JP2009195147A - Method for detecting and determining nematode in soil, and consolidation tool of soil sample usable for the method - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for readily and accurately detecting and determining nematodes in soil by extracting nucleic acids from the nematodes in the soil within a short time in high efficiency. <P>SOLUTION: The method for extracting the nucleic acids from the nematodes in the soil includes the following steps (a) and (b), and the method for detecting and determining the nematodes in the soil includes the following steps (a) to (c): (a) a step M for consolidating the soil sample collected from the soil; (b) a step for extracting the nucleic acids from the soil sample consolidated by the step of (a); and (c) a step for detecting or determining the nucleic acids extracted by the step (b). <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a method for extracting nucleic acids from nematodes in soil, and a soil diagnostic method for detecting and quantifying plant parasitic nematodes in soil that are involved in crop diseases. More specifically, a method of extracting a nucleic acid with high efficiency by destroying a nematode in a soil sample by compacting the soil sample, and a line in the soil by detecting or quantifying the extracted nucleic acid. The present invention relates to a method for detecting and quantifying insects quickly and accurately. The present invention also relates to a compacting device having a mechanism capable of manually applying a strong pressure to a soil sample.

In the cultivation of agricultural products, soil diseases caused by the infection of agricultural products with nematodes in the soil become a problem. Nematodes that inhabit the soil are roughly classified into self-active nematodes beneficial to plants and plant parasitic nematodes harmful to plants, and the latter plant parasitic nematodes cause soil diseases.
Autoactive nematodes include predatory nematodes that prey on protozoa and other nematodes, and corrosive nematodes that decompose organic matter such as fallen leaves, which are beneficial for crops. Is.
On the other hand, plant parasitic nematodes are harmful to crops because they infest the roots of crops and die crops or reduce commercial value. In Japan, root-knot nematodes, cyst nematodes, and neptune nematodes are called three major parasitic nematodes and cause serious damage.

In order to control plant parasitic nematodes, soil fumigants etc. are used, but soil fumigants can not selectively control only plant parasitic nematodes, so by using soil fumigants, There is a problem that it also eliminates autoactive nematodes and other soil microorganisms that are beneficial to crops. Therefore, it is preferable to minimize the use of soil fumigants.
In order to reduce the use of soil fumigants, to prevent the use of unnecessary soil fumigants, avoid preventive use as much as possible, and determine how many nematodes parasitic on the cultivated crops live in the soil. A fumigant must be used after detection or quantification.
As a method of identifying nematodes inhabiting soil, the type of nematode is identified by observing the difference in the shape of the mouth or tail of the nematode or mouth needle by observation with an optical microscope, and the number of nematodes is counted. However, this method not only requires specialized knowledge and skill, but also requires a lot of labor and is not easy to perform.

As a method for easily detecting or quantifying nematodes in soil, the present inventors previously isolated nematodes from soil, amplified nucleic acids of the nematodes by PCR method or real-time PCR method, and detected or quantified. A method for quantification was developed (Patent Document 1, Non-Patent Document 1, and Non-Patent Document 2).
In these methods, when nucleic acids are extracted directly from soil, nucleic acids are hardly obtained or extraction efficiency is very poor. First, nematodes are separated from soil using the Bellman method or the two-layer centrifugal suspension method. There was a need to do.

The Bellman method is a separation method using the property that nematodes move from soil to water by their own activity. Specifically, (1) place a Japanese paper filter on the pan and put a soil sample, (2) fill the glass funnel with water, and (3) place the net so that the bottom of the pan is immersed in the water of the glass funnel. Place the dish in a glass funnel and (4) leave the nematode for 3 days at a temperature at which the nematode is active, and move the nematode from the soil into the water to separate the nematode from the soil. .
The Bellman method is the most widely used nematode separation method, but it takes 2 to 3 days for the separation as described above, and the separation rate is low, which affects the motility of the nematode. This has a serious drawback that the separation rate changes under the influence of physiological conditions and soil conditions of nematodes (Non-patent Document 3).

The two-layer centrifugal suspension method is a method of separating nematodes and soil particles by the difference in density.
Specifically, (1) put a soil sample in a centrifuge tube, add water to suspend it, (2) gently inject the specific gravity solution into the bottom of the centrifuge tube, and (3) centrifuge the centrifuge tube. The soil particles with relatively high density are precipitated to form a soil particle layer, and the nematodes with relatively low density are separated near the interface between the water layer and the specific gravity liquid layer, and (4) the water layer and the specific gravity liquid layer. The nematode is separated by passing through the mesh.
The two-layer centrifugal suspension method is a method having a higher separation rate than the Bellman method, but requires a complicated operation with the centrifugal device as described above. In addition, cyst nematodes that survive in the form of eggs with a small amount of soil that can be tested tend to settle due to the adhesion of soil particles, so the separation rate is low, and in soils with high organic matter and clay content, the nematode separation rate decreases. It has various drawbacks such as poor separation of large nematodes (Non-patent Document 3).

