JP2009171974A - GFRalpha3 AND ITS USE - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a new method for identification and isolation of a DNA, and to provide a new method for recombinant production of polypeptide characterized by the presence of a GFRα3 sequence which is a new α-subunit receptor. <P>SOLUTION: Provided is a mammalian GFRα3, a new α-subunit receptor of the GDNF (i.e. GFR) receptor family, nucleotide sequences including expressed sequence tags (ESTs), oligonucleotide probes, polypeptides, vectors and host cells, and immunoadhesions and antibodies to the mammalian GFRα3. Provided, further, is an assay for measuring activation of an α-subunit receptor by detecting tyrosine kinase receptor activation (i.e., autophosphorylation) or other activities related to ligand-induced α-subunit receptor homo-dimerization or homo-oligomerization. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

(Technical field)
The present invention relates generally to the identification and isolation of novel DNA and the recombinant production of novel polypeptides characterized by the presence of the α-subunit receptor GFRα3 sequence. The present invention further relates to an assay for measuring ligand-induced activation of α-subunit receptors, which assay includes kinase receptor activation, kinase domain of α receptor using enzyme-linked immunosorbent assay (KIRA ELISA). By detection of autophosphorylation of receptor protein tyrosine kinase (rPTK) fusion, or other means of detecting α-subunit homodimerization.

(Introduction)
(background)
Neurotrophic factors (eg, insulin-like growth factor, nerve growth factor, brain-derived neurotrophic factor, neurotrophin-3, neurotrophin-4 / 5, and neurotrophin-6, ciliary neurotrophic factor, GDNF , As well as neuroturins, as potential means for enhancing the survival of certain neuronal cells, such as neurodegenerative diseases (eg amyotrophic lateral sclerosis, Alzheimer's disease, seizures, epilepsy, Huntington Disease, Parkinson's disease, and peripheral neuropathy) It has been proposed to provide additional therapy for this purpose.Protein neurotrophic factor, or neurotrophin, is a vertebrate neuron. Affects the growth and development of the system, and different groups of new in the brain and periphery The neurotrophic factor is believed to play an important role in promoting neuronal differentiation, survival, and function, partly in neural tissue, based on established precedents for nerve growth factor (NGF). NGF is believed to have important signaling functions, supporting the survival of sympathetic, sensory, and forebrain brainstem neurons both in vitro and in vivo. Rescues neurons from developmental cell death, conversely, removal or sequestration of endogenous NGF by administration of anti-NGF antibodies promotes such cell death (Heumann, J. Exp. Biol., 132 : 133-150 (1987); Hefti, J. Neurosci., 6 : 2155-2162 (1986); Theoen et al., Annu. Rev. Physiol., 60: 284-335 (1980)).

Additional neurotrophic factors associated with NGF have since been identified. These include the following: brain-derived neurotrophic factor (BDGF) (Leiblock et al., Nature, 341: 149-152 (1989), neurotrophin-3 (NT-3) (Kaisho et al., FEBS Lett., 266: 187 (1990); Maisonpierre et al., Science, 247: 1466 (1990); Rosenthal et al., Neuron, 4: 767 (1990)), and neurotrophin 4/5 (NT-4 / 5) (Berckmeier et al., Neuron, 7: 857-866 (1991)).

Like other polypeptide growth factors, neurotrophins affect their target cells through interaction with cell surface receptors. According to current understanding, two transmembrane glycoproteins act as receptors for known neurotrophins. By equilibrium binding studies, neurotrophin-responsive neuronal cells have a common low molecular weight (65,000-80,000 daltons), typically a low affinity receptor called p75 ^LNGFR or p75, and high molecular weight (130, 000-150,000 daltons) receptors. High affinity receptors are members of the trk family of receptor tyrosine kinases.

Receptor tyrosine kinases are known to act as receptors for various protein factors that promote cell proliferation, differentiation, and survival. In addition to trk receptors, examples of other receptor tyrosine kinases include epidermal growth factor (EGF) receptor, fibroblast growth factor (FGF) receptor, and platelet derived growth factor (PDGF) receptor. Typically, these receptors penetrate the cell membrane, one part of the receptor is inside the cell and in contact with the cytoplasm, and another part of the receptor is outside the cell. Binding of the ligand to the extracellular portion of the receptor induces tyrosine kinase activity in the intracellular portion of the receptor, ensuring that phosphorylation of various intracellular proteins is involved in cell signaling pathways.

Glial cell line-derived neurotrophic factor (“GDNF”) and Neuturin (“NTN”) are powerful survival factors for two recently identified structurally related sympathetic and central nervous system neurons. (Lin et al., Science 260: 1130-1132 (1993); Henderson et al., Science 266: 1062-1064 (1994); Buj-Bello et al., Neuron 15: 821-828 (1995); Kotzbauer et al., Nature 384: 467. ~ 470 (1996)). Recently, GDNF has passed through a multi-component receptor system consisting of a ligand-bound glycosyl-phosphatidylinositol (GPI) binding protein (designated GDNFRα; also designated GFR-α-1) and a transmembrane receptor tyrosine kinase Ret. It has been shown to mediate its action (Treanor et al., Nature 382: 80-83 (1996); Jing et al., Cell 85: 1113-1124 (1996); Trpp et al., Nature 381: 785-789 (1996); Durbec et al., Nature 381: 789-793 (1996)). NTN signals are transmitted through GFRα2 (which is also Ret related).

Membrane-bound proteins and receptors can play an important role in formation, differentiation, and maintenance in multicellular organisms. The fate of many individual cells (eg, proliferation, migration, differentiation, or interaction with other cells) is typically governed by information received from other cells and / or the direct environment. This information is frequently communicated by secreted polypeptides (eg, mitogens, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones), which in turn are diverse cell receptors. Or it is accepted and blocked by membrane-bound proteins. Such membrane-bound proteins and cell receptors include, but are not limited to: cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cell attachments such as selectins and integrins. molecule. For example, signaling that regulates cell proliferation and differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases, enzymes that catalyze the process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor.

Membrane-bound proteins and receptor molecules have a variety of industrial applications including formulations and diagnostic agents. For example, receptor immunoadhesins can be used as therapeutic agents to block receptor-ligand interactions. This membrane-bound protein can also be used for screening for potential peptide inhibitors or small molecule inhibitors of related receptor / ligand interactions.

Abnormal expression or uncontrolled regulation of any one of these receptor tyrosine kinases can result in different malignancies and pathological disorders. Accordingly, receptor tyrosine kinases (“RTKs”), their ligands, or the α-subunit to which they bind to provide a novel and additional means for the diagnosis and treatment of receptor tyrosine kinase pathway related disorders and cellular processes. There is a need to identify means to modulate, control, and manipulate receptor molecules (eg, GPI-coupled α-subunit receptors). The present application provides such means by providing clinicians and researchers with new molecules that are specific for the interaction of specific receptor genes and their gene products. These compounds provided herein and the methods of use thereof allow for very good therapeutic control and specificity. Accordingly, one object of the present invention is to provide improved therapies for the prevention and / or treatment of neurological and other conditions in which specific neurotrophic signaling pathways play a role. .

(Summary)
Applicants have identified a family of cDNAs that encode a novel human polypeptide, named “GFRα3” in the present application, or a homologue thereof. This GFRα3 is an α-subunit receptor, a receptor complexed with a β subunit receptor in response to ligand binding. The α-subunit provides a ligand binding component and the β subunit provides catalytic signaling activity such as tyrosine kinase activity. The GFRα3 receptor family members complex with a β subunit receptor called Ret. This heterocomplex produces signal transduction. The present invention provides, in part, that the α-subunit can dimerize upon ligand binding, and further this dimerization is a kinase catalytic domain fused to the ligand-binding domain of the α-subunit receptor. Based on the knowledge that the kinase activity of can be activated.

In one embodiment, the present invention encodes a GFRα3 polypeptide comprising the sequence of (a) amino acids 27-400 of SEQ ID NO: 15, amino acids 27-369 of SEQ ID NO: 17, or amino acids 27-374 of SEQ ID NO: 5 An isolated nucleic acid molecule having at least about 65% sequence identity to a nucleic acid sequence, or (b) the complement of the nucleic acid molecule of (a) is provided. In another embodiment, the nucleic acid sequence is a ligand binding domain of the GFRα3 polypeptide of amino acids 84-360 of SEQ ID NO: 15, a ligand binding domain of the GFRα3 polypeptide of amino acids 84-329 of SEQ ID NO: 17, or SEQ ID NO: 20. A ligand binding domain of a GFRα3 polypeptide of amino acid sequence 110-386, or a complementary nucleic acid thereof. The isolated nucleic acid preferably comprises a GFRα3 coding sequence that hybridizes under stringent conditions to a nucleic acid sequence encoding a GFRα3 polypeptide of the invention. This sequence identity is preferably at least about 75%, more preferably at least 85%, even more preferably at least 90%, and most preferably at least 95%. In one aspect, the encoded polypeptide comprises at least about 75%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, and most preferably at least 95% sequence identity. A ligand binding domain of the GFRα3 polypeptide of amino acid residues 27-400 of SEQ ID NO: 15, amino acids 27-369 of SEQ ID NO: 17, amino acids 27-374 of SEQ ID NO: 5, or amino acids 84-360 of SEQ ID NO: 15, sequence It has the ligand binding domain of the GFRα3 polypeptide of amino acids 84 to 329 of number 17 or the sequence of the GFRα3 polypeptide of the sequence of amino acids 110 to 386 of SEQ ID NO: 20. Preferably, this identity is to amino acid residues 27 to 400 of SEQ ID NO: 15 and the DNA encoding it. In a further embodiment, the isolated nucleic acid molecule comprises DNA encoding a GFRα3 polypeptide having amino acid residues 27-400 of SEQ ID NO: 15, or is complementary to such encoding nucleic acid sequence; And it remains stably bound to the nucleic acid under at least moderate stringency conditions and, if necessary, high stringency conditions. In another aspect, the present invention provides a nucleic acid of the full-length protein of clone DNA48613, DNA48614, or mouse GFRα3 (clone 13). These have been deposited with the ATCC under the accession numbers ATCC 209752 (name: DNA48613-1268), ATCC209511 (name: DNA48614-1268) and ATCC on April 7, 1998, respectively.

In yet another embodiment, the present invention provides a vector comprising DNA encoding a GFRα3 polypeptide. Host cells containing such vectors are also provided. By way of example, this host cell is a CHO cell, E. coli. E. coli, or yeast cells. Further provided is a process for producing a GFRα3 polypeptide, and the process comprises culturing host cells under conditions suitable for expression of GFRα3, and recovering GFRα3 from the cell culture. .

In yet another embodiment, the present invention provides an isolated GFRα3 polypeptide. Specifically, the present invention provides an isolated native sequence GFRα3 polypeptide, and in one embodiment, the polypeptide comprises an amino acid sequence comprising residues 27-400 of SEQ ID NO: 15. In particular, a native GFRα3 polypeptide is included that includes or does not include the native signal sequence in SEQ ID NO: 15 (amino acids 1-26) and includes or does not include the starting methionine. In yet another embodiment, the amino acid residues 27-400 of SEQ ID NO: 15, amino acids 27-369 of SEQ ID NO: 17, amino acids 27-374 of SEQ ID NO: 5, or the GFRα3 polypeptide of amino acids 84-360 of SEQ ID NO: 15 A polypeptide comprising a ligand binding domain, a ligand binding domain of a GFRα3 polypeptide of amino acids 84-329 of SEQ ID NO: 17, or a ligand binding domain of a GFRα3 polypeptide of amino acids 110-386 of SEQ ID NO: 20 is provided. Alternatively, the present invention provides a GFRα3 polypeptide encoded by the nucleic acid deposited under the accession number described above. This polypeptide optionally lacks the hydrophobic sequence associated with the GPI anchor.

In yet another embodiment, the present invention provides a chimeric molecule comprising a GFRα3 polypeptide fused to a heterologous polypeptide or amino acid sequence. Examples of such chimeric molecules include GFRα3 polypeptides fused to an epitope tag sequence or an Fc region of an immunoglobulin. The chimeric molecule can comprise a ligand binding domain of an α-subunit receptor, an intracellular catalytic domain of a tyrosine kinase receptor, and a flag epitope.

In yet another embodiment, the invention provides an antibody that specifically binds to a GFRα3 polypeptide. Optionally, this antibody is a monoclonal antibody.

Surprisingly, the α-subunit receptor herein can dimerize upon ligand binding, and that such dimerization can activate the kinase domain fused to the α-subunit receptor. In view of the insights, methods are provided herein for measuring ligand-induced α subunit receptor activation (ie, homodimerization or homooligomerization). In one embodiment, preferably by measuring receptor protein tyrosine kinase (rPTK) autophosphorylation of a polypeptide fusion comprising the ligand binding domain of the α-subunit receptor and the intracellular catalytic domain of the receptor protein tyrosine kinase, A sensitive and reliable assay is provided that measures alpha subunit receptor activation (ie, homodimerization or homooligomerization) induced by an agonist or ligand. The construct may further include a flag epitope that facilitates capture and detection of optionally activated (eg, dimerized, phosphorylated) α-subunit receptors. This assay is desirable to qualitatively or quantitatively measure α-subunit receptor activation and to facilitate the identification and characterization of potential agonists and antagonists for selected α-subunit receptors. Useful. It is a further object of the present invention to provide an assay that allows ligand-receptor interactions to be studied for any selected α-subunit receptor, preferably the GFRα subunit receptor.

This assay must have a high throughput, ie the ability to reliably evaluate a large number of samples in a relatively short time (eg 1 day). This assay ideally does not use radioactive material and is also amenable to automation.

In at least one embodiment of the invention, a generic that allows the α-subunit receptor of interest to be studied regardless of whether a receptor-specific capture agent having the desired characteristics is available. An assay is provided. Furthermore, it is an object of the present invention to provide an assay that substantially demonstrates the ligand binding activity of the α-subunit receptor in situ. This is desirable as long as the change in interaction between the receptor and the ligand reduces the likelihood that this receptor may result from the membrane not being bound. In one embodiment of this assay, for measuring ligand binding by detecting serine-threonine kinase phosphorylation, intracellular kinase phosphorylation, and phosphatase activity of the catalytic domain fused to the α-subunit receptor. A method is provided. Thus, the present invention detects catalytic dimerization or homo-oligomerization and then kinase or phosphatase activity (ie, by autophosphorylation) of the catalytic domain fused to the ligand binding domain of the α-subunit receptor of interest. ) To measure the activation or ligand binding of the α-subunit receptor construct chimera.

This assay can be divided into two major steps, each of which is typically performed in a separate assay plate. The first stage of the assay preferably includes activating the α-subunit construct in the KIRA stage of the assay. The second stage of the assay involves measuring the activation of the receptor construct. Conveniently, this is accomplished by measuring receptor construct activation using an enzyme linked immunosorbent assay (ELISA).

