JP2009180711A - Bio-marker - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an identifying and measuring method or the like of a bio-marker relevant to an inflammation disease. <P>SOLUTION: Early detection and early prevention of the inflammation disease or therapeutic effect can be effectively determined by measuring the amount of enzyme (for example, GalNAc4S-6ST or the like) for guiding surplus sulfation of chondroitin sulphuric acid or the change of the amount of chondroitin sulphuric acid sulfated with the enzyme. In other words, the material can be used as the bio-marker for the inflammation disease. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to biomarkers that can be used for diagnosis and inspection of inflammatory diseases.

  While various biomarkers are currently being developed, albumin contained in urine is an item to evaluate kidney function, and GPT and GOT in serum are frequently used as test items to evaluate liver function. (Non-patent Document 1). However, since these changes have already progressed in symptom and the results of organ function decline are targeted for evaluation, they are still not sufficient as methods for early detection.

  Prior art documents relating to the present invention are shown below.

Sharpe PC, Ann Clin Biochem, 38, 652-664, (2001)

  The identification of therapeutic factors related to diseases has become popular at the non-clinical experimental level, and therapeutic methods have been established focusing on these factors. In relation to this, the development of substances (biomarkers) that quantitatively measure changes in the body, such as proteins contained in urine and serum, and serve as indicators of the changes. The point of view of how to enable early detection of the disease and prevent the onset of the disease is considered to be a major focus of this biomarker development. An object of the present invention is to provide a biomarker identification and measurement method related to inflammatory diseases.

  It is necessary to develop a new evaluation index that can solve the above-mentioned problems, and the present inventor has eagerly studied a method different from the existing index.

  The present inventor measured the change in the amount of an enzyme (for example, GalNAc4S-6ST) that induces excessive sulfation of chondroitin sulfate, or the amount of chondroitin sulfate sulfated by the enzyme, thereby measuring the inflammatory disease. It was found that early detection and early prevention or treatment effects can be judged effectively.

  For example, for the first time, it is found that a substance such as GalNAc4S-6ST, C4ST, C6ST, chondroitin sulfate A, chondroitin sulfate C, or chondroitin sulfate E can be used as a biomarker as a measurement index for diagnosing or testing inflammatory diseases. Succeeded.

  The present inventor succeeded in newly identifying biomarkers that can be used for diagnosis and examination of inflammatory diseases, and completed the present invention.

The present invention relates to identification of biomarkers related to inflammatory diseases, and various methods using the biomarkers, more specifically,
[1] Inflammatory disease marker comprising a sulfate group transposase at position 4 or 6 of GalNAc constituting chondroitin sulfate, or chondroitin sulfate sulfated by the enzyme,
[2] The inflammation according to [1], wherein the sulfotransferase is GalNAc4S-6ST, C4ST, or C6ST, and the sulfated chondroitin sulfate is chondroitin sulfate A, chondroitin sulfate C, or chondroitin sulfate E. Disease markers,
[3] The marker according to [1] or [2], which is for diagnosis of inflammatory diseases, for determination of therapeutic effect or for determination of progress,
[4] The marker according to any one of [1] to [3], wherein the inflammatory disease is a disease caused by tissue fibrosis,
[5] A research reagent comprising the marker according to any one of [1] to [4] as a component,
[6] A reagent for diagnosing inflammatory diseases, for determining therapeutic effects, or for determining the degree of progression, comprising a substance having binding activity to the marker according to any one of [1] to [4],
[7] The reagent according to [6], wherein the substance is an anti-GalNAc4S-6ST antibody,
[8] A method for examining inflammatory diseases, comprising using the marker according to [1] or [2] as a detection marker,
[9] A method for determining the progress of an inflammatory disease, comprising the following steps (a) and (b):
(A) A step of measuring the amount of the marker according to [1] or [2] for a test sample collected from an individual at an interval (b) When the amount of the marker is increased, Step [10] for determining that the drug is progressing, a method for determining the therapeutic effect of a drug on inflammatory disease, comprising the following steps (a) and (b):
(A) a test sample collected from an individual before and after administration of a test drug, a step of measuring the amount of the marker according to [1] or [2] (b) the amount of the marker after administration decreases A step [11] in which the test drug is determined to have a therapeutic effect, comprising the following steps (a) and (b):
(A) About the sample isolate | separated from the subject, the process of measuring the quantity of the marker as described in [1] or [2] (b) Compared with the quantity in the sample isolate | separated from the healthy subject, If the amount is increased, a step of determining that the patient is suffering from an inflammatory disease is provided.

  GalNAc4S-6ST, which is a biomarker of the present invention, is localized as transmembrane type II in the Golgi apparatus in the cell, and is mainly chondroitin sulfate type A (sulfated at the 4-position of GalNAc residue in chondroitin sulfate) Oversulfate and convert to chondroitin sulfate type E. However, it has already been confirmed that this enzyme is cleaved at a hydrophilic site by a cleaving enzyme that has not yet been specified and exists in serum (Inoue, H. et al. (1986) J. Biol. Chem. 261 , 4470-4475). Therefore, the present invention was able to find an increased amount of GalNAc4S-6ST in the serum by measuring and comparing the amount of GalNAc4S-6ST in the untreated group; NASH, cirrhosis and control group. The findings shown in FIG. 1 indicate the amount of GalNAc4S-6ST that increases with progression of symptoms in the NASH group and the cirrhosis group.

  In addition, as a result of measuring serum in the group treated with the treatment method devised by the present inventors for cirrhosis mouse model, it was found that the amount of GalNAc4S-6ST in the increased serum decreased. It was. This can also be provided as a simple method by which the therapeutic effect can be estimated simply by measuring the amount of GalNAc4S-6ST in the serum. FIG. 2 shows the quantification of the amount of GalNAc4S-6ST after treatment of a cirrhosis mouse model. Treatment is by administration of cocktail siRNA in C6ST-1 and C6ST-2.

  As mentioned above, GalNAc4S-6ST was found to be available as a biomarker for inflammatory diseases.

  As an example of the present invention, serum is separated from blood of untreated group and treated group, the serum is adhered to a specially processed plate, and a GalNAc4S-6ST monoclonal antibody developed by the present inventor is used. By quantifying GalNAc4S-6ST remaining on the plate and comparing it with the amount of GalNAc4S-6ST in the control group, effective early detection and early prevention and prediction of the therapeutic effect can be performed.

[Mode for Carrying Out the Invention]
The present invention provides biomarkers (which may be described as “the marker of the present invention” in the present specification) that can be used for diagnosis and testing of inflammatory diseases.

  The marker of the present invention preferably includes a sulfotransferase using N-acetylgalactosamine (GalNAc) constituting chondroitin sulfate as a substrate. GalNAc is an N-acetyl form of galactosamine, a kind of hexosamine. In addition, N-acetylgalactosamine is known to undergo chemical modification at positions 1-6.

