JP2009213430A - New fusion protein for treating disorder of outer layer of retina - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a means effective for recovering a visual function and improving photosensitivity at low illumination intensity. <P>SOLUTION: The fusion protein is a fusion protein between a photoreceptor channel protein and a fluorescent protein. The fluorescent protein emits a light having the sensitive wavelength of the photoreceptor channel protein when excited by a visible light. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a fusion protein of a photoreceptor channel protein and a fluorescent protein, a polynucleotide encoding the fusion protein, an expression vector containing the polynucleotide, and their therapeutic use.

  The number of blind persons in Japan in Japan is 16,000, and the factors can be roughly divided into two, except for severe trauma, due to inner retinal disorders and outer layer disorders. In diseases such as retinal pigment degeneration and age-related macular degeneration, it is known that the outer retina is selectively denatured.

  As for the photoreception of the retina and its information transmission mechanism, incident light and video information are received by photoreceptor cells (photocells) located in the outer retina and transmitted to the inner retina. The information is transmitted to the brain by ganglion cells that constitute the optic nerve, located in the inner layer of the retina. As described above, the only cells that can receive light, that is, images, are photoreceptor cells in the retina. If the photoreceptor cells degenerate or disappear due to some factor, even if other cells are normal, they can be blind.

  According to the photoreceptor mode of photoreceptors, it is known that a chain reaction of various proteins is necessary after photoreceptors with photoreceptor proteins present in photoreceptor cells. In this manner, it has conventionally been considered impossible to confer photoreceptivity by introducing a single gene. In this connection, in order to confer photoreceptive ability on nerve cells, it is necessary to introduce at least three kinds of proteins (ie, arrestin, opsin, and G protein α subunit) into one cell. (Non-Patent Document 1).

  Nagel et al. (Non-Patent Document 2) show that channelrhodopsin-2 (hereinafter also referred to as “ChR2”) isolated from the green alga Chamydomonas has both photoreceptivity and cation-selective permeability, and ChR2 It has been reported that photoreceptive ability can be imparted to cultured mammalian cells (HEK293, BHK) by introducing the gene.

  The present inventors tried to reconstruct visual function by introducing the channel rhodopsin-2 gene into the remaining retinal neurons in a genetically blind rat caused by damage to the outer retina. There was no visual cortex response (visual evoked potential), but there was a response to light after gene transfer, and the minimum illuminance at which the visual cortex response was seen was 240 lux. In comparison, it was reported that the photosensitivity was low (Non-patent Document 3).

  Patent Document 1 describes that photoresponsiveness was acquired by expressing in a neuronal cell a fusion protein of channel rhodopsin-2 and Venus (modified GFP) similar to that used here.

JP 2006-217866 Zemelman BV et al., Neuron. 2002 Jan 3; 33 (1): 15-22. Nagel G et al., Proc Natl Acad Sci U S A. 2003 Nov 25; 100 (24): 13940-5. Tomita H. et al., Invest Ophthalmol Vis Sci., 48 (8): 3821-6, 2007

  Thus, although the recovery of visual function is seen by introduction of the photoreceptor channel protein gene, there is still a problem that the photosensitivity is lower than that of normal vision.

  Accordingly, an object of the present invention is to provide an effective means for resolving the above-mentioned photosensitivity problem while restoring visual function.

  Nocturnal animals have reflectors (tapetum) that reflect light. It is known that the reflector has a function of reflecting light that is not received by the photoreceptor cells in the retina and giving the photoreceptor cells a chance to receive them again.

  Therefore, the inventors have obtained a hint from this reflector and attempted to artificially produce it as a means for amplifying incident light. Specifically, a fluorescent protein that emits light upon excitation of visible light (however, this light is a light having a sensitive wavelength of the photoreceptor channel protein) is used as a reflector-like protein, and the protein and the photoreceptor channel. When it was expressed in the rat retina as a fusion protein with the protein, it was confirmed that the visual function was restored and the light sensitivity was improved at low illuminance. The present invention is based on such knowledge.

That is, the present invention includes the following features.
(1) The fusion protein of a photoreceptor channel protein and a fluorescent protein, wherein the fluorescent protein emits light having a wavelength sensitive to the photoreceptor channel protein when excited by visible light. protein.

  (2) The fusion protein according to (1) above, wherein the photoreceptor channel protein is channelrhodopsin-2 (ChR2).