As mentioned above, it is not possible to collect all nematodes from soil using any separation method, and the separation rate varies depending on the type of soil collected and the motility of the nematodes. The nematode could not be accurately quantified. Further, these separation methods require a great deal of labor and time, and cannot provide a simple and inexpensive soil diagnosis method.

JP 2007-74905 A Takeki Toyoda (Koki TOYOTA), 4 others, Soil Science and Plant Nutrition, February 2008, Vol. 54, No. 1, pp. 72-76 Erika Sato, four others, Japanese Journal of Nematology, December 2007, Vol. 37, No. 2, pp. 87-92 Edited by the Japanese Nematode Society, “Nematode Experimental Method”, March 2004, pp. 86-95

  Therefore, in view of the above-mentioned conventional situation, the present invention provides a method for detecting or quantifying nematodes in soil easily and accurately by extracting nucleic acids from nematodes in soil in a short time and with high efficiency. With the goal.

  In order to solve the above-mentioned problems, the present inventors have conducted extensive studies, and surprisingly, when the soil sample is consolidated, the pores in which nematodes can inhabit are reduced and nematodes are destroyed. It was found that the nematode nucleic acid can be extracted from the soil in a short time and with high efficiency by omitting the step of separating nematodes by the double-layer centrifugal suspension method. In addition, when soil samples are consolidated, nematode nucleic acids can be extracted with high efficiency, so that nematodes in soil can be accurately detected or quantified without being greatly affected by differences in soil type or worm motility. As a result, the inventors have found out that the present invention can be achieved.

  That is, the present invention provides a method for detecting and quantifying nematodes in soils (I) to (XII) below, a compacting device used in the method, and a kit including the compacting device.

(I) A method for extracting nucleic acid from nematodes in soil, the method comprising the following steps:
(I) a step of compacting a soil sample collected from soil;
(B) A step of extracting nucleic acid from the soil sample consolidated by the step (a).

(II) A method for detecting or quantifying nematodes in soil, the method comprising the following steps:
(I) a step of compacting a soil sample collected from soil;
(B) a step of extracting nucleic acid from the soil sample consolidated by the step (a);
(C) A step of detecting or quantifying the nucleic acid extracted in the step (b).

(III) In the step (b), the soil sample is consolidated until the volume of pores having a diameter of 30 μm or more in the soil sample is reduced by 30 to 100%, as described in (I) or (II) above the method of.

(IV) In the step (I), the soil sample is consolidated until the dry density of the soil sample becomes 0.85 to 2.7 g / cm ^3. The method described.

(V) The nematode is a plant parasitic nematode, and the nucleic acid in the step (c) is a nucleic acid having a base sequence specific to the plant parasitic nematode, The method according to any one of (II) to (IV).

(VI) The method according to (V) above, wherein the plant parasitic nematode and the nucleic acid having a base sequence specific to the plant parasitic nematode are any of the following three combinations: :
Potato cyst nematode / nucleic acid having a base sequence of 100 to 200 residues out of the base sequence set forth in SEQ ID NO: 1;
Sweet potato root nematode / Nucleic acid having a base sequence of 100 to 200 residues out of the base sequence shown in SEQ ID NO: 2;
A nucleic acid having a base sequence of 100 to 200 residues among the base sequences set forth in soybean cyst nematode / SEQ ID NO: 3.
A nucleic acid having a base sequence of 100 to 200 residues out of the base sequence described in SEQ ID NO: 4.

(VII) The method according to any one of (II) to (VI), wherein in the step (c), the extracted nucleic acid is amplified and detected or quantified.

(VIII) The method according to any one of (II) to (VII) above, which further comprises the following step (d):
(D) A step of quantifying nematodes in a soil sample by comparing the amount of nucleic acids quantified in the step (c) above with the amount of nucleic acids quantified using a sample with a known amount of nematodes.

(IX) A compacting instrument used for compacting a soil sample in the method described in (I) to (VIII) above, further comprising a sample container for storing the soil sample.

(X) In the consolidation apparatus according to (IX), a support base (3) on which the sample container (1) can be installed, a main body (4) connected to the support base (3), an upper part of the main body (4), A fastener (5) slidable in the vertical direction by screwing, and a pressing portion (2) attached to the tip of the fastener (5), and sliding the fastener (5) downward. 10. A compaction device according to claim 9, characterized in that when it is moved, the compression part (2) fits into the sample container (1) and can be compacted by applying pressure to the soil sample.

(XI) In the consolidation device according to (X), the main body (4) has a substantially inverted U shape, and one end of the connecting portion between the support base (3) and the main body (4) is connected to the pivot portion (6). The other end of the connecting part of the support base (3) and the main body (4) is fixed by a jaw part (7) and a rotatable hook (8). A compaction instrument.

