flat hydrophobic surface. The copper site is optimized for its electron transfer function, and the negative and hydrophobic sites are thought to be involved in the recognition of physiological response patterns. Chemical modification, cross-linking, and site-directed mutagenesis studies confirmed the importance of negative and hydrophobic sites in binding interactions with cytochrome f, and two functionally significant electrons, including plastocyanin The model of transmission site was confirmed. One putative electron transfer site is relatively short (about 4cm) and is involved in the solvent-exposed copper ligand His-87 in the hydrophobic site, while the other is longer (about 12-15cm) and is almost conserved in the negative site. Redinbo et al., J. Bioenerg. Biomembr. 26: 49-66 (1994) involved in residue Tyr-83.

Rusticyanin rusticyanin is Thiobacillus (Thiobacillus) blue copper containing single-chain polypeptides obtained from (reeds di Ji Oba Shirasu (Acidithiobacillus) also called). The X-ray crystal structure of the oxidized form of the highly stable and highly oxidizing cupredoxin rusticyanin from Thiobacillus ferrooxidans (SEQ ID NO: 5) was determined by multi-wavelength anomalous diffraction, 1.9 Refined to high resolution. Rustocyanin is composed of a nuclear β sandwich folded structure composed of 6- and 7-stranded β-sheets. Like other cupredoxins, copper ions are coordinated by a mass of four conserved residues (His85, Cys138, His143, Met148) aligned in a distorted tetrahedron, Walter, RL et al., J. Mol. Biol., Vol. 263, pp-730-51 (1996).

Pseudoazurin Pseudoazurin is a family of kyanite-containing single chain polypeptides. The amino acid sequence of pseudoazurin obtained from Achromobacter cycloclastes is shown in SEQ ID NO: 6. X-ray structural analysis of pseudoazurin shows that it has a similar structure to azurin despite the low sequence homology between these proteins. Two major differences exist between the overall structure of pseudoazurin and azurin. There is a carboxy-terminal extension in pseudoazurin compared to azurin, which consists of two α helices. In the central peptide region, azurin contains a shortened extended loop in pseudo-azurin and forms a flap containing a short α-helix. The only major difference at the atomic site of copper is the structure of the MET side chain and the Met-S copper bond length. These are significantly shorter in pseudoazurin than azurin.

Phytocyanin
Proteins that can be identified as phytocyanin include, but are not limited to, cucumber basic protein, stellacyanin, mavicyanin, umecyanin, cucumber peeled cupredoxin, putative cyanide protein of pea sheath, And kyanite protein from Arabidopsis thaliana. In all but the cucumber basic protein and pea sheath protein, the axial methionine ligand normally found at the chalcopyrite site is replaced by glutamine.

Auracyanin
Auracyanin A, auracyanin B-1 and auracyanin B-2, designated by three small cyanobium proteins, were isolated from the thermophilic green gliding photosynthetic bacterium Chloroflexus aurantiacus. The two Bs are glycoproteins that have almost identical properties to each other but differ from the A form. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis demonstrates monomer molecular weights apparent as 14 (A), 18 (B-2) and 22 (B-1) kDa.

  The amino acid sequence of auracyanin A is a 139-residue polypeptide, auracyanin A (Van Dreissche et al., Protein Science 8: 947-957 (1999).) His58, Cys123, His128, and Met132 are known. Of the small copper proteins plastocyanin and azurin, which are evolutionarily conserved metal ligands, are spaced in the expected manner. The second structural prediction also shows that auracyanin has a general β-barrel structure similar to that of azurin from Pseudomonas aeruginosa and plastocyanin from poplar leaves. However, auracyanin appears to have the sequence characteristics of both small copper protein sequence classes. The overall similarity to the azurin consensus sequence is approximately the same as that of the plastocyanin consensus sequence. The auracyanin N-terminal sequence region 1-18 is significantly rich in glycine and hydroxy amino acids. See SEQ ID NO: 16, which is a typical amino acid sequence for the A chain of auracyanin from Chloroflexus aurantiacus (NCBI Protein Data Bank Accession No. AAM12874).

  The auracyanin B molecule has a standard cupredoxin folding structure. The crystal structure of auracyanin B from Chloroflexus aurantiacus was studied (Bond et al., J. Mol. Biol. 306: 47-67 (2001)). With the exception of an additional N-terminal chain, the molecule is very similar to that of the bacterial cupredoxin, azurin. In other cupredoxins, one of the Cu ligands is present on polypeptide chain 4 and the other three are along a large loop between chains 7 and 8. The geometry of the Cu site is discussed in relation to the amino acid spacing between the latter three ligands. The crystallographically characterized Cu-binding domain of auracyanin B is located on the periplasmic side of the cytoplasmic membrane by an N-terminal tail that exhibits significant sequence identity with known tethers in several other membrane-related electron transfer proteins. Probably tied together. The amino acid sequence of the B form is shown in McManus et al. (J. Biol Chem. 267: 6531-6540 (1992)). See SEQ ID NO: 17, which is a typical amino acid sequence for chain B of auracyanin from Chloroflexus aurantiacus (NCBI Protein Data Bank Accession No. 1QHQA).

Stellacyanin stellacyanin is, phytocyanins subclass, a family of ubiquitous plant cupredoxin. An exemplary sequence of stellacyanin is included herein as SEQ ID NO: 15. From horseradish roots (Koch et al., J. Am. Chem. Soc. 127: 158-166 (2005)) and cucumber terracyanin (Hart el al., Protein Science 5: 2175-2183 (1996)) Crystal structure of umecyanin and stellacyanin. The protein has an overall folded structure similar to other photocyanines. The ephrin B2 protein ectodomain tertiary structure has significant similarity to stellacyanin (Toth et al., Developmental Cell 1: 83-92 (2001).). A typical amino acid sequence of stellacyanin is found in accession number 1 JER, SEQ ID NO: 15 of the National Center for Biotechnology Information Protein Data Bank.

Cucumber Basic Protein A typical amino acid sequence derived from cucumber basic protein is included herein as SEQ ID NO: 18. The crystal structure of cucumber basic protein (CBP) and type 1 kyanite protein has been refined with a resolution of 1.8 mm. The molecule is similar to other kyanite proteins with a Greek key β-barrel structure. The barrel is open on one side and is well described as “beta-sandwich” or “beta-octopus” (Guss et al., J. Mol. Biol. 262: 686-705 (1996)). The ephrin B2 protein ectodomain tertiary structure has a high similarity (rms deviation 1.5Å for 50α carbon) with cucumber basic protein (Toth et al., Developmental Cell 1: 83-92 (2001).).

  Cu atoms are normal indigo with bond length Cu-N (His39) = 1.93 A, Cu-S (Cys79) = 2.16 A, Cu-N (His84) = 1.95 A, Cu-S (Met89) = 2.61 A Has copper ore NNSS 'coordination. The disulfide bond, (Cys52) -S-S- (Cys85), appears to play an important role in stabilizing the molecular structure. The folded structure of the polypeptide is typical of a subfamily of hematite proteins (phytocyanins), as well as non-metalloproteins (Ragweed allergen Ra3) where CBP has a high degree of sequence identity. Proteins currently identifiable as phytocyanin are CBP, stellalacyanin, mavicyanin, umecyanin, cucumber peeled cupredoxin, putative cyanobium protein in pea sheath, and cyanobium protein from Arabidopsis thaliana is there. In all but CBP and pea sheath proteins, the axial methionine ligand normally found at the chalcopyrite site is replaced by glutamine. A typical sequence for a cucumber basic protein is found in NCBI Protein Data Bank accession number 2 CBP, SEQ ID NO: 18.

Cytochrome cytochrome c ₅₅₁
Cytochrome c ₅₅₁ from Pseudomonas aeruginosa (Pa-C551) is a monomeric redox of 82 amino acid residues (SEQ ID NO: 2) involved in catabolic denitrification as a physiological electron donor of nitrite reductase It is a protein. The functional properties of Pa-C551 have been extensively investigated. Reactions with non-physiological small inorganic redox reactants and other macromolecules such as hematite proteins, eukaryotic cytochrome c and the physiological partner nitrite reductase are responsible for protein-protein electron transfer A test was provided.

  The three-dimensional structure of Pa-C551, a member of bacterial class I cytochromes, is a single low-spin heme containing His-Met ligation and a poly, which leaves the edges of the typical, but exposed, heme pyrrole rings II and III. Peptide folding is shown (Cutruzzola et al., J. Inorgan. Chem. 88: 353-61 (2002)). Deletion of the 20 residue omega loop present in mammalian class I cytochromes causes further exposure of the heme edge of propionate level 13. The distribution of charged residues on the surface of Pa-C551 shows strong anisotropy: on the one hand rich in acidic residues and on the other hand positive side chains located at the boundary of the hydrophobic patch surrounding the heme gap The ring is shown. This patch contains residues Gly11, Val13, Ala14, Met22, Val23, Pro58, Ile59, Pro60, Pro62, Pro63 and Ala65. The anisotropic charge distribution leads to a large bipolar moment that is important for the electron transport composite morphology.

  The charge distribution described above for Pa-C551 has been reported for other electron transfer proteins and their electron acceptors. Furthermore, site-specific mutagenesis modifications of residues within hydrophobic or charged patches have shown the importance of surface complementarity for binding and electron transfer for different proteins. As an example, evidence for the relevance of the hydrophobic patch to the electron transport properties of azurin from Pseudomonas aeruginosa is also from studies conducted on mutants of residues Met44 and Met64 that were changed to positively and negatively charged amino acids. I was drowned.