The enzyme is not particularly limited as long as it has an activity of transferring a sulfate group to the 4-position or 6-position of GalNAc, and an enzyme having a transfer activity of both the 4-position and the 6-position sulfate is also used in the present invention. Included in the above sulfotransferases. For example, the enzymes described in any of the following (a) to (i) can be mentioned.
(a) GalNAc4ST-1: N-acetylgalactosamine 4-sulfotransferase-1
Also known as CHST8: Carbohydrate (N-acetylgalactosamine 4-O) sulfotransferase 8
(b) GalNAc4ST-2
CHST9: Carbohydrate (N-acetylgalactosamine 4-O) sulfotransferase 9
(c) C4ST-1: chondroitin-4-O-sulfotransferase-1
Also known as CHST11: Carbohydrate (chondroitin 4) sulfotransferase 11
(d) C4ST-2
Also known as CHST12
(e) C4ST-3
Also known as CHST13
(f) C6ST-1: chondroitin-6-O-sulfotransferase-1
CHST3: Carbohydrate (chondroitin 6) sulfotransferase 3
(g) C6ST-2: chondroitin-6-O-sulfotransferase-2
CHST7: Carbohydrate (chondroitin 6) sulfotransferase 7
(h) GalNAc4S-6ST: N-acetylgalactosamine 4-sulfate 6-0 sulfotransferase
(i) D4ST-1: dermatan 4 sulfotransferase 1

  Information on the amino acid sequence of the sulfotransferase in the present invention or the DNA sequence encoding the amino acid sequence can be appropriately obtained using, for example, a public gene database. For example, accession numbers, base sequences, and amino acid sequences in the public gene database Genbank of enzymes that can be used as markers of the present invention are exemplified below.

GalNAc4ST-1 (Accession number NM_175140, nucleotide sequence SEQ ID NO: 1, amino acid sequence SEQ ID NO: 2)
GalNAc4ST-2 (Accession number NM_199055, nucleotide sequence SEQ ID NO: 3, amino acid sequence SEQ ID NO: 4)
C4ST-1 (Accession number NM_021439, nucleotide sequence SEQ ID NO: 5, amino acid sequence SEQ ID NO: 6)
C4ST-2 (Accession number NM_021528, nucleotide sequence SEQ ID NO: 7, amino acid sequence SEQ ID NO: 8)
C4ST-3 (Accession number XM_355798, nucleotide sequence SEQ ID NO: 9, amino acid sequence SEQ ID NO: 10)
D4ST (accession number NM_028117, nucleotide sequence SEQ ID NO: 11, amino acid sequence SEQ ID NO: 12)
C6ST-1 (Accession number NM_016803, nucleotide sequence SEQ ID NO: 13, amino acid sequence SEQ ID NO: 14)
C6ST-2 (Accession No. AB046929, SEQ ID NO: 15 of nucleotide sequence, SEQ ID NO: 16 of amino acid sequence)
GalNAc4S-6ST (accession number NM_015892, nucleotide sequence SEQ ID NO: 17, amino acid sequence SEQ ID NO: 18)

  For example, for non-human organisms, the homologous protein of the organism corresponding to the above enzyme can be used as appropriate as a marker for inflammatory diseases. The homologue has, for example, high homology (usually 70% or more, preferably 80% or more, more preferably 90% or more, most preferably 95% or more) with the sequence described in the sequence listing, and A protein having a function (for example, sulfate group transfer activity etc.) possessed by the protein can be used as a marker of the present invention. The protein is, for example, one or more amino acids added, deleted, substituted, inserted in the amino acid sequence described in any of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18. The number of amino acids that usually changes varies within 30 amino acids, preferably within 10 amino acids, more preferably within 5 amino acids, and most preferably within 3 amino acids.

  The gene in the present invention includes, for example, endogenous in other organisms corresponding to DNA comprising the base sequence described in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, and 17. Genes (such as homologues).

  In addition, endogenous DNA of other organisms corresponding to the DNA described in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, and 17 are generally SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, and 17 have high homology with the DNA. High homology means 50% or more, preferably 70% or more, more preferably 80% or more, more preferably 90% or more (for example, 95% or more, further 96%, 97%, 98% or 99% or more). ) Homology. This homology is determined by the mBLAST algorithm (Altschul et al. (1990) Proc. Natl. Acad. Sci. USA 87: 2264-8; Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-7 ) Can be determined. In addition, when isolated from the living body, the DNA is considered to hybridize with the DNAs described in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, and 17 under stringent conditions. It is done. Here, as “stringent conditions”, for example, “2 × SSC, 0.1% SDS, 50 ° C.”, “2 × SSC, 0.1% SDS, 42 ° C.”, “1 × SSC, 0.1% SDS, 37 ° C.” More stringent conditions include “2 × SSC, 0.1% SDS, 65 ° C.”, “0.5 × SSC, 0.1% SDS, 42 ° C.” and “0.2 × SSC, 0.1% SDS, 65 ° C.” Can do.

  A person skilled in the art appropriately selects a protein functionally equivalent to the above protein from the above-mentioned highly homologous proteins using the presence or absence of sulfation transfer activity at position 4 or 6 of N-acetylgalactosamine as an index, It can be used as a marker of the present invention.

In addition, as the marker of the present invention, the following enzymes are particularly preferable.
・ GalNAc4S-6ST (N-acetylgalactosamine 4-sulfate 6-0 sulfotransferase)
GalNAc4S-6ST is localized as transmembrane type II in the Golgi body in epithelial cells, and mainly by oversulfating chondroitin sulfate type A (sulfated at carbon 4 position of GalNAc residue in chondroitin sulfate). It works to convert to chondroitin sulfate type E. However, it has already been confirmed that this enzyme is cleaved at a hydrophilic site by a cleaving enzyme that has not yet been specified and exists in serum (Inoue, H. et al. (1986) J. Biol. Chem. 261 , 4470-4475).

・ C4ST (chondroitin 4-sulfotransferase)
It is an enzyme that transfers a sulfate group to the 4-position of the N-acetylgalactosamine residue in chondroitin. It is a sulfotransferase directly involved in the construction of chondroitin sulfate A. In addition, there are three types of isotopes C4ST (C4ST-1, C4ST-2, C4ST-3). (Yamauchi, S. et al. J. Biol. Chem. 275: 8975-8981, 2000.).

・ C6ST (chondroitin 6-sulfotransferase)
It is an enzyme that transfers a sulfate group to the 6-position of the N-acetylgalactosamine residue in chondroitin. It is a sulfotransferase directly involved in the construction of chondroitin sulfate C. In addition, there are two types of isotopes C6ST (C6ST-1, C6ST-2). (Tsutsumi, K. et al. FEBS Lett. 441: 235-241, 1998.).

Furthermore, in the present invention, chondroitin sulfate itself sulfated by the above-mentioned sulfotransferase can be used as the marker of the present invention.
That is, the following substances can be suitably used as the marker of the present invention.