The KIRA stage of this assay involves eukaryotic activity such that the extracellular domain of the α-subunit receptor faces the cell's external environment, the transmembrane domain is located at the cell membrane, and the catalytic kinase domain is located within the cell. Activating the α-subunit receptor-kinase receptor fusion construct located in the cell membrane of a biological cell. This stage of the overall assay includes the following steps (a)-(c): (a) a cell (usually a mammalian cell line) is a first solid phase (eg, a first assay). The solid phase is coated with a substantially uniform population of cells so that it adheres to the wells of the plate. Frequently, the cells are adherent, thereby naturally attaching to the first solid phase. In one embodiment of the invention, the cell is a DNA encoding a polypeptide receptor construct comprising an α-subunit receptor ligand binding domain fused to a catalytic kinase domain, or a “receptor construct” as further defined below. And is expressed by the cell such that the receptor or receptor construct is properly located on the cell membrane.

This receptor construct further preferably comprises a fusion with a flag polypeptide. This flag polypeptide is recognized by the capture agent (often a capture antibody) in the ELISA portion of the assay. The use of the receptor construct disclosed herein is particularly advantageous. Because this use provides a “generic” assay in which autophosphorylation of any kinase receptor domain can be measured, regardless of whether a receptor-specific capture agent with the required characteristics is available Because it does. Frequently, this receptor construct comprises an ECD of the selected α-subunit receptor, the catalytic ICD (and possibly the transmembrane domain) of another well-characterized tyrosine kinase (eg, Rse receptor). ).

(B) The analyte is then added to the well with the attached cells so that the receptor construct is exposed (or contacted) to the analyte. This assay allows the identification of agonist and antagonist ligands for the α-subunit assay of interest. In order to detect the presence of an antagonist ligand that blocks binding and / or activation of this receptor by an agonist ligand, the attached cells are first suspicious of being an antagonist ligand and then an agonist ligand (or A mixture of agonists and antagonists) and competitive inhibition of receptor binding and activation can be measured. This assay may also identify antagonists that bind to agonist ligands and thereby reduce or eliminate the ability to bind to and activate the kinase domain. To detect such antagonists, the suspected antagonist for the receptor and the agonist are incubated together, and the attached cells are then exposed to the ligand mixture.

(C) After exposure to the analyte, the adhering cells are lysed using lysis buffer (which has solubilized surfactant in it) and gentle agitation, thereby The cell lysate can be released and the cell lysate can be directly subjected to the ELISA portion of the assay without the need for concentration or purification of the cell lysate. Thus, this assay surprisingly does not require enrichment of this cell lysate prior to ELISA unless Knutson and Buck (supra), Klein et al. (Supra) and Hagino et al. (Supra). Provides a significant modification to the assay described by. Furthermore, in this assay, unlike other assays, cells can be lysed in lysis buffer using gentle agitation without the need for cell homogenization, centrifugation, or clarification. The cell lysate thus prepared is then ready to be subjected to the ELISA stage of the assay. Surprisingly, the first assay plate can be stored at a freezing temperature (ie, about −20 ° C. to −70 ° C.) for a significant time (at least 6 months) prior to the ELISA step of the assay. Was discovered. This is a significant finding as long as the KIRA and ELISA steps of this assay can be performed on separate days.

The ELISA configuration of this assay includes steps (d)-(h) described below.

(D) As a first step, this second solid phase (usually the well of an ELISA microtiter plate) is specifically bound to this receptor construct, preferably the flag polypeptide present if necessary. Coat with capture agent (often capture antibody). The coating of the second solid phase is performed so that the capture agent adheres to the second solid phase. The capture agent is generally a monoclonal antibody, although polyclonal antibodies can also be used, as described in the examples herein.

(E) The cell lysate obtained in step (c) of the above-described KIRA stage of the assay is attached to the second solid phase so that the receptor construct is attached (or captured). Exposed to or contacted with a capture agent. The assay of the present invention differs from the Klein et al. Assay in that a ligand for the receptor as well as a kinase inhibitor is present to achieve proper immobilization of the receptor or receptor construct to the second solid phase. do not need.

(F) A washing step is then performed to remove unbound cell lysate, leaving the captured receptor or receptor construct.

(G) The attached or captured receptor construct is then exposed to or contacted with an anti-phosphotyrosine antibody that identifies a phosphorylated tyrosine residue in the tyrosine kinase receptor domain. In a preferred embodiment, the anti-phosphotyrosine antibody is conjugated (directly or indirectly) to an enzyme that catalyzes the color change of a non-radioactive chromogenic reagent. Thus, phosphorylation of the receptor can be measured by subsequent color change of the reagent. The enzyme can be bound directly to the anti-phosphotyrosine antibody, or a molecule that is bound (eg, biotin) can be bound to the anti-phosphotyrosine antibody, followed by the enzyme being bound to the molecule Can be bound to this anti-phosphotyrosine antibody.

(H) Finally, the binding of the anti-phosphotyrosine antibody to the captured receptor construct can be measured, for example, by a chromogenic change in a chromogenic reagent.

The present invention also relates to Rse flag reagents that are particularly useful for use in KIRA ELISA assays. The Rse flag reagent is a polypeptide comprising a fusion of a flag polypeptide (usually the gD flag described herein) to the carboxyl terminus of the intracellular domain of Rse rPTK. In general, the transmembrane domain of Rse and another extracellular domain of rPTK of interest are also present in the fusion polypeptide reagent. The nucleic acid encoding this reagent and cells transformed therewith are also the present invention.

In yet a further aspect, the present invention relates to a kit that can be used in the KIRA ELISA disclosed above, wherein the kit comprises an anti-flag polypeptide capture agent (eg, a capture antibody) (this is generally described herein). Bound to a second solid phase as described), and a receptor construct. Thus, the kit generally provides an ELISA microtiter plate with an anti-flag polypeptide capture antibody attached to the well. Optionally, the kit also provides an anti-phosphotyrosine antibody that is frequently labeled, or reagents for labeling the anti-phosphotyrosine antibody are provided in the kit. Sometimes a homogeneous population of cells transformed with the receptor constructs described herein is also provided with the kit. The kit may also include instructions for performing a KIRA ELISA.

Detailed Description of Preferred Embodiments
(I. Definition)
As used herein, the terms “GFRα3”, “GFRα3 polypeptide” and “GFRα3 homolog” include native sequence GFRα3 and variants of GFRα3, which are further defined herein below. The GFRα3 can be isolated from a variety of sources (eg, from human tissue types or from another source) or can be prepared by recombinant or synthetic methods. “Native sequence GFRα3” includes a polypeptide having the same amino acid sequence as GFRα3 derived from nature. Such native sequence GFRα3 can be isolated from nature or can be produced by recombinant or synthetic means. The term “native sequence GFRα3” specifically includes naturally occurring truncated or secreted forms of GFRα3 (eg, extracellular domain sequences), naturally occurring variant forms of GFRα3 (eg, alternatively spliced forms) and GFRα3 Includes naturally occurring allelic variants. In one embodiment of the invention, this native sequence GFRα3 comprises amino acids 1 to 400 of SEQ ID NO: 15 with or without an N-terminal signal sequence and with or without an initial methionine at position 1. The mature or full-length native sequence GFRα3.

A “GFRα3 variant” is at least about 75 to (a) a DNA molecule encoding a GFRα3 polypeptide, with or without its native signal sequence, or (b) the complement of the DNA molecule of (a). Active GFRα3 as defined below with% amino acid sequence identity. In certain embodiments, the GFRα3 variant has at least about 80% amino acid sequence homology with GFRα3 having the deduced amino acid sequence set forth in SEQ ID NO: 15 for the full-length native sequence GFRα3. Such GFRα3 variants include, for example, GFRα3 polypeptides in which one or more amino acid residues have been added or deleted from the N-terminus or C-terminus of the sequence of SEQ ID NO: 15. Preferably, the nucleic acid sequence identity or amino acid sequence identity is at least about 75%, more preferably at least about 80%, and even more preferably at least about 90%, and even more preferably at least About 95%.

“Percent amino acid sequence identity (%)” for the GFRα3 sequence identified herein aligned the sequences and introduced gaps where necessary to achieve the maximum percent sequence identity. Later, it is defined as the percentage of amino acid residues in the candidate sequence that are identical to amino acid residues in the GFRα3 sequence (any conservative substitutions are not considered part of the sequence identity). Alignments for the purpose of determining percent amino acid sequence identity are publicly available in various ways within the purview of those skilled in the art, such as BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software Can be achieved using simple computer software. One skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

“Percent nucleic acid sequence identity (%)” for the GFRα3 sequences identified herein aligned the sequences and introduced gaps where necessary to achieve the maximum percent sequence identity. Later defined as the percentage of nucleotides in the candidate sequence that are identical to the nucleotides in the GFRα3 sequence. Alignments for the purpose of determining percent nucleic acid sequence identity are publicly available in various ways within the purview of those skilled in the art, such as, for example, BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software Can be achieved using simple computer software. One skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

“Isolated” as used to describe the various polypeptides disclosed herein refers to polypeptides that have been identified and separated and / or recovered from components of their natural environment. To do. Contaminant components of its natural environment are substances that typically inhibit diagnostic or therapeutic use for polypeptides and can include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In a preferred embodiment, the polypeptide is (1) sufficient to obtain at least 15 residues of the N-terminal amino acid sequence or internal amino acid sequence by use of a spinning cup sequencer, or ( 2) Purified to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue, or preferably silver staining. Isolated polypeptide includes the polypeptide in situ within recombinant cells. This is because at least one component of the GFRα3 natural environment does not exist. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step.

An “isolated” DNA48613 nucleic acid molecule is a nucleic acid molecule that has been identified and isolated from at least one contaminating nucleic acid molecule that is normally bound in a natural source of DNA48613 nucleic acid. An isolated DNA48613 nucleic acid molecule is other than in the form or manner found in nature. Thus, an isolated d48613 nucleic acid molecule is distinguished from a DNA48613 nucleic acid molecule when present in natural cells. However, an isolated DNA48613 nucleic acid molecule includes, for example, a DNA48613 nucleic acid molecule contained in cells that normally express DNA48613 when the nucleic acid molecule is in a chromosomal location different from that of natural cells.

The term “control sequence” refers to a DNA sequence necessary for the expression of an operably linked coding sequence in a particular host organism. The control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.

A nucleic acid is “operably linked” when it is placed into a functional relationship with another nucleic acid sequence. For example, when a DNA for a presequence or secretory leader is expressed as a preprotein involved in the secretion of the polypeptide, it is operably linked to the DNA of the polypeptide; the promoter or enhancer can transcribe the coding sequence. The ribosome binding site is operably linked to the coding sequence if it is positioned to facilitate translation. In general, “operably linked” means that the linked DNA sequences are continuous, and in the case of a secretory leader, are in a continuous and reading phase. However, enhancers do not have to be continuous. Ligation is achieved by ligation at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers are used according to conventional practice.

The “stringency” of a hybridization reaction can be readily determined by one skilled in the art and is generally an experimental calculation that depends on probe length, wash temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, but shorter probes require lower temperatures. Hybridization generally depends on the ability of denatured DNA to re-anneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature that can be used. As a result, higher relative temperatures tend to make the reaction conditions more stringent, while lower temperatures can be said to be less stringent. For further details and explanation of stringency of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers (1995).

“Stringent conditions” or “high stringency conditions” as defined herein may be identified by: (1) conditions that use low ionic strength and high temperature for washing (eg, 50 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.1% sodium dodecyl sulfate at 0 ° C.); (2) conditions using a denaturing agent such as formamide during hybridization (eg at 42 ° C. 50% (v / v) formamide and 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / pH 6.5 50 mM sodium phosphate buffer, 750 mM sodium chloride, 75 mM sodium citrate) Or (3) at 42 ° C., 50% formamide, 5 × SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 × Denhart solution, sonicated salmon sperm DNA (50 μg / ml), 0.1% SDS, and Conditions using 10% dextran sulfate and washing at 42 ° C. in 0.2 × SSC (sodium chloride / sodium citrate) and 0.1% SDS; or (4) 10% dextran sulfate at 55 ° C., 2 × Conditions using SSC and a 50% formamide buffer followed by a high stringency wash of 0.1 × SSC containing EDTA at 55 ° C.

“Moderately stringent conditions” can be identified as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and washings of stringent lower than the stringent above. And the use of hybridization conditions (eg, temperature, ionic strength, and% SDS). Examples of moderately stringent conditions are: 20% formamide, 5 × SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 × Denhardt's solution, 10% dextran sulfate, and 20 mg Overnight incubation at 37 ° C. in a solution containing / mL denatured sheared salmon sperm DNA, followed by washing of the filter in 1 × SSC at about 37-50 ° C. Those skilled in the art understand how to adjust the temperature, ionic strength, etc. necessary to adapt factors such as probe length and the like.

“RPTK” means receptor protein tyrosine kinase.

“ECD”, “TM domain”, and “ICD” refer to the extracellular domain, transmembrane domain, and intracellular domain of rPTK, respectively.

As used throughout this application, “kinase receptor activation” or “KIRA” refers to a cell-bound receptor construct (typically having an rPTK ICD domain) in the intracellular domain of the rPTK portion of the receptor construct. Refers to the first stage of the present assay, which is exposed to agonist / antagonist ligands that may (or may not) induce phosphorylation of tyrosine residues. KIRA is generally performed in a “first assay plate” as defined herein. US Pat. No. 5,766,863 and its corresponding WO publication (Kinase receptor activation assay) describe a recombinantly expressed protein fusion of a receptor extracellular domain and a replacement enzyme domain (eg, a tyrosine kinase domain). Which is hereby incorporated by reference in its entirety to teach the KIRA assay to be used.

“Enzyme-linked immunosorbent assay” or “ELISA” refers to the second stage of the present assay and includes measuring tyrosine phosphorylation of the kinase domain of the receptor construct. The ELISA is usually performed in a “second assay plate” as disclosed in the present application. An ELISA is a “sandwich ELISA” as long as it involves capturing the receptor construct in a second solid phase (usually the well of an ELISA microtiter plate). An ELISA assay generally involves the preparation of an enzyme-antibody conjugate. This bound enzyme cleaves the substrate, producing a chromogenic reaction product that can be detected by spectrophotometry. In this assay, the absorbance of the developed solution in individual microtiter wells is proportional to the amount of phosphotyrosine. A review of ELISA is found in Current Protocols in Molecular Biology, Volume 2, Chapter 11 (1991). The term “ELISA” is used to describe the second stage of the present assay, but this is only a preferred embodiment of the present invention. This is because, as disclosed herein, techniques other than enzyme detection can be used to measure the binding of anti-phosphotyrosine antibodies to activated receptors.