The cytochrome c-type domain has a folded structure consisting of a series of α-helices and reverse turns that help wrap the covalently bound heme within the hydrophobic pocket. This domain, cytochrome c protein single domain, can be found, for example, cytochrome c6, cytochrome c _552, in cytochrome c ₄₅₉ and mitochondrial cytochrome c. Cytochrome c-type domains are a number of other proteins, such as cytochrome cd1-nitrite reductase as the N-terminal heme c domain, quinoprotein alcohol dehydrogenase as the C-terminal domain, and quinohemoprotein amine dehydrogenase A as domains 1 and 2. It is present in the cytochrome bc ₁ complex in the chain as well as as the cytochrome bc ₁ domain. Structural analysis with the VAST algorithm (cytochrome c ₅₅₁ from Pseudomonas aeruginosa as a reference) showed significant structural proximity (P value between 10 ^{-10.3 and} 10 ^-4.5 ) only for cytochrome.

Methods of Use The present invention provides methods for treating patients at risk of acquiring or acquiring malaria fever or for inhibiting the spread of malaria parasites. These methods include administering to a patient or vector insect a cupredoxin or cytochrome that inhibits parasitemia in malaria-infected mammalian cells, or a variant, derivative or structural equivalent thereof. Inhibition of parasitemia can be determined by a number of methods well known to those skilled in the art. One method is described in Example 6 and determines inhibition of parasitemia in human erythrocytes infected with malaria. In other embodiments, cupredoxin or cytochrome, or a variant, derivative or structural equivalent thereof, inhibits the intracellular response of Plasmodium in human erythrocytes, and they are administered to a patient or vector insect. Methods for determining the intracellular response of Plasmodium are well known in the art, and one such method is described in Example 2. Aspects of the invention are not limited to any particular mechanism, and inhibition of parasitemia includes, but is not limited to, inhibition of parasite replication in infected erythrocytes, parasitism infecting uninfected erythrocytes. It provides many aspects, including inhibition of organisms, inhibition of parasite growth cycles, and inhibition of parasite entry into mammalian cells.

  The present invention also provides a method of treating patients suffering from infection with Plasmodium by administering an effective amount of at least one protein that is cupredoxin or cytochrome, or a variant, derivative or structural equivalent thereof. To do. Subjects that can be treated by this method are all mammals that can be infected by Plasmodium, and specifically human patients. Known malaria parasites that infect mammals include, but are not limited to, Plasmodium falciparum, Plasmodium falciparum (P. vivax), P. berghei (Rodentia-specific), P. yoelli (mouse-specific), P. cynomolgi and P. knowlesi (monkey-specific) are included.

Cupredoxin and cytochrome c ₅₅₁ are also effective against HIV-1 infection, as disclosed in co-filed applications. That application is “Compositions and Methods for Treating HIV Infection with Cupredoxin and Cytochrome c”, US Provisional Patent Application Number (), the disclosure of which is expressly incorporated herein by reference. In addition, HIV and malaria co-infection is very common in many parts of the world, especially in sub-Saharan Africa. In some embodiments, patients suffering from infection with Plasmodium also suffer from infection with HIV. In some embodiments, the methods of treatment of the present invention also include administering an anti-HIV agent. In some embodiments, the anti-HIV agent is also co-administered.

  The present invention also treats patients suspected of contacting malaria parasites by administering an effective amount of at least one peptide that is a cupredoxin and / or cytochrome, or a variant, derivative or structural equivalent of cupredoxin or cytochrome. Provide a way to do it. For example, if a patient resides or travels in a region of the world where malaria infection of other of the patient's species is common, the patient is suspected of having contact with the malaria parasite. Treatment with this method is recommended when the patient is about to contact or has already been in contact with the malaria parasite. Contact with malaria parasites is often caused by contact with vector insects such as mosquitoes. As a result, the areas where these insects and malaria parasites occur in large numbers are considered to be in areas where patients are likely to come into contact with malaria parasites. Such regions of the world include, but are not limited to, parts of Africa, Asia and Latin America. In addition, if a patient comes into contact with blood infected with Plasmodium, is intentionally exposed to Plasmodium, or is accidentally infused with parasite-contaminated blood or drugs, contact with Plasmodium Can be suspected.

  Cupredoxin or cytochrome, or a variant, derivative or structural equivalent of cupredoxin or cytochrome can be administered to a patient by many routes and many therapies well known to those skilled in the art. In certain embodiments, the cupredoxin or cytochrome, or the variant, derivative or structural equivalent of cupredoxin or cytochrome is orally, topically, inhaled, infused, more specifically intravenous, intramuscular or subcutaneous. Be administered within.

  In one embodiment, the method comprises a unit dosage composition comprising cupredoxin or cytochrome, or a variant, derivative or structural equivalent thereof, and a composition comprising an antimalarial fever agent and / or an anti-HIV agent. Co-administering a unit dose of the composition to the patient. These compositions may be administered at about the same time or within a predetermined time after other administrations, for example from about 1 minute to about 60 minutes, or from about 1 hour to about 12 hours.

  The invention also provides at least one of cupredoxin or cytochrome, or a variant, derivative or structural equivalent of cupredoxin or cytochrome, in an amount effective to reduce the infectivity of parasites in a co-existing mammalian population. Is provided to a vector insect in the population to inhibit the spread of the malaria parasite in a vector insect population with a malaria parasite. In a particular embodiment, the vector insect is a mosquito, more specifically an Anopheles gambiae. In this method, administration of cupredoxin or cytochrome, or a variant, derivative or structural equivalent of cupredoxin or cytochrome can be accomplished by placing the peptide in a composition that will be consumed by the vector insect. However, any method of contacting a peptide with a malaria parasite in the gut of a vector insect is contemplated. Many methods for administering chemicals to insect populations that cause such consumption are known in the art.

In other embodiments, a transmissible genetic element transmitted from one mosquito to another will be operably linked to a sequence encoding a cupredoxin operably connected to a constitutive promoter. Cupredoxin or cytochrome, or a variant, derivative or structural equivalent of cupredoxin or cytochrome will be produced inside an anopheles infected with Plasmodium falciparum and will interfere with replication / survival in mosquitoes.
Other approaches to administration of peptides to vector insects include, but are not limited to, cupredoxin or cytochrome, or variants, derivatives or structural equivalents of cupredoxin or cytochrome genes derived from other proteins normally consumed by insects Fusing with other genes. The amount of peptide administered to the vector insect should be an amount effective to reduce the infectivity of the Plasmodium in the mammal when the vector insect comes into contact with the mammal. In certain embodiments, the dosage should be an amount effective to reduce the infectivity of the Plasmodium parasite when the vector insect comes into contact with a human.

  Mosquito larvae are suitable for use in the present invention, and preferably the promoter used is a strong promoter. Two alternative categories of promoters are available for use: inducible promoters and constitutive promoters. Inducible promoters include, for example, heat shock promoters. Preferably, the heat shock promoter is an insect heat shock promoter, such as the Drosophila hsp70 promoter. This can induce the expression of genes in heterologous species including medfly. The present invention also includes the use of the fruit fly hsp70 promoter (Papadimitriou et al., Insect Mol Biol 7: 279-90 (1998)). An alternative system may be based on induction with the antibiotic tetracycline (Heinrich and Scott, PNAS 97: 8229-8232, (2000)).

  The heat shock promoter is induced by increasing the temperature of the conditions in which the fruit fly is cultured. For example, at 23-25 ° C., the hsp70 promoter is active at low levels or not at all. This allows insect larvae to grow without stress induced by the production of heterologous proteins. At higher temperatures, however, for example at 37-42 ° C., the hsp70 promoter is induced and expresses heterologous proteins at high levels.

Inducible promoters may be constructed based on known inducible gene control elements. For example, inducible promoters may be constructed by combining response elements to drugs or hormones that may be administered in the diet. In a preferred embodiment, the human estrogen responsive element (ERE) may be used to control the expression of the protein of interest as long as the insect is transformed with a second coding sequence that expresses the human estrogen receptor. Good.
A constitutive promoter may also be used to express proteins and / or other proteins required in insect larvae. For example, the constitutive promoter may be a cytoplasmic actin promoter. The Drosophila melanogaster cytoplasmic actin promoter has been cloned (Act5C) and is highly active inside mosquitoes (Huynh and Zieler, J. Mol. Biol. 288: 13-20 (1999)). Cytoplasmic actin genes and their promoters may also be isolated from other insects including the fruit fly. Other examples include cytoplasmic tubulin promoters, such as the fruit fly cytoplasmic tubulin promoter.

  A promoter that controls the secreted polypeptide can optionally be used in conjunction with a suitable signal sequence for direct secretion of the protein into the hemolymph. For example, the larval serum protein promoter may be used (Benes et al., Mol. Gen. Genet 249 (5): 545-556 (1995)).

  Mass rearing technology for mosquitoes is highly developed. For protein production, larval cultures initiated at different times can be synchronized by appropriate temperature shift measures. This is possible because the growth rate depends on the temperature of the environment; the growth rate of larvae at 18 ° C. is reduced to approximately 50%.