・ CS-A (chondroitin sulfate A)
This is a sugar chain in which the sulfate group was transferred to C4ST at the 4-position of the N-acetylgalactosamine residue in chondroitin.

・ CS-C (chondroitin sulfate C)
It is a sugar chain in which a sulfate group was transferred to C6-ST of the N-acetylgalactosamine residue in chondroitin by C6ST.

・ CS-E (chondroitin sulfate E)
It is a sugar chain in which the sulfate group was transferred to C4ST and GalNAc4S-6ST at the 4th and 6th positions of N-acetylgalactosamine residue in chondroitin, respectively.

  A preferred embodiment of the present invention includes an inflammatory disease marker comprising a sulfate group transferase at the 4-position or 6-position of GalNAc constituting chondroitin sulfate, or chondroitin sulfate sulfated by the enzyme.

  The present invention more preferably provides an inflammatory disease marker comprising a substance selected from the group consisting of GalNAc4S-6ST, C4ST, C6ST, chondroitin sulfate A, chondroitin sulfate C, and chondroitin sulfate E.

  The present invention also relates to various methods (sometimes referred to as “the method of the present invention”) for inflammatory diseases by using the presence of the marker of the present invention as an index. For example, one embodiment of various methods relating to inflammatory diseases includes, for example, a method for examining inflammatory diseases, characterized in that the marker of the present invention is used as a detection marker.

  The inflammatory disease in the present invention is a disease caused by fibrosis of tissues in the living body, and includes diseases in all organs caused by inflammation. “Tissue fibrosis” is a characteristic in which fibroblasts infiltrate by growth factors secreted from activated macrophages and express excessive collagen and the like. The inflammatory disease of the present invention exhibits pathological features that increase and activate macrophage infiltration into the inflammatory site.

  For example, up-regulated GalNAc4S-6ST directly synthesizes persulfated CSPG, and overdeposition of the persulfated CSPG at the inflammatory site induces macrophage infiltration resulting from inflammatory disease. Furthermore, activation of the macrophages (secretion of fibroblast inducers by activation) has a mechanism that induces fibroblast infiltration due to tissue fibrosis.

  Examples of the inflammatory disease in the present invention include diseases in all organs resulting from inflammation. Specifically, Parkinson's disease, ulcerative colitis, non-alcoholic steatohepatitis (NASH) and the like can be exemplified. In addition to the above diseases, for example, the following diseases can be exemplified.

(1) Kidney: Diabetic nephropathy, nephritis, renal fibrosis, renal failure
(2) Pancreas: Pancreatitis
(3) Liver: Hepatitis, cirrhosis
(4) Stomach: gastritis
(5) Lung: Pneumonia, emphysema, pulmonary fibrosis, bronchiectasis, asthma
(6) Heart: arteriosclerosis, angina pectoris, myocardial infarction
(7) Bronchitis
(8) Brain: Encephalitis, Alzheimer's disease, multiple sclerosis, amyotrophic lateral sclerosis

A preferred embodiment of the method of the present invention using the presence of the marker of the present invention as an index includes, for example, a method for determining the progress of an inflammatory disease. That is, the present invention provides a method for determining the degree of progression of an inflammatory disease, comprising the following steps (a) and (b).
(A) A step of measuring the amount of the marker of the present invention for a test sample collected from an individual at an interval (b) When the amount of the marker is increased, the disease is progressing Judgment process

  In this method, first, a test sample is collected from an individual at intervals. That is, during the interval, the degree of progression of inflammatory disease can be evaluated using the marker of the present invention as an index.

  In the present invention, the “individual” to be tested is usually a human, but the testing method of the present invention is not necessarily limited to a method in which only humans are tested. Living organisms other than humans (preferably mammals, more preferably vertebrates such as mice, rats, monkeys, dogs, cats, and experimental animals) can also be examined.

  The individual in the present invention can usually include patients already suffering from inflammatory diseases. By performing the above-described method of the present invention on the patient, the degree of disease progression can be evaluated.

  In a preferred embodiment of the present invention, a sample obtained (separated) from an individual before and after the interval is subjected to the method of the present invention. If the amount of a marker of the present invention in a later acquired sample is greater than the amount of the marker in a previously acquired sample, the disease has progressed in a more severe direction (eg, from a minor condition to a severe condition). Is in progress) On the other hand, when the amount of the marker of the present invention is decreased, it is determined that the disease is in a minor direction (recovered).

  In the method of the present invention, it is also possible to determine the degree of progression of inflammatory disease by comparing the amount of the marker of the present invention in a sample obtained later with a control. That is, the degree of progress can be determined by a single measurement.

  For example, when a sample derived from a healthy person is used as a control, it is determined that the disease is progressing when the amount of the marker in the obtained sample is increased compared to the control. On the other hand, when the amount of the marker is not changed or decreased as compared with the control, it is determined that the disease has recovered or is improving.

  Examples of the test sample collected from an individual in the present invention include blood (serum, intravascular cells (for example, red blood cells, white blood cells, lymphocytes, etc.)), urine, sweat, tears, metabolites and the like. In addition, tissues or cells collected or excised by surgery, body fluids collected for the purpose of examination, etc. can be exemplified.

  For example, when serum is used as a test sample, serum separation from blood can be performed, for example, as follows. First, blood obtained from an individual is allowed to stand at room temperature for 1 hour, and after confirming that a blood clot has been formed, it is centrifuged at 3000 rpm for 5 minutes using a centrifuge. After centrifugation, the supernatant separated into two layers is used as serum.

  In step (a) of this method, the amount of the marker in the test sample is measured. A person skilled in the art can appropriately measure the amount of the marker in the test sample using a known technique.

  For example, measurement can be performed using an antibody that recognizes the marker of the present invention (in this specification, it may be simply referred to as “the antibody of the present invention”). Using the antibody of the present invention, for example, Western blotting method, ELISA method and the like can be performed to measure the abundance of the marker of the present invention. The antibody used for detection of the marker of the present invention is not particularly limited as long as it is a detectable antibody. For example, both a monoclonal antibody and a polyclonal antibody can be used.

  Antibodies that bind to the marker of the present invention can be prepared by methods known to those skilled in the art. If it is a polyclonal antibody, it can obtain as follows, for example. A serum is obtained by immunizing a small animal such as a rabbit with a recombinant (recombinant) marker protein expressed in a microorganism such as Escherichia coli or a partial peptide thereof as a fusion protein with a natural marker of the present invention or GST. This is prepared by, for example, purification using ammonium sulfate precipitation, protein A, protein G column, DEAE ion exchange chromatography, an affinity column coupled with the marker or synthetic peptide of the present invention, and the like. In the case of a monoclonal antibody, for example, the marker protein of the present invention or a partial peptide thereof is immunized to a small animal such as a mouse, the spleen is removed from the mouse, and this is ground to separate the cells. A myeloma cell is fused with a reagent such as polyethylene glycol, and a clone producing an antibody that binds to the marker of the present invention is selected from the resulting fused cells (hybridoma). Subsequently, the obtained hybridoma is transplanted into the abdominal cavity of the mouse, and ascites is collected from the mouse, and the obtained monoclonal antibody is obtained by, for example, ammonium sulfate precipitation, protein A, protein G column, DEAE ion exchange chromatography, It can be prepared by purification with an affinity column coupled with a marker or a synthetic peptide.