The terms “tyrosine kinase”, “tyrosine kinase receptor”, “receptor protein tyrosine kinase”, and “rPTK” are used interchangeably herein and at least one phosphate that accepts a phenol group in its ICD. A protein having This protein is usually a receptor as long as it has ligand-bound ECD, TM domain, and ICD. This ICD usually contains a catalytic kinase domain and has one or more phosphates that accept tyrosine residues. Examples of tyrosine kinase receptors include: insulin receptor, insulin-related receptor, epidermal growth factor receptor (EGF-R), platelet derived growth factor receptors A and B (PDGF-RA and PDGF-RB) ), Insulin-like growth factor 1 receptor (IGF-1-R), macrophage colony stimulating factor receptor (M-CSF-R), HER2 / neu / c-erbB-2 receptor, HER3 / c-erbB-3 receptor, Xmrk receptor, IRR receptor, fibroblast growth factor (FGF) receptors bek and flg, c-kit receptor, Flk / kDR receptor, Rse receptor, Eph, Elk, Eck, Eek, Erk, Cek4 / Mek4 / HEK, And Ce 5 receptor, AxI receptor, hepatocyte growth factor receptor (HGF-R), Flt1 VEGF receptor, SAL-S1 receptor, HpTK 5 receptor, trkA receptor, trkB receptor, and trkC receptor. See, eg, Ulrich and Schlessinger, Cell 81: 203-212 (1990); Fantl et al., Annu. Rev. Biochem. 62: 453-481 (1993); Mark et al., Journal of Biological Chemistry 269 (14): 10720-10728 (1994); and WO 93/15201.

The above terms include at least the extracellular domain of the selected α-subunit receptor and the intracellular domain of the kinase receptor (preferably rPTK), and optionally the same or another tyrosine kinase transmembrane domain, and It further includes a chimeric “receptor” molecule, or “receptor construct”, or “α-subunit receptor construct”, optionally containing a flag epitope. Of course, the alpha receptor of interest can provide a transmembrane domain if it has one. These terms also include amino acid sequence variants and covalent derivatives of various α-subunit receptors, where they are fused under the condition that they still exhibit kinase phosphorylation activity in a KIRA ELISA. including. Thus, this variant generally has conservative amino acid modifications. Individual domains of α-subunit receptor kinases can be expressed based on sequence homology to known receptors in related families and hydrophobicity plots. For example, hydrophobic transmembrane domains can be readily determined, and ECD and ICD, if present, are usually amino-terminal and carboxyl-terminal, respectively, to the transmembrane domain or GPI anchor. Conveniently, the transmembrane domain and ICD of the Rse receptor are typically fused with the GPI-anchor sequence to the ECD of the α-subunit receptor of interest, thereby causing a receptor as referred to herein. Chimeric receptors can be formed which are included in the term denoting a construct.

In a preferred embodiment, the α-subunit receptor is selected from the group consisting of GFRa1, GFRa2, GFRa3, and GFRa4.

“Autophosphorylation” means activation of the catalytic kinase domain of the rPTK portion of the receptor construct, which results in phosphorylation of at least one unique tyrosine residue. In general, autophosphorylation occurs when an agonist molecule binds to the extracellular domain of the α-subunit receptor. Without being limited to any particular mechanism of action, binding of an agonist molecule results in oligomerization of the receptor construct that results in activation of the catalytic kinase domain.

"Solid phase" means a non-aqueous matrix to which cells (in the KIRA stage of the assay) or capture agents can attach (in the ELISA stage of the assay). Usually, this solid phase comprises the wells of an assay plate, but the invention is in no way limited to this embodiment. For example, the solid phase can comprise a discontinuous solid phase of discrete particles. The particles are porous and can be formed from many different materials such as polysaccharides (eg, agarose), polyacrylamide, polystyrene, polyvinyl alcohol, silicone, and glass. See US Pat. No. 4,275,149 for examples of suitable specific solid phases.

“Well” means a depression or holding space in which an aqueous sample can be placed. This well is provided in an “assay plate”. The present invention typically uses a “first assay plate”, which is formed from a material (eg, polystyrene) that optimizes the attachment of cells (having a receptor or receptor construct) thereto. Is done. In general, the individual wells of the first assay plate have a high surface area to volume ratio, and thus a suitable shape is a flat-bottom well (where cells adhere). The “second assay plate” is generally formed of a material (eg, polystyrene) that optimizes the attachment of the capture agent thereto. The second assay plate can have the same general structure and / or characteristics as the first assay plate. However, separate plates are used for the KIRA stage of the assay and the ELISA stage of the assay.

In a preferred embodiment of the invention, the first assay plate and the second assay plate are both “microtiter” plates. As used herein, the term “microtiter” plate refers to an assay plate having between about 30-200 individual wells (usually 96 wells). Frequently, individual wells of the microtiter plate hold a maximum volume of about 250 μl. Conveniently, the first assay plate is a 96 well polystyrene or plastic cell culture microtiter plate (eg, sold by Becton Dickinson Labware, Lincoln Park, NJ) that allows automation. Frequently, about 50 μl to 300 μl, more preferably 100 μl to 200 μl of an aqueous sample containing cell culture medium and cells suspended therein is added to each well of the first assay plate at the KIRA stage of the assay. To do. It is desirable to seed between 1 × 10 ^{4 and} 3 × 10 ⁵ cells per well. More preferably, 5 × 10 ⁴ to 1 × 10 ⁵ cells are seeded per well. Typically, the second assay plate comprises a polystyrene microtiter ELISA plate (eg, a plate sold by Nunc Maxisorp, Inter Med, Denmark).

The term “homogeneous population of cells” refers to a substantially homogeneous population of cells in which at least about 80%, and preferably about 90%, of the cells in the population are the same cell type. Therefore, it is convenient to use a cell line. The cell line is a eukaryotic cell line, usually an animal cell line, and preferably a mammalian cell line.

The cell has or is transformed to produce a selected receptor construct. Thus, the cell is transformed with a nucleic acid encoding the receptor construct, and the nucleic acid has the receptor ECD facing the cell's external environment and the transmembrane domain is located within the cell membrane and the kinase domain is It is expressed so as to be located inside the cell. As a general proposition, a minimum number of about 1 × 10 ⁴ receptors / cell is required.

The term “adhesive” as used herein to describe a cell naturally attaches to the first solid phase (often the well of the first assay plate), thereby causing the inside of the well to A cell that forms a constant coating of cells on its surface. A constant coating of cells is generally formed after about 8-16 hours of incubation of the cells in the wells of the first assay plate. After incubation, non-adherent cells and cell culture medium are discarded from the first assay plate. Incubations are usually performed at a temperature that is optimal for cell growth (ie, about 37 ° C.). Examples of adherent cell lines include CHO cells (Urlaub and Chasin, Proc. Natl. Acad. Sci. USA 77: 4216 (1980)), MCF-7 cells (ATCC HB22), 293 cells (Graham et al., J. Biol. Gen Virol. 36:59 (1977)), Swiss albino 3T3 fibroblast cell line (ATCC accession number CCL92), and U937 macrophage cell line (ATCC accession number CRL 1593).

A “flag polypeptide” has sufficient residues to provide an epitope (to which a “capture agent” can be made) (preferably a linear epitope), which may not be a kinase domain or ligand. Includes short polypeptides that are short enough not to interfere with the activity of the binding domain. The flag polypeptide is also unique enough so that the capture agent for it does not bind to other reagents in the assay. Selection of “unique” flag polypeptide sequences can be accomplished, for example, by comparing the sequence of the proposed flag polypeptide against other known sequences in Genbank or EMBL. Suitable flag polypeptides generally have at least 6 amino acid residues and usually have about 8-80 amino acid residues (preferably between about 9-30 amino acid residues).

“Receptor construct” means a polypeptide comprising a fusion of an α-subunit receptor ligand binding domain and a kinase receptor catalytic domain, and optionally a flag polypeptide as defined above. The flag polypeptide is provided at a position in the receptor construct as follows: a) the flag polypeptide does not interfere with ligand binding to the receptor; b) the flag polypeptide prevents autophosphorylation of the receptor. C) The flag polypeptide is presented in an appropriate configuration such that it can bind to the capture agent in the ELISA step of the assay. Frequently, the polypeptide flag is present at the N-terminus of the receptor construct. Alternatively, the flag polypeptide can be present at the C-terminus of the receptor construct. Rse. The gD construct is preferred. The Rse constructs disclosed herein are particularly useful. Because the ICD (and optionally the transmembrane domain) is fused to the ECD of the receptor of interest, thereby eliminating the need to establish where this flag polypeptide should be located with respect to the receptor of interest. Because you get.

“Rse.gD” refers to a receptor construct having an Rse receptor protein tyrosine kinase ICD domain in which a herpes simplex virus glycoprotein D (gD) flag polypeptide is fused to its COOH terminus.

“Rse.flag reagent” refers to a polypeptide comprising the ICD of the Rse receptor fused at its COOH terminus to a flag polypeptide (usually a gD flag polypeptide). Sometimes the ECD and Rse TM domains of the α-subunit receptor of interest are also Rse. Present in gD reagent. “Receptor ECD / Rse.gD chimera” refers to a fusion of an ECD of the α-subunit receptor ligand binding domain of interest to the TM domain and ICD domain of Rse fused to the COD terminus of the gD flag polypeptide.

“Capture agent” means a compound or agent that can be attached to a second solid phase as defined herein and that is selective for the receptor construct. Thus, this capture agent captures the receptor construct in the well of the second assay plate. Usually, the capture agent selectively binds to a flag polypeptide that is fused to the receptor of interest. This capture agent binding is unaffected by the presence or absence of ligand bound to the receptor and does not induce receptor activation upon capture. Furthermore, this capture agent does not sterically block access to phosphorylated tyrosine by anti-phosphotyrosine antibodies. Means for selecting an appropriate capture agent are described herein. In general, capture agents include antibodies (eg, affinity purified polyclonal or monoclonal antibodies), although other selective agents such as streptavidin that selectively bind to a “strep tag” polypeptide can also be used. (See Schmidt et al., Protein Engineering 6 (1): 109-122 (1993)). Streptavidin is described in, for example, Zymed Laboratories, S.A. It can be purchased commercially from San Francisco, CA. Alternatively, the capture agent may comprise protein A, which specifically binds to immunoglobulin. In this embodiment of the invention, the activated receptor-construct present in the cell lysate is incubated with an antibody that specifically binds to it, thereby forming a receptor-antibody complex. This complex can be captured by protein A by specific binding to the antibody present in the complex. Protein A can be obtained from, for example, Pharmacia Biotech, Inc. , Piscataway, New Jersey.

In the most preferred embodiment, the capture agent is a monoclonal antibody that specifically binds to a flag polypeptide, which is present in the receptor construct. Examples of suitable flag polypeptides and their respective capture antibodies include the flu HA flag and its antibody 12CA5 (Field et al., Mol. Cell. Biol. 8: 2159-2165 (1988)); c-myc flag and it 8F9, 3C7, 6E10, G4, B7, and 9E10 antibodies (Evan et al., Molecular and Cellular Biology 5 (12): 3610-3616 (1985)); and herpes simplex virus glycoprotein D (gD) flag and 5B6 thereto Antibodies (Paborsky et al., Protein Engineering 3 (6): 547-553 (1990)) and Mark et al., Journal of Biological Chemistry 269 14): 10720-10728 (1994)), and the like. Other flag polypeptides have been disclosed. Examples include Flag-peptide (Hopp et al., BioTechnology 6: 1204-1210 (1988)); KT3 epitope peptide (Martin et al., Science 255: 192-194 (1992)); α-tubulin epitope peptide (Skinner et al., J. Biol. Chem. 266: 15163-15166 (1991)); and the T7 gene 10 protein peptide tag (Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA 87: 6393-6397 (1990)). . Once this flag polypeptide is selected as described above, capture antibodies against it can be generated using the techniques disclosed herein.

The term “analyte” usually refers to a compound or composition to be studied in order to investigate its ability to activate (or interfere with) the activation of the α-subunit receptor of interest. The analyte may comprise a body fluid (eg, plasma or amniotic fluid) or composition known or suspected of containing a ligand for the tyrosine kinase receptor. The analyte can also include cells having a ligand for the α-subunit receptor of interest.

As used herein, “ligand” refers to a molecule that can bind to the desired extracellular α-subunit receptor or a known agonist thereof. This ligand is usually an agonist or antagonist for the receptor.

“Agonist” means a molecule capable of activating the intracellular kinase domain of a receptor construct upon binding to an extracellular α-subunit receptor moiety. Frequently, the agonist comprises a growth factor (ie, a polypeptide that can stimulate cell division). Exemplary growth factors include artemin, newturin, GDNF, and percefin. Alternatively, the agonist may be an antibody to the receptor indicated herein in the examples or further to its flag sequence. However, other non-protein agonists (eg, small organic molecules) are also included in the present invention.

“Antagonist” means a molecule that blocks agonistic action. Typically, the antagonist is one of the following: (a) binds to the α-subunit receptor moiety, thereby blocking receptor binding and / or activity by the agonist for the receptor (antagonist is the receptor's May bind ECD, but this is not necessarily absolute); or (b) binds to an agonist, thereby preventing activation of the receptor by the agonist. This assay facilitates the detection of both types of antagonists. An antagonist can comprise, for example, a peptide fragment comprising the receptor binding domain of an endogenous agonist ligand for the receptor. The antagonist can also be an antibody directed against the ECD of the receptor or against a known agonist of the receptor. However, other non-protein molecules are also included in this term.

The term “antibody” is used in the broadest sense, and more particularly a single anti-GFRα3 monoclonal antibody (including agonists, antagonists, and neutralizing antibodies), and an anti-GFRα3 antibody composition with polyepitope specificity. Can contain things. The term “monoclonal antibody” as used herein refers to an antibody obtained from a substantially homogeneous population of antibodies, ie, individual antibodies comprising this population may be present in small amounts. Except for mutations present in

“Active” or “activity” for purposes herein, as the context indicates, retains the biological and / or immunological activity of the native or naturally occurring GFRα3, or receptor. Refers to the form of the GFRα3 or α-subunit receptor. A preferred activity is the ability to bind to and affect an agonist or natural ligand (eg, block or otherwise modulate its activity). This activity preferably includes modulation of neuronal function.

A “GFRα3 ligand” is a molecule that binds to and preferably activates the native sequence GFRα3. The ability of a molecule to bind to GFRα3 can be determined, for example, by the ability of the putative ligand to bind to the GFRα3 immunoadhesin coated on the assay plate. The specificity of binding can be determined by comparing binding to GFRα1 or 2.

The term “anti-phosphotyrosine antibody” refers to a molecule (usually an antibody) that selectively binds to a phosphorylated tyrosine residue in the kinase domain of rPTK. The antibody can be polyclonal, but is preferably a monoclonal antibody. Anti-phosphotyrosine polyclonal antibodies can be made using the techniques disclosed in White and Backer, Methods in Enzymology 201: 65-67 (1991), and monoclonal anti-phosphotyrosine antibodies are described in, for example, Upstate Biologicals, Inc. (UBI, Lake Placid, NY).

As used herein, the term “label” refers to a detectable compound or composition that is conjugated directly or indirectly to a molecule (eg, an anti-phosphotyrosine antibody). The label can itself be detectable (eg, a radioisotope label or a fluorescent label) or, in the case of an enzyme label, can catalyze a chemical change in the substrate compound or composition that is detectable. A preferred label is an enzyme label that catalyzes the discoloration of a non-radioactive coloring reagent.

“Washing” removes the solid phase from unbound material (eg, non-adherent cells, non-adherent capture agents, non-binding ligands, receptors, receptor constructs, cell lysates, or anti-phosphotyrosine antibodies). As such, exposure to an aqueous solution (usually a buffer or cell culture medium) is meant. In order to reduce background noise, it is advantageous to include a surfactant (eg, Triton X) in the cleaning solution. Usually, the aqueous wash solution is decanted from the wells of the assay plate after washing. Conveniently, cleaning can be accomplished using an automated cleaning device. Sometimes several washing steps (eg, between about 1-10 washing steps) may be required.