  (3) The fusion protein according to (2) above, wherein channelrhodopsin-2 is derived from Chlamydomonas reinhardtii.

(4) The fusion protein according to (1) above, wherein the photoreceptor channel protein is a polypeptide according to any one of the following (a) to (c).
(a) a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2
(b) a polypeptide comprising a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence shown in SEQ ID NO: 2 and having a biological activity equivalent to the polypeptide of (a)
(c) a polypeptide having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 2 and having a biological activity equivalent to the polypeptide of (a)

(5) The fusion protein according to (1) above, wherein the photoreceptor channel protein is a polypeptide according to any one of the following (a) to (c).
(a) a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 4
(b) a polypeptide comprising a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence shown in SEQ ID NO: 4 and having a biological activity equivalent to the polypeptide of (a)
(c) a polypeptide having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 4 and having a biological activity equivalent to the polypeptide of (a)

  (6) The fusion protein according to any one of (1) to (5) above, wherein the fluorescent protein is a Cyan fluorescent protein.

  (7) The fusion protein according to (6) above, wherein the Cyan fluorescent protein is derived from Anemonia majano.

(8) The fusion protein according to any one of (1) to (5) above, wherein the fluorescent protein is a polypeptide according to any one of the following (a) to (c).
(a) a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 6
(b) a polypeptide comprising one or several amino acid deletions, substitutions, additions or insertions in the amino acid sequence shown in SEQ ID NO: 6 and having optical properties equivalent to the polypeptide of (a)
(c) a polypeptide having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 6 and having optical properties equivalent to the polypeptide of (a)
(9) A polynucleotide encoding the fusion protein according to any one of (1) to (8) above.

(10) An expression vector comprising the polynucleotide according to (9), which is operably linked to a promoter.
(11) The expression vector according to (10) above, which is a viral vector.

  (12) The fusion protein according to any one of (1) to (8) above, or the expression vector according to (10) or (11) above in the manufacture of a medicament for treating a subject suffering from a disorder of the outer retina Use of.

  (13) The use according to (12) above, wherein the disorder of the outer retina is retinitis pigmentosa, age-related macular degeneration, or retinal detachment.

  (14) A pharmaceutical composition for treating a disorder of the outer retina, comprising as an active ingredient the fusion protein according to any one of (1) to (8) above or the expression vector according to (10) or (11) above .

  (15) The pharmaceutical composition according to the above (14), wherein the disorder of the outer retina is retinitis pigmentosa, age-related macular degeneration, or retinal detachment.

  ADVANTAGE OF THE INVENTION According to this invention, the novel fusion protein useful for the improvement of the photosensitivity in low illumination intensity is provided with the recovery | restoration of visual function.

  The fusion protein of the present invention is useful for treating a subject suffering from a disorder of the outer retina such as retinal pigment degeneration or age-related macular degeneration.

The present invention will be described below.
The present invention relates to a fusion protein useful for treatment of a subject suffering from a disorder of the outer retina, a polynucleotide encoding the fusion protein, an expression vector containing the polypeptide, and their therapeutic use.

1. Fusion Protein 1.1 Photoreceptor Channel Protein As used herein, “photoreceptor channel protein” has a function of receiving incident light and a channel function of converting received light into an electrical signal. Any protein. That is, in the present invention, the photoreceptor channel protein is a protein that exerts a visual function instead of a visual cell that has impaired visual function or has lost visual function.

  Various proteins are known to date as proteins having a photoreceptor function and a channel function. For example, such proteins include rhodopsin family proteins (such as channelrhodopsin-1 and channelrhodopsin-2) originating from green algae such as Chlamydomonas, bacteriorhodopsin, halorhodopsin, sensory rhodopsin, proteorhodopsin derived from highly halophilic bacteria Which can be used in the present invention.

  In the present invention, a particularly preferred photoreceptor channel protein is ChR2 protein derived from Chlamydomonas reinhardtii or a homologue or variant thereof. ChR2 protein is known as a protein that causes depolarization (that is, cation transmission) in response to blue light of 400 to 500 nm, and its gene sequence and amino acid sequence are also known (GenBank accession number AF461397). ChR2 protein has been reported to restore visual function by its expression in ganglion cells of genetically blind rats (see Non-Patent Document 3).