(XII) A kit for extracting nucleic acids from nematodes in soil, comprising the compacting device according to any of (IX) to (XI) and a reagent for extracting nucleic acids in soil samples.

(XIII) Detecting nematodes in soil, comprising the consolidation device according to any one of (IX) to (XI), a reagent for extracting nucleic acid in a soil sample, and a reagent for detecting or quantifying nucleic acid Kit to quantify.

  The method for extracting nucleic acids from nematodes in soil according to the present invention reduces the pores in which nematodes can inhabit and destroys nematodes by compacting the soil, so that nematode nucleic acids are efficiently extracted from soil. There is an effect that it can be extracted. According to the method for detecting or quantifying nematodes in soil according to the present invention, nucleic acids can be extracted with high efficiency by compacting a soil sample. Therefore, nematodes from soil such as the Bellman method and the two-layer centrifugal suspension method can be extracted. It does not require a separation step and enables detection or quantification in a short time. Furthermore, according to the method for detecting or quantifying nematodes in soil according to the present invention, there is little problem that the extraction efficiency varies depending on the type of soil, and the extraction efficiency does not vary due to the difference in the exercise ability of the nematodes. Thus, nematodes can be detected or quantified more accurately.

In the method of the present invention, when the soil sample is consolidated until the number of pores having a diameter of 15 μm or more in the soil sample is reduced by 30 to 100%, or the dry density of the soil sample is 0.85 to 2.7 g / cm ³ . When the soil sample is consolidated until it becomes, the nematode is more reliably destroyed and the nucleic acid extraction efficiency is increased by 1.2 to 7 times or more (see Example 2). Since it is possible to extract with efficiency near 100% (see Example 5), nematodes can be detected or quantified more accurately.
In the step (c) of the method of the present invention, when a nucleic acid having a sequence specific to a plant parasitic nematode is detected or quantified, it is parasitic on a specific plant parasitic nematode, for example, a crop to be cultivated. It is possible to accurately and easily detect or quantify only the nematodes that do so, making it possible to accurately determine the suitability of the use of soil fumigants, reducing the number of wasteful use of pesticides, and reducing the microbial environment of the soil. A pesticide-reducing farming method that can keep as much as possible can be implemented.

Hereinafter, the best mode for carrying out the present invention will be described. The present invention is not limited to this form.
The method for extracting nucleic acid from nematodes in soil of the present invention comprises the following steps (a) and (b).
(I) a step of compacting a soil sample collected from soil;
(B) A step of extracting nucleic acid from the soil sample consolidated by the step (a).
Here, the soil sample collected from the soil is preferably a soil sample simply sampled from cultivated land or the like, but is a soil sample obtained by adding physical or chemical treatment such as cryopreservation to the sampled one. Also good.

  Here, consolidation means increasing the density of soil by applying pressure. Any method may be used for the compaction as long as it reduces the pores in the soil where nematodes can inhabit. However, a soil sample is packed in a closed space such as a container, and pressure is applied. The method of further narrowing the space filled with soil samples is preferable. The degree of consolidation may be such that the volume of voids having a diameter of 15 μm or more inhabiting nematodes is reduced by 30% or more, preferably 60% or more, more preferably 90% to 100%. The volume of voids having a diameter of 15 μm or more can be measured by the method described in Example 3. The pressure required to perform such consolidation varies depending on the soil sample.

Another index for the degree of compaction of the soil sample includes the dry density of the soil sample. For example, the soil sample is preferably compacted until the dry density of the soil sample becomes 0.85 to 2.7 g / cm ³ . More preferably, the soil sample is compacted until the dry density of the soil sample becomes 0.95 to 1.2 g / cm ³ . In the present invention, the dry density measurement method is based on the method described in “Soil Environmental Analysis Method” (Japan Soil Fertilizer Society, 1997).
Moreover, as another parameter | index, the volume of a soil sample is mentioned, It is preferable to compact until the volume of a soil sample reduces 50 to 80%. More preferably, compaction is performed until the volume of the soil sample is reduced by 60% or more.

In the step (a) of the present invention, as a method for extracting nucleic acid from a compacted soil sample, a method for extracting nucleic acid from microorganisms in soil or an improved method thereof can be used. In particular, a method called a direct extraction method (Direct Lysis Method) for extracting nucleic acids of microorganisms directly from soil is preferable. Here, the nucleic acid is DNA or RNA.
The direct extraction method is based on the method originally developed by Ogram et al. (Ogram et al., 1987, J. Microbiol. Methods, vol.7, pp.57-66). It consists of two steps: I) destruction of cells in soil and (II) separation and purification of nucleic acids.