By “blocking buffer” is meant an aqueous pH buffered solution that includes at least one blocking compound that can bind to the exposed surface of a second solid phase that is not coated with a capture agent. This blocking compound is usually a protein such as bovine serum albumin (BSA), gelatin, casein, or milk powder and does not cross-react with any of the reagents in the assay (eg, anti-phosphotyrosine antibodies and detection reagents). Block buffer is generally provided at a pH between about 7 and 7.5, and suitable buffering agents include phosphate buffer and TRIS buffer.

By “lysis buffer” is meant an aqueous pH buffered solution comprising a solubilizing surfactant, one or more protease inhibitors, and at least one phosphatase inhibitor (eg, sodium orthovanadate). The term “solubilizing surfactant” refers to a water-miscible nonionic surfactant that lyses the cell membrane of eukaryotic cells but does not denature or activate the receptor construct. Examples of suitable nonionic surfactants include Triton-X 100, Tween 20, CHAPS, and Nonidet P-40 (NP40) (eg, available from Calbiochem, La Jolla, California). Many other nonionic surfactants are available in the art. Examples of suitable protease inhibitors include phenylmethylsulfonyl fluoride (PMSF), leupeptin, pepstatin, aprotinin, 4- (2-aminoethyl) -benzenesulfonyl fluoride hydrochloride-bestatin, chymostatin, and benzamidine. Preservatives (eg, thimerosal) and one or more compounds that maintain the isotonicity of the solution (eg, sodium chloride (NaCl) or sucrose), and buffers (eg, Tris or PBS) are also usually present To do. In general, the pH of the lysis buffer ranges from about 7 to 7.5.

Usually, after the lysis buffer is added to the first assay plate, the first assay plate is “gently agitated” and this expression causes the first assay plate to move at a much lower rate (usually circular motion). )) To physically shake. “Gent agitation” does not include mechanically disrupting the cells (eg, by homogenizing or centrifuging the cells). Exemplary shaking speeds are, for example, in the Belico rotary shaker, 200-500 rpm, preferably 300-400 rpm.

II. Compositions and Methods of the Invention
(A. Full length GFRα3)
The present invention provides newly identified and isolated nucleotide sequences encoding a polypeptide referred to herein as GFRα3. In particular, Applicants have identified and isolated cDNA encoding a GFRα3 polypeptide. This will be disclosed in more detail in the examples below. Using BLAST, BLAST-2 and FastA sequence alignment computer programs, Applicants found that the full-length native sequence GFRα3 (SEQ ID NO: 15) has 34% amino acid sequence identity with GFRα1 and GFRα2. Therefore, at present, it is considered that GFRα3 disclosed in the present application is a newly identified member in the GFR protein family and may have a neuronal cell activation function typical of the GFR protein family. However, the limited distribution of GFRα3 compared to GFRα1 and GFRα2 makes GFRα3 and its agonists preferred molecules to avoid unwanted side effects when administered.

Glial cell line-derived neurotrophic factor (“GDNF”) and Neuturin (“NTN”) are two structurally related potent survival factors of sympathetic sensory neurons and central nervous system neurons (Lin). Science 260: 1130-1132 (1993); Henderson et al., Science 266: 1062-1064 (1994); Buj-Bello et al. Neuron 15: 821-828 (1995); Kotzbauer et al., Nature 384: 467-470 1996)). GDNF has been shown to mediate its action through a multicomponent receptor system composed of a ligand-bound glycosyl-phosphatidylinositol (GPI) -linked protein (referred to as GDNFRα or GFRα1) and a transmembrane tyrosine kinase Ret ( Trenor et al., Nature 382: 80-83 (1996); Jing et al., Cell 85: 1131-1124 (1996); Trpp et al., Nature 381: 785-789 (1996); Durbec et al., Nature 381: 789-793 (1996). )). The NTN signal is transmitted by GFRα2, which also associates with Ret. Described herein is the isolation, sequence, and tissue distribution of a GPI-linked protein termed GFRα3 and its gene. This has been shown to modulate the response to novel ligands in the NTN and GDNF families. In the case of a cellular response to NTN, the cell requires the presence of GFRα2. Ligand-bound GFRα2 induces phosphorylation of the tyrosine kinase receptor Ret. These findings identify Ret and GFrRα2 as the signaling and ligand binding components of the NTN and related ligand receptors, respectively. This defines a novel neurotrophic and differentiation factor receptor family of receptors, including a shared transmembrane protein tyrosine kinase (Ret) and a ligand-specific GPI-linked protein component (GFRα).

Glial cell line-derived neurotrophic factor (“GDNF”) (Lin et al., Science 260: 1130-1132 (1993); WO 93/06116, which is incorporated herein by reference in its entirety) Brain dopaminergic neurons (Lin et al., Science 260: 1130-1132 (1993); Stroenberg et al., Exp. Neurol., 124: 401-412 (1993); Beck et al., Nature, 373: 339-341 (1995); Brain Res., 672: 104-111 (1995); Tomac et al., Nature, 373: 335-339 (1995)), spinal motor neurons (Henderson et al., Science 266: 1062-1064 (1994); Ppenheim et al., Nature, 373: 344-346 (1995); Yan et al., Nature 373: 341-344 (1995)), and noradrenergic neurons (Arenas et al., Neuron, 15: 1436-1473 (1995)) It is a survival factor. These are Parkinson's disease (Hirsch et al., Nature, 334: 345-348 (1988); Hornykiewicz, Mt. Sinai J. Med., 55: 11-20 (1988)), amyotrophic lateral sclerosis (Hirano et al.), Respectively. , Amyotropic Lateral Sclerosis and Other Motor Neurons Diseases, edited by P. Rowland (New York: Raven Press Inc. 91-101 (1991)), and Alzheimer's disease (Marcyneuk et al. 1986); Cash et al., Neurology, 37: 42-46 (1987); Chan-Palay et al., Comp. Neurol., 287: 37. -392 (1989)) Based on mice genetically engineered to be deficient in GDNF, additional biological roles for GDNF have been reported: intestinal neurons, sympathetic neurons , And sensory neurons, and development and / or survival of the renal system, not catecholaminergic neurons in the central nervous system (CNS) (Moore et al., Nature 382: 76-79 (1996); Picel et al., Nature 382: 73-76 (1996); Sanchez et al., Nature 382: 70-73 (1996)) Despite the physiological and clinical significance of GDNF, little is known about its mechanism of action.

Cytokine receptors frequently assemble into multi-subunit complexes. Sometimes the α subunit of this complex is involved in binding to cognate growth factors, and the β subunit may include the ability to transmit signals to cells. Without wishing to be bound by theory, these receptors are assigned to three subfamilies depending on the complex formed. Subfamily 1 against EPO, granulocyte colony stimulating factor (G-CSF), interleukin-4 (IL-4), interleukin-7 (IL-7), growth hormone (GH), and prolactin (PRL) Includes receptors. Ligand binding to receptors belonging to this subfamily is thought to result in receptor homodimerization. Subfamily 2 includes IL-3, granulocyte macrophage colony stimulating factor (GM-CSF), interleukin-5 (IL-5), interleukin-6 (IL-6), leukocyte inhibitory factor (LIF), oncostatin Includes receptors for M (OSM) and ciliary neurotrophic factor (CNTF). Subfamily 2 receptors are α subunits for ligand binding and β subunits for signal transduction (shared β subunits of IL-3, GM-CSF, and IL-5 receptors, or IL-6 , LIF, OSM, and gp130 subunits of CNTF receptors). Subfamily 3 contains only interleukin-2 (IL-2) receptors. The β and γ subunits of the IL-2 receptor complex are cytokine-receptor polypeptides that associate with the α-subunit of unrelated Tac antigens.

The present invention is based on the discovery of GFRα3. This is a protein in the GFR family whose natural ligand is unknown. The experiments described herein demonstrate that this molecule is a receptor that appears to play a role in mediating responses to novel GDNF family ligands. In particular, this receptor has been found to be present in a variety of tissues and cell populations, including neurons, and thus GFRα3 ligands (eg, agonist antibodies) have been shown to proliferate, grow, grow GFRα3-containing cells and Ret-containing cells, It is shown that it can be used to stimulate survival, differentiation, metabolism, or regeneration.

(B. GFRα3 variant)
In addition to the full-length native sequence GFRα3 described herein, it is contemplated that GFRα3 variants can be prepared. GFRα3 variants can be prepared by introducing appropriate nucleotide changes into GFRα3 DNA, or by polypeptide synthesis of the desired GFRα3. One skilled in the art recognizes that amino acid changes can alter the post-translational process of GFRα3 (eg, change the number or position of glycosylation sites or change membrane attachment properties). Indeed, the splice GFRα3 splice variant is encoded by DNA48614 and the mouse variant is encoded by SEQ ID NO: 4. Other variants include IgG tagged and gD-RSE chimeras made as described in the Examples.

Modifications in the native full-length sequence GFRα3 or in the various domains of GFRα3 described herein include, for example, any technique and guideline for conservative and non-conservative mutations (eg, US Pat. No. 5,364). , 934). The modification may be a substitution, deletion or insertion of one or more codons encoding GFRα3, resulting in a change in the amino acid sequence of GFRα3 compared to the native sequence GFRα3. Optionally, this modification is by substitution of at least one amino acid with any other amino acid in one or more of the domains of GFRα3. Guidance in determining which amino acid residues can be inserted, substituted or deleted without adversely affecting the desired activity compares the sequence of GFRα3 with that of known homologous protein molecules and is highly homologous It can be found by minimizing the number of amino acid sequence changes made in the sex region. An amino acid substitution may be the result of replacing one amino acid with another amino acid having similar structural and / or chemical properties (eg, substitution of leucine with serine (ie, conservative amino acid substitution)). Insertions or deletions can optionally range from 1 to 5 amino acids. Possible modifications are made by systematically making amino acid insertions, deletions or substitutions in the sequence and testing the resulting variants for activity in the in vitro assays described in the Examples below. Can be determined.

The variant comprises (a) a nucleic acid sequence encoding a GFRα3 polypeptide comprising amino acid 27-400 of SEQ ID NO: 15, amino acid 27-369 of SEQ ID NO: 17, or amino acid 27-374 of SEQ ID NO: 5, or (b ) A variant encoded by an isolated nucleic acid molecule having at least about 65% sequence identity to the complement of the nucleic acid molecule of (a). Further, the variant comprises a nucleic acid molecule sequence comprising the ligand binding domain of the GFRα3 polypeptide of amino acids 84-360 of SEQ ID NO: 15; amino acids 84-329 of SEQ ID NO: 17; Or may be encoded by their complementary nucleic acids. These isolated nucleic acid molecules preferably comprise a GFRα3 coding sequence that preferentially hybridizes under stringent conditions to a nucleic acid sequence encoding a GFRα3 polypeptide of the invention. The sequence identity preferably has a sequence identity of at least about 75%, more preferably at least about 85%, even more preferably at least about 90%, and most preferably at least about 95%. Typically, the polypeptide is a polypeptide having amino acid residues 27-400 of SEQ ID NO: 15, a polypeptide having amino acids 27-369 of SEQ ID NO: 17, a polypeptide having amino acids 27-374 of SEQ ID NO: 5, A ligand binding domain of a GFRα3 polypeptide of the sequence of amino acids 84 to 360 of SEQ ID NO: 15, a ligand binding domain of the GFRα3 polypeptide of the sequence of amino acids 84 to 329 of SEQ ID NO: 17, or a sequence of amino acids 110 to 386 of SEQ ID NO: 20 It has at least about 75%, preferably at least about 80%, more preferably at least 85%, even more preferably at least 90%, and most preferably at least about 95% sequence identity with the ligand binding domain of the GFRα3 polypeptide. Preferably, the identity is to amino acid residues 27-400 of SEQ ID NO: 15 and the DNA encoding it. The isolated nucleic acid molecule can comprise DNA encoding a GFRα3 polypeptide having amino acid residues 27 to 400 of SEQ ID NO: 15, or is complementary to such encoding nucleic acid sequence and at least in It remains stably bound to it under conditions of conditions, optionally under conditions of high stringency. The protein is also clone DNA48613, DNA48614, deposited at It can be encoded by a nucleic acid encoding the full length protein of mouse GFRα3 (clone 13) or a nucleic acid that hybridizes to it under stringent conditions.

Modifications can be made using methods known in the art, such as oligonucleotide-mediated (site-specific) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis (Carter et al., Nucl. Acids Res., 13: 4331 (1986); Zoller et al., Nucl. Acids Res., 10: 6487 (1987)), cassette mutagenesis (Wells et al., Gene 34: 315). (1985)), restriction selective mutagenesis (Wells et al., Philos. Trans. R. Soc. London SerA, 317: 415 (1986)), or other known techniques are cloned to generate GFRα3 variant DNA. It can be carried out on activated DNA.

Scanning amino acid analysis can also be used to identify one or more amino acids along a contiguous sequence. Among the preferred scanning amino acids are relatively small neutral amino acids. Such amino acids include alanine, glycine, serine, and cysteine. Alanine is a typically preferred scanning amino acid among this group. This is because it eliminates side chains beyond the β carbon and does not seem to change the conformation of the variant backbone. Alanine is also typically preferred because it is the most common amino acid. In addition, it is frequently found in both embedded and exposed positions (Creighton, The Proteins (WH Freeman & Co., NY); Chothia, J. Mol. Biol. 150: 1 (1976)). If an alanine substitution does not result in a sufficient amount of modification, an isosteric amino acid can be used.

(C. Modification of GFRα3)
Covalent modifications of GFRα3 are included within the scope of the present invention. One type of covalent modification involves reacting a targeted amino acid residue of GFRα3 with an organic derivatizing agent that can react with a selected side chain of the N-terminal or C-terminal residue of GFRα3. . Derivatization with bifunctional agents is useful, for example, for use in methods for purifying anti-GFRα3 antibodies, for cross-linking GFRα3 to a water-soluble support matrix or surface, and vice versa. Commonly used crosslinking agents include, for example, 1,1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide ester (for example, ester with 4-azidosalicylic acid), homodioxy Functional imide esters (including disuccinimidyl esters such as 3,3′-dithiobis (succinimidyl propionate)), bifunctional maleimides such as bis-N-maleimide-1,8-octane And drugs such as methyl-3-((p-azidophenyl) dithio) propioimidate).

Other modifications include deamidation of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, hydroxylation of proline and lysine, and phosphorylation of the hydroxyl group of seryl or threonyl residues, respectively. , Lysine, arginine and histidine side chain a-amino group methylation (TE Creighton, Proteins: Structure and Molecular Properties, WH Freeman & Co., San Francisco, pp. 79-86) ), Acetylation of the N-terminal amine, and amidation of any C-terminal carboxyl group.