Pharmaceutical compositions comprising cupredoxins and / or cytochromes and variants and derivatives thereof Pharmaceutical compositions comprising cupredoxins or cytochromes, or variants, derivatives or structural equivalents thereof can be prepared using any conventional method, e.g., conventional It can be produced by a mixing, dissolving, granulating, dragee, emulsifying, encapsulating, entrapping, or lyophilizing process. Substantially pure cupredoxin and / or cytochrome and variants, derivatives and structural equivalents thereof can be readily combined with pharmaceutically acceptable carriers well known to those skilled in the art. Such carriers allow formulations to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like. Suitable carriers or excipients can also include, for example, fillers and cellulose formulations. Other excipients can include, for example, perfume additives, colorants, anti-tacking agents, thickeners, and other acceptable additives, adjuvants, or binders. In some embodiments, the pharmaceutical formulation is substantially free of preservatives. In other embodiments, the pharmaceutical formulation comprises at least one preservative. General methodologies for pharmaceutical dosage forms are found in Ansel et al., Pharmaceutical Dosage Forms and Drug Delivery Systems (Lippencott Williams & Wilkins, Baltimore MD (1999)).

  Compositions comprising cupredoxin or cytochrome, or variants, derivatives or structural equivalents thereof can be injected (e.g., intradermal, subcutaneous, intramuscular, intraperitoneal), inhalation, topical administration, suppositories, transdermal patches. It can be administered in a variety of ways including the use of fabric or orally. General information about drug delivery systems can be found in Ansel et al., Id. In some embodiments, the composition comprising cupredoxin or cytochrome, or a variant, derivative or structural equivalent thereof, is formulated and used directly as an infusion for, inter alia, subcutaneous and intravenous injection. Can do. Injectable formulations can be used advantageously to treat patients at risk of malaria infection, expected to be infected with malaria, or infected with malaria. Alternatively, a composition comprising cupredoxin or cytochrome, or variants, derivatives or structural equivalents thereof can be taken orally after mixing with a protective agent such as polypropylene glycol or similar coating agents.

  When administration is by injection, cupredoxin or cytochrome, or a variant, derivative or structural equivalent thereof, in an aqueous solution, specifically a physiologically compatible buffer such as Hanks's solution, Ringer's solution, or physiological Formulated in a normal saline buffer. The solution may contain formulation agents such as suspensions, stabilizers and / or dispersants. Alternatively, cupredoxin or cytochrome, or variants, derivatives, structural equivalents thereof, may be present in powder form for a composition comprising a suitable vehicle, such as sterile pyrogen-free water, prior to use. In some embodiments, the pharmaceutical composition does not include an adjuvant or any other substance added to enhance the immune response stimulated by the peptide. In some embodiments, the pharmaceutical composition comprises a substance that inhibits an immune response to the peptide.

  When administration is by intravenous infusion, the intravenous infusion for use to administer cupredoxin or cytochrome, or variants, derivatives, structural equivalents thereof, may also be composed of crystalline or colloid. Crystalline as used herein is an aqueous solution of mineral salts or other water-soluble molecules. Colloids used herein include larger insoluble molecules such as gelatin. Intravenous fluids may be sterile.

Crystalline liquids that can be used for intravenous administration include, but are not limited to, normal saline (0.9% sodium chloride solution), Ringer's lactate or Ringer, as described in Table 2. Solutions and 5% dextrose solution in water, also called D5W.

  When administration is by inhalation, cupredoxin or cytochrome, or mutants, derivatives, structural equivalents thereof, use the appropriate propellant, such as dichlorodifluoromethane, trichlorofluoromethane, carbon dioxide, other appropriate gases. It may be delivered in the form of an aerosol spray from a pressurized pack or nebulizer containing. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve that delivers a measured amount. For example, gelatin capsules and cartridges are formulated to contain a protein powder mixture and a suitable powder base, such as lactose or starch, for use in an inhaler or aerator.

  When administration is by local administration, cupredoxin or cytochrome, or variants, derivatives, structural equivalents thereof, should be formulated as aqueous solutions, gels, ointments, creams, suspensions, etc., as is well known to those skilled in the art. Can do. In some embodiments, administration is by transdermal patch. When administration is by suppository (eg, rectum or vagina), compositions of cupredoxin and / or cytochrome c and variants and derivatives thereof can also be formulated in compositions containing conventional suppository bases.

  When administered orally, cupredoxin or cytochrome, or variants, derivatives, structural equivalents thereof, can be readily formulated by combining with pharmaceutically acceptable carriers well known to those skilled in the art. Solid carriers such as mannitol, lactose, magnesium stearate and the like may be used and such carriers may be used for ingestion of cupredoxins and / or cytochromes, and variants and derivatives thereof by the patient being treated. And can be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like. For oral solid formulations such as powders, capsules and tablets, suitable excipients include fillers such as sugars, cellulose preparations, granules, and binders.

  Other convenient carriers well known to those skilled in the art also include multivalent carriers such as bacterial capsular polysaccharides, dextrans or genetically engineered vectors. In addition, sustained release formulations containing cupredoxin or cytochrome, or variants, derivatives, structural equivalents thereof, release cupredoxin or cytochrome, or variants, derivatives, structural equivalents thereof over an extended period of time. Enable. In the absence of a sustained release formulation, cupredoxin or cytochrome, or variants, derivatives, structural equivalents thereof, are removed from the patient's body prior to inducing or enhancing a therapeutic effect and / or, for example It is degraded by proteases and simple hydrolysis.

  The half-life in the bloodstream of the compositions of the present invention can be determined in several ways well known to those skilled in the art, such as, but not limited to, circulating peptides (Monk et al., BioDrugs 19 (4): 261-78, ( DeFreest et al., J. Pept. Res. 63 (5): 409-19 (2004)), D, L-peptide (diastereomers), (Futaki et al., J. Biol. Chem. Feb 23; 276 (8): 5836-40 (2001); Papo et al., Cancer Res. 64 (16): 5779-86 (2004); Miller et al., Biochem. Pharmacol. 36 (1): 169 -76, (1987)); peptide-containing special amino acids (Lee et al., J. Pept. Res. 63 (2): 69-84 (2004)), N- and C-terminal modifications (Labrie et al. , Clin. Invest. Med. 13 (5): 275-8, (1990)), and concatenation with hydrocarbons (Schafmeister et al., J. Am. Chem. Soc. 122: 5891-5892 (2000); Walenski et al., Science 305: 1466-1470 (2004)) can be extended or optimized. Of particular interest are d-isomerization (substitution) and modification of peptide stability via D-substitution or L-amino acid substitution and linking with hydrocarbons.

  In various embodiments, the pharmaceutical composition includes carriers and excipients (buffers, carbohydrates, mannitol, proteins, polypeptides or amino acids such as glycine, antioxidants, bacteriostats, chelating agents, suspending agents. , Including, but not limited to, thickeners and / or preservatives), water, oils, saline solutions, aqueous dextrose and glycerol solutions, and other pharmaceutically acceptable as required for appropriate physiological conditions Auxiliary substances such as buffering agents, tonicity adjusting agents, wetting agents and the like are included. It will be appreciated that while any suitable carrier known to those skilled in the art is used to administer the composition of the invention, the type of carrier will vary depending on the mode of administration. The compound will be encapsulated within the liposome using well known techniques. Biodegradable microspheres can also be used as carriers for the pharmaceutical compositions of the present invention. Suitable biodegradable microspheres are disclosed, for example, in US Pat. Nos. 4,897,268; 5,075,109; 5,928,647; 5,811,128; 5,820,883; 5,853,763; 5,814,344 and 5,942,252.

  The pharmaceutical composition may be sterilized by conventional, well-known sterilization techniques, or may be sterile filtered. The resulting aqueous solution is packaged for use or the lyophilized formulation is combined with a sterile solution prior to administration.

Administration of cupredoxin and / or cytochrome and variants and derivatives thereof Cupredoxin or cytochrome, or a variant, derivative, structural equivalent thereof can be formulated and administered as a pharmaceutical composition, and any suitable route E.g. oral, buccal, inhalation, sublingual gland, rectum, vagina, transurethral, nasal, topical, percutaneous, i.e. transdermal, parenteral (intravenous, intramuscular (Including subcutaneous and intracoronary) routes. These pharmaceutical formulations can be administered in any effective amount to achieve their intended purpose. More specifically, the composition is administered in a therapeutically effective amount. In certain embodiments, the therapeutically effective amount is generally about 0.01-20 mg / day / kg body weight.

Compounds comprising cupredoxin or cytochrome, or variants, derivatives, structural equivalents thereof, are useful for the therapeutic and / or prophylactic treatment of malaria infection, alone or in combination with other active agents. The appropriate dosage will of course depend on, for example, the cupredoxin or cytochrome used, or a variant, derivative, structural equivalent compound, host, mode of administration and the nature and severity of the condition being treated. Will change. However, in general, satisfactory results in humans have been shown to be obtained with daily administration of about 0.01-20 mg / kg body weight. Daily dosages shown in humans are, for example, from about 0.7 mg to about 1400 mg of cupredoxin or cytochrome c ₅₅₁ , or these conveniently administered in daily, weekly, monthly, and / or continuous administration, or these Are within the scope of the mutant, derivative or structural equivalent compounds. Daily administration can be 1 to 12 times / day of dispersed administration. Alternatively, it can be administered every other day, every third day, every fourth day, every fifth day, every six days, every week, and similarly every other day up to 31 days. Alternatively, it can be administered continuously using patches, intravenous administration, and the like.