  Here, the “homolog” refers to a protein (or nucleic acid) having the same function from different organisms. The homologous protein and the sequence of the nucleic acid encoding it can be searched by using an algorithm such as BLAST or FASTA by accessing a well-known database such as NCBI or EMBL. Such homologous nucleic acid or gene can be isolated according to a conventional method. For example, a primer for specifically amplifying a gene identified using a database storing base sequence information is designed, chemically synthesized, and PCR is performed using the primer using the genomic DNA extracted from the target organism as a template. The homologue of the target ChR2 gene can be amplified and isolated. A method for assaying whether or not the polypeptide encoded by the isolated homologue of the ChR2 gene has the same function as the polypeptide encoded by the ChR2 gene will be described later.

  An example of the base sequence of the ChR2 gene is shown in SEQ ID NO: 1, and the amino acid sequence of the ChR2 protein encoded by the base sequence shown in SEQ ID NO: 1 is shown in SEQ ID NO: 2. The ChR2 protein encoded by the ChR2 gene is not limited to the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, but substitution or deletion of one or several amino acids in the amino acid sequence shown in SEQ ID NO: 2, Those having an addition or insertion and having a biological activity equivalent to or higher than that of the ChR2 protein consisting of the amino acid sequence shown in SEQ ID NO: 2, or having the same sequence homology as the amino acid sequence shown in SEQ ID NO: 2. And having a biological activity equal to or higher than that of the ChR2 protein consisting of the amino acid sequence shown in SEQ ID NO: 2 (hereinafter also referred to as “ChR2 mutant polypeptide”).

  In the present specification, “several” used in the context of ChR2 mutant polypeptide is an integer of 10 or less, for example, an integer of 2 to 9, 2 to 7, or 2 to 5.

  The “substantially identical sequence homology” is at least 90%, more preferably at least 95%, more preferably at least 96%, 97%, 98% or 99% of the amino acid sequence shown in SEQ ID NO: 2. It means having homology. The% homology refers to a value calculated using software (for example, FASTA, DANASYS, BLAST, etc.) that calculates homology between a plurality (two) of amino acid sequences with default settings.

  As used herein, “equivalent biological activity” as used in the context of ChR2 protein refers to the fact that the strength of biological activity such as photosensitivity and channel function is substantially the same. The term may also include the case of having substantially the same biological activity, and the “same” biological activity here is the same in light sensitive wavelength, for example, the nature of the ion permeable activity. Say something.

  The ChR2 gene is not limited to the polynucleotide consisting of the base sequence shown in SEQ ID NO: 1, but is a polynucleotide that hybridizes under stringent conditions to the complementary strand of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 1. And a polynucleotide encoding a polypeptide having a biological activity equal to or higher than that of the ChR2 protein consisting of the amino acid sequence shown in SEQ ID NO: 2 (hereinafter also referred to as “ChR2 mutant polynucleotide”).

  The `` stringent conditions '' used in the present specification is not limited thereto, but, for example, at 30 ° C. to 50 ° C., 3-4 × SSC (150 mM sodium chloride, 15 mM sodium citrate, pH 7. 2) Hybridization in 0.1-0.5% SDS for 1-24 hours, more preferably at 40 ° C.-45 ° C., 3.4 × SSC, hybridization in 0.3% SDS for 1-24 hours, and subsequent washing Including. Examples of washing conditions include conditions such as continuous washing at room temperature with a solution containing 2 × SSC and 0.1% SDS, and a 1 × SSC solution and a 0.2 × SSC solution. However, the combinations of the above conditions are exemplary, and those skilled in the art will understand the above or other factors that determine the stringency of hybridization (eg, the concentration, length and GC content of the hybridization probe, the hybridization reaction). It is possible to achieve the same stringency as above by appropriately combining the time and the like.

  The ChR2 mutant polynucleotide may be a naturally occurring one or an artificially introduced mutation. Artificial mutations can be introduced by conventional methods using, for example, site-specific mutagenesis, PCR-based mutagenesis, etc. (Proc Natl Acad Sci USA., 1984 81: 5662; Sambrook et al., Molecular Cloning A Laboratory Manual (1989) Second edition, Cold Spring Harbor Laboratory Press; Ausubel et al., Current Protocols in Molecular Biology 1995 John Wiley & Sons).