Another type of covalent modification of a GFRα3 polypeptide included within the scope of the present invention involves a change in the native glycosylation pattern of the polypeptide. By “change in native glycosylation pattern” is meant, for purposes herein, the deletion of one or more carbohydrate moieties found in the native sequence GFRα3, and / or one or more that are not present in the native sequence GFRα3. It is intended to mean adding a glycosylation site and / or changing the proportion and / or composition of sugar residues attached to the glycosylation site.

Addition of glycosylation sites to the GFRα3 polypeptide can be accomplished by changing the amino acid sequence. This change can be made, for example, by the addition of one or more serine or threonine residues to the native sequence GFRα3, or substitution with these residues (for O-linked glycosylation sites). The GFRα3 amino acid sequence may be altered at the DNA level as needed (especially by mutating the DNA encoding the GFRα3 polypeptide at a preselected base position so that a codon translated into the desired amino acid is generated). Can be changed through).

Another means of increasing the number of carbohydrate moieties in the GFRα3 polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, for example, WO 87/05330 (published September 11, 1987) and Aplin and Wriston, CRC Crit. Rev. Biochem. 259-306 (1981).

Removal of the carbohydrate moiety present in the GFRα3 polypeptide can be accomplished chemically or enzymatically, or by mutated substitution of codons encoding amino acid residues that serve as targets for glycosylation. Chemical deglycosylation techniques are known in the art and are described, for example, in Hakimudin et al., Arch. Biochem. Biophys. 259: 52 (1987) and Edge et al., Anal. Biochem. 118: 131 (1981). Enzymatic cleavage of a carbohydrate moiety on a polypeptide is described by Thotkura et al. Enzymol. 138: 350 (1987) and can be achieved by the use of various endoglycosidases and exoglycosidases.

Another type of covalent modification of GFRα3 is described in US Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791, 192; or 4,179,337, including linking a GFRα3 polypeptide to one of various non-proteinaceous polymers (eg, polyethylene glycol, polypropylene glycol, or polyoxyalkylene).

The GFRα3 of the present invention can also be modified to form a chimeric molecule comprising GFRα3 fused to another heterologous polypeptide or amino acid sequence. In one embodiment, such a chimeric molecule comprises a fusion of GFRα3 with a tag polypeptide that provides an epitope to which an anti-tag antibody can selectively bind. The epitope tag is generally placed at the amino terminus or carboxyl terminus of GFRα3. The presence of such epitope-tagged forms of GFRα3 can be detected using an antibody against the tag polypeptide. Also, provision of the epitope tag allows GFRα3 to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag. In an alternative embodiment, the chimeric molecule may comprise a fusion of GFRα3 with an immunoglobulin or a specific region of an immunoglobulin. For a bivalent form of the chimeric molecule, such fusion can be to the Fc region of the IgG molecule.

Various tag polypeptides and their respective antibodies are well known in the art. Examples include polyhistidine (poly-his) or poly-histidine-glycine (poly-his-gly) tag; flu HA tag polypeptide and its antibody 12CA5 (Field et al., Mol. Cell. Biol., 8: 2159- 2165 (1988)); c-myc tags and 8F9, 3C7, 6E10, G4, B7, and 9E10 antibodies against them (Evan et al., Molecular and Cellular Biology, 5: 3610-3616 (1985)); and herpes simplex virus sugars Protein D (gD) tag and its antibody (Paborsky et al., Protein Engineering, 3 (6): 547-553 (1990)). Other tag polypeptides include Flag peptide (Hopp et al., BioTechnology, 6: 1204-1210 (1988)); KT3 epitope peptide (Martin et al., Science, 255: 192-194 (1992)); a-tubulin epitope Peptide (Skinner et al .; J. Biol. Chem. 266: 15163-15166 (1991)); and T7 gene 10 protein peptide tag (Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA, 87: 6393-697 ( 1990)).

(D. Preparation of GFRα3)
The following description primarily relates to the production of GFRα3 by culturing cells transformed or transfected with a vector comprising a GFRα3 nucleic acid. Of course, it is contemplated that alternative methods well known in the art can be used to prepare GFRα3. For example, the GFRα3 sequence, or portion thereof, can be generated by direct peptide synthesis using solid phase technology (eg, Stewart et al., Solid-Phase Peptide Synthesis, WH Freeman Co., San Francisco, CA (1969); Merrifield, J. Am. Chem. Soc., 85: 2149-2154 (1963)). In vitro protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be performed, for example, using an Applied Biosystems Peptide Synthesizer (Foster City, CA), using the manufacturer's instructions. The various portions of GFRα3 can be chemically synthesized separately and combined using chemical or enzymatic methods to produce full length GFRα3.

(1. Isolation of DNA encoding GFRα3)
DNA encoding GFRα3 can be obtained from a cDNA library prepared from tissue having GFRα3 mRNA and thought to express it at detectable levels. Accordingly, human GFRα3 DNA can be conveniently obtained from a cDNA library prepared from human tissue, as described in the Examples. The gene encoding GFRα3 can also be obtained from a genomic library or by oligonucleotide synthesis.

The library can be screened using a probe (eg, an antibody to GFRα3 or an oligonucleotide of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded thereby. Screening cDNA or genomic libraries with selected probes is described in standard procedures (eg, Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989)). Procedure). An alternative means for isolating the gene encoding GFRα3 is to use PCR technology (Sambrook et al., Supra; Diffenbach et al., PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1995).

The following examples describe techniques for screening cDNA libraries. The oligonucleotide sequence selected as the probe should be long enough to minimize false positives and should be sufficiently apparent. The oligonucleotide is preferably labeled such that it can be detected upon hybridization to DNA in the library being screened. Methods of labeling are well known in the art and include the use of radioactive labels such as 32P labeled ATP, biotinylation, or enzyme labels. Hybridization conditions (including moderate or high stringency) are provided in Sambrook et al., Supra.

Sequences identified by such library screening can be compared and aligned against other known sequences deposited and available in public databases (eg, GenBank) or other private sequence databases. Sequence identity (either at the amino acid or nucleotide level) within a given region of the molecule or over the full length sequence is calculated by computer software programs (eg, BLAST, BLAST) that use various algorithms to measure homology. -2, ALIGN, DNAstar, and INHERIT) can be determined through sequence alignment.

Nucleic acids having protein coding sequences are first screened for selected cDNA or genomic libraries using the deduced amino acid sequences disclosed herein and, if necessary, Sambrook et al. Using conventional primer extension procedures as described in e.g.) can be obtained by detecting precursors and processing intermediates of mRNA that may not have been reverse transcribed into cDNA.

(2. Selection and transformation of host cells)
Host cells are transfected or transformed with the expression or cloning vectors described herein for GFRα3 production and either induce promoters, select for transformants, or have the desired sequence In a conventional nutrient medium modified as appropriate to amplify the gene encoding. Culture conditions (eg, media, temperature, pH, etc.) can be selected by one skilled in the art without undue experimentation. In general, the principles, protocols, and practical techniques for maximizing cell culture productivity are described in Mammalian Cell Biotechnology: a Practical Approach, M .; Butler, knitting, (IRL Press, 1991) and Sambrook et al., Supra.

Methods of transfection are known to those skilled in the art (eg, CaPO4 and electroporation). Depending on the host cell used, transformation is performed using standard techniques appropriate to such cells. Calcium treatment using calcium chloride (as described in Sambrook et al., Supra), or electroporation is generally used for prokaryotes or other cells that contain significant cell wall barriers. Infection with Agrobacterium tumefaciens is used for transformation of certain plant cells as described in Shaw et al., Gene, 23: 315 (1983) and WO 89/05858 (published June 29, 1989). The For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb, Virology, 52: 456-457 (1978) can be used. General aspects of mammalian cell host system transformation are described in US Pat. No. 4,399,216. Transformation into yeast is typically performed by Van Solingen et al. Bact. , 130: 946 (1977) and Hsiao et al., Proc. Natl. Acad. Sci. (USA) 76: 3829 (1979). However, other methods for introducing DNA into cells (eg, nuclear microinjection, electroporation, bacterial protoplast fusion with intact cells, or polycations (eg, polybrene, polyornithine)) can also be used. . See Keown et al., Methods in Enzymology, 185: 527-537 (1990) and Mansour et al., Nature 336: 348-352 (1988) for various techniques for transforming mammalian cells.

As used herein, suitable host cells for cloning or expressing DNA in a vector include prokaryotic cells, yeast cells, or higher eukaryotic cells. Suitable prokaryotes include, but are not limited to, eubacteria (eg, gram negative or gram positive organisms (eg, enteric bacteria (eg, E. coli)). Various E.I. E. coli strains are publicly available (eg, E. coli K12 strain MM294 (ATCC 31,466); E. coli X1776 (ATCC 31,537); E. coli strain W3110 (ATCC 27,325); and K5 772). (ATCC 53,635)).

In addition to prokaryotes, eukaryotic microbes (eg, filamentous fungi or yeast) are suitable cloning or expression hosts for GFRα3-encoding vectors. Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism.

Suitable host cells for the expression of glycosylated GFRα3 are derived from multicellular organisms. Examples of invertebrate cells include insect cells (eg Drosophila S2 and Spodoptera Sf9) and plant cells. Examples of useful mammalian host cell lines include Chinese hamster ovary cells (CHO) and COS cells. More detailed examples include monkey kidney CV1 strain (COS-7, ATCC CRL1651) transformed with SV40; human embryonic kidney strain (293 or 293 cells subcloned for growth in suspension culture, Graham J. Gen. Virol. 36; 59 (1977)); Chinese hamster ovary cells / -DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA 77: 4216 (1980)); Cells (TM4, Mother, Biol. Reprod. 23: 243-251 (1980)); human lung cells (W138, ATCC CCL75); human hepatocytes (Hep G2, HB8065); and mouse breast cancer (MMT060562, ATCC CCL51). Including It is. The selection of an appropriate host cell is considered to be within the ability of those skilled in the art.

(3. Selection and use of replicable vectors)
Nucleic acid (eg, cDNA or genomic DNA) encoding GFRα3 can be inserted into a replicable vector for cloning (amplification of DNA) or for expression. Various vectors are publicly available. The vector can be, for example, in the form of a plasmid, cosmid, viral particle, or phage. The appropriate nucleic acid sequence can be inserted into the vector by a variety of procedures. In general, DNA is inserted into an appropriate restriction endonuclease site using techniques known in the art. Vector components generally include, but are not limited to, one or more signal sequences, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. The construction of a suitable vector containing one or more of these components uses standard ligation techniques known to those skilled in the art.

GFRα3 is not only directly, but also as a fusion polypeptide with a heterologous polypeptide, which can be a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide. Can be produced recombinantly. In general, the signal sequence can be a component of the vector, or it can be a part of GFRα3 DNA that can be inserted into the vector. The signal sequence can be, for example, a prokaryotic signal sequence selected from the group of alkaline phosphatase, penicillinase, lpp, or thermostable enterotoxin II leader. For yeast selection, the signal sequence can be, for example, a yeast invertase leader, an alpha factor leader (including Saccharomyces and Kluyveromyces a-factor leader, the latter described in US Pat. No. 5,010,182) or an acid phosphatase leader, C.I. It may be the signal described in the albicans glucoamylase leader (EP362, 179 (published on April 4, 1990)) or WO90 / 13646 (published on November 15, 1990). For mammalian cell expression, mammalian signal sequences can be used to direct protein secretion (eg, signal sequences from secreted polypeptides of the same or related species, as well as viral secretion leaders).

Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are well known for a variety of bacteria, yeast, and viruses. The origin of replication from plasmid pBR322 is appropriate for most gram-negative bacteria; 2: the plasmid origin is appropriate for yeast, and the various viral origins (SV40, polyoma, adenovirus, VSV, or BPV) are Useful for cloning vectors in animal cells.

Expression and cloning vectors typically contain a selection gene (also called a selectable marker). Exemplary selection genes are (a) a protein that confers resistance to antibiotics or other toxins (eg, ampicillin, neomycin, methotrexate, or tetracycline), (b) a protein that complements an auxotrophic defect, or (c) It encodes a protein that supplies essential nutrients that are not available from the complex medium (eg, the gene encoding D-alanine racemase for Bacilli). Examples of suitable selectable markers for mammalian cells are markers that allow the identification of cells that have the ability to take up GFRα3 nucleic acids (eg, DHFR or thymidine kinase). Suitable host cells when wild type DHFR is used are described in Urlaub et al., Proc. Natl. Acad. Sci. USA, 77: 4216 (1980), a CHO cell line deficient in DHFR activity prepared and grown as described. A suitable selection gene for use in yeast is the trp1 gene present in the yeast plasmid YRp7 (Stinchcomb et al., Nature, 282: 39 (1979); Kingsman et al., Gene, 7: 141 (1979); Tschemer et al., Gene, 10: 157 (1980)). The trp1 gene provides a selectable marker for a mutant strain of yeast lacking the ability to grow on tryptophan (eg, ATCC No. 44076 or PEP4-1) (Jones, Genetics, 85:12 (1977)).

Expression and cloning vectors usually contain a promoter operably linked to the GFRα3 nucleic acid sequence to direct mRNA synthesis. Promoters recognized by a variety of potential host cells are well known. Suitable promoters for use with prokaryotic hosts include the b-lactamase and lactose promoter systems (Chang et al., Nature, 275: 615 (1978); Goeddel, Nature, 281: 544 (1979)), alkaline phosphatase, a -Tryptophan (trp) promoter system (Goeddel, Nucleic Acids Res., 8: 4057 (1980); EP 36, 776), and hybrid promoters (eg tac promoter) (deBoer et al, Proc. Natl. Acad. Sci. USA, 80: 21-25 (1983) A promoter for use in bacterial systems is also Shine Darga operably linked to DNA encoding GFRα3. Contains the Luno (SD) sequence.

Examples of suitable promoter sequences for use with yeast hosts include the promoter of 3-phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem. 255: 2073 (1980)) or other glycolytic enzyme promoters. (Hess et al., J. Adv. Enzyme Reg., 7: 149 (1968); Holland, Biochemistry, 17: 2073 (1978)) (eg, enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate dehydrogenase). Carboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triose phosphate isomerase, phosphoglucose isomerase, and glucokinase). I can get lost.

Other yeast promoters (which are inducible promoters with the additional advantage of transcription controlled by growth conditions) are alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradation enzymes related to nitrogen metabolism, metallothionein, glycine Promoter region for seraldehyde-3-phosphate dehydrogenase and the enzymes responsible for maltose and galactose utilization. Suitable vectors and promoters for use in yeast expression are further described in EP 73,657. GFRα3 transcription from vectors in mammalian host cells can be performed, for example, by viruses (eg, polyoma virus, avian varicella virus (UK 2,211,504 (published July 5, 1989)), adenovirus (eg, adenovirus). By promoters derived from the genomes of viruses 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, retrovirus, hepatitis B virus and simian virus 40 (SV40)) Such promoters are controlled as long as they are compatible with the host cell system, by promoters obtained from immunoglobulin promoters) and by promoters obtained from heat shock promoters.

Transcription of DNA encoding GFRα3 by higher eukaryotes can be increased by inserting an enhancer sequence into the vector. An enhancer is a cis-acting element of DNA, usually 10-300 bp, that acts on a promoter to increase its transcription. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, a-fetoprotein, and insulin). Typically, however, one skilled in the art will use enhancers from eukaryotic viruses. Examples include the SV40 enhancer behind the origin of replication (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer behind the origin of replication, and the adenovirus enhancer. Enhancers can be spliced into the vector at the 5 'or 3' position relative to the GFRα3 coding sequence, but are preferably located 5 'to the promoter.