The step (I) includes three methods: (1) chemical treatment, (2) physical treatment, and (3) enzymatic treatment. (1) As a chemical treatment, surfactants such as SDS and LDS, phenol / chloroform, benzyl chloride, guanidine thioocyanate (GTC) and the like can be used. Of these, use of a surfactant, particularly SDS, is preferable because of good extraction efficiency. As physical treatment, bead beating (bead-beating) that destroys cells by shaking vigorously with small glass beads or zirconia beads, heating, freezing / thawing, etc. can be used. Is preferable because various forms of cells can be destroyed. As the enzymatic treatment, lysozyme, proteinase K, achromopeptidase, pronase and the like are used, and it is particularly preferable to use lysozyme.
These methods can be used in various combinations, but among them, the method combining the surfactant and the bead beating method is the most powerful method for destroying cells.
In order to prevent the loss of nucleic acid molecules adsorbed on soil particles or digested by degrading enzymes during cell destruction, a chelating agent such as EDTA or Chelex100, sodium phosphate buffer, or a high concentration of 1 M or more A salt solution or the like can be added.
In addition, RNA can be extracted while preventing degradation of RNA by using guanidine thiocyanate, sarkosyl, mercaptoethanol or the like (YU-Li et al., 1991, Applied and Environmental Microbiology). , vol.57, pp.765-768)

In the method of the present invention, since the nematode is destroyed by the process of compacting the soil sample, the step (I) is not absolutely necessary, but the synergistic effect combined with the step (I) Thus, nucleic acid can be extracted with high efficiency. For example, by combining the step of compacting a soil sample and the step (I), it is possible to extract nucleic acids with an efficiency that is 1.2 to 7 times higher than in the case of only the step (I). (See Examples 2 and 5).

In the step (II), only the nucleic acid must be extracted from the soil sample containing various contaminants, and therefore, multiple steps of purification are often required.
First, humic substances in the soil can be removed by adding cetyltrimethylammonium bromide (CTAB) or polyvinylpolypyrrolidone (PVPP) that forms a complex with denatured proteins and polysaccharides and cell residues.
The nucleic acid can be purified by deproteinization by organic solvent extraction and the like, and concentration of the nucleic acid by alcohol precipitation or the like. Deproteinization can be performed by salting out using a saturated salt solution in addition to extraction with an organic solvent such as phenol, phenol-chloroform, chloroform-isoamyl alcohol and the like.
For concentration of nucleic acid, alcohol precipitation with ethanol or isopropanol or precipitation with polyethylene glycol (PEG) can be used.

  In order to further purify the nucleic acid purified as described above, agarose electrophoresis, CsCl density gradient centrifugation, gel filtration chromatography, or the like can be used. In addition, the nucleic acid can be purified by using a commercially available DNA purification kit or column.

  In addition to the above method, a nucleic acid can also be extracted from a compacted soil sample using a commercially available soil extraction kit. For example, ISOIL for Beads Beating (Nippon Gene), Fast DNA spin kit for soil (registered trademark, Qbio gene, USA), UltraClean Soil DNA kit (registered trademark, Mobio, USA) and the like are commercially available. As a kit for extracting RNA, Bio101 FastRNA Pro Soil-Direct Kit (registered trademark, Qbiogene, USA) is commercially available.

By detecting or quantifying the nucleic acid extracted by the above method, nematodes in the soil can be detected or quantified.
That is, this invention provides the method of detecting or quantifying the nematode in soil characterized by including the process of the following (i)-(c).
(I) a step of compacting a soil sample collected from soil;
(B) a step of extracting nucleic acid from the soil sample consolidated by the step (a);
(C) A step of detecting or quantifying the nucleic acid extracted in the step (b).

Here, in order to detect or quantify the nucleic acid, the extracted nucleic acid may be detected or quantified as it is, but since the amount of nematode nucleic acid is very small, the extracted nucleic acid may be amplified for detection or quantification. preferable. The method for amplifying the nucleic acid is not particularly limited, and PCR method, LAMP method, ICAN method and the like can be used.
When nucleic acid is detected or quantified, if a nucleic acid having a base sequence specific to a specific plant parasitic nematode is detected or quantified, whether the specific plant parasitic nematode exists in the soil. It is possible to detect and quantify whether or not it exists. In order to detect or quantify a nucleic acid having such a base sequence, for example, it is specifically amplified using a primer complementary to the nucleic acid having the base sequence and / or complementary to the nucleic acid having the base sequence. Can be detected or quantified by hybridizing a typical probe.

The method for detecting the extracted nucleic acid or the nucleic acid obtained by amplifying the nucleic acid is not limited to these, but a method of hybridizing with a complementary nucleic acid labeled with fluorescence, chemiluminescence, enzyme or radioactive signal, real-time PCR. And a method of separating by electrophoresis, a method of binding to a labeled antibody, a method of hybridizing with a labeled peptide nucleic acid, a method of using an electrochemical sensor, a method of using a microarray / gene chip, and the like. Among these, it is preferable to quantify by real-time PCR.