  Whether the above-mentioned ChR2 mutant polypeptide, or a polypeptide encoded by a ChR2 mutant polynucleotide or a homologous gene of ChR2 gene has a biological activity equivalent to that of ChR2 protein is, for example, electrophysiology The assay can be carried out by examining membrane potential recording using an artificial technique and changes in intracellular ion concentration using a fluorescent probe.

  In the present invention, as the ChR2 protein, it is not always necessary to use the full length of the ChR2 protein, and a ChR2 protein fragment may be used as long as it has photosensitivity and channel function.

  Such ChR2 protein fragments include, but are not limited to, the N-terminal fragment (amino acid residues 1 to 315) of ChR2 protein. An example of the polynucleotide encoding this fragment is shown in SEQ ID NO: 3, and the amino acid sequence of the ChR2 protein fragment encoded by the polynucleotide shown in SEQ ID NO: 3 is shown in SEQ ID NO: 4. The ChR2 protein fragment of the present invention is a variant of the ChR2 fragment consisting of the amino acid sequence shown in SEQ ID NO: 4, that is, the amino acid sequence shown in SEQ ID NO: 4, or less, for example, 2 to 9, 2 to 7, 2 to A polypeptide comprising a deletion, substitution, addition or insertion of 5 amino acids and having a biological activity equivalent to that of the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 4, or at least the amino acid sequence shown in SEQ ID NO: 4 Biology equivalent to a polypeptide having 90%, more preferably at least 95%, more preferably at least 96%, 97%, 98% or 99% sequence identity and consisting of the amino acid sequence set forth in SEQ ID NO: 4 Also included are polypeptides having functional activity.

1.2 Fluorescent protein The "fluorescent protein" used in the present invention emits light having a sensitive wavelength of a photoreceptor channel protein when excited by visible light (that is, light having a wavelength of 390 nm to 770 nm), or Any fluorescent protein that emits light at the sensitive wavelength of the photoreceptor channel protein as the ion concentration changes. That is, the fluorescent protein of the present invention is selected according to the photoreceptor channel protein to be used. The presence of the fluorescent protein allows the photoreceptor channel protein to accept both direct incident light as well as the light emitted by the fluorescent protein, so that the photoreceptor channel protein receives light at low light (approximately 110-240 lux). The capacity can be increased.

  Fluorescent proteins that can be used in the present invention include, but are not limited to, Cyan fluorescent proteins such as Cyan derived from anemonia majano, Venus which is a modified GFP (eg Nagai T et al. , Nat Biotechnol. 2002 Jan; 20 (1): 87-90), Cherry (see eg Shaner NC et al., Nat Biotechnol. 2004 Dec; 22 (12): 1567-72.), MCFPm (see eg Zacharias, DA et al., Science 296, 913-916 (2002)), CyPet (see, for example, Nguyen, AW & Daugherty, PS; Nat. Biotechnol. 23, 355-360 (2005)).

  A particularly preferred fluorescent protein in the present invention is Cyan encoded by Cyan gene derived from Anemonia majano or a homologous gene corresponding to the Cyan gene. Cyan is known as a protein having an excitation peak at 458 nm and emitting fluorescence at a peak of 480 nm, and its gene sequence and amino acid sequence are also known (GenBank accession number AF168421). Since the 480 nm peak fluorescence emitted by Cyan is the sensitive wavelength of the photoreception channel protein ChR2, it is particularly preferred to use Cyan in combination with the ChR2 protein.

  Here, the “homologous gene corresponding to the Cyan gene” refers to a homologous gene corresponding to the Cyan gene isolated from an organism different from Anemonia majano. Examples of methods for isolating homologous genes are as described above. A method for assaying whether the homologous gene of the isolated Cyan gene has the same function as the Cyan gene will be described later.

  An example of the base sequence of the Cyan gene is shown in SEQ ID NO: 5, and the amino acid sequence of Cyan encoded by the base sequence shown in SEQ ID NO: 5 is shown in SEQ ID NO: 6. The Cyan encoded by the Cyan gene is not limited to the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 6, but substitution, deletion or addition of one or several amino acids in the amino acid sequence shown in SEQ ID NO: 6 Or having an optical property equivalent to Cyan consisting of the amino acid sequence shown in SEQ ID NO: 6 or having substantially the same sequence homology as the amino acid sequence shown in SEQ ID NO: 6 Including those having the same optical properties as Cyan comprising the amino acid sequence shown in No. 6 (hereinafter also referred to as “Cyan mutant polypeptide”). Here, the stringent conditions are as described above.