  Methods of introducing cupredoxin or cytochrome, or variants, derivatives, structural equivalents thereof to a patient, in some embodiments, include cupredoxin or cytochrome, or variants, derivatives, structural equivalents, and malaria. This is done through co-administration with other drugs used for therapy. Such methods are well known in the art. In certain embodiments, cupredoxin and / or cytochrome c are part of a cocktail or co-administered with other malaria therapeutics. Antimalarial drugs of interest include, but are not limited to, proguanyl, chlorproguanil, trimethoprim, chloroquine, mefloquine, lumefantrin, atovaquone, pyrimethamine-sulfadoxine, pyrimethamine-dapsone, halophanthrin, quinine, quinidine , Amodiaquine, amopyroquine, sulfonamide, artemisinin, arteflene, artemether, artesunate, primaquine, pyronalidine, proguanil, chloroquine, mefloquine, pyrimethamine-sulfadoxine, pyrimethamine-daptone, halophanthrin, quinine, proguanil, chloroquine, Mefloquine, 1,16-hexadecamethylenebis (N-methylpyrrolidinium) dibromide, and combinations thereof are included.

Methods for introducing cupredoxin or cytochrome c ₅₅₁ , or variants, derivatives, structural equivalents thereof into a patient, in some embodiments, are currently used to introduce anti-HIV agents, such as protease inhibitor-containing cocktails. Same as the method used. Such methods are well known to those skilled in the art. In certain embodiments, cupredoxin or cytochrome c ₅₅₁ , or variants, derivatives, structural equivalents thereof, are co-administered with a portion of a cocktail or anti-HIV therapeutic agent. Anti-HIV drugs also include, but are not limited to, reverse transcriptase inhibitors: AZT (zidovudine [Retrovir]), ddC (zarcitabine [Hivid], dideoxyinosine), d4T (stavudine [Zerit]), and 3TC (lamivudine) [Epivir]), non-nucleoside reverse transcriptase inhibitors (NNRTIS): delavirdine (Rescriptor) and nevirapine (Viramune), protease inhibitors: ritonavir (Norvir), combination of lopinavir and ritonavir (Kaletra), saquinavir (Invirase), indinavir Sulfates (Crixivan), Amprenavir (Agenerase), and Nelfinavir (Viracept) are included. In some embodiments, a combination of several drugs called anti-active antiretroviral therapy (HAART) is used to treat the patient.

  The exact prescription, route of administration and dosing will be determined by attending a physician in view of the patient's condition. Dosage amount and interval can be adjusted individually to provide plasma levels of active cupredoxin or cytochrome that are sufficient to maintain therapeutic effect, or variants, derivatives or structural equivalents thereof. . In general, the desired cupredoxin or cytochrome, or variants, derivatives, structural equivalents thereof, are administered in admixture with the intended route of administration and a pharmaceutical carrier selected for standard pharmaceutical practice. The

  In one aspect, cupredoxin or cytochrome, or variants, derivatives, structural equivalents thereof, are delivered as DNA such that the polypeptide is generated in situ. In one embodiment, the DNA is `` naked '' as described, for example, in Ulmer et al., (Science 259: 1745-1749 (1993)) and reviewed by Cohen (Science 259: 1691-1692 (1993)). " Naked DNA uptake may be increased by coating the DNA onto a carrier (eg, biodegradable beads that are effectively transported into the cell after degradation). In such methods, the DNA may be present in any of a variety of delivery systems known to those skilled in the art, including nucleic acid expression systems, bacterial and viral expression systems. Techniques for inserting DNA into such expression systems are well known to those skilled in the art. See, for example, WO90 / 11092, WO93 / 24640, WO 93/17706, and US Pat. No. 5,736,524.

  Vectors used to transfer genetic material from organism to organism can be divided into two general categories: cloning vectors are essential for propagation in suitable host cells into which foreign DNA can be inserted. The plasmid or phage is replicated in a region that is The foreign DNA replicates and propagates as if it were a component of the vector. An expression vector (eg, plasmid, yeast, or animal viral genome) is used to introduce foreign genetic material into a host cell or tissue in order to transcribe and translate foreign DNA (eg, cupredoxin and / or cytochrome DNA). Used for. In an expression vector, the introduced DNA is operably linked to an element (eg, a promoter that signals the host cell to highly transcribe the inserted DNA). Some promoters are exceptionally useful, for example inducible promoters that control the genetic product in response to specific factors. Polynucleotides of cupredoxin or cytochrome and their variants and derivatives that function in an inducible promoter so that they can be expressed can control cupredoxin or cytochrome and their variants and derivatives depending on the specific factors. Examples of classical inducible promoters include those that are responsive to α-interferon, heat shock, heavy metal ions, and steroids such as glucocorticoids (Kaufman, Methods Enzymol. 185: 487-511 (1990)) and tetracycline Is included. Other desirable inducible promoters include those that are not endogenous to the cell into which the construct is introduced, however, are responsive in those cells to which the inducer is supplied exogenously. In general, useful expression vectors are often plasmids. However, other forms of expression vectors, such as viral vectors (eg, replication defective retroviruses, adenoviruses and adeno-associated viruses) are contemplated.

The choice of vector is dictated by the organism or cell used and the desired outcome of the vector. In general, a vector includes a signal sequence, an origin of replication, a marker gene, a polylinker site, an enhancer element, a promoter, and a transcription termination sequence. As an example, one clones a cupredoxin or cytochrome gene into a vector that can be delivered in a mosquito, the home of malaria parasites, to prevent the parasite from replicating inside the mosquito. The deliverability of the vector will also allow the spread of cupredoxin / cytochrome to other surrounding mosquitoes that also infect malaria parasites.
The exact formulation, route of administration and dosage will be determined by the attending physician in view of the patient's condition. The dose and its interval are individually set to provide active cupredoxin and / or plasma values of cytochrome and their variants and derivatives sufficient to treat the patient and maintain a therapeutic effect. Can be adjusted. In general, the desired cupredoxin and / or cytochrome, and variants and derivatives thereof may be administered in admixture with a pharmaceutical carrier selected according to the intended route of administration and standard pharmaceutical practice. it can. The pharmaceutical composition used in accordance with the present invention comprises excipients and adjuvants that facilitate the process of cupredoxins and / or cytochromes and their variants and derivatives into formulations that can be used therapeutically, cupredoxins And / or can be formulated in conventional manner using one or more physiologically acceptable carriers comprising an active agent that inhibits or stimulates secretion of cytochromes and their variants and derivatives, or mixtures thereof.

In one aspect of a kit comprising cupredoxin and / or cytochrome C and variants and derivatives thereof , the present invention provides a kit comprising one or more of the following in a package or container: (1) cupredoxin or cytochrome, or A biologically active composition comprising these variants, derivatives or structural equivalents; (2) a pharmaceutically acceptable adjuvant or excipient; (3) a vehicle for administration such as a syringe; ) Instructions for administration. Embodiments in which two or more components (1) to (4) are found in the same container are also contemplated.

  In another aspect, the present invention provides a kit comprising one or more of the following in a package or container: (1) Biology comprising cupredoxin or cytochrome, or variants, derivatives or structural equivalents thereof Active composition; (2) antimalarial agent, including but not limited to proguanil, chlorproguanil, trimethoprim, chloroquine, mefloquine, lumefantrin, atovaquone, pyrimethamine-sulfadoxine, pyrimethamine-dapson, halophanthrin Quinine, quinidine, amodiaquine, amopyroquine, sulfonamide, artemisinin, arteflene, artemether, artesunate, primaquine, pyronalidine, proguanil, chloroquine, mefloquine, pyrimethamine-sulfadoxine, pyrimethamine-dap Son, halofantrine, quinine, proguanil, chloroquine, mefloquine, 1,16-hexadecamethylenebis (N-methylpyrrolidinium) dibromide; (3) a pharmaceutically acceptable adjuvant or excipient; ) Medium for administration such as a syringe; (5) Instructions for administration. Embodiments in which two or more components (1) to (5) are found in the same package or container are also contemplated.

  In some embodiments, the kit also includes an anti-HIV therapeutic agent in a package or container. Anti-HIV therapeutic agents of interest include, but are not limited to, reverse transcriptase inhibitors: AZT (Dibudosine [Retrovir]), ddC (Zarcitabine [Hivid], dideoxyinosine), d4T (Stavudine [Zerit]), and 3TC (Lamivudine [Epivir]), non-nucleoside reverse transcriptase inhibitors (NNRTIS): delavirdine (Rescriptor) and nevirapine (Viramune), protease inhibitors: ritonavir (Norvir), combination of lopinavir and ritonavir (Kaletra), saquinavir (Invirase) Indinavir sulfate (Crixivan), Amprenavir (Agenerase) and Nelfinavir (Viracept). In some embodiments, a combination of several drugs called potent active antiretroviral therapy (HAART) is included in the kit.