Real-time PCR uses a nucleic acid to be quantified as a template, and causes a fluorescent substance to act when performing a double-stranded DNA synthesis reaction using two PCR primers (primer sets) called F and R primers. This is a PCR method in which a fluorescent signal is generated when the synthesis reaction occurs. In this method, the amount of PCR product generated can be monitored in real time while continuing the PCR reaction, and the template can be quantified based on the amplification curve.
Such a real-time PCR method can be performed using various commercially available instruments and systems. For example, Applied Biosystems 7900HT Fast (Applied Biosystems), LightCycler (registered trademark, Roche Diagnostics), iCycler iQ (registered trademark). Bio-Rad Laboratories) and the like can be used.

In the method for detecting or quantifying nematodes in soil according to the present invention, a specific nematode, for example, potato cyst nematode, sweet potato nematode, soybean cyst nematode, or northern nematode nematode can be detected or quantified. That is, in order to detect or quantify potato cyst nematodes, in the step (c) of the present invention, a nucleic acid having a base sequence of 100 to 200 residues of the base sequence described in SEQ ID NO: 1 is detected or quantified. For example, it can be detected or quantified by specifically amplifying the nucleic acid using a primer having the base sequence described in SEQ ID NOs: 5 and 6.
As primers, for example, the following primer pairs can be used.
PCN280f (5 '→ 3'): GCGTCGTTGAGCGGTTGTT (SEQ ID NO: 5)
PCN398r (5 '→ 3'): CCACGGACGTAGCACACAAG (SEQ ID NO: 6)

In order to detect or quantify sweet potato nematode, in the step (c) of the present invention, a nucleic acid having a base sequence of 100 to 200 residues of the base sequence described in SEQ ID NO: 2 may be detected or quantified. For example, it can be detected or quantified by specifically amplifying the nucleic acid using a primer having the nucleotide sequence set forth in SEQ ID NOs: 7 and 8.
As primers, for example, the following primer pairs can be used.
RKNf (5 '→ 3'): GCTGGTGTCTAAGTGTTGCTGATAC (SEQ ID NO: 7)
RKNr (5 '→ 3'): GAGCCTAGTGATCCACCGATAAG (SEQ ID NO: 8)
Since the above-mentioned primer pair can also detect Java root-knot nematodes and arenaria root-knot nematodes, it can also be used as a primer for detecting root-knot nematodes.

In order to detect or quantify soybean cyst nematode, in the step (c) of the present invention, a nucleic acid having a base sequence of 100 to 200 residues of the base sequence described in SEQ ID NO: 3 is detected or quantified. Well, for example, it can be detected or quantified by specifically amplifying the nucleic acid using a primer having the base sequence described in SEQ ID NOs: 9 and 10.
As primers, for example, the following primer pairs can be used.
forward (5 '→ 3'): CTAGCGTTGGCACCACCAA (SEQ ID NO: 9)
reverse (5 ′ → 3 ′): AATGTTGGGCAGCGTCCACA (SEQ ID NO: 10)

In order to detect or quantitate the northern root nematode, in the step (c) of the present invention, a nucleic acid having a base sequence of 100 to 200 residues out of the base sequence described in SEQ ID NO: 4 is detected or quantified. Well, for example, it can be detected or quantified by specifically amplifying the nucleic acid using primers having the nucleotide sequences set forth in SEQ ID NOs: 11 and 12.
As primers, for example, the following primer pairs can be used.
NEGf (5 '→ 3'): ATTCCGTCCGTGGTTGCTATG (SEQ ID NO: 11)
NEGr (5 '→ 3'): GCCGAGTGATCCACCGATAAG (SEQ ID NO: 12)

In the method of the present invention, the amount of nucleic acid derived from nematode in the soil quantified by the above method is compared with the amount of nucleic acid quantified using a sample of which the amount of nematode is known. Nematodes can be quantified. Here, examples of the sample having a known amount of nematodes include, for example, a soil sample in which the amount of nematodes is known by counting nematodes in soil, or a plant parasitic line separated from soil and selected by type. Nucleic acids having sequences specific to the worm itself or plant parasitic nematodes can be used. Quantification of a sample with a known amount of nematode may be performed separately from the soil sample for which the nematode is to be quantified, or may be added to the soil sample for which the nematode is to be quantified to serve as an internal standard. When the internal standard is used, it is necessary to use a nematode of a different type from the nematode to be quantified or its nucleic acid or another nucleic acid with low homology. The method for quantifying nematodes in soil according to the present invention can extract nucleic acids with high efficiency by compacting a soil sample, and in some cases can extract with 100% efficiency. Therefore, even if a sample with a known amount of nematode is quantified separately from the soil for which the nematode is to be quantified without using it as an internal standard, the error due to the difference in extraction efficiency due to the type of soil is small, Accurate quantification is possible.