  In the present specification, “several” used in the context of the Cyan mutant polypeptide is as defined above.

  As used herein, “equivalent optical properties” as used in the context of Cyan refers to substantially the same optical properties such as excitation sensitivity, emission intensity, excitation peak, and emission wavelength.

  The Cyan gene is not limited to the polynucleotide consisting of the base sequence shown in SEQ ID NO: 5, but is a polynucleotide that hybridizes under stringent conditions to the complementary strand of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 5. And a polynucleotide encoding a polypeptide having the same optical properties as Cyan comprising the amino acid sequence shown in SEQ ID NO: 6 (hereinafter also referred to as “mutant polynucleotide”).

  In addition, whether or not the above-mentioned mutant polypeptide or the polypeptide encoded by the mutant polynucleotide or the homologous gene of the Cyan gene has an optical activity equivalent to that of Cyan is determined by, for example, purifying the mutant protein and fluorescence. Alternatively, it can be assayed by measuring the wavelength with a spectrophotometer.

1.3 Production of Fusion Protein The fusion protein of the present invention is a fusion protein of a photoreceptor channel protein and a fluorescent protein. In the fusion protein of the present invention, the fluorescent protein is preferably fused at the N-terminus or C-terminus of the photoreceptor channel protein.

  The fusion protein of the present invention can be produced by genetic engineering techniques based on the sequence information of the photoreceptor channel protein gene (eg, SEQ ID NO: 1) and the fluorescent protein gene (eg, SEQ ID NO: 5).

  Specifically, a fusion polynucleotide containing a photoreceptor channel protein gene and a fluorescent protein gene operatively linked to a promoter (also referred to as “polynucleotide encoding a fusion protein”) is replicated in the host cell. These proteins can be stably expressed, can be stably expressed, incorporated into an expression vector that can stably hold the gene, and the resulting recombinant expression vector is used to transform the host, in which the fusion protein Can be produced. For recombination techniques, reference can be made to Sambrook et al. (Supra) and Ausubel et al. (Supra).

  Examples of expression vectors include, but are not limited to, plasmids derived from Escherichia coli (for example, pET28, pGEX4T, pUC118, pUC119, pUC18, pUC19, and other plasmid DNAs), Bacillus subtilis Plasmids (eg, pUB110, pTP5, and other plasmid DNAs), yeast-derived plasmids (eg, YEp13, YEp24, YCp50, and other plasmid DNAs), λ phage (λgt11, λZAP, etc.), mammalian plasmids (pCMV , PSV40), viral vectors (adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, lentivirus vectors, vaccinia virus vectors and other animal virus vectors, baculovirus vectors and other insect virus vectors), plant vectors (binary vectors) pBI), cosmid vectors, etc. Can.

  As used herein, “operably linked” refers to a functional between a promoter sequence and a polynucleotide sequence of interest such that the promoter sequence can initiate transcription of the polynucleotide sequence of interest. This is a simple bond.

  The promoter is not particularly limited, and a suitable promoter may be selected depending on the host, and any of a constitutive promoter and an inducible promoter known in the art may be used. In the present invention, it is particularly preferable to use a constitutive promoter. For example, as a promoter that can be used in the present invention, CMV promoter, SV40 promoter, CAG promoter, synapsin promoter, rhodopsin promoter, CaMV promoter, glycolytic enzyme promoter, lac promoter, trp promoter, tac promoter, GAPDH promoter, GAL1 Examples include promoters, PH05 promoters, and PGK promoters.

  The fusion polynucleotide is inserted into the expression vector by, for example, preparing or ligating a restriction enzyme site flanking the fusion polynucleotide and inserting it into a restriction enzyme site or multiple cloning site of an appropriate vector DNA. In addition to promoter and fusion protein DNA, expression vectors include enhancers and other cis elements, splicing signals, poly A addition signals, selection markers (drug resistance gene markers such as ampicillin resistance marker, tetracycline resistance marker, LEU1, An auxotrophic complementary gene marker such as TRP1 and URA3, a dominant selection marker such as APH, DHFR, and TK), a ribosome binding site (RBS), and the like may also be included.