  The form of the antibody of the present invention is not particularly limited, so long as it binds to the marker of the present invention, in addition to the polyclonal antibody and the monoclonal antibody, a human antibody, a humanized antibody by genetic recombination, and an antibody fragment or antibody thereof Modified products are also included.

  The marker of the present invention used as a sensitizing antigen for obtaining an antibody is not limited for the animal species from which it is derived, but is preferably a protein derived from a mammal such as a mouse or human, and particularly preferably a protein derived from a human. A human-derived protein can be appropriately obtained by those skilled in the art using the gene sequence or amino acid sequence disclosed in the present specification.

  In the present invention, the protein used as the sensitizing antigen may be a complete protein or a partial peptide of the protein. Examples of the partial peptide of the protein include an amino group (N) terminal fragment and a carboxy (C) terminal fragment of the protein, or a kinase active site at the center. As used herein, “antibody” means an antibody that reacts with the full length or fragment of a protein.

  Polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies (scFv) (Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85: 5879-83; The Pharmacology of Monoclonal Antibody, Vol. 113, Rosenburg and Moore ed., Springer Verlag (1994) pp. 269-315), humanized antibody, multispecific antibody (LeDoussal et al. (1992) Int. J. Cancer Suppl. 7: 58 -62; Paulus (1985) Behring Inst. Mitt. 78: 118-32; Millstein and Cuello (1983) Nature 305: 537-9; Zimmermann (1986) Rev. Physiol. Biochem. Pharmacol. 105: 176-260; VanDijk et al. (1989) Int. J. Cancer 43: 944-9), and antibody fragments such as Fab, Fab ′, F (ab ′) 2, Fc, Fv and the like. Such an antibody may be modified with PEG or the like as necessary. It can also be produced as a fusion protein with β-galactosidase, maltose binding protein, GST, green fluorescent protein (GFP), etc. so that it can be detected without using a secondary antibody. Further, by labeling the antibody with biotin or the like, it can be modified so that the antibody can be detected and recovered using avidin, streptavidin or the like.

  In addition to immunizing non-human animals with antigens to obtain the above hybridomas, human lymphocytes such as human lymphocytes infected with EB virus are sensitized with proteins, protein-expressing cells or lysates thereof in vitro. Lymphocytes can be fused with human-derived myeloma cells having permanent mitotic activity, such as U266, to obtain hybridomas that produce desired human antibodies having binding activity to proteins.

  As another embodiment of the method for measuring the amount of the marker of the present invention in a test sample, a substance (nucleic acid, peptide, protein, compound, etc.) that specifically binds to the marker of the present invention is chemically labeled, It can also be carried out by detecting a labeled complex (compound bound to the marker of the present invention).

  Furthermore, another embodiment of the method for measuring the amount of the marker of the present invention can be carried out by chemically labeling a sugar chain or the like modified with the marker of the present invention and detecting the labeled product (Prescher , JA et al. Chemical Remodeling of Cell Surfaces in Living Animals. Nature 2004, 430, 873-877.). Examples of the chemical label include a label with a fluorescent substance.

  Further, when the marker of the present invention is produced by intravascular cells such as lymphocytes and leukocytes, the amount of the marker of the present invention is also measured by detecting the DNA or mRNA of the gene encoding the marker of the present invention. be able to.

  Specifically, measurement of the expression level of the gene encoding the marker protein of the present invention can be appropriately performed by those skilled in the art using known techniques.

  When measuring the expression level of a gene using the amount of translation product (protein) of the gene as an index, for example, a protein sample is prepared from a test sample and the amount of the marker of the present invention contained in the protein sample is measured. To do. Such methods include methods well known to those skilled in the art, such as enzyme-linked immunoassay (ELISA), double monoclonal antibody sandwich immunoassay, monoclonal polyclonal antibody sandwich assay, immunofluorescence, western blotting, dot blotting. Method, immunoprecipitation, protein chip analysis (protein nucleic acid enzyme Vol.47 No.5 (2002), protein nucleic acid enzyme Vol.47 No.8 (2002)), two-dimensional electrophoresis, SDS polyacrylamide electrophoresis Law, but not limited to.

  When measuring the gene expression level using the gene transcription product (mRNA) production level as an indicator, for example, an RNA sample is prepared from a test sample, and RNA encoding the marker of the present invention contained in the RNA sample is used. Measure the amount of It is also possible to evaluate the expression level by preparing a cDNA sample from the test sample and measuring the amount of cDNA encoding the marker of the present invention contained in the cDNA sample. RNA samples and cDNA samples from test samples can be prepared from test samples collected from individuals by methods well known to those skilled in the art. Examples of such methods include methods well known to those skilled in the art, such as Northern blotting, RT-PCR, and DNA array.

  In addition, since CS-A, CS-C, and CS-E in the marker of the present invention are sugar chains, the amount of these markers can be measured in addition to the above method, for example, a lectin specific for these sugar chains, etc. It is possible to measure this as an index.

  By using the determination method of the present invention, it is possible to examine the degree of progression of inflammatory diseases. The determination method of the present invention helps to determine a more efficient strategy and treatment policy in the prevention and treatment of inflammatory diseases.

  Further, as another embodiment of the method of the present invention, for example, a method for determining the therapeutic effect of a drug on an inflammatory disease using the marker of the present invention as an index can be mentioned.

A preferred embodiment of the above method is a method for determining the therapeutic effect of a drug on an inflammatory disease, comprising the following steps (a) and (b).
(A) A step of measuring the amount of the marker of the present invention for a test sample collected from an individual before and after administration of the test drug. (B) When the amount of the marker after administration is decreased, A step of determining that a drug has a therapeutic effect

  In this method, the marker of the present invention is detected from a test sample collected (separated) from an individual before and after administration of the test drug.

  The test drug (medicine) in the present invention is not particularly limited, and examples thereof include various existing drugs. Moreover, the substance used for the method of the present invention is not limited to a substance whose drug efficacy is already known, and various compounds can be evaluated for the degree of inflammatory disease treatment effect. In addition, the drug used in the method of the present invention may be, for example, a nucleic acid such as DNA or RNA, or a liposome (phospholipid vesicle) encapsulating a nucleic acid. By the method of the present invention, for example, a therapeutic effect on inflammatory diseases can be examined for a gene therapy agent containing a nucleic acid as a component.

  Measurement of the amount of marker in the test sample in this method can be carried out as described above.