Expression vectors used in eukaryotic host cells (nucleated cells from yeast, fungi, insects, plants, animals, humans, or other multicellular organisms) are also used to terminate transcription and stabilize mRNA. Contains the sequences necessary for Such sequences are generally available from the 5 'and optionally 3' untranslated region of eukaryotic or viral DNA or cDNA. These regions contain nucleotide segments that are transcribed as polyadenylated fragments in the untranslated region of the mRNA encoding GFRα3. Still other methods, vectors, and host cells suitable for adaptation to synthesis of GFRα3 in recombinant vertebrate cell cultures are described in Gething et al., Nature, 293: 620-625 (1981); Mantei et al., Nature. 281: 40-46 (1979); EP 117,060; and EP 117,058.

(4. Detection of gene amplification / expression)
Gene amplification and / or expression can be performed directly in the sample (eg, conventional Southern blotting, Northern blotting (mRNA transcription) using appropriate labeled probes based on the sequences provided herein. (For quantification) (Thomas, Proc. Natl. Acad. Sci. USA, 77: 5201-5205 (1980)), dot plotting (DNA analysis), or in situ hybridization). Alternatively, antibodies that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes, or DNA-protein duplexes, can be used. This antibody can then be labeled and this assay can be used to detect antibody binding to the duplex upon binding of the duplex to the surface and thus upon formation of the duplex on the surface. Can be performed so that presence can be detected.

Alternatively, gene expression can be measured by immunological methods (eg, immunohistological staining of cells or tissue sections, and cell culture or body fluid assays) to directly quantify gene product expression. . Antibodies useful for immunohistological staining and / or assay of sample fluids can be either monoclonal or polyclonal and can be prepared in any mammal. Conveniently, the antibody is fused to the native sequence GFRα3 polypeptide or to a synthetic peptide based on the DNA sequences provided herein or to GFRα3 DNA and encodes a specific antibody epitope. Can be prepared for exogenous sequences.

(5. Preparation of polypeptide)
The GFRa form can be recovered from the culture medium or from the host cell lysate. If it is membrane bound, it can be released from the membrane using a suitable surfactant solution (eg, Triton-X100) or by enzymatic cleavage. Cells used for expression of GFRα3 can be disrupted by various physical or chemical means such as freeze-thaw cycling, sonication, mechanical disruption, or cytolytic agents. It may be desirable to purify GFRα3 from recombinant cell proteins or polypeptides. The following procedure represents a suitable purification procedure: fractionation on an ion exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or a cation exchange resin (eg DEAE); chromatofocusing; SDS- PAGE; ammonium sulfate precipitation; gel filtration (eg using Sephadex G-75); protein A Sepharose column to remove contaminants (eg IgG); and metal chelation to bind the epitope-tagged form of GFRα3 column. Various methods of protein purification can be used, and such methods are known in the art and are described by Deuscher, Methods in Enzymology, 182 (1990); Scopes, Protein Purification: Principles and Practice, Springer-Verlag, New York (1982). The purification step selected will depend, for example, on the production process used and the nature of the particular GFRα3 produced.

(E. Use for GFRα3)
Nucleotide sequences encoding GFRα3 (or their complements) have a variety of applications in the field of molecular biology, as they are hybridization probes in chromosome and gene mapping, and in the production of antisense RNA and DNA. Including the use of GFRα3 nucleic acids are also useful for the preparation of GFRα3 polypeptides by the recombinant techniques described herein.

The full-length native sequence GFRα3 (SEQ ID NO: 14) gene, or a portion thereof, may be used to isolate the full-length gene or yet another gene having the desired sequence identity to the GFRα3 sequence disclosed in SEQ ID NO: 15 (eg, GFRα3 naturally occurring variants or genes encoding GFRα3 from other species) can be used as hybridization probes for cDNA libraries. Optionally, the length of the probe is about 20 to about 50 bases. The hybridization probe can be derived from the nucleotide sequence of SEQ ID NO: 14, or can be derived from a genomic sequence comprising the promoter element, enhancer element and intron of the native sequence GFRα3. As an example, the screening method includes isolating the coding region of the GFRα3 gene using a known DNA sequence to synthesize a selected probe of about 40 bases. Hybridization probes can be labeled with various labels (radionucleotides such as 32P or 35S, or enzymatic labels such as alkaline phosphatase coupled to the probe via an avidin / biotin coupling system). In order to determine to which member of such a library this probe hybridizes using a labeled probe having a sequence complementary to that of the GFRα3 gene of the present invention, human cDNA, genomic DNA, Alternatively, a library of mRNA can be screened. Hybridization techniques are described in further detail in the examples below.

This probe can also be used in PCR techniques to create a pool of sequences for identification of closely related GFRα3 sequences.

The nucleotide sequence encoding GFRα3 can also be used to map a gene encoding GFRα3 and to construct hybridization probes for genetic analysis of individuals with genetic disorders. Nucleotide sequences provided herein can be used to locate specific regions of chromosomes and chromosomes using known techniques (eg, in situ hybridization, linkage analysis to known chromosomal markers, and hybridization screening using libraries). Can be mapped.

When a coding sequence for GFRα3 encodes a protein that binds to another protein (eg, when GFRα3 is a receptor), GFRα3 is used in an assay to identify other proteins or molecules involved in binding interactions. Can be done. By such methods, inhibitors of the receptor / ligand binding interaction can be identified. Proteins involved in such binding interactions can also be used to screen for binding interaction peptides or small molecule inhibitors or agonists. The receptor GFRα3 can also be used to isolate correlated ligands. Screening assays can be designed to find lead compounds that mimic the biological activity of native GFRα3 or GFRα3 receptors. Such screening assays include assays adapted for high throughput screening of chemical libraries, making them particularly suitable for the identification of small molecule drug candidates. Contemplated small molecules include synthetic organic or inorganic compounds. This assay can be performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays and cell-based assays, which are well characterized in the art.

Nucleic acids encoding GFRα3 or modified forms thereof can also be used to generate either transgenic or “knock-out” animals, which are then useful in the development and screening of therapeutically useful reagents. A transgenic animal (eg, a mouse or rat) is an animal that has cells that contain the transgene, and the transgene was introduced into the animal before birth (eg, at the embryonic stage) or into its ancestors. A transgene is DNA that is integrated into the genome of a cell from which a transgenic animal develops. In one embodiment, a cDNA encoding GFRα3 can be used to clone genomic DNA encoding GFRα3 and contains cells expressing DNA encoding the genomic sequence GFRα3 according to established techniques. Can be used to make animals. Methods for producing transgenic animals (especially animals such as mice or rats) have become routine in the art and are described, for example, in US Pat. Nos. 4,736,866 and 4,870, 009. Typically, specific cells are targeted for GFRα3 transgene integration with tissue-specific enhancers. Transgenic animals containing a copy of a transgene encoding GFRα3 introduced into the germ line of the animal at the embryonic stage can be used to test the effect of increased expression of DNA encoding GFRα3. Such animals can be used, for example, as test animals for reagents thought to confer protection from pathological conditions associated with its overexpression. In accordance with this aspect of the invention, the animals are treated with a reagent and the reduced incidence of pathological condition compared to an untreated animal carrying the transgene indicates the potential for therapeutic intervention for that pathological condition. .

A non-human homolog of GFRα3 is a defective gene or alteration that encodes GFRα3 as a result of homologous recombination between an endogenous gene encoding GFRα3 and a modified genomic DNA encoding GFRα3 that is introduced into an animal embryo cell. Can be used to construct GFRα3 “knockout” animals with the generated genes. For example, cDNA encoding GFRα3 can be used to clone genomic DNA encoding GFRα3 according to established techniques. A portion of genomic DNA encoding GFRα3 can be deleted or replaced with another gene (eg, a gene encoding a selectable marker that can be used to monitor integration). Typically, several kilobases of unaltered flanking DNA (both at the 5 'and 3' ends) are included in the vector (see, eg, Thomas and Capecchi, for descriptions of homologous recombination vectors). Cell, 51: 503 (1987)). This vector is introduced into an embryonic stem cell line (eg, by electroporation) and cells in which the introduced DNA is homologously recombined with endogenous DNA (eg, Li et al., Cell, 69: 915). (See 1992). The selected cells are then injected into an animal (eg, mouse or rat) blastocyst to form an aggregated chimera (eg, Bradley, Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, edited by E. Robertson ( IRL, Oxford, 1987), pages 113-152). The chimeric embryo is then transplanted into an appropriate pseudopregnant female rearing animal and the embryo is reared for a period of time to create a “knock-out” animal. Offspring carrying DNA homologously recombined in their primordial cells can be identified by standard techniques, and all cells of the animal are bred to animals that contain the homologously recombined DNA Can be used for. Knockout animals can be characterized, for example, for their ability to protect against specific pathological conditions and for their development of pathological conditions due to the absence of GFRα3 polypeptide.

Agents that bind to GFRα3 molecules may be useful in the treatment of diseases or conditions involving the peripheral nervous system. For example, such ligands can be used to treat peripheral neuropathy associated with diabetes, HIV, chemotherapeutic treatment. Ligands that bind to GFRα3 are expected to be useful in the treatment of neuropathic pain, and antagonists of GFRα3 are non-neuropathic properties of chronic pain (eg, chronic pain associated with various inflammatory conditions, however, Expected to be useful in treating (but not limited to). The treatment is consistent with the data of Example 5. In Example 5, strong expression of GFRα3 was observed during development and in adult sensory ganglia. GFRα3 or agonists or antagonists thereof are used to treat conditions involving autonomic nervous system dysfunction, including but not limited to blood pressure or cardiac rhythm disorders, gastrointestinal function, weakness and urinary tract regulation obtain. Other signs of ligand binding to GFRα3 include postherpetic neuralgia, herpes zoster, asthma, irritable bowel, inflammatory bowel, cystitis, headache (migraine), arthritis, spinal cord injury, constipation, hypertension, mucositis ( including mucositis), dry mouth or dry eye, fibrinemia, chronic back pain, or wound healing. These uses are consistent with the expression observed in sympathetic ganglia.

The surprising relative lack of expression of GFRα3 in many organs, including notably brain, intestine and kidneys, indicates that ligands (and other agonists or antagonists) that bind to this receptor include GFRα1 and GFRα2 ( It shows that there are no side effects that may be associated with ligands that bind to (GDNF and Neuturin). Thus, ligands that act through GFRα3 are particularly useful for treating peripheral nervous system disorders, but with respect to weight loss, motor function, or kidney function, ligands that act through GFRα1 or GRFα2 Induces low effects.

(F. Anti-GFRα3 antibody)
The present invention further provides anti-GFRα3 antibodies. Exemplary antibodies include polyclonal antibodies, monoclonal antibodies, humanized antibodies, bispecific antibodies, and heteroconjugate antibodies.

(1. Polyclonal antibody)
The anti-GFRα3 antibody may comprise a polyclonal antibody. Methods for preparing polyclonal antibodies are known to those skilled in the art. Polyclonal antibodies can be raised in mammals by, for example, one or more injections of an immunizing agent (and adjuvant if desired). Typically, the immunizing agent and / or adjuvant is injected into the mammal by multiple subcutaneous or intraperitoneal injections. The immunizing agent can comprise a GFRα3 polypeptide or a fusion protein thereof. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants that can be used include Freund's complete adjuvant and MPL-TDM adjuvant (monophospholithyl lipid A, synthetic trehalose dicorynomycolate). The immunization protocol can be selected by one skilled in the art without undue experimentation.

(2. Monoclonal antibody)
Alternatively, the anti-GFRα3 antibody can be a monoclonal antibody. Monoclonal antibodies can be prepared using hybridoma methods as described by Kohler and Milstein, Nature, 256: 495 (1975). In hybridoma methods, a mouse, hamster, or other suitable host animal typically produces an antibody that specifically binds to the immunizing agent and induces lymphocytes to induce lymphocytes. Immunized. Alternatively, lymphocytes can be immunized in vitro.

The immunizing agent typically includes a GFRα3 polypeptide or a fusion protein thereof. Generally, peripheral blood lymphocytes ("PBL") are used when cells of human origin are desired, or spleen cells or lymph node cells are used when a non-human mammalian source is desired Is done. The lymphocytes are then fused with an immortal cell line using a suitable fusing agent such as polyethylene glycol to form hybridoma cells (Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986). ) 59-103). Immortal cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin. Usually rat or mouse myeloma cell lines are used. The hybridoma cells can be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of unfused, immortalized cells. For example, if the parent cell lacks the enzyme hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT), the culture medium for the hybridoma typically comprises hypoxanthine, aminopterin, and thymidine (“HAT medium”). . These substances prevent the growth of HGPRT deficient cells.

Preferred immortal cell lines are those that fuse efficiently, support stable high level expression of antibodies by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. A more preferred immortal cell line is a mouse myeloma line. This can be obtained, for example, from the Salk Institute Cell Distribution Center, San Diego, California and the American Type Culture Collection, Rockville, Maryland. Human myeloma cell lines and mouse-human heterologous myeloma cell lines have also been described for the production of human monoclonal antibodies (Kozbor, J. Immunol., 133: 3001 (1984); Brodeur et al., Monoclonal Production Technologies and). Applications, Marc Dekker, Inc., New York, (1987) 51-63).

The culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies against GFRα3. Preferably, the binding specificity of monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay (eg, radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA)). Such techniques and assays are known in the art. The binding affinity of monoclonal antibodies is described, for example, in Munson and Pollard, Anal. Biochem. 107: 220 (1980) can be determined by Scatchard analysis. After the desired hybridoma cells are identified, the clones can be subcloned by limiting dilution procedures and grown by standard methods (Goding, supra). Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells can be grown in vivo as ascites in a mammal.

Monoclonal antibodies secreted by subclones are isolated from culture medium or ascites fluid by conventional immunoglobulin purification procedures (eg, protein A-sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography) or Can be purified. Monoclonal antibodies can also be made by recombinant DNA methods, such as those described in US Pat. No. 4,816,567. DNA encoding the monoclonal antibodies of the present invention can be readily isolated using conventional procedures (eg, by using oligonucleotide probes that can specifically bind to the genes encoding the heavy and light chains of mouse antibodies). Can be released and sequenced. The hybridoma cells of the present invention serve as a preferred source of such DNA. Once isolated, the DNA can be located in an expression vector, which is then a host cell (eg, Simian COS cell, Chinese hamster ovary (CHO) cell, which otherwise does not produce immunoglobulin proteins). Or myeloma cells) to obtain monoclonal antibody synthesis in recombinant host cells. DNA can also be obtained, for example, by replacing the coding sequence with human heavy and light chain constant domains instead of homologous mouse sequences (US Pat. No. 4,816,567; Morrison et al., Supra) or All or part of the coding sequence for a non-immunoglobulin polypeptide can be modified by covalently attaching to the immunoglobulin coding sequence. Such non-immunoglobulin polypeptides can be substituted for the constant domain of an antibody of the invention, or can be substituted for the variable domain of one antigen binding site of an antibody of the invention to create a chimeric bivalent antibody. .