  To transform a host, use protoplast method, spheroplast method, competent cell method, virus method, calcium phosphate method, lipofection method, microinjection method, gene bombardment method, Agrobacterium method, electroporation, etc. Can be done. The host used for transformation is not particularly limited as long as it can express the fusion protein of the present invention. Bacteria (E. coli, Bacillus subtilis, etc.), yeast (Saccharomyces cerevisiae, etc.), animal cells (COS cells) , Chinese hamster ovary (CHO) cells, 3T3 cells, BHK cells, HEK293 cells, etc.) and insect cells.

  The obtained transformant is cultured under suitable conditions using a medium containing an assimilated carbon source, nitrogen source, metal salt, vitamins and the like. The transformant is usually cultured at 25 to 37 ° C. for 3 to 6 hours under aerobic conditions such as shaking culture or aeration and agitation culture. During the culture period, the pH is kept near neutral. The pH is adjusted using an inorganic or organic acid, an alkaline solution, or the like. During the culture, an antibiotic such as ampicillin or tetracycline may be added to the medium according to the selection marker inserted into the recombinant expression vector, if necessary.

  The fusion protein of the present invention is fractionated and purified by a general method from a culture obtained by culturing a transformant (culture supernatant, cultured cell, cultured cell, cell or cell homogenate, etc.). It can be obtained in such a manner as to retain its activity by ultrafiltration concentration, freeze drying, spray drying, crystallization, and the like.

  Moreover, the fusion protein expression vector used for the transformation can also be used as an active ingredient in the therapeutic use of the present invention, as described later. In this case, for example, a vector excellent in the efficiency of introduction into the retina, photoreceptor cell, ganglion cell, bipolar cell, replication maintenance in the cell, stability, expression efficiency, etc. may be used. Examples of such vectors include, but are not limited to, adeno-associated virus vectors, retrovirus vectors, lentivirus vectors and other viral vectors, and (self-replicating) plasmids.

  The fusion protein expression vector of the present invention is disclosed in, for example, Tomita H et al., Invest Ophthalmol Vis Sci. 2007 Aug; 48 (8): 3821-6; and Sugano E et al., Invest Ophthalmol Vis Sci. 2005 Sep; 46 (9): Can be produced according to the method described in 3341-8.

2. Therapeutic use The fusion protein of the present invention is obtained by fusing a fluorescent protein to a photoreceptor protein that restores visual function. Fluorescent proteins emit light at the sensitive wavelength of photoreceptor channel proteins when excited by visible light, or photoreceptor channel proteins due to changes in ionic concentration associated with photoreceptor protein photoreception Since the light emitting wavelength of the photosensitizer is selected, the photoreceptor channel protein can accept not only the directly incident light but also the light emitted by the fluorescent protein. Can be increased.

  Therefore, the expression vector containing the fusion protein of the present invention and the polynucleotide encoding the fusion protein is useful for the treatment of a subject suffering from a disorder of the outer retina.

  “Outer retina disorder” means that visual cells in the outer retina are degenerated or lost, resulting in visual dysfunction or visual dysfunction, but cells other than photoreceptor cells remain normal. Or it refers to any disease that retains part of its function. In the present invention, examples of such diseases include, but are not limited to, retinitis pigmentosa, age-related macular degeneration, and retinal detachment.

  As used herein, “subject” means a subject who is blind or at risk of blindness due to a disorder of the outer retina. In the present invention, the subject is not limited to a human but may be a mammal other than a human or an avian animal. Examples of other mammals include mice, rats, monkeys, rabbits, dogs, cats, cows and horses.

  Further, as used herein, “treatment of a subject suffering from a disorder of the outer retina” refers to administration of the pharmaceutical agent of the present invention in a subject who has lost or is at risk of blindness due to a disorder of the outer retina. Compared to the previous, it refers to restoring visual function and increasing light sensitivity at low illumination.

2.1 Pharmaceutical Composition The pharmaceutical composition of the present invention comprises an expression vector comprising the fusion protein of the present invention and a polynucleotide encoding the fusion protein as an active ingredient, for treating a subject suffering from a disorder of the outer retina. It is formulated as a medicine. That is, the medicament of the present invention contains a therapeutically effective amount of a fusion protein or expression vector. The “therapeutically effective amount” refers to an amount that can give a therapeutic effect for a given symptom or usage, and the amount is appropriately determined by those skilled in the art by conducting a test using an animal or a clinical test. The age, weight, sex, disease state or severity of the subject subject, method of administration, etc. should be considered. In the case of viruses, the viral load is, for example, 10 ¹² to 10 ¹³ capsids / ml (eg, about 10 ¹³ capsids / ml).