  Next, in this method, when the amount of the marker decreases after administration of the test drug, it is determined that the test drug has an inflammatory disease therapeutic effect.

  The above-described method of the present invention can be performed using, for example, an inflammatory disease model animal. That is, a test drug is administered to an inflammatory disease model animal, and the amount of the marker of the present invention is measured for a test sample obtained from the animal. If the amount of the marker is significantly reduced compared to the control or before administration, the drug is determined to have a therapeutic effect on inflammatory diseases.

  Here, “treatment” is not necessarily limited to a case having a complete therapeutic effect on an inflammatory disease, but also includes a case in which it has a partial effect or an improvement effect, or an effect to stop disease progression. The therapeutic effect includes a preventive effect.

  By using the method of the present invention, it is possible to efficiently determine the therapeutic effect of a drug on an inflammatory disease. The method of the present invention makes it possible to efficiently select drugs effective for inflammatory diseases, and helps advance more efficient strategies and treatments in the treatment of inflammatory diseases.

  The drug determined to have a therapeutic effect by the method of the present invention can also be used as a therapeutic agent for inflammatory diseases.

Moreover, as another aspect of the method of this invention, the test | inspection method of an inflammatory disease which uses the marker of this invention as an parameter | index can be mentioned, for example. That is, this invention relates to the test | inspection method of an inflammatory disease including the following processes (a) and (b).
(A) Step of measuring the amount of the marker of the present invention for the sample separated from the subject (b) When the amount of the marker is increased compared to the amount in the sample separated from the healthy subject And determining that the patient is suffering from an inflammatory disease

  In this method, the amount of the marker of the present invention is measured for a sample obtained (separated) from a subject.

  In this method, the amount of the marker of the present invention in the sample is then measured. Measurement of the amount of marker can be carried out as described above.

  The method then compares the amount of marker in the sample isolated from the control or healthy subject with the amount of marker in the sample isolated from the subject. When the amount of the marker of the subject is greater than the amount of the marker in the healthy subject, the subject is determined to have an inflammatory disease.

  By the method of the present invention, even if it is difficult to diagnose from symptoms such as whether or not an inflammatory disease is affected, it is determined whether or not the inflammatory disease is affected by measuring the amount of the marker of the present invention. Is possible. It is also possible to appropriately determine the progress of inflammatory disease by quantifying the marker of the present invention.

  The marker of the present invention can be used for diagnosing inflammatory diseases, determining therapeutic effects, or determining progress.

  The present invention also provides a research reagent (test agent) comprising the marker of the present invention as a component. The reagent is used for research and examination using the marker of the present invention as an index. For example, it is used as a research reagent in the academic field.

  In addition to the marker of the present invention, various reagents, labeling substances and the like can be combined with the reagent of the present invention in accordance with the method for examining inflammatory diseases. These preparation methods are as described above.

  Furthermore, this invention relates to the reagent for the method of this invention which uses the substance for detecting the marker of this invention as a component. In a preferred embodiment, there is provided a reagent for diagnosing inflammatory diseases, for determining therapeutic effects, or for determining the degree of progression, comprising a substance having binding activity to the marker of the present invention.

  Examples of the substance having a binding activity to the marker of the present invention include an antibody, a lectin, a peptide, a low molecular compound and the like that bind to the marker of the present invention. Preferred embodiments of the antibody that binds to the marker of the present invention include various antibodies used for measuring the amount of the marker of the present invention as described above. For example, an antibody that binds to GalNAc4S-6ST (anti-GalNAc4S-6ST antibody) is exemplified as a substance having binding activity to the marker of the present invention.

  EXAMPLES The present invention will be specifically described below with reference to examples, but the present invention is not limited to these examples.

[Example 1] Comparison of serum levels of GalNAc4S-6ST in healthy subjects, non-alcoholic steatohepatitis (NASH) patients, and cirrhosis (LC) patients
We examined changes in GalNAc4S-6ST in sera of NASH patients and cirrhosis patients. As an experimental procedure, in order to make the serum protein level in the plate uniform, BCA assay kit (PIERCE), which is a protein quantification reagent, was used to measure the amount of serum protein in healthy, NASH, and cirrhotic patients. After that, the serum (10 μg / well) of each group and the antigenic peptide (Peptide Laboratories; within the range of 250 ng to 10 pg) used for calculation of the standard curve to the plate (Nunc) used for this measurement. The serum of each group was allowed to adhere to a specially processed plate by injecting and storing in a refrigerator at 4 ° C. overnight. For detection of GalNac4S-6ST contained in each serum, the amount contained in the serum was detected by using a primary antibody specific to GalNac4S-6ST and a labeled secondary antibody.

  As a means until detection of GalNAc4S-6ST, it was prepared as detection of GalNAc4S-6ST after standing at room temperature for 2 hours at 50 μl / well of Block Ace (manufactured by Snow Brand Milk Products Co., Ltd.) diluted 2-fold in the blocking process. ; After preparing anti-GalNAc4S-6ST Ab (rabbit IgG) in 0.035μg / well in 10-fold diluted Block Ace solution, the primary antibody reaction is carried out at 37 ° C for 1 hour. Anti-rabbit IgG-HRP labeling (1: 15000, ICN Biomedicals) was reacted at 37 ° C. for 30 minutes.

  Next, as a color development process, 50 μl of TMB substrate (Sigma-Aldrich) was added and reacted for about 20 minutes, and then the degree of color development was measured with a plate reader (POWER Wave XS, BIO-TEK). First, a numerical value obtained from a standard curve was graphed to obtain a function correlated with the curve. By calculating the numerical value representing the amount of GalNAc4S-6ST detected from the serum of each group using the correlation function, the amount of GalNAc4S-6ST in the serum of each group shown in FIG. 1 can be obtained. It was.

  As shown here, the numerical value of GalNAc4S-6ST in the serum of healthy subjects was compared, and the progression of the disease (NASH and cirrhosis are linear diseases; Farrell GC and Larter CZ, Hepatology 43: 99-112), the amount contained in the serum tended to increase.

[Example 2] GalNAc4S-6ST level in serum is a judgment marker showing therapeutic effect. Changes in the amount of GalNAc4S-6ST in serum are considered to be effective in determining the therapeutic effect, and cirrhosis treated with C6ST cocktail siRNA as shown below. A model mouse was adopted. This cirrhosis model mouse is a model mouse in which carbon tetrachloride is continuously administered to induce fibrosis of the liver (Sakaida I., et al. Hepatology 40: 1304-1311, 2004). First, C57BL / 6J mice (female, 7 weeks old, CLEA Japan) mixed with carbon tetrachloride 5μl / 100g body weight (Sigma) and mineral oil 95μl / 100g body weight (Sigma-Aldrich) This was injected into the abdominal cavity twice a week for 4 weeks (a total of 7 doses in the last week) to induce a cirrhosis model.