The present invention also provides an apparatus suitable for compacting a soil sample. The compacting instrument of the present invention includes a sample container for storing a soil sample, and a compression unit that applies pressure to the soil sample in the sample container.
One of the preferable embodiments of the consolidation device of the present invention is a device as shown in FIG. In other words, a support base (3) on which the sample container (1) can be installed, a main body (4) connected to the support base (3), and a tightening that can be slid vertically by screwing the upper part of the main body (4) An attachment tool (5) and a compression portion (2) attached to the tip of the fastening tool (5) are provided, and when the fastening tool (5) is slid downward, the sample container (1) is compressed. The compacting device is characterized in that the part (2) is inserted and can be compacted by applying pressure to the soil sample.
FIG. 2 shows a state in which the fastener (5) attached to the main body (4) is slid up and down in the compacting device of the present invention. The consolidation device of the present invention may be manufactured using any material, but iron is preferably used as a material from the viewpoint of stability.
Since this compaction instrument can manually apply a high pressure to the soil sample and is compact and easy to carry, the method of the present invention can be easily implemented.

Further, the main body (4) has a substantially inverted U-shape, and one end of the connecting portion between the support base (3) and the main body (4) is rotatably connected via the pivot portion (6), and the support base (3 ) And the other end of the connecting portion of the main body (4) can be fixed by the jaw (7) and the rotatable hook (8), the hook (8) is rotated and the jaw (7) The sample container (1) can be easily removed or installed by removing and rotating the main body (4) around the pivot (6).
Here, the sample container (1) can be a cylindrical metal container, and the support base (3), the main body (4), the jaw part (7) and the hook (8) can be manufactured by: . Also,

The present invention also provides a kit for extracting nucleic acids from nematodes in soil, comprising the above-described compaction device and a reagent for extracting nucleic acids in soil samples. Here, the reagent for extracting nucleic acid in the soil sample is not limited to these, but is a cell lysis reagent including a surfactant, beads and / or lysozyme, phenol, chloroform, alcohol, PEG, CTAB. And / or a nucleic acid purification reagent containing PVPP, and a purification column.

The present invention also provides a kit for detecting or quantifying nematodes in soil, comprising the above-described compaction instrument, a reagent for extracting nucleic acids in soil samples, and a reagent for detecting or quantifying nucleic acids. Here, the reagent for detecting or quantifying the nucleic acid is not limited to these, but labeled with polymerase, reverse transcriptase, reaction buffer, dNTP mix, primer, fluorescent dye, radioisotope, or the like. Examples include probes and hybridization buffers.

  EXAMPLES Next, although an Example demonstrates this invention further in detail, this invention is not limited to these aspects.

(Extraction of nematode nucleic acids in soil)
(Consolidation of soil samples)
Using the compaction apparatus shown in FIG. 1, about 30 g of soil (humic black soil) was filled into a 100 cm ³ cylindrical sample container, and compacted under the following three conditions. Next, using a spatula or a flat-blade screwdriver, the soil was taken out from the cylindrical sample container and loosened sufficiently to prepare the following three types of samples.
No compaction: no compaction (dry density 0.5 g / cm ³ )
There compaction: compaction about Large (dry density 1.16 g / cm ³ or so)

(Agitation of soil sample)
The above two kinds of soil samples and TE buffer were mixed at a ratio of 1: 1 (w / v). Next, the mixture was put into each soil stirrer (AUTO CELL MASTER CM-200 ASONE) and stirred at 15000 rpm for 10 minutes.
(DNA extraction from soil)
(1) The nematode suspension obtained by the above stirring was put in a tube with a sterilized lid containing 0.75 g of zirconia beads (φ0.1 mm) and 0.25 g of glass beads (φ0.5 mm).
(2) After adding 0.7 ml of lysis buffer (0.5% SDS, 100 mM Tris-HCl (pH 8.0), 300 mM EDTA (pH 8.0)), the mixture was added with Bead beating 5000 rpm (bead type cell crusher BS12 Waken Pharmaceutical). After 2 seconds, centrifugation was performed at 12000 g for 5 minutes at room temperature.
(3) 700 μL of the supernatant was transferred to a new 2 mL Eppendorf tube, 377 μL of 5M NaCl and 270 μL of 10% CTAB were added, cultured at 60 ° C. for 10 minutes, and shaken several times in the middle.
(4) After cooling to room temperature, 500 μL of chloroform was added, vortexed for 15 seconds, centrifuged at 15000 g at room temperature for 20 minutes, and the aqueous layer was transferred to a new eppen.
(5) Chloroform was added again to the aqueous layer, and after centrifugation, 1200 μL of the aqueous layer was transferred to a new eppen (at 15000 g for 20 minutes).
(6) 720 uL of 20% PEG (20% POLYETHYLENEGLYCOL8000, 1.6M NaCl) was added, mixed, centrifuged at 15000 rpm, 4 ° C. for 20 minutes, and the supernatant was removed.
(7) 1 mL of 70% ethanol was added, stirred well, and then centrifuged (15000 rpm, 4 ° C., 2 minutes).
(8) After removing the solution, wash again with 70% ethanol (add 500 μL)
(9) The precipitate was lightly dried, and 100 μL of TE was added to obtain a DNA extraction sample.