Where a kit is provided, the different components of the composition may be packaged in separate containers and mixed immediately prior to use. Such packaging of the ingredients allows for long term storage without losing the function of the active ingredient.
Reagents contained in the kit are supplied in all types of containers that preserve the activity of the different components and that are not adsorbed or modified depending on their materials. For example, sealed glass ampoule containers are packaged under lyophilized polypeptides or polynucleotides of cupredoxin and / or cytochrome c and variants and derivatives thereof, or neutral, non-reactive gases such as nitrogen. Buffer. The ampoule container may be made of any suitable material, such as glass, organic polymers (eg, polycarbonate, polystyrene, etc.), ceramic, metal or any other material typically used to hold a similar reagent. Good. Other examples of suitable containers include foil-lined interiors, such as ampule containers containing aluminum or alloys and simple bottle containers that can be made from materials similar to envelope containers. Other containers include test tubes, vials, flasks, bottles, syringes, and the like. The container may have a sterile access port, such as a bottle with a stopper that can be penetrated by a hypodermic needle. Other containers may have two compartments separated by an easily removable membrane that allows the components to be mixed when it is removed. The removable film can be glass, plastic, rubber or the like.

  Kits can also be provided with documentation. The instructions are printed on paper or other media and / or electronically readable media such as floppy disks, CD-ROM and DVD-ROM, Zip disks, video tapes, audio tapes, flashes It may be provided as a memory device or the like. The detailed instructions may not be physically attached to the kit; instead, the user may access an Internet website created by the kit manufacturer or distributor, or by email. You may obtain it.

Modified cupredoxins and / or cytochromes Cupredoxins or cytochromes are chemically modified or genetically altered to produce variants and derivatives as described above. Such variants and derivatives can be synthesized by standard techniques.

  In addition to naturally occurring allelic variations of cupredoxin and cytochrome, changes can be introduced by mutations in the sequence encoding cupredoxin or cytochrome. Here, the amino acid sequence of cupredoxin or cytochrome changes to such an extent that it does not significantly change the ability of cupredoxin or cytochrome to inhibit parasitemia in malaria-infected erythrocytes. “Non-essential” amino acid residues are those residues that can be altered from the wild-type sequence of cupredoxins without altering biological activity. On the other hand, “essential” amino acid residues are required for such biological activity. For example, amino acid residues conserved in cupredoxins are not expected to be particularly amenable to change and are therefore “essential”.

Amino acids for which conservative substitutions can be made that do not alter the activity of the polypeptide are well known to those of skill in the art. Useful conservative substitutions are shown in Table 3 as “preferred substitutions”. Conservative substitutions by substitution of one class of amino acids with other amino acids of the same type are within the scope of the invention as long as the substitution does not substantially alter the biological activity of the compound.

(1) non-conservative affecting the structure of the polypeptide backbone, such as β-sheet or α-helix conformation, (2) charge, (3) hydrophobicity, or (4) side chain mass at the target site Substitution can modify the function of the cytotoxic factor. Residues are divided into groups based on common side chain properties as shown in Table 4. Non-conservative substitutions include the replacement of one group of these classes with another. Substitutions may be introduced at conservative substitution sites or more specifically at non-conservative sites.

Variant polypeptides can be made using methods well known in the art such as oligonucleotide-mediated (site-specific) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis (Carter, Biochem J. 237: 1-7 (1986); Zoller and Smith, Methods Enzymol. 154: 329-350 (1987), cassette mutagenesis, restriction site selection mutagenesis ( Wells et al., Gene 34: 315-323 (1985)) or other known techniques can be performed on the cloned DNA to produce cupredoxin or cytochrome c ₅₅₁ mutant DNA.

Known mutations cupredoxin and cytochrome c ₅₅₁ may also be used for making a variant cupredoxin and cytochrome c ₅₅₁ is used in the method of the present invention. For example, C112D and M44KM64E mutants of azurin are known to have different cytotoxins and growth-restricting activities than conventional azurin, and such altered activity is also useful in the therapeutic methods of the present invention. is there. One embodiment of the method of the present invention utilizes cupredoxins and / or cytochromes and these variants and derivatives that retain the ability to inhibit the growth of malaria infection in mammalian cells. In other embodiments, the methods of the present invention utilize cupredoxin variants, such as the M44KM64E mutant, that have the ability to stop cell growth.

  A more complete understanding of the invention can be obtained by reference to the following specific examples. These examples are described solely for purposes of illustration and are not meant to limit the scope of the invention. Form changes and equivalent substitutions are considered as the environment suggests or suggests convenience. If specific terms are used herein, these terms are intended for descriptive meaning and are not intended to limit the invention. The modifications and variations of the invention described above can be obtained without departing from the spirit and scope of the invention. Therefore, these restrictions should be imposed only on the given embodiment.

Example

Example 1: cupredoxin and in vitro inhibition cupredoxin bacteria wt azurin parasitemia by P. falciparum by cytochrome, M44KM64E azurin, rusticyanin and cyanobacteria plastocyanin and Pseudomonas aeruginosa cytochrome c _551,, human cytochrome c and Horumidiumu Raminosamu (Phormidium laminosum) cytochrome f was tested in a normal red blood cell (RBC) assay at a concentration of 200 μg / ml, inoculated 30 hours later. In these studies, normal RBCs were washed twice in serum-free medium and resuspended in 10% hematocrit in complete RPMI. 200 μl of 10% Hct RBC was added to each of the 24 wells (final 2% Hct in 1 ml) and 30 μl complete RPMI containing recombinant cupredoxin or cytochrome protein at 666 μM for a final concentration of 200 μM. Schizont stage parasites were prepared by centrifuging late cultures through a Percoll cushion at 3200 rpm for 10 minutes. For infection, 4 × 10 ⁶ parasite / well in 500 μl volume was added at t = 0 hours. Plates were incubated for 30 hours and scored by blood smear and Giemsa staining.

Control shows 9.5% parasitemia (standard error 1.3%), wt azurin 6.9% (standard error 1.4%), M44KM64E azurin 9.1% (standard error 1.0%), rusticyanin 7.2% (standard error 0.7%) Cytochrome c ₅₅₁ 7.5% (standard error 1.5%), human cytochrome c 8.4% (standard error 0.4%), plastocyanin 8.1% (standard error 1.3%), and cytochrome f 6.6% (standard error 1.0%). This shows that it has demonstrated 20-30% inhibition of parasitemia by cupredoxins such as wt azurin and rusticyanin and cytochrome (eg cytochrome f or cytochrome c ₅₅₁ ).

  Cupredoxins were tested for their effects at each stage of the parasite life cycle (0-24 hours, ring form; 24-36 hours, trophozoites; 36-48 hours, schizonts). Controls showed an average of 0.1% ring form and 9.4% trophozoite form. On the other hand, wt azurin showed 6.9% trophozoite form although it had no effect on ring form. Cytochrome f showed a 0.2% ring form but a significantly lower (6.3%) trophozoite form. Notably, rusticyanin showed a very high (2.0%) ring form and a significantly reduced (5.2%) trophozoite form. Others had no significant effect. The parasites in the rusticyanin-treated samples were debilitated and died compared to the rest of the samples, showing significant inhibition and toxic effects of rusticyanin on parasite development.

Example 2: In vitro inhibition of intracellular response of Plasmodium falciparum by rusticyanin To determine whether bacterial redox proteins can inhibit the intracellular response of Plasmodium falciparum, erythrocytes were hypotonically formulated Was added to 200 μg / ml intracellular recombinant protein concentrate. Blood cells were then washed, resuspended and infected with schizont stage parasites (P. falciparum) as described in Example 1. Erythrocytes were incubated for 19-40 hours to produce Giemsa smears.

Compared to normal erythrocyte infection in Example 1, only rusticyanin reduced the total number of parasitemias in the added cell culture. At 19 hours, there was no significant difference in infiltration and ring morphology between the empty features at 5.0 ± 0.4% and the rusticyanin-added features at 4.5 ± 1.0%. However, at 40 hours, the rusticyanin-added corpse showed a lower level of infection. No major results were seen for all bacterial proteins at 19 hours. However, at 40 hours, the control untreated figure showed 4.6 ± 0.3% parasitemia, whereas the rusticyanin-treated figure showed 2.7 ± 0.8% parasitemia (almost 50% decrease). Indicated. See Table 5. Wt azurin, M44KM64E mutant azurin, plastocyanin, cytochrome c ₅₅₁ , human cytochrome c and cyanobacterial cytochrome f protein showed 4.2-5.4% different parasitemia.

Example 3: Structural homology between azurin and the Fab fragment of the G17.12 monoclonal antibody complexed with Pf MSP1-19. Previous studies have shown that cupredoxin is structurally similar to the variable domain of an immunoglobulin superfamily member. (Gough & Chothia, Structure 12: 917-925 (2004); Stevens et al., J. Mol. Recognit. 18: 150-157 (2005)). The DALI algorithm (Holm & Park, Bioinformatics 16: 566-567 (2000)) was used to search the 3D database for the structural homology of azurin from Pseudomonas aeruginosa (1JZG). Azurin shows structural similarity to the Fab fragment of the G17.12 monoclonal antibody complexed with the Pf MSP1-19 fragment of the P. falciparum MSP1 merozoite surface protein (Pizarro et al., J. Mol. Biol. 328: 1091-1103 (2003).). Table 6 Azurin also shows structural similarity to ICAM-1 (Table 6). It is involved in brain malaria and is associated with receptors on endothelial cells in capillaries of the brain and other tissues for the isolation of erythrocytes infected with Plasmodium falciparum (Smith et al., Proc. Natl. Acad. Sci. USA 97: 1766-1771 (2000); Franke-Fayard et al., Proc. Natl. Acad. Sci. USA 102: 11468-11473 (2005)).