  The treatment consists of Gene World's C6ST cocktail siRNA (1 μg / 200 μl-) for the C6ST-1 and C6ST-2 genes involved in sulfation of the 6 position of the GalNAc residue of the two amino sugars constituting the chondroitin chain. 0.1% atelocollagen (manufactured by Koken Co., Ltd.) was administered to the above cirrhosis model mice (4 times after carbon tetrachloride administration). Thereafter, the amount of GalNAc4S-6ST contained in the serum obtained by separation from the blood of the treatment group was compared. For serum separation, blood obtained from each group (control group, untreated group, treated group) was allowed to stand at room temperature for 1 hour, and it was confirmed that a clot was formed. Spin at 5 min for rotation. After the centrifugation, the supernatant separated into two layers was used as serum. The results calculated by measuring each serogroup in the same manner as in Example 1 are shown in FIG.

  As a result, the cirrhosis model group in which GalNAc4S-6ST was detected in a larger amount than the control group, but the amount of GalNAc4S-6ST in the serum after treatment was decreased. This showed a result correlating with the decrease in GalNAc4S-6ST gene expression shown in Example 5. From this, it was confirmed that by detecting the amount of GalNAc4S-6ST in the serum after treatment, it can be used as a biomarker that can easily determine the therapeutic effect from the serum and as a detection tool.

  Examples of findings showing the therapeutic effect of the cirrhosis model mice used in Example 2 are shown below.

[Example 3] Inhibition of their gene expression by C6ST-1, C6ST-2 cocktail siRNA Part of the second leaf of the liver collected from the untreated group, treated group and control group of the cirrhosis model mice described in Example 2 Were frozen in 1.5 ml tubes, inter alia, with liquid nitrogen. To 50 mg of tissue, add 200 ml of chloroform (Sigma-Aldrich) to the homogenized suspension of 1 ml of RNA-Bee (TEL-TEST) and gently mix, and then ice-cool for about 5 minutes. Centrifugation was performed using a centrifuge (Centrifuge 5417R, manufactured by eppendolf) at 12,000 rpm, 4 ° C. for 15 minutes. Transfer 500 μl of the supernatant after centrifugation to another 1.5 ml tube, add 500 μl of isopropanol equivalent to the supernatant (Sigma-Aldrich), mix and add 1 μl glycogen (Invitrogen) for 15 minutes. Chilled. Centrifuge for 15 minutes at 12,000 rpm and 4 ° C after 15 minutes with ice-cooling, and then wash 3 times with 1000 µl of 75% ethanol (manufactured by Sigma-Aldrich) for 30 minutes to 1 hour. After drying, dissolve in Otsuka distilled water (Otsuka Pharmaceutical), further dilute 100 times with Otsuka distilled water, and plate reader (POWER Wave XS, manufactured by BIO-TEK) on a UV plate (Corning Coaster) The RNA concentration in the sample extracted by (1) was calculated. The obtained RNA sample was adjusted to a concentration of 500 ng / 20 μl, heated at 68 ° C. for 3 minutes with BLOCK INCUBATOR (manufactured by ASTEC), and ice-cooled for 10 minutes. RT PreMix solution (composition: 25 mg MgCl ₂ 18.64 μl (Invitrogen)), 5 × Buffer 20 μl (Invitrogen), 0.1 M DTT 6.6 μl (Invitrogen), 10 mM dNTP mix 10 μl (Invitrogen), Rnase Inhibitor 2 μl (Invitrogen), MMLV Reverse Transcriptase 1.2 μl (Invitrogen), Random primer 2 μl (Invitrogen), sterile distilled water (Otsuka distilled water; Otsuka Pharmaceutical) )) Was added in an amount of 80 μl, heated at 42 ° C. for 1 hour, 99 ° C. for 5 minutes in a BLOCK INCUBATOR, and then cooled on ice to prepare 100 μl of cDNA.

  PCR reaction was performed with the following composition using the obtained cDNA. SYBR Premix EX taq 12.5μl (manufactured by TAKARA), sterile distilled water 11.3μl (Otsuka distilled water), primer 0.1μl (50 pmol / μl), cDNA 1μl are mixed, and Real-time PCR Dice (TAKARA) 95 The reaction was carried out for 40 cycles at 5 ° C. and 30 seconds at 60 ° C. After the reaction was completed, the expression level was measured using 36B4 gene as an internal standard. The state of gene expression of C6ST-1 and C6ST-2 is shown in FIG.

  The expression of C6ST-1 gene was overexpressed in the untreated group compared with the control group, but it was suggested that the overexpression was suppressed by C6ST siRNA treatment. Similarly, C6ST-2 was overexpressed in the untreated group, but its overexpression was suppressed by the treatment.

Real time PCR primer sequence;
C6ST-1
F-TGTTCCTGGCATTTGTGGTCATA (SEQ ID NO: 19)
R-CCAACTCGCTCAGGGACAAGA (SEQ ID NO: 20)

C6ST-2
F-GCTGTGTAATACCCTGATCCCTGAA (SEQ ID NO: 21)
R-CACAGTGTGATAGATCGCCTCCA (SEQ ID NO: 22)

36B4
F-TTCCAGGCTTTGGGCATCA (SEQ ID NO: 23)
R-ATGTTCAGCATGTTCAGCAGTGTG (SEQ ID NO: 24)

[Example 4] Inhibition of CSPG overaccumulation by C6ST siRNA As described in Example 2, a part of the second lobe of the liver collected from a cirrhosis model mouse was used as an embedding agent OCT compound (manufactured by Miles) for freezing. Embed and block made with liquid nitrogen. A 5 μm section was prepared from the frozen block using a cryostat (manufactured by Microm).

  The obtained section was fixed with acetone (manufactured by Wako) for 10 minutes, washed with a phosphate buffer, and further anti-chondroitin sulfate proteoglycan (CSPG) antibody (clone CS56, mouse monoclonal antibody, 1: 100 dilution) as a primary antibody; Seikagaku Kogyo) was added and reacted at 4 ° C. overnight. Then, after performing a secondary antibody reaction using a histofine mouse stain kit (manufactured by Nichirei), a DAB substrate solution (manufactured by Nichirei) was added, and the sample was observed under an optical microscope (manufactured by Leica). The degree of brown color development was confirmed. The obtained immunostaining findings are shown in FIG. The left column is the untreated group, and the right column is the C6ST siRNA treated group. We were able to observe how CSPG accumulation was suppressed in the treatment group.

[Example 5] Inhibition of GalNAc4S-6ST expression by C6ST cocktail siRNA In the same manner as in Example 3, expression in GalNac4S-6ST was analyzed using cDNA of each group as a template. The result is shown in FIG. In spite of C6ST cocktail siRNA treatment, it was found that GalNAc4S-6ST, which was untreated and overexpressed, suppressed its overexpression by treatment.