The antibody can be a monovalent antibody. Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chains and modified heavy chains. The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosslinking. Alternatively, the relevant cysteine residues are substituted or deleted with another amino acid residue to prevent crosslinking.

In vitro methods are also suitable for preparing monovalent antibodies. Digestion of antibodies to produce antibody fragments, particularly Fab fragments, can be accomplished using conventional techniques known in the art.

(3. Humanized antibody)
The anti-GFRα3 antibody of the present invention further includes a humanized antibody or a human antibody. Humanized forms of non-human (eg, murine) antibodies are chimeric immunoglobulins, immunoglobulin chains, or fragments thereof (eg, Fv, Fab, Fab ′, F (ab ′)) that contain minimal sequence derived from non-human immunoglobulin. 2, or other antigen-binding subsequence of the antibody). Humanized antibodies are derived from the CDRs of a non-human species (donor antibody) (eg, mouse, rat or rabbit) whose recipient complementarity determining region (CDR) derived residues have the desired specificity, affinity and tolerance. Human immunoglobulins (recipient antibodies), which are substituted by the residues of In some cases, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences. Generally, a humanized antibody comprises substantially all of at least one, and typically two variable domains, wherein all or substantially all of the CDR regions are in the CDR regions of non-human immunoglobulin. Corresponding and all or substantially all of the FR region is the FR region of the human immunoglobulin consensus sequence. Humanized antibodies also optimally comprise at least a portion of an immunoglobulin constant region (Fc), typically a human immunoglobulin constant region (Jones et al., Nature, 321: 522-525 (1986); Riechmann). Et al., Nature, 332: 323-329 (1988); and Presta, Curr. Op. Struct. Biol. 2: 593-596 (1992)).

Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into the humanized antibody from a source that is non-human. These non-human amino acid residues are often referred to as “import” residues, which are typically taken from an “import” variable domain. Humanization is basically based on the method of Winter and co-workers (Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature, 332: 323-327 (1988); Verhoeyen et al., Science. 239: 1534-1536 (1988)) by replacing the corresponding sequence of a human antibody with a rodent CDR or CDR sequence. Accordingly, such “humanized” antibodies are chimeric antibodies (US Pat. No. 4,816,567), which are substantially less than intact human variable domains or are derived from non-human species. Replaced by the sequence to be. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies. .

Human antibodies can also be produced using various techniques known in the art, including phage display libraries (Hoogenboom and Winter, J. Mol. Biol., 227: 381 (1991); Marks et al., J. Mol. Biol., 222: 581 (1991)). The techniques of Cole et al. And Boerner et al. Are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Lis, p. 77 (1985)) and Boerner et al., J. Immunol. (1): 86-95 (1991)).

(4. Bispecific antibody)
Bispecific antibodies are monoclonal (preferably human or humanized) antibodies that have binding specificities for at least two different antigens. In this case, one of the binding specificities is for GFRα3 and the other is for any other antigen and preferably for cell surface proteins or receptors or receptor subunits.

Methods for generating bispecific antibodies are known in the art. Classically, recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy chain / light chain pairs, where the two heavy chains have different specificities (Milstein and Cuello). , Nature, 305: 537-539 (1983)). Due to the random combination of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, only one of which is an exact duplex. Has a specific structure. Accurate molecular purification is usually achieved by affinity chromatography steps. Similar procedures are described in WO 93/08829 (published May 13, 1993) and Traunecker et al., EMBO. J. et al. 10: 3655-3659 (1991).

Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences. The fusion is preferably an immunoglobulin heavy chain constant domain, comprising at least part of the hinge, CH2 and CH3 regions. It is preferred to have a first heavy chain constant region (CH1) containing the site necessary for light chain binding present in at least one of the fusions. The immunoglobulin heavy chain fusion and, if desired, the DNA encoding the immunoglobulin light chain are inserted into separate expression vectors and cotransfected into a suitable host organism. For further details of generating bispecific antibodies see, for example, Suresh et al., Methods in Enzymology, 121: 210 (1986).

(5. Heteroconjugate antibody)
Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are composed of two covalently bound antibodies. Such antibodies, for example, target immune system cells to unwanted cells (US Pat. No. 4,676,980), and treatment of HIV infection (WO 91/00360; WO 92/003733; EP03089) is proposed. It is contemplated that antibodies can be prepared in vitro using known methods in synthetic protein chemistry, including methods involving cross-linking agents. For example, immunotoxins can be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate, and the reagents disclosed, for example, in US Pat. No. 4,676,980.

(G. Use for anti-GFRα3 antibody)
The anti-GFRα3 antibody of the present invention has various utilities. For example, anti-GFRα3 antibodies can be used in diagnostic assays for GFRα3 (eg, detecting its expression in specific cells, tissues or serum). Various diagnostic assay techniques known in the art can be used, such as competitive binding assays, direct or indirect sandwich assays and immunoprecipitation assays performed in either heterogeneous or homogeneous phases (Zola, Monoclonal Antibodies: A Manual of Technologies, CRC Press, Inc., (1987) pp. 147-158). The antibody used in the diagnostic assay can be labeled with a detectable moiety. The detectable moiety should be capable of producing a detectable signal, either directly or indirectly. For example, the detectable moiety can be a radioisotope (eg, 3H, 14C, 32P, 35S, or 125I), a fluorescent or chemiluminescent compound (eg, fluorescein isothiocyanate, rhodamine, or luciferin), or an enzyme (eg, Alkaline phosphotase, β-galactosidase, or horseradish peroxidase). Any method known in the art for conjugating a detectable moiety to an antibody (Hunter et al., Nature, 144: 945 (1962); David et al., Biochemistry, 13: 1014 (1974); Pain et al. J. Immunol. Meth., 40: 219 (1981); and Nygren, J. Histochem. And Cytochem., 30: 407 (1982)).

Anti-GFRα3 antibodies are also useful for affinity purification of GFRα3 from recombinant cell culture or natural sources. In this process, antibodies to GFRα3 are immobilized on a suitable support (eg, Sephadex resin or filter paper) using methods well known in the art. The immobilized antibody is then contacted with a sample containing GFRα3 to be purified, after which the support is washed with a suitable solvent that removes substantially all of the material in the sample except GFRα3, GFRα3 is bound to the immobilized antibody. Finally, the support is washed with another solvent suitable for releasing GFRα3 from the antibody.

H. Assay for ligand-induced A-subunit activity
The compounds and methods of the present invention can be used in assays to detect molecules that activate or inhibit GFRα3 signaling, and in fact homodimerization upon activation with ligands or other agonists Or can be applied to other α-subunit receptor molecules that homooligomerize (eg, GFRα1, GFRα2, GFRα4). This assay is based on the surprising fact that upon ligand binding the α-subunit receptor can be homodimerized or homooligomerized. And further, this dimerization of the α-subunit, when fused to a receptor protein kinase intracellular domain capable of kinase activity, preferably tyrosine kinase activity, is kinase activity (eg readily detectable) Autophosphorylation). Although the methods and constructs herein are discussed with respect to one or another of the GFRα subunit receptors disclosed herein, the methods are based on the α-subunit receptor family (α-subunit receptors). Is typically a ligand-binding partner of a multi-subunit signaling complex comprising a β subunit, including tyrosine kinase activity that is activated when the ligand-activated α-subunit binds to the β subunit. In certain families, it is easily applied to any α-receptor.

Various assays have been developed to measure kinase activity, and in particular tyrosine kinase activity. Some of these assays measure the ability of tyrosine kinase enzymes to phosphorylate synthetic substrate polypeptides. For example, assays have been developed to measure growth factor-stimulated tyrosine kinase activity by measuring the ability of the kinase to catalyze the transfer of ATP to the appropriate acceptor substrate of γ-phosphate. For example, Pike, L.M. , Methods of Enzymology 146: 353-362 (1987) and Hunter, Journal of Biological Chemistry 257 (9): 4843-4848 (1982). In this assay, the use of (γ- ³² P) ATP allows for radiolabeling of phosphorylated substrates (which are peptides containing synthetic tyrosine). Other protein kinase assays have been described, including tyrosine kinase receptors (eg, EGF receptors (see Donato et al., Cell Growth Differ. 3: 259-268 (1992))), insulin receptors ( See Kasuga et al., Journal of Biological Chemistry 257 (17): 9891-9884 (1982) and Kasuga et al., Methods in Enzymology 109: 609-621 (1985)) and Liver Growth Hormone Receptor (fungal, Jur. ^{Chemistry 267 (24): 17390-17396 32} P incorporation into (1992)) is measured The

Construction of alpha receptor constructs comprising fusions to Rse or other tyrosine kinase domains, vectors for expressing such constructs, transfected or transformed host cells expressing these constructs, As well as means for increasing their expression at the cell surface are accomplished as is known in the art, for example, using techniques as described herein for expression of GFRα3. Some specific preferred means are provided below.

(1. Kinase receptor activation-KIRA)
The first step of the assay of the present invention involves phosphorylation of the kinase domain of the receptor construct, where the receptor construct is present in the cell membrane of a eukaryotic cell. The receptor construct can be derived from a nucleic acid encoding a receptor construct (as described herein) that can be transformed into a cell. In one embodiment of the invention, the nucleic acid encoding the receptor construct is transformed into a cell. A preferred and exemplary technique for transforming a cell with either the receptor or receptor construct nucleic acid is as follows.

(A. Cell transformation)
The present invention provides a substantial improvement over the in vitro soluble kinase receptor assay to the extent that it is believed to more accurately reflect α-subunit receptor activity in situ. Eukaryotic cells can be assembled into receptor constructs (α-subunit receptor and kinase domain fusions) such that the receptor construct properly assembles itself at the cell membrane and still retains kinase activity that can be detected in the ELISA stage of the assay. As well as, optionally, either an amino-terminal flag polypeptide or a carboxy-terminal flag polypeptide). This is to measure the ligand binding activity of any α-subunit receptor for homodimerization or homooligomerization upon ligand binding, via the fusion kinase assay. A general assay is provided.

If a suitable capture agent as described herein is available for the selected receptor construct, the cell is transformed with a nucleic acid encoding only the receptor construct without the flag polypeptide. obtain.

To provide a nucleic acid encoding a receptor construct, a nucleic acid encoding an α-subunit receptor encodes an intracellular catalytic kinase domain of a receptor kinase (preferably rPTK) containing a transmembrane domain at its 3 ′ end. Fused to the nucleic acid to be fused, and optionally to the N-terminus of the flag polypeptide. Alternatively, the nucleic acid encoding the α-subunit receptor-kinase domain fusion is fused at its 5 'end to the nucleic acid encoding the carboxy terminus of the flag polypeptide. Thus, the flag polypeptide is provided at either the carboxy terminus or the amino terminus of the receptor construct. Examples of suitable flag polypeptides are provided above. Selection of other suitable flag polypeptides is possible using the techniques described herein.

Rse. In order to produce a fusion between the flag reagent and the α-subunit receptor of interest, a nucleic acid encoding the ECD (or GPI anchor minus variant) of the α-subunit receptor of interest has Rse at its 3 ′ end. . It is fused to a nucleic acid encoding the amino terminus of the flag reagent.

Incorporation of the signal sequence into the expression vector is required because the receptor construct must be transported to the cell membrane so that it is located so that the ECD faces the external environment of the cell. Thus, an appropriate signal sequence is used to position the receptor construct in such a manner. This signal sequence is generally a component of the vector or can be part of the receptor construct DNA that is inserted into the vector. If a heterologous signal sequence is used, it is derived from a sequence that is recognized and processed (ie, cleaved by a signal peptidase) by the host cell.

(B. Selection of cells for use in the assay)
As mentioned above, the cells subjected to the assay are preferably cells transformed with the receptor construct. The suitability of the cells for use in this assay is tested.

If the cell line is transformed with the receptor construct (without the flag polypeptide), it can be readily discovered whether the cell line is suitable for use in this assay. During the first step, successful transformation and expression of the nucleic acid encoding the receptor construct is determined. The strategy found in US Pat. No. 5,766,863, or its corresponding WO publication (referred to as “kinase receptor activation assay”) may be followed. In order to identify whether the ECD of the receptor construct is present on the cell surface, flow cytometric analysis can be performed using antibodies to the ECD of the α-subunit receptor. The antibody can be made using the techniques for producing the antibodies discussed herein. Flow cytometric analysis can be performed, for example, using the techniques described in Current Protocols in Immunology, Coligen et al., Wiley publishers, Volumes 1 and 2. Briefly, flow cytometric analysis involves incubating intact cells (having the receptor) with antibodies to its ECD followed by washing. The antibody-bound cells are then incubated with a species-specific anti-antibody antibody conjugated to a fluorescent dye. After washing, the labeled cells are analyzed by fluorescence activated flow cytometry to detect whether ECD is present on the cell surface.

In the following steps, the ability of cell-bound receptors to be activated is tested. To determine this, the transformed cells are exposed to a known agonist for the receptor (eg, an endogenous ligand or an agonist antibody for that receptor). In the case of GFRα3, the natural ligand is artemin. After exposure, the cells are lysed in an appropriate buffer (eg, sodium dodecylbenzenesulfonate in phosphate buffered saline; SDS in PBS) and an anti-phosphotyrosine antibody as described below For example, Wang, Molecular and Cellular Biology 5 (12): 3640-3643 (1985); Glenney et al., Journal of Immunological Methods 109: 277-285 (1988); 201: 101-110 (1991); Kozma et al., Methods in Enzymology 201: 28-43 (1991); Holmes et al., Science. e 256: 1205-10 (1992); or Corfas et al., PNAS. USA 90: 1624-1628 (1993).

Assuming that the Western blotting step indicates that the receptor construct can be activated, a KIRA ELISA test run can be performed to further establish whether the transformed cell line can be used in the assay. .

In a preferred embodiment of the invention, the KIRA ELISA is “generic” to the extent that any α-subunit receptor of interest can be studied regardless of the availability of receptor-specific reagents (ie, capture agents). Assay. This embodiment uses a receptor construct having a flag polypeptide at either the amino terminus or the carboxyl terminus of the receptor.

If the flag polypeptide is provided at the NH ₂ terminus (eg gD. TrkA, B and C receptor constructs), the procedure for selecting transformed cell lines for use in this assay is described above. Similar to the procedure. In this embodiment, the cells are transformed with a flag polypeptide-receptor construct, as previously described herein. Successful transformation of the receptor and flag polypeptide (ie, the receptor construct in this example) is confirmed. To study this, two-dimensional flow cytometric analysis can be performed using antibodies against both the flag polypeptide and the receptor ECD. Techniques for two-dimensional flow cytometric analysis are disclosed in Current Protocols in Immunology, supra.

Cells that have been successfully transformed with a receptor construct having a C-terminal flag polypeptide are also suitable for use in this assay. Following cell transformation, successful transformation of the receptor is determined, for example, by flow cytometry using an antibody to the ECD of the receptor of interest. Flow cytometry analysis can be performed substantially as described above.