This example shows two antigens in which cupredoxins, including azurin, are packed and linked by disulfide bonds to the variable domains of immunoglobulin superfamily members and the extracellular domains of intercellular adhesion molecules (ICAMs) and their ligands. It is demonstrated to demonstrate structural similarity with parallel β sheets.

Example 4: Cloning and expression of Laz and H.8-azurin fusion genes The laz gene from Aspergillus was cloned based on its known sequence (SEQ ID NO: 22). Using the azurin gene of Pseudomonas aeruginosa (SEQ ID NO: 1) (named paz) and the sequence of H.8 epitope of laz from Aspergillus (SEQ ID NO: 21), the H.8 epitope gene was cloned in frame H.8-paz is generated at the 5 ′ end of paz or paz-H.8 is generated at the 3 ′ end of paz.

Cloning and expression of Paz and laz genes
Cloning and overexpression of the azurin gene has been described (Yamada, et al., Proc. Natl. Acad. Sci. USA 99: 14098-14103 (2002); Punj, et al., Oncogene 23: 2367-2378 ( 2004)). The Laz coding gene (laz) of Aspergillus was amplified by PCR with the genomic DNA of Aspergillus strain F62 as template DNA. The forward and reverse primers used were 5′-CCG GAATTC CGGCAGGGATGTTGTAAATATCCG-3 ′ (SEQ ID NO: 23) and 5′-GG GGTACC GCCGTGGCAGGCATACAGCATTTCAATCGG ′ (SEQ ID NO: 24). The additionally introduced restriction sites EcoRI and KpnI sites were underlined, respectively. A 1.0 kb amplified DNA fragment digested with EcoRI and KpnI was inserted into the corresponding site of the pUC18 vector (Yanisch-Perron, et al., Gene 33: 103-119 (1985)). Then, the laz gene was arranged downstream of the lac promoter to obtain an expression plasmid pUC18-laz (Table 7).

A plasmid expressing the fusion H.8 of Aspergillus laz and Pseudomonas aeruginosa azurin (Paz) was constructed by PCR with pUC19-paz and pUC18-laz as templates. For the H.8-Paz fusion, the 3.1 kb fragment was amplified with pUC18-laz as template and primer, and 5 ′-(phosphorylated) GGCAGCAGGGGCTTCGGCAGCATCTGC-3 ′ (SEQ ID NO: 25) and 5′-CTGCAG GTCGAC TCTAGAGGATCCCG-3 '(SEQ ID NO: 26). The SalI site is underlined. A PCR amplified 0.4 kb fragment was obtained from pUC19-paz as template and primer. 5 ′-(phosphorylated) GCCGAGTGCTCGGTGGACATCCAGG-3 ′ (SEQ ID NO: 27) and 5′-TA CTCGAG TCACTTCAGGGTCAGGGTG-3 ′ (SEQ ID NO: 28). The XhoI site is underlined. The expression plasmid pUC18-H.8-paz was obtained by cloning the SalI digested PCR fragment derived from pUC18-laz and the XhoI digested PCR fragment derived from pUC19-paz (Table 7).

E. coli JM109 was used as a host strain for the expression of azurin and its derivative genes. Recombinant E. coli strains were cultured in 2 × YT medium containing 100 μg / ml ampicillin, 0.1 mM IPTG and 0.5 mM CuSO ₄ for 16 hours at 37 ° C. to produce azurin protein.

  When E. coli containing these plasmids were grown in the presence of IPTG, lysed cells and proteins purified as described for azurin (Yamada, et al., Proc. Natl. Acad. Sci. USA 99: 14098-14103 (2002); Punj, et al., Oncogene 23: 2367-2378 (2004); Yamada, et al., Cell.Microbiol. 7: 1418-1431 (2005)), various azurin derivatives It moved on SDS-PAGE as one component. However, the H.8-containing protein (approximately 17 kDa) showed unusual migration as previously shown (Cannon, Clin. Microbiol. Rev. 2: S1-S4 (1989); Fisette, et al., J. Biol. Chem. 278: 46252-46260 (2003)).

Plasmid construction for the fused GST protein.
A plasmid expressing the fused glutathione S-transferase (GST) -cleaved wt-azurin (azu) derivative was constructed by polymerase chain reaction using proofreading DNA polymerase. For pGST-azu 36-128, the amplified PCR fragment was introduced into the BamHl and EcoRl sites of the commercial GST expression vector pGEX-5X (Amersham Biosciences, Piscataway, NJ). The fragment was amplified with pUC19-azu as template and primer. 5′-C GGGATCC CCG GCA ACC TGC CGA AGA ACG TCA TGG GC-3 ′ (SEQ ID NO: 29) and 5′-CG GAATTC GCA TCA CTT CAG GGT CAG GG-3 ′ (SEQ ID NO: 30). The additionally introduced BamHl and EcoRI sites were underlined, respectively. Carboxyl-terminal truncation of the azu gene was performed cumulatively by introducing stop codons using the QuickChange specific site mutagenesis kit (Stratagene, La Jolla, CA).

  For pGST-azu 36-89, a stop codon was introduced into Gly90. A plasmid carrying pGST-azu 36-128 was used as template DNA. Three sets of oligonucleotides for site-directed mutagenesis are shown as follows: For pGST-azu 36-89: 5'-CCA AGC TGA TCG GCT CGT GAG AGAAGG ACT CGG TGA CC-3 '(SEQ ID NO: 31), and 5'-GGT CAC CGA GTC CTT CTC TCA CGA GCC GAT CAG CTT GG-3 (SEQ ID NO: 32).

For pGST-azu 88-113, the carboxyl terminal truncation of the azu gene was performed cumulatively by introducing stop codons using the QuickChange specific site mutagenesis kit. For pGST-azu 88-113, a stop codon was introduced into Phe114. A plasmid carrying pGST-azu 88-128 was used as a template. For pGST-azu 88-128, the amplified PCR fragment was introduced into the BamH1 and EcoR1 sites of a commercially available GST expression vector pGEX-5X (Amersham Biosciences). Fragments were template and primer, 5'-C GGGGATCC CCG GCT CGG GCG AGA AGG AC-3 '(SEQ ID NO: 33) and 5'-CGG GAATTC TCC ACT TCA GGG TCA GGG TG-3' (SEQ ID NO: 34) Amplified with pUC19-azu. The additionally introduced BamH1 and EcoR1 sites were underlined, respectively.

  A set of oligonucleotides for site-directed mutagenesis is shown for the preparation of pGST-azu 88-113 as follows: 5'-GTT CTT CTG CAC CTA GCC GGG CCA CTC CG-3 ' (SEQ ID NO: 35) and 5'-CGG AGT GGC CCG GCT AGG TGC AGA AGA AC-3 '(SEQ ID NO: 36). pGST-azu 88-113 is used to transform E. coli XL-1 blue strain. Plasmid extracts were performed using commercial kits (Qiagen, Venlo, The Netherlands) and PCR sequencing was performed to evaluate plasmid insertion and transfection.

  E. coli BL21 (DE3) was used as a host strain for expression of gst and its fusion derivatives. E. coli strain XL-1-Blue transformed with pGST-azu plasmid was grown in LB medium containing ampicillin at 37 ° C. for 3 hours. IPTG induction (0.4 mM) was followed by incubation at 37 ° C. for 2-4 hours to maximize expression levels. Cells were isolated by centrifugation and resuspended in 25 mL of 1 × PBS buffer. The subsequent cell lysate was subjected to two time-lapse treatments: cell suspension via sonication (20 minutes on ice) and heat-cooled shock (using appropriate protease inhibitors) in an acetone dry cooling bath. . The supernatant of the cell lysis mixture was isolated and passed through a freshly packed 1 mL glutathione-Sepharose 4B (Amersham Biosciences) column equilibrated with PBS. After column washing, the GST-azu product was eluted using 10 mM glutathione in 20 mM Tris-HCl pH 8. The purity of GST-Azu 88-113 was tested via electrophoresis using a 10% SDS-PAGE Tris-Gly gel stained with Coomassie Brilliant Blue R reagent. Protein concentration was determined using the Bradford method.

Example 5: Azurin binds to the C-terminal fragments MSP1-19 and MSP1-42 of the Plasmodium falciparum merozoite surface protein MSP1.
Giving structural similarity between the fab fragment of monoclonal antibody G17.12 conjugated with azurin and Pf MSP1-19 (Pizarro et al., Id) and complexed with Pf MSP1-42 or Pf MSP1-19 The ability of azurin to form was determined. Two derivatives of azurin from gonnococci and meningococci, e.g. meningococcus with an additional 39 amino acid epitope called H.8 epitope, Laz, azurin-like protein (Gotschlich & Seiff, FEMS Microbiol. Lett. 43: 253-255 (1987); Kawula et al., Mol. Microbiol. 1: 179-185 (1987)) and H.8-azurin (H.8 epitope of Laz is within the framework of P. aeruginosa azurin) Were fused to the N-terminal part of (as described in Example 4).