(Agarose gel electrophoresis)
(1) 20 mL of 1 × TAE was mixed with 0.2 g of agarose.
(2) Heated in a microwave to completely dissolve the agarose.
(3) Pour into a mold and let stand for 1 hour to prepare an agarose gel.
(4) 10 μL of the above DNA extraction sample was mixed with 1 μL of 6 × loading buffer and set on a gel.
(5) The gel was run for 20 minutes with an electrophoresis apparatus (Mupid-exu TaKaRa).
(6) It was immersed in ethidium bromide solution for 20 minutes, the gel was stained, and it was confirmed that nucleic acid could be extracted from the soil sample.

(Quantification by real-time PCR)
(1) The PC on which Smart Cycler (registered trademark) software Version 2.0 was installed and the Smart Cycler (registered trademark) II System were connected with a USB cable.
(2) The number of tubes to be reacted with the program according to the primer used was selected.
(3) The reaction tube for Smart Cycler (registered trademark) was placed on a cooled metal cooling stand. (Put on vinyl gloves to prevent fingerprints and other dirt from remaining on the tube.)
(4) Sterilized water, the following primers (forward / reverse), and SYBR (registered trademark) Premix Ex Taq (registered trademark) (TaKaRa Bio Inc.) were mixed according to the following Table 1 to prepare a master mix. (SYBR (registered trademark) Premix Ex Taq (registered trademark) is shaded)
Potato cyst nematode
PCN280f (5 '→ 3'): GCGTCGTTGAGCGGTTGTT
PCN280r (5 '→ 3'): CCACGGACGTAGCACACAAG
Root-knot nematode
RKNf (5 '→ 3'): GCTGGTGTCTAAGTGTTGCTGATAC
RKNr (5 '→ 3'): GAGCCTAGTGATCCACCGATAAG
Soybean cyst nematode
forward (5 '→ 3'): CTAGCGTTGGCACCACCAA
reverse (5 '→ 3'): AATGTTGGGCAGCGTCCACA
Kitanegusu nematode
NEGf (5 '→ 3'): ATTCCGTCCGTGGTTGCTATG
NEGr (5 '→ 3'): GCCGAGTGATCCACCGATAAG
(5) 5 μL of 100-fold diluted template DNA was placed in each tube and centrifuged.
(6) The master mix was dispensed into each tube and centrifuged.
(7) A tube was set in the Smart Cycler (registered trademark) II System (Cephied) and "Run" was started.
(8) After completion of the run, the tube was collected, the software was closed, and the Smart Cycler (registered trademark) II System was turned off.

The results of the above real-time PCR are shown in FIGS.
As shown in FIG. 3, it can be confirmed that with the compaction treatment, the fluorescence intensity of real-time PCR rises faster and the DNA fragment amplified from the melt curve is derived from the target soybean cyst nematode.
As is clear from FIG. 4, the Ct value was 27.1 ± 0.17 in the consolidated sample, whereas the Ct value was 30.0 ± 0.26 in the sample that was not consolidated, which was significantly faster by 2.9 times. It was. This means that the extraction efficiency of cyst nematode-derived DNA is increased by about 7.6 times due to consolidation.

  FIG. 5 shows pF-moisture curves for soils consolidated to different extents (until the volume decreases by 30%, 40%, 50%, respectively). It can be seen that when the moisture content is pF1 (corresponding to a pore of 1 kPa = 300 μm), the moisture content of the soil varies greatly depending on whether compaction is present. Since this water content represents the amount of pores, it can be seen that the amount of water decreases with consolidation, the amount of pores decreases. It can be seen that the tendency of the moisture content to differ depending on the presence or absence of compaction continues up to pF2.3 (corresponding to 20 kPa = 15 μm pores), that is, pores with a size of 15 μm or more are reduced by compaction. Incidentally, the amount of pores can be easily determined by a pressure plate method (for example, DIK-3404 wide area soil pF measuring instrument manufactured by Daikai Rika Kogyo Co., Ltd.). Further, in this figure, the portion with a moisture content lower than pF2.3 is shown by a single curve, which indicates that the pore volume of 15 μm or less is not affected by consolidation.

Using the apparatus of FIG. 1, the soil can be compacted to any dry density. In other words, when 50 g (dry weight) of soil is filled in a 100 cc cylindrical sample container, the height of the black soil used in this experiment is 5 cm. The dry density at this time corresponds to 0.5 g / cm ³ . If this is consolidated sequentially and the height is 2.5 cm, it becomes 1.0 g / cm3. That is, it is possible to adjust the soil to an arbitrary dry density by adjusting the height according to the degree of consolidation while keeping the soil to be used constant.
The graph which plotted the amount of nematode reduction | decrease at the time of consolidating black Iodite to each dry density is shown in FIG.