Successful transformation of the entire receptor construct (including the COOH terminal flag polypeptide) is then analyzed. This can be accomplished by cell lysis (using the cell lysis techniques disclosed herein) and immunoprecipitation of membrane extracts using antibodies to the α-subunit receptor of interest. The immunoprecipitated membrane extract is then subjected to Western blot analysis using an antibody specific for the flag polypeptide. Alternatively, α-subunit specific ELISA analysis of anti-flag polypeptide capture membrane lysate can be performed. Briefly, this involves coating the ELISA well with a suitable flag specific capture agent. The well is blocked and washed, and the lysate is then incubated in the well. Unbound receptor construct is removed by washing. The wells are then reacted with receptor-specific antibody (s) conjugated directly or indirectly to HRPO. The wells are washed and then HRPO is exposed to a chromogenic substrate (eg, TMB). Detection of receptor activation and implementation of the KIRA ELISA test are basically the same as described above.

Once useful cells are identified, they are subjected to the KIRA stage of the claimed assay.

(C. Coating of the first solid phase with cells)
A first solid phase (eg, a well of the first assay plate) is coated with cells transformed according to the previous section.

Preferably, the adherent cell line is selected such that the cells naturally adhere to the first solid phase. However, the use of adherent cell lines is not essential. For example, non-adherent cells (eg, red blood cells) can be added to a round bottom well of an assay plate such as that marketed by, for example, Becton Dickinson Labware, Lincoln Park, New Jersey. The assay plate is then placed in a plate carrier and centrifuged to create a pellet of cells that adhere to the bottom of the wells. The cell culture supernatant is removed using a pipette. Thus, the use of adherent cells is clearly advantageous over non-adherent cells. This is because it reduces variability in this assay (ie, cells in a round-bottom well pellet can be harvested with the supernatant when using alternative methods).

Cells added to the wells of the first assay plate can be maintained in tissue culture flasks and utilized when a confluent cell density of about 70% -90% is achieved. Then, generally between about 1 × 10 ⁴ and 3 × 10 ⁵ (and preferably 5 × 10 ⁴ to 1 × 10 ⁵ ) cells per flat-bottom well are seeded using, for example, a pipette. . That the addition of the above cell concentrations is sufficient to allow activation of the receptor construct as measured in the ELISA stage of the assay without the need to concentrate or clarify the cells or cell lysate before Found unexpectedly. Often, the cells are diluted with culture medium prior to seeding into the wells of a microtiter plate to the desired cell density.

Cells are usually cultured in microtiter plates for a time sufficient to optimize their attachment to the wells but not too long to begin to deteriorate. Accordingly, incubation at a temperature at which the cells are physiologically optimal (usually about 37 ° C.) for about 8-16 hours is preferred. Suitable media for cell culture are described in Section 1A above. Recommend cultured in 5% CO _2.

After overnight incubation, the supernatant of the wells is decanted and excess supernatant can be further removed by lightly tamping the microtiter plate with an adsorption substrate (eg, paper towel), while the sponge is Acts equally. Thus, a substantially uniform adherent cell layer remains on the internal surface of the individual wells of the microtiter plate. These adherent cells are then exposed to the analyte.

(D. Preparation and addition of analyte)
As described above, the analyte may comprise an agonist ligand (or suspected agonist) or antagonist (or suspected antagonist) for the α-subunit receptor of interest. The ligand can be an endogenous polypeptide or a synthetic molecule (eg, an inorganic or organic molecule). Usually the ligand is a polypeptide. This assay is useful for screening molecules that activate (or antagonize activation) the α-subunit receptor of interest. This assay can therefore be used for the development of therapeutically effective molecules.

When the ligand is an agonist, the molecule can include native growth factors (eg, artemin, neuturin, GDNF, and persephin). Many of these growth factors are commercially available. Alternatively, growth factors can be made by peptide synthesis or recombinant techniques described herein. Synthetic small molecule agonists can likewise be made by those skilled in the art using conventional chemical synthesis techniques. Preferably, one is to assay for agonist or antagonist antibodies.

If the ligand is present in the biological fluid, the analyte can be prepared using techniques well known in the art. Body fluids such as blood or amniotic fluid can be used directly, but concentrates may be required. If the analyte to be tested contains a particular tissue, the cells can be grown in cell culture and the supernatant can be tested for secreted ligand.

Often the ligand is diluted in an aqueous diluent (eg, cell culture medium) so that a standard curve can be generated. However, the ligand may be present in the cell or cell component (eg, cell membrane). In particular, it has been found that the assay can be used to detect the presence of a ligand in the cell membrane of a selected cell line. This is clearly useful for discovering new endogenous ligands for known α-subunit receptors.

For example, the ligand composition is added to each well containing attached cells using a pipette. At least one control well (eg, with an aqueous diluent for the ligand added) is included in the assay.

Adhering cells are usually stimulated for a period of time that is sufficient to optimize for the signal, but not too long, so that the signal is reduced as a result of dephosphorylation by the endogenous phosphatase of the receptor. A suitable stimulation time is between about 10 minutes and 60 minutes, preferably about 30 minutes, at a physiologically optimal temperature for the cells (usually about 37 ° C.).

After activation, the well supernatant can be decanted and the plate can then be lightly packed with absorbent substrate to remove excess supernatant.

This assay can be used to detect antagonist ligands for the receptor of interest. Antagonists are generally divided into two categories: (a) those that bind to the receptor and thereby block the binding and / or activation of the receptor by agonists to the receptor (the antagonist is Can bind to ECD, but this is not necessarily the case), and (b) binds to the agonist and thus prevents activation of the receptor by the agonist.

In order to detect antagonist molecules from category (a), the cells are exposed to a suspected antagonist ligand substantially as referred to above. After exposure to the antagonist, the well supernatant is decanted and the plate is tapped. A known agonist (eg, endogenous growth factor) is then added to the washed cells substantially as described in the previous paragraph. The well supernatant is then decanted and the plate is tapped. Alternatively, a composition comprising both the antagonist and agonist can be added to the adherent cells substantially as described above. Subsequently, the ability of a suspected antagonist to block its receptor binding and / or activation can be measured by ELISA as discussed below.

In order to detect antagonist molecules from category (b) above, a known agonist is preincubated with a suspected antagonist prior to the KIRA stage of the assay. This incubation is performed for a period of time sufficient to allow the antagonist-agonist complex to form (eg, 30 minutes to 12 hours). This complex is then subjected to an assay using uncomplexed agonists and antagonists as controls.

After exposure to the agonist (and optionally the antagonist) ligand, the cells are lysed as described below.

(E. Lysis of cells)
In this step of the assay, the cells solubilize the receptor construct so that it remains activated (ie, tyrosine residues remain phosphorylated) for the ELISA stage of the assay. Dissolved. Accordingly, the cells are lysed as described above using a lysis buffer that serves to solubilize the receptor construct, but do not dephosphorylate or denature the receptor construct.

If a microtiter plate is used as described above, approximately 75-200 μl of lysis buffer is added to each well. The plate can then be gently shaken for about 1-2 hours using a plate shaker (eg, a plate shaker sold by Bellco Instruments, Vineland, NJ). Shaking can be performed at room temperature.

(2. Enzyme-linked immunosorbent assay-ELISA)
The second stage of the assay involves a sandwich ELISA performed in a second assay plate. To perform this ELISA, a capture agent is prepared.

(A. Preparation of capture drug)
As mentioned above, capture agents often include polyclonal antibodies (usually affinity purified polyclonal antibodies) or monoclonal antibodies. Other capture agents are mentioned and described in the definition section above. The capture agent binds specifically to either its receptor or its flag polypeptide (ie, antigen).

Polyclonal antibodies directed against an antigen (either its receptor or its flag polypeptide) generally have multiple subcutaneous (sc) or intraperitoneal (sc) or antigenic fragments thereof (often the ECD of the alpha subunit receptor) and an adjuvant. ip) elicited in animals by injection. Binding the antigen or fragment containing its target amino acid sequence to a protein that is immunogenic in the species to be immunized (eg, keyhole limpet hemocyanin) using a bifunctional or derivatized agent It can be useful to embody.

Routes and schedules for administering the immunogen to the host animal or antibody producing cells cultured therefrom are generally established and maintained using conventional techniques for antibody stimulation and production. Mice are often used as test models, but any mammalian subject (including human subjects or antibody-producing cells derived therefrom) can be manipulated according to the process of the present invention to produce a mammal (human, It is contemplated that it can act as a basis for the production of hybrid cell lines).

Animals are typically combined with 3 volumes of Freund's complete adjuvant for immunogenic conjugates or derivatives, 1 mg or 1 μg conjugate (for rabbits or mice, respectively) and multiple sites Immunize by injecting the solution intradermally. One month later, the animals are injected subcutaneously at multiple sites in Freund's complete adjuvant (or other suitable adjuvant) in an amount 1/5 to 1/10 of the original amount of the conjugate. Boost. Blood is drawn from the animals after 7-14 days and the serum is assayed for anti-antigen titer. Animals are boosted until the titer reaches a plateau. Preferably, the animal is boosted with a conjugate that is the same antigen but is conjugated with a different protein and / or via a different cross-linking agent. Conjugates can also be made as protein fusions in recombinant cell culture. A coagulant (eg, alum) is also used to enhance the immune response.

Following immunization, the monoclonal antibody is recovered from immune cells (typically spleen cells or lymphocytes from lymph node tissue) from the immunized animal, and the cells are treated in a conventional manner (eg, with myeloma cells). It can be prepared by immortalization (by fusion or transformation with Epstein-Barr virus (EB) virus) and screening for clones producing the desired antibody. Kohler and Milstein, Eur. J. et al. Immunol. 6: 511 (1976) and is also described in Hammerling et al., Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N .; Y. The hybridoma technology described on pages 563-681 (1981) has been widely applied to produce hybrid cell lines that secrete high levels of monoclonal antibodies against a number of specific antigens.

It is also possible to fuse one type of cell with another type of cell. However, it is preferred that the immunized antibody-producing cells and the source of myeloma are from the same species.

Hybrid cell lines can be maintained in culture in cell culture medium. The cell lines of the invention can be selected and / or maintained in a composition comprising continuous cell lines in hypoxanthine-aminopterin-thymidine (HAT) medium. In fact, once the hybridoma cell line is established, it can be maintained in a variety of nutritionally appropriate media. Moreover, hybrid cell lines can be stored and stored in a number of conventional ways. This includes freezing and storage under liquid nitrogen. Frozen cell lines can be regenerated and cultured indefinitely by restarted synthesis and secretion of monoclonal antibodies.

Secreted antibodies are recovered from the tissue culture supernatant by conventional methods such as precipitation, ion exchange chromatography, affinity chromatography, and the like. The antibodies described herein are also recovered from hybridoma cell cultures by conventional methods for purification of IgG or IgM, if circumstances permit. These conventional methods have heretofore been used to purify these immunoglobulins from pooled plasma (eg, ethanol precipitation procedures or polyethylene glycol precipitation procedures). The purified antibody is then filter sterilized. When this antibody is a polyclonal antibody, it is generally affinity purified using an affinity column generated to provide a substantially specific capture antibody from the antigen of interest. Affinity chromatography is usually preceded by other purification techniques (eg, liquid chromatography).

In a further embodiment, the antibody or antibody fragment is generated using a flag polypeptide, alpha subunit receptor, or a fragment thereof via the techniques described in McCafferty et al., Nature, 348: 552-554 (1990). An appropriate antibody or antibody fragment can be selected by isolation from the prepared antibody phage library. Clackson et al., Nature 352: 624-628 (1991) and Marks et al., J. Biol. Mol. Biol. 222: 581-597 (1991) describe the isolation of murine and human antibodies using phage libraries, respectively. Subsequent publications produce high affinity (nM range) human antibodies by chain shuffling (Mark et al., Bio / Technol. 10: 779-783 (1992)), as well as constructing very large phage libraries Combinatorial infection and in vivo recombination (Waterhouse et al., Nuc. Acids Res. 21: 2265-2266 (1993)) are described as strategies for. These techniques are therefore viable alternatives to the traditional monoclonal antibody hybridoma technology for isolation of “monoclonal” antibodies encompassed by the present invention.

The DNA encoding the monoclonal antibody of the present invention can be obtained using conventional procedures (eg, by using oligonucleotide probes that can specifically bind to the genes encoding the heavy and light chains of the murine antibody). Easily isolated and sequenced. The hybridoma cells of the invention serve as a preferred source of such DNA. Once isolated, this DNA can be placed in an expression vector, which is then used as a simian COS cell, a Chinese hamster ovary (CHO) cell, or a myeloma cell that otherwise does not produce immunoglobulin proteins. Transfected into a host cell to obtain monoclonal antibody synthesis in the recombinant host cell. This DNA also replaces, for example, sequences encoding human heavy and light chain constant domains in place of homologous mouse sequences (Morrison et al., Proc. Nat. Acad. Sci. 81: 6851 (1984)). ), Or all or part of the sequence encoding the non-immunoglobulin polypeptide can be modified by covalently attaching to the immunoglobulin coding sequence. In this manner, “chimeric” or “hybrid” antibodies are prepared that have the binding specificity of the anti-receptor or anti-flag polypeptide monoclonal antibodies herein. Thus, this antibody can be made by recombinant DNA methods (Cabilly et al., US Pat. No. 4,816,567).

The binding of the capture agent is not affected by the presence or absence of a ligand bound to the receptor, and the capture agent does not sterically block access to tyrosine phosphorylated by an anti-phosphotyrosine antibody. Furthermore, this capture agent naturally does not activate the receptor of interest.

First, once a capture agent (eg, antibody or streptavidin) is selected, binding to either the receptor or the flag polypeptide (where the receptor construct is used in the assay) is confirmed. Is done. This can be determined, for example, by flow cytometry analysis, immunoprecipitation or antigen-coated ELISA. Flow cytometric analysis is described above. Immunoprecipitation usually involves lysing the cells (with the receptor construct) in a non-ionic detergent (eg 0.5% Triton X-100) in a suitable buffer (eg PBS). The cell lysate thus obtained is then incubated with a potential anti-receptor or anti-flag polypeptide capture agent. The immune complex uses (a) an anti-capture drug antibody in the presence of polyethylene glycol (PEG) that enhances precipitation of the immune complex, or (b) insoluble (eg, agarose-binding) protein A or Precipitate with either protein G. The immunoprecipitated material is then analyzed by polyacrylamide gel electrophoresis (PAGE). For antigen-coated ELISA, ELISA wells are coated overnight with either purified receptor, purified flag polypeptide, or purified receptor construct. The coated wells are then exposed to potential capture agents and screened with HRPO-conjugated species-specific anti-capture agent antibodies.

The ability of the capture agent to bind to the receptor or flag polypeptide in the presence of a ligand for the receptor is also confirmed. This can be analyzed by incubating the receptor construct with a known ligand for the receptor (eg, endogenous growth factor or agonist antibody thereto). Flow cytometry analysis, immunoprecipitation, or antigen-coated ELISA can then be performed as substantially described above to investigate the binding of the capture agent.

Assuming that this capture agent is appropriate when determined by the two steps above, the capture agent then undergoes receptor activation (ie, autophosphorylation) either before or after cell lysis. Shown not to induce. Accordingly, the