  In formulating the medicament of the present invention, the active ingredient is formulated with one or more pharmaceutically acceptable carriers. Examples of pharmaceutically acceptable carriers include, but are not limited to, various buffers such as physiological saline, phosphate, acetate, and the like.

  Moreover, as long as the effect by this invention is not inhibited, the pharmaceutical of this invention may contain other therapeutic components other than the said component. Examples of such therapeutic components include known drugs as therapeutic agents for retinitis pigmentosa, age-related macular degeneration, or retinal detachment.

  The medicament of the present invention can be formulated into, for example, an injection for local administration, an eye drop or an eye wash. Injectable formulations may be presented in unit dosage form, for example in ampoules or multi-dose containers, with the addition of preservatives. Alternatively, the medicament of the present invention may be a lyophilized agent for reconstitution prior to use with a suitable vehicle, such as sterile pyrogen-free water.

  The administration of the medicament of the present invention is preferably performed by direct injection into the affected area of the subject, that is, the retina, or direct contact with the vitreous body.

  EXAMPLES Hereinafter, although an Example demonstrates this invention in detail, this invention is not limited to this.

1. Construction of adeno-associated virus vector expressing fusion protein
In order to prepare an adeno-associated virus vector (AAV-ChR2Cyan) expressing a ChR2Cyan fusion protein, first, a plasmid vector pAAVST-ChR2Cyan was prepared.

MRNA was extracted from Chlamydomonas, cDNA was synthesized, and PCR was performed using the following F1 and R1 primers to amplify ChR2 fragments corresponding to amino acid residues 1 to 315 of ChR2. Using the following primers F2 and R2 with EcoRI and BamHI added to forward and reverse, respectively, amplified ChR2 was subjected to PCR again, EcoRI and BamHI sites were added, and introduced into the EcoRI and BamHI sites of pAAVST.
F1 primer: ACCATGGATTATGGAGGCGCCCTG (SEQ ID NO: 7)
R1 primer: CTTGCCGGTGCCCTTGTTGA (SEQ ID NO: 8)
F2 primer: TGAATTCCACCATGGATTATGGAGGCGCCCTG (SEQ ID NO: 9)
R2 primer: GTGGATCCTTGCCGGTGCCCTTGTTGA (SEQ ID NO: 10)

  A plasmid map of the plasmid vector pAAVST-ChR2Cyan thus prepared is shown in FIG.

  As a control, to create an adeno-associated virus vector (AAV-ChR2Venus) that expresses a fusion protein of ChR2 and Venus (Ex: 515, EM: 528; that is, emits light that does not overlap with the sensitive wavelength range of ChR2) The plasmid vector pAAVST-ChR2Venus was prepared according to the method described in Tomita H et al (described above).

  Three types of plasmid vectors pAAVST-ChR2Cyan or pAAVST-ChR2Venus thus prepared, plasmid pAAV-RC containing the gene encoding viral replication and coat protein, and plasmid pHelper containing the viral replication origin are introduced into cultured 293 cells. As a result, viruses of AAV-ChR2Cyan and AAV-ChR2Venus were produced, respectively. Virus particles were purified by the SSCP method (literature Auricchio A, Hildinger M, O'Connor E, Gao GP, Wilson JM. Isolation of highly infectious and pure adeno-associated virus type 2 vectors with a single-step gravity-flow column. Hum Gene Ther. 2001; 12: 71-76.). Viral titers were measured using the Progen AAV2 Titration ELISA kit (Progen Biotechnik, Heidelberg). This kit is based on ELISA using an antibody against viral coat protein.

All of the purified virus solutions yielded virus solutions of 5 × 10 ¹² capsids / ml or more. This was adjusted with Phasphate buffered saline (PBS) to 5 × 10 ¹² capsids / ml and used in the following experiments.