  In vitro protein-protein interactions were evaluated using a Biacore X spectrometer from Biacore AB International. All tests were performed at 25 ° C in HBS-EP running buffer (0.01 M HEPES, pH 7.4, 0.15 M NaCl, 3 mM EDTA, 0.005% v / v surfactant P20) using an Au-CM5 sensor chip (Biacore) I went there. Protein immobilization on the CM5 chip was performed by amine coupling treatment. The protein was immobilized after NHS / EDC preactivation on the CM5 surface (510 μM): injection of 50 μl azurin (510 μM). Non-crosslinked protein was removed by post-treatment of the CM5 surface with ethanolamine (1M, pH 8.8). Binding studies were performed by injecting protein eluent (50 μl) across the protein-CM5 surface at a flow rate of 30 μl / min 120 seconds after the end of injection. The protein eluent included GST-azurin fusion proteins (GST, GST-Azu 36-128, GST-Azu 36-89, and GST-Azu 88-113 as described in Example 4). The sensor chip surface was regenerated between protein injections using 100 mM NaOH (10 μl injection pulse). All binding studies were performed in parallel on negative flow channels with exposed Au-CM5 sensor surfaces to correct nonspecific binding to the chip. In order to obtain binding constant data, a titration test was designed through the injection of increasing concentrations of protein eluent (0.05-2000 nM). SPR data was fitted to Langmuir (1: 1) equilibrium binding model [Req = Rmax / (1 + Kd / C] as specified in the Biacore software with an extrapolated binding constant (Kd).

  Specific interactions of azurin, H.8-azurin and Laz with Pf MSP1-19 and Pf MSP1-42 proteins were determined by surface plasmon resonance (SPR) analysis and the data are shown in FIG. SPR sensorgrams for the binding of azurin and its derivatives to immobilized Pf MSP1-19 and Pf MSP1-42 showed selective recognition between these proteins. Nanomolar concentrations of azurin allowed significant binding to immobilized MSP1-19 (Figure 1A) or MSP1-42 (Figure 1B), and both H.8-azurin and Laz were identified as azurin and MSP1-19. A higher affinity to bind to the merozoite surface protein MSP1 cleavage product was demonstrated with a characteristic Kd value of between 32.2 nM and 54.3 nM between azurin and MSP1-42. The Kd values between H.8-azurin and MSP1-19 and MSP1-42 were 11.8 nM and 14.3 nM, whereas the values between Laz and MSP1-19 and MSP1-42 were 26.2 nM and 45.6 nM.

  To assess whether the H.8 epitope will facilitate the binding of H.8-azurin or Laz to the PfMSP1-19 or PfMSP1-42 site, it binds to MSP1-19 or MSP1-42, H The ability of glutathione S transferase (GST) and the fusion derivative H.8-GST when the .8 epitope was fused to the N-terminus of GST (see Example 4) was tested. H.8-GST showed weak binding to MSP1-42, but neither GST nor H.8-GST bound to PfMSP1-19 (FIG. 1A) or MSP1-42 (FIG. 1B).

  Glutathione S-transferase (GST) and some fusion proteins (Yamada et al., Cell. Microbiol. 7: 1418-1431 (2005), and Example 4) when a portion of azurin is fused with GST, -19 was tested for its ability to bind. GST alone or GST-Azu 88-113 did not show any binding when azurin amino acid sequence 88-113 of 128 amino acids of azurin was fused with GST in frame (FIG. 1C), whereas amino acids GST-Azu36-89 containing sequences 36-89 and GST-Azu36-128 containing amino acid sequences 36-128 showed significant binding to MSP-19 showing Kd values of 20.9 nM and 24.5 nM, respectively.

Example 6: Inhibition of parasitemia by Plasmodium falciparum by azurin, H.8-azurin and Laz.
The degree of parasitemia was determined using schizont stage parasites and normal red blood cells (RBC). Normal red blood cells (RBC) were washed twice in serum-free medium and resuspended in 10% hematocrit in complete RPMI. 200 μl of 10% hematocrit RBC was added to each of the 24 wells and 300 μl complete RPMI with or without azurin, H.8-azurin or Laz was added. Schizont stage P. falciparum parasites were prepared by centrifuging late cultures through a Percoll cushion at 3200 rpm for 10 minutes. For infection, 4 × 10 ⁶ parasites per well in a 500 μl volume were added at time zero. Plates were incubated overnight (approximately 16 hours) before being scored by thin blood smears and Giemsa staining.

  In all of azurin, H.8-azurin or Laz, a relatively high concentration (about 50 μM) but a significant inhibition of parasitemia depending on the dose has been demonstrated (FIG. 2). Concentrations probably reflect a number of ways in which malaria parasites infiltrate red blood cells (Cowman et al., FEBS Lett. 476: 84-88 (2000); Baum et al., J. Biol. Chem. 281: 5197- 5208 (2006)), high concentrations of azurin or Laz are required to interfere with the invasion process. As shown by its enhanced binding affinity for MSP1-19, both H.8-azurin and Neisserial Laz protein have higher levels of parasitemia due to Plasmodium falciparum when compared to azurin. Showed inhibition.

  When azurin was labeled with the red fluorescent dye Alexa fluor 568 and used in the invasion assay, trace amounts of red fluorescence could be detected inside the RBC. This suggests that azurin binds to MSP1-19 and does not enter RBC as part of it. More specifically, the RBC that showed the presence of a schizont suggests that azurin could not bind to MSP1-19. These data are in complete agreement with our previous observations (Yamada et al., Cell. Microbiol. 7: 1418-1431 (2005)), and azurin does not enter normal cells such as macrophages, mast cells, etc. The effects of azurin, H.8-azurin or Laz are in the invasion stage, not the parasite intracellular replication stage. Taken together, the data in FIG. 2 demonstrates the potential antimalarial effects of azurin, H.8-azurin and Laz through interference in the invasion of RBCs by parasites.

Example 7. Azurin binds to ICAM.
Interesting structural similarities between ICAM and azurin, known to be involved as receptors for erythrocytes infected with Plasmodium falciparum (Table 6) (Wassmer et al., PloS Med. 2: 885-890 (2005); Dormeyer et al., Antimicrob. Agents Chemotherap. 50: 724-730 (2006)) measured by SPR between azurin and ICAM, eg ICAM-1, ICAM-2, ICAM-3 and NCAM. Facilitated test analysis of protein-protein interactions. Azurin immobilized on a CM5 chip, ICAM-3 (Fig. 3, Kd = 19.5 + 5.4 nM) and NCAM (Fig. 3, inset) (but interestingly not ICAM-1 and ICAM-2) Showed strong binding. While not limiting the approach that the invention provides, some of the effects of azurin on the inhibition of Plasmodium falciparum parasitemia may be mediated through its interaction with ICAM-3 or NCAM There is.

Example 8 Treatment of patients who may or may have been exposed to malaria Clinical use for malaria prevention, drugs containing one or more cupredoxins and / or cytochromes are administered to patients.

  Fifteen healthy male volunteers residing in areas where malaria is endemic, with no prior history of antibodies to blood-stage P. falciparum parasites as determined by immunofluorescence assays (22- 50 years) is injected with purified cupredoxin and purified cytochrome pharmaceutical formulation. Two of these men are positioned as untreated controls.

  The sterile pharmaceutical formulation is in the form of a 0.5 ml single dose ampoule of sterile P. aeruginosa azurin in a pharmaceutical formulation designed for intravenous administration well known to those skilled in the art. The pharmaceutical formulation was stored at 4 ° C. and protected from light prior to administration. In one clinical trial, azurin is prepared at five different concentrations: 10 μg, 30 μg, 100 μg, 300 μg and 800 μg azurin / 0.5 ml dose.

  The pharmaceutical formulation was administered intravenously to 13 volunteers each for 10 doses. Volunteers receive initial treatment on day 0, followed by the same administration every other day for 3 weeks. Volunteers are immediately observed for toxic effects for 20 minutes after injection. After 24 and 48 hours, they are examined for signs of fever, local tenderness, erythema, hot flashes, sclerosis and lymphadenopathy, headache, fever, chills, malaise, local pain, nausea and joints Ask about pain. Prior to each administration, all clinical tests are performed on blood and urine samples. Complete blood counts and serum chemistry profiles will be reexamined 2 days after each dose. Presence of malaria parasites is determined by light microscopic examination (ME) of contaminated blood smears or ICT malaria P.f./P.v. Test kit (Binax, Inc., Portland, ME). The results demonstrate the effectiveness of the treatment.

Example 9: Control of insect malaria infection Infectious genetic elements transmitted from one mosquito to another will be operably linked to a cupredoxin coding sequence operably linked to a constitutive promoter . Thus, Pseudomonas aeruginosa azurin will be produced inside an anopheles infected with P. falciparum. This interferes with its replication / survival within the mosquito. This mosquito will survive in endemic areas and azurin-containing genetic elements will spread to other P. aeruginosa-infected anopheles that inhibit P. aeruginosa growth or survival.

Example 10: Treatment of patients infected with malaria Clinical use of malaria treatment comprising one or more cupredoxins and / or cytochromes for the treatment of human malaria infection.

  Purified Pseudomonas aeruginosa for 15 healthy male volunteers aged 22-50 years with a history of pre-existing antibodies against blood-stage P. falciparum parasites as determined by immunofluorescence assay Inject a pharmaceutical preparation of azurin. Two of these men are positioned as treatment controls.