Real-time PCR primer sequence;
GalNAc4S-6ST
F-GTGAGTTCTGCTGCGGTCCA (SEQ ID NO: 25)
R-AGTCCATGCTGATGCCCAGAG (SEQ ID NO: 26)

[Example 6] Macrophage infiltration and suppression of inflammatory cytokine TNF-α A rat anti-mouse F4 / 80 antibody (clone; CI: A3) was prepared against a liver section treated as described in Example 4. -1, 1: 200 dilution; manufactured by BMA) was added and allowed to react at room temperature for 1 hour. Subsequently, rat IgG labeled with HRP (1:25 dilution; manufactured by Biosource) was added as a secondary antibody. The sample was observed under an optical microscope (manufactured by Leica), and antibody binding visualized with a brown signal was confirmed. FIG. 6 shows the result of comparing the tissue findings of each group thus obtained and the number of F4 / 80 positive cells. The expression results of TNF-α analyzed by the same method as in Example 3 are also shown. In all the findings, suppression of factors involved in inflammation was confirmed in the C6ST siRNA treatment group.

Real-time PCR primer sequence;
TNF-α
F-CAGGAGGGAGAACAGAAACTCCA (SEQ ID NO: 27)
R-CCTGGTTGGCTGCTTGCTT (SEQ ID NO: 28)

[Example 7] Suppression of fibrosis-related genes Gene expression analysis was performed on the genes related to fibrosis using the technique described in Example 3. The result is shown in FIG. The fibrosis genes shown in the cirrhosis model mouse (untreated group) group were overexpressed, but the overexpression in the treated group was significantly suppressed. The α-SMA and type I collagen listed here are synthetic genes for proteins involved in direct fibrosis, and CTGF and TGF-β are synthetic genes for factors that induce fibroblast invasion. . C6ST siRNA treatment that inhibits CSPG synthesis suppressed the infiltration of a group of cells (mainly macrophages and fibroblasts) that express the genes related to fibrosis.

Real-time PCR primer sequence;
α-SMA
F-GAGCATCCGACACTGCTGACA (SEQ ID NO: 29)
R-AGCACAGCCTGAATAGCCACATAC (SEQ ID NO: 30)

Type 1 collagen
F-ACCCGATGGCAACAATGGA (SEQ ID NO: 31)
R-ACCAGCAGGGCCTTGTTCAC (SEQ ID NO: 32)

36B4 (acidic ribosomal phosphoprotein P0)
F-TTCCAGGCTTTGGGCATCA (SEQ ID NO: 33)
R-TGTTCAGCATGTTCAGCAGTGTG (SEQ ID NO: 34)

TGF-β
GTGTGGAGCAACATGTGGAACTCTA (SEQ ID NO: 35)
TTGGTTCAGCCACTGCCGTA (SEQ ID NO: 36)

CTGF
ACCCGAGTTACCAATGACAATACC (SEQ ID NO: 37)
CCGCAGAACTTAGCCCTGTATG (SEQ ID NO: 38)

[Example 8] Inhibition of type I collagen accumulation In order to obtain a tissue finding to support the results of Example 7, it was verified by immunostaining of type I collagen indicating the degree of fibrosis. (Rabbit anti-mouse type I collagen antiserum, which is a primary antibody (1: 2000 dilution; manufactured by LSL)) was added to a liver section prepared in the same manner as in Example 4 and allowed to react at room temperature for 1 hour. As a secondary antibody, peroxidase-labeled anti-rabbit IgG (1:25 dilution; manufactured by Cappel) was reacted at room temperature for 30 minutes.

  The obtained findings and the results of quantifying the degree of liver fibrosis are shown in FIG. The degree of liver fibrosis was evaluated according to a previous report (Dai K, et al. World J Gactroenterol. 31: 4822-4826, 2005, Hillebrandt S, et al. Nature Genetics 37: 835-843, 2005). As a result, deposition on type I collagen in the C6ST siRNA treatment group was alleviated.

[Example 9] Gene expression relating to renin-angiotensin The gene expression in angiotensinogen and angiotensin converting enzyme (ACE) relating to the synthesis pathway of angiotensin II involved in an increase in blood pressure was analyzed in the same manner as in Example 3. The result of each gene expression is shown in FIG. In both cases, it was confirmed that C6ST siRNA treatment showed a decrease in expression.

Real time PCR primer sequences:
Angiotensinogen
TGACCCAGTTCTTGCCACTGAG (SEQ ID NO: 39)
ACACCGAGATGCTGTTGTCCAC (SEQ ID NO: 40)

ACE
AGTACAACTGGGCGCCAAACA (SEQ ID NO: 41)
GGAAATTGACGCGGTTGGAC (SEQ ID NO: 42)

[Example 10] Promotion of cell renewal by C6ST siRNA treatment (BrdU detection)
BrdU was injected into 100 μl (5 mg / ml: Sigma-Aldrich) vein one hour before sacrifice of the cirrhosis model mice of Example 2. Thereafter, the liver sections treated as described in Example 4 were treated with 2N hydrochloric acid at room temperature for 20 minutes, and then rat anti-BrdU antibody (clone; CI: A3-1, 1: 200 dilution; manufactured by abcam) was added and allowed to react at room temperature for 1 hour. Subsequently, rat IgG labeled with HRP (1:25 dilution; manufactured by Biosource) was added as a secondary antibody.

  The observation of observing the regeneration of hepatocytes in the C6ST siRNA treatment group is shown in FIG. Furthermore, the result of comparing the number of BrdU positive cells is also shown in FIG. As a result, it was clearly suggested that regeneration of hepatocytes was promoted in the C6ST siRNA treatment group.

[Example 11] Comparison of serum C4ST-1 levels in healthy subjects and non-alcoholic steatohepatitis (NASH) patients
We decided to examine the change of C4ST-1 in the serum of NASH patients. As an experimental procedure, the BCA assay kit (PIERCE), a protein quantification reagent, was used to measure the amount of protein in the serum of healthy volunteers and NASH patients, and then used for this measurement in order to make the serum protein level in the plate uniform. Each serum (10 μg / well) was injected into a plate (manufactured by Nunc) and stored in a refrigerator at 4 ° C. overnight, thereby allowing each serum to adhere to a specially processed plate. C4ST-1 contained in each serum was detected by using a primary antibody specific to C4ST-1 and a secondary antibody labeled with HRP to detect the amount contained in the serum.

  As a means until detection of C4ST-1, it was prepared as detection of C4ST-1 after standing at room temperature for 2 hours at 50 μl / well of Block Ace (manufactured by Snow Brand Milk Products Co., Ltd.) diluted 2-fold in the blocking process. Anti-C4ST-1 mAb (mouse IgG: Abcam) was prepared in a 10-fold diluted Block Ace solution at 0.05 μg / well, and then the primary antibody reaction was performed at 37 ° C. for 1 hour. Anti-mouse IgG-HRP labeling of the secondary antibody (1: 2500, Jackson ImmunoResearch) was reacted at 37 ° C. for 30 minutes.