2. Verification of increased photosensitivity at low illuminance associated with recovery of visual function in genetically blind rats As genetically blind rats, Royal College of Surgeons (RCS) rats that genetically cause photoreceptor cell degeneration were used. Ketamine hydrochloride (33 mg / kg) and xylazine hydrochloride (66 mg / kg) were intramuscularly injected and anesthetized. The eye was instilled with an eye drop anesthetic. Using a 10 μl microsyringe, 5 μl of the virus solution was injected into the vitreous. AAV-ChR2Cyan was administered to the right eye and AAV-ChR2Venus was administered to the left eye. Visual evoked potentials were measured every 6 to 1 week after injection. A blue LED was used as the stimulus light for visual evoked potential measurement, and the intensity of the stimulus light was adjusted by the current value supplied to the LED. The illuminance of the stimulation light was measured at a location 10 cm away from the stimulation light.

  In light stimulation of 240 lux or more, there was no significant difference in the amplitude of the visual evoked potential in both AAV-ChR2Cyan and AAV-ChR2Venus. In the AAV-ChR2Venus eye, no response to light stimulation was observed with stimuli of less than 240 lux, whereas in the AAV-ChR2Cyan eye, visual evoked potentials were recorded with stimuli of 110 lux and higher, and the amplitude was significantly higher ( Figure 2).

  In this way, a fusion protein of a photoreceptor channel protein and a fluorescent protein that emits light having a wavelength at which the protein is sensitive has been detected in a genetically-blind rat into which the photoreceptor channel protein has been recovered along with the recovery of visual function. It was found that the sensitivity was significantly increased.

FIG. 1 shows a plasmid map of the plasmid vector pAAVST-ChR2Cyan used for the production of the adeno-associated virus vector AAV-ChR2Cyan used in the Examples. FIG. 2 shows that photosensitivity at low illumination was improved in genetically blind rats expressing the fusion protein of the present invention.

Claims (15)

  A fusion protein of a photoreceptor channel protein and a fluorescent protein, wherein the fluorescent protein emits light having a sensitivity wavelength of the photoreceptor channel protein when excited by visible light.   2. The fusion protein of claim 1, wherein the photoreceptor channel protein is channelrhodopsin-2 (ChR2).   3. The fusion protein according to claim 2, wherein channelrhodopsin-2 is derived from chlamydomonas reinhardtii. 2. The fusion protein according to claim 1, wherein the photoreceptor channel protein is a polypeptide according to any one of the following (a) to (c).
(a) a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2
(b) a polypeptide comprising a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence shown in SEQ ID NO: 2 and having a biological activity equivalent to the polypeptide of (a)
(c) a polypeptide having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 2 and having a biological activity equivalent to the polypeptide of (a) 2. The fusion protein according to claim 1, wherein the photoreceptor channel protein is a polypeptide according to any one of the following (a) to (c).
(a) a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 4
(b) a polypeptide comprising a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence shown in SEQ ID NO: 4 and having a biological activity equivalent to the polypeptide of (a)
(c) a polypeptide having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 4 and having a biological activity equivalent to the polypeptide of (a)   The fusion protein according to any one of claims 1 to 5, wherein the fluorescent protein is a Cyan fluorescent protein.   7. The fusion protein according to claim 6, wherein the Cyan fluorescent protein is derived from Anemonia majano. The fusion protein according to any one of claims 1 to 5, wherein the fluorescent protein is a polypeptide according to any one of the following (a) to (c).
(a) a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 6
(b) a polypeptide comprising one or several amino acid deletions, substitutions, additions or insertions in the amino acid sequence shown in SEQ ID NO: 6 and having optical properties equivalent to the polypeptide of (a)
(c) a polypeptide having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 6 and having optical properties equivalent to the polypeptide of (a)   A polynucleotide encoding the fusion protein according to any one of claims 1 to 8.   10. An expression vector comprising the polynucleotide of claim 9 operably linked to a promoter.   11. The expression vector according to claim 10, which is a viral vector.   Use of the fusion protein according to any one of claims 1 to 8 or the expression vector according to claim 10 or 11 in the manufacture of a medicament for treating a subject suffering from a disorder of the outer retina.   13. The use according to claim 12, wherein the disorder of the outer retina is retinitis pigmentosa, age-related macular degeneration, or retinal detachment.   A pharmaceutical composition for treating a disorder of the outer retina, comprising the fusion protein according to any one of claims 1 to 8 or the expression vector according to claim 10 or 11 as an active ingredient.   15. The pharmaceutical composition according to claim 14, wherein the disorder of the outer retina is retinitis pigmentosa, age-related macular degeneration, or retinal detachment.

Images