The sterile pharmaceutical formulation is in the form of a 0.5 ml single-dose ampoule of sterile P. aeruginosa azurin in a pharmaceutical formulation designed for intravenous administration well known to those skilled in the art. Pharmaceutical formulations are stored at 4 ° C and protected from light prior to administration. In one clinical trial, Pseudomonas aeruginosa azurin is prepared at 5 different concentrations per 0.5 ml dose: 10 μg, 30 μg, 100 μg, 300 μg and 800 μg azurin / cytochrome c ₅₅₁ (1: 1 on a molecular basis).

  The pharmaceutical formulation is administered intravenously to 13 volunteers each for 10 doses. Volunteers receive initial treatment on day 0, followed by the same administration every other day for 3 weeks. Volunteers are immediately observed for toxic effects for 20 minutes after injection. After 24 and 48 hours, they are examined for signs of fever, local tenderness, erythema, hot flashes, sclerosis and lymphadenopathy, headache, fever, chills, malaise, local pain, nausea and joints Ask about pain. Prior to each administration, all clinical tests are performed on blood and urine samples. Reexamine 2 days after each dose for complete blood count and serum chemistry profile. Presence of malaria parasites is determined by light microscopic examination (ME) of contaminated blood smears or ICT malaria P.f./P.v. Test kit (Binax, Inc., Portland, ME). The results demonstrate the effectiveness of the treatment.

FIG. 1 shows surface plasmon resonance binding of azurin, H.8-azurin (H.8-Az), Laz and GST-azurin (GST-Azu) constructs showing the interaction with MSP1-19 and MSP1-42. Titration. (A) Binding curve demonstrating the interaction of azurin and its analogs with MSP1-19 (MSP1-19-CM5) immobilized on a carboxymethyldextran coated gold sensor chip. The concentration-dependent binding of azurin protein to MSP1-19 was determined by injection of various concentrations (0.05-300 nM) across the sensor surface, and the extent of binding was measured as an equilibrium resonance response value measured in resonance units (RU). Was evaluated as a function of H.8-Az and Laz bound somewhat more strongly than azurin, but binding was not observed with GST or H.8-GST. (B) In vitro binding titrations for immobilized MSP1-42 and azurin and its analogs were performed in a manner similar to the binding to MSP1-19 as shown in (A). The relative binding affinity was determined by fitting the data to Req = Rmax / (1+ (Kd / C)) and fitting the data points in the graph to fit the curve. MSP1-19 binding Kd values are 32.2 ± 2.4 nM (azurin), 26.2 ± 2.4 nM (Laz), 11.8 ± 0.3 nM (H.8-Az), MSP1-42 binding Kd value is 54.3 ± 7.6 nM (Azurin), 45.6 ± 2.4 nM (Laz) and 14.3 ± 1.7 nM (H.8-Az). (C) Binding titration for GST-Azu fusion protein interaction on the MSP1-19-CM5 sensor surface demonstrates recognition of GST-Azu 36-128 and GST-Azu 36-89 on MSP1-19. No binding was observed with GST or GST-Azu 88-113. FIG. 2 shows the inhibition of Plasmodium falciparum (parasitic growth in RBC) by different concentrations of azurin, H.8-azurin (H.8-Az) and Laz shown in the figure. In these studies, normal erythrocytes cultured overnight were infected with schizonts in the absence or presence (different concentrations) of these proteins. The number of intracellular parasites was scored by thin blood smears and Giemsa staining. FIG. 3 is a surface plasmon resonance binding curve for binding between ICAM (ICAM-1, ICAM-2, ICAM-3 and NCAM, inset) and immobilized azurin. Due to the large non-specific binding to the naked AU-CM5 chip, CM5 was added to the running buffer as eluent (1 mg / ml CM5 in HBS-EP buffer). The selective recognition of azurin by ICAM-3 but not ICAM-1 or ICAM-2 was prominent and the binding strength was 19.5 ± 5.4 NM. The KD for NCAM binding to azurin was 20 ± 5.0 NM, as shown in the inset.

Claims (41)

  An isolated peptide which is a variant, derivative or structural equivalent of cupredoxin or cytochrome and which can inhibit parasitemia due to malaria in erythrocytes infected with malaria.   The isolated peptide according to claim 1, which can inhibit parasitemia caused by malaria in human erythrocytes infected with P. falciparum.   An isolated peptide that is a variant, derivative or structural equivalent of cupredoxin or cytochrome and that can inhibit intracellular replication of Plasmodium in human erythrocytes infected with malaria.   An isolated peptide that is a variant, derivative or structural equivalent of cupredoxin and is capable of binding to a protein selected from the group consisting of PfMSP1-19 and PfMSP1-42.   2. The isolated peptide of claim 1, wherein the cupredoxin is selected from the group consisting of azurin, pseudoazurin, plastocyanin, rusticyanin, Laz and auracyanin.   6. The isolated peptide of claim 5, wherein the cupredoxin is selected from the group consisting of rusticyanin, azurin and Laz.   The cupredoxin is Pseudomonas aeruginosa, Alcaligenes faecalis, Achromobacter xylosoxidan, Bordetella bronchiseptica, Methylomonas sp ), Neisseria gonorrhea, Pseudomonas fluorescens, Pseudomonas chlororaphis, Xylella fastidiosa, and Vibrio parahaemolyticus The isolated peptide according to claim 1, wherein   The cupredoxin is derived from an organism selected from the group consisting of Thiobacillus ferrooxidans, Pseudomonas aeruginosa, Neisseria gonorrhea, and Neisseria meningitidis. 6. The isolated peptide according to 6.   2. The isolated peptide according to claim 1, wherein the cytochrome is selected from the group consisting of cytochrome c and cytochrome f.   The isolated peptide of claim 9, wherein the cytochrome c is derived from an organism selected from the group consisting of human and Pseudomonas aeruginosa.   The isolated peptide according to claim 9, wherein the cytochrome f is derived from cyanobacteria.   The isolated peptide according to claim 1, which is a truncated form of a peptide selected from the group consisting of SEQ ID NOs: 1 to 20 and 22.   2. The isolated peptide of claim 1, which exhibits at least 90% amino acid sequence identity to the group consisting of SEQ ID NOs: 1-20 and 22.   The isolated peptide according to claim 1, which is a truncated form of cupredoxin or cytochrome.   The isolated peptide according to claim 1, wherein the peptide has about 10 residues or more and about 100 residues or less.   The isolated peptide according to claim 1, wherein the peptide comprises azurin residues 36-89.   The isolated peptide according to claim 1, wherein the peptide consists of azurin residues 36-89.   The isolated peptide of claim 1, wherein the peptide comprises a residue of cupredoxin equivalent to azurin 36-89.   2. The isolated peptide of claim 1 fused to the H.8 region of Laz.   2. The isolated peptide of claim 1, which is a structural equivalent of monoclonal antibody G17.12.   A composition comprising at least one cupredoxin, cytochrome or isolated peptide according to claim 1 in a pharmaceutical composition.   24. The composition of claim 21, wherein the pharmaceutical composition is formulated for intravenous administration.   24. The composition of claim 21 further comprising another antimalarial agent.   The composition of claim 21 further comprising an anti-HIV agent.   The cupredoxin is Pseudomonas aeruginosa, Alcaligenes faecalis, Achromobacter xylosoxidan, Bordetella bronchiseptica, Methylomonas sp ), Neisseria gonorrhea, Pseudomonas fluorescens, Pseudomonas chlororaphis, Xylella fastidiosa, and Vibrio parahaemolyticus The composition of claim 21, wherein:   26. The composition of claim 25, wherein the cupredoxin is derived from an organism selected from the group consisting of Thiobacillus ferrooxidans, Neisseria gonorrhea, and Neisseria meningitidis.   24. The composition of claim 21, wherein the cytochrome is selected from the group consisting of cytochrome c and cytochrome f.   28. The composition of claim 27, wherein the cytochrome c is derived from an organism selected from the group consisting of human and Pseudomonas aeruginosa.   The composition according to claim 27, wherein the cytochrome f is derived from cyanobacteria.   23. The composition of claim 21, wherein the cupredoxin or cytochrome c is selected from the group consisting of SEQ ID NOs: 1-20 and 22.   23. A method for treating a patient suffering from an infection caused by Plasmodium, comprising administering to the patient an effective amount of the composition of claim 21.   23. A method for treating a patient suspected of being in contact with a malaria parasite, comprising administering to the patient an effective amount of the composition of claim 21.   23. A method for preventing malaria in a mammal comprising administering an effective amount of the composition of claim 21 to a vector insect in a population of vector insects encapsulating plasmodium.   35. The method of claim 33, wherein the peptide inhibits malaria-induced parasitemia in human erythrocytes infected with malaria in a patient.   32. The method of claim 31, wherein the malaria parasite is selected from the group consisting of Plasmodium vivax and Plasmodium falciparum.   32. The method of claim 31, wherein the patient is further afflicted with an HIV infection.   32. The method of claim 31, wherein the composition is administered with a second composition comprising an active ingredient selected from the group consisting of an antimalarial agent and an anti-HIV agent.   38. The method of claim 37, wherein the composition of claim 21 is administered within 0 minutes to 12 hours of administration of the second composition.   32. The method of claim 31, wherein the composition is administered to a patient by a method selected from the group consisting of oral, inhalation, intravenous, intramuscular and subcutaneous administration.   40. The method of claim 39, wherein the composition is administered intravenously to a patient.   34. The method of claim 33, wherein the composition is administered orally to a vector insect.

Images