  Negussa nematode was bisected, one was added to the soil and the other was not added to the soil and completely destroyed in solution. The soil to which Negusa nematode was added was consolidated, DNA was extracted from it, and the northern nematode nematode was quantified by real-time PCR. The result is shown in FIG. When the value obtained by quantifying the nematode nematode using a solution that was completely destroyed in the control solution was taken as 100, when the soil was consolidated, it became the same 100 as the solution, but the soil was not consolidated, The amount of Negusale nematode extracted from the soil using ordinary methods was quantified and was less than 20. In other words, it is understood that the efficiency increased by a factor of 4 due to compaction, and that all the northern root nematodes added to the soil by consolidation could be recovered and detected.

The method for extracting nucleic acids from nematodes in soil, the method for detecting and quantifying nematodes in soil, the compacting device used in the method and the kit including the compacting device according to the present invention are: It is useful in the field of

It is the front view which showed each part structure of the compaction instrument of this invention. It is a figure which shows the state which slid the fastening tool of the compaction instrument of this invention up and down. It is a figure which shows the melt curve and amplification curve of real-time PCR. It is a figure which shows the result of real-time PCR. FIG. 3 is a diagram showing pF-water curves of soils consolidated at different degrees. It is the figure which showed the relationship between the dry density at the time of compacting soil, and a nematode reduction amount. It is a figure which shows the result of having compared the extraction efficiency of a nucleic acid.

Explanation of symbols

DESCRIPTION OF SYMBOLS 1 ... Sample container 2 ... Compression part 3 ... Support stand 4 ... Main body 5 ... Fastening tool 6 ... Pivoting part 7 ... Chin part 8 ... Hook

Claims (13)

A method for extracting nucleic acids from nematodes in soil, comprising the following steps:
(I) a step of compacting a soil sample collected from soil;
(B) A step of extracting nucleic acid from the soil sample consolidated by the step (a). A method for detecting or quantifying nematodes in soil, comprising the following steps:
(I) a step of compacting a soil sample collected from soil;
(B) a step of extracting nucleic acid from the soil sample consolidated by the step (a);
(C) A step of detecting or quantifying the nucleic acid extracted in the step (b).   3. The method according to claim 1, wherein in the step (a), the soil sample is consolidated until the volume of pores having a diameter of 15 μm or more in the soil sample is reduced by 30 to 100%. The method according to claim 1 or 2, wherein in the step (a), the soil sample is consolidated until the dry density of the soil sample becomes 0.85 to 2.7 g / cm ³ .   The nematode is a plant parasitic nematode, and the nucleic acid in the step (c) is a nucleic acid having a base sequence specific to the plant parasitic nematode, 5. The method according to any one of 4. The method according to claim 5, wherein the plant parasitic nematode and the nucleic acid having a base sequence specific to the plant parasitic nematode are any one of the following three combinations:
Potato cyst nematode / nucleic acid having a base sequence of 100 to 200 residues out of the base sequence set forth in SEQ ID NO: 1;
Sweet potato root nematode / Nucleic acid having a base sequence of 100 to 200 residues out of the base sequence shown in SEQ ID NO: 2;
A nucleic acid having a base sequence of 100 to 200 residues among the base sequences set forth in soybean cyst nematode / SEQ ID NO: 3.
A nucleic acid having a base sequence of 100 to 200 residues out of the base sequence described in SEQ ID NO: 4.   The method according to any one of claims 2 to 6, wherein in the step (c), the extracted nucleic acid is amplified and detected or quantified. The method according to any one of claims 2 to 7, further comprising the following step (d):
(D) A step of quantifying nematodes in a soil sample by comparing the amount of nucleic acids quantified in the step (c) above with the amount of nucleic acids quantified using a sample with a known amount of nematodes.   9. A compacting instrument used for compacting a soil sample in the method according to claim 1, further comprising a sample container for storing the soil sample.   The compaction device according to claim 9, wherein the support base (3) on which the sample container (1) can be installed, the main body (4) connected to the support base (3), and the upper part of the main body (4) are screwed together. When provided with a fastener (5) slidable in the vertical direction and a compression part (2) attached to the tip of the fastener (5), and sliding the fastener (5) downward, The compacting device according to claim 9, characterized in that the compression part (2) fits into the sample container (1) and can be compacted by applying pressure to the soil sample.   The consolidation device according to claim 10, wherein the main body (4) has a substantially inverted U-shape, and one end of the connecting portion of the support base (3) and the main body (4) is rotated via the pivot portion (6). A compacting device characterized in that the other end of the connecting portion of the support base (3) and the main body (4) can be fixed by a jaw (7) and a rotatable hook (8). .   The kit which extracts a nucleic acid from the nematode in soil containing the compacting instrument in any one of Claims 9-11, and the reagent which extracts the nucleic acid in a soil sample.   A kit for detecting or quantifying nematodes in soil, comprising the compacting device according to any one of claims 9 to 11, a reagent for extracting nucleic acids in a soil sample, and a reagent for detecting or quantifying nucleic acids.