  Next, as a color development process, add 50 μl of TMB substrate (Sigma-Aldrich), react for about 20 minutes, and measure the color development with a plate reader (POWER Wave XS, BIO-TEK). 11 shows. Each data in FIG. 11 is shown as an average of n = 4.

  As a result, the amount of C4ST-1 contained in the serum of NASH patients was higher than that in healthy subjects, suggesting that C4ST-1 can also be used as a biomarker for inflammatory diseases.

[Example 12] Comparison of serum CS-A and CS-E levels in healthy subjects and non-alcoholic steatohepatitis (NASH) patients
We decided to examine changes in CS-A and CS-E in the serum of NASH patients. As an experimental procedure, the BCA assay kit (PIERCE), a protein quantification reagent, was used to measure the amount of protein in the serum of healthy volunteers and NASH patients, and then used for this measurement in order to make the serum protein level in the plate uniform. Each serum (10 μg / well) was injected into each plate (Nunc) and stored in a refrigerator at 4 ° C. overnight to attach each serum to a specially processed plate. For detection of CS-A and CS-E contained in serum, the amount contained in serum was detected by using a specific primary antibody and a secondary antibody labeled with HRP in each.

  As a means to detect CS-A and CS-E, block ace (manufactured by Snow Brand Milk Products Co., Ltd.) diluted 10-fold in the blocking process was allowed to stand at 50 μl / well for 2 hours at room temperature, then CS-A and CS-E Anti-CS-A mAb (clone name: 2H6, mouse IgM, Seikagaku) and anti-CS-E mAb (clone name: Mo-225, mouse IgM, Seikagaku) Was prepared in a 100-fold diluted Block Ace solution at 0.05 μg / well, and then the primary antibody reaction was performed at 37 ° C. for 1 hour, and the secondary antibody was labeled with anti-mouse IgM Ab-HRP (1 : 2500, Jackson ImmunoResearch) was allowed to react at 37 ° C for 30 minutes.

  Next, as a color development process, add 50 μl of TMB substrate (Sigma-Aldrich), react for about 20 minutes, and then measure the degree of color development with a plate reader (POWER Wave XS, BIO-TEK). 12 shows. Each data in FIG. 12 is shown as an average of n = 4.

  As a result, the amount of CS-A and CS-E contained in the serum of patients with NASH was higher than that of healthy subjects, suggesting that these can also be used as biomarkers for inflammatory diseases.

  Most conventional biomarkers are produced because the disease has already progressed, and few of them can actually link early detection and prevention. The index in the present invention can be an invention that leads to early detection and early prevention because of the GalNAc4S-6ST enzyme directly linked to a disease, and can exhibit a therapeutic effect. In addition, the use of this invention as a method for evaluating therapeutic effects in clinical trials for drug discovery prevents dropouts of drug discovery candidate substances, resulting from the development of new biomarkers that can play a major role in further drug development in the future. Can be provided as

It is a figure which shows the finding that the quantity contained in the serum of GalNAc4S-6ST increases as disease progresses. It is a figure which shows the finding that GalNAc4S-6ST increased by cirrhosis decreases by C6ST cocktail siRNA treatment. This method has been confirmed to be applicable to Parkinson's disease, ulcerative colitis, emphysema, and NASH mouse models. It is a figure which shows those gene expression suppression effects by C6ST-1, C6ST-2 cocktail siRNA. It is a photograph which shows an immuno-staining finding. The left column is the untreated group and the right column is the C6ST siRNA treated group. We were able to observe how CSPG accumulation was suppressed in the treatment group. It is a figure which shows the result of having analyzed the expression in GalNac4S-6ST using cDNA of each group as a template. In spite of C6ST cocktail siRNA treatment, it was found that GalNAc4S-6ST, which was untreated and overexpressed, suppressed its overexpression by treatment. It is the figure and photograph which show the infiltration effect | action of macrophage, and the inhibitory action of TNF- (alpha) of inflammatory cytokine. Samples were observed under an optical microscope to confirm antibody binding visualized with a brown signal. The results of comparing the histological findings of each group thus obtained and the number of F4 / 80 positive cells are shown by photographs. It is a figure which shows the inhibitory effect of a fibrosis related gene. It is a figure which shows the inhibitory effect of type I collagen accumulation. It is a figure which shows the result of the gene expression in the angiotensinogen regarding the synthetic pathway of angiotensin II in connection with the raise of a blood pressure, and an angiotensin converting enzyme. It is the photograph and figure which show the observation which observed the regeneration of the hepatocyte in the C6ST siRNA treatment group. It is a figure which shows the result of having compared the amount of C4ST-1 in serum in a NASH patient and a healthy subject. A large amount of C4ST-1 was confirmed in the serum of NASH patients. It is a figure which shows the result of having compared the amount of CS-A and CS-E in serum in a NASH patient and a healthy subject. A large amount of CS-A and CS-E were confirmed in the serum of NASH patients.

Claims (11)

  A marker for inflammatory diseases, comprising sulfate group transferase at position 4 or 6 of GalNAc constituting chondroitin sulfate, or chondroitin sulfate sulfated by the enzyme.   The inflammatory disease marker according to claim 1, wherein the sulfotransferase is GalNAc4S-6ST, C4ST, or C6ST, and the sulfated chondroitin sulfate is chondroitin sulfate A, chondroitin sulfate C, or chondroitin sulfate E.   The marker according to claim 1 or 2, which is used for diagnosis of inflammatory disease, determination of therapeutic effect, or determination of progress.   The marker according to claim 1, wherein the inflammatory disease is a disease caused by tissue fibrosis.   The research reagent which uses the marker in any one of Claims 1-4 as a component.   A reagent for diagnosing inflammatory diseases, for determining therapeutic effects, or for determining the degree of progression, comprising a substance having binding activity to the marker according to any one of claims 1 to 4.   The reagent according to claim 6, wherein the substance is an anti-GalNAc4S-6ST antibody.   A method for examining an inflammatory disease, wherein the marker according to claim 1 or 2 is used as a detection marker. A method for determining the degree of progression of an inflammatory disease, comprising the following steps (a) and (b).
(A) A step of measuring the amount of the marker according to claim 1 or 2 for a test sample collected from an individual at intervals (b) When the amount of the marker increases, the disease progresses The process to determine that A method for determining a therapeutic effect of a drug on an inflammatory disease, comprising the following steps (a) and (b).
(A) A step of measuring the amount of the marker according to claim 1 or 2 for a test sample collected from an individual before and after administration of the test drug (b) The amount of the marker after administration is decreased A step of determining that the test drug has a therapeutic effect A test method for inflammatory diseases, comprising the following steps (a) and (b).
(A) a step of measuring the amount of the marker according to claim 1 or 2 for the sample separated from the subject; and (b) the amount of the marker compared to the amount in the sample separated from the healthy subject. The step of determining that the patient is suffering from an inflammatory disease when the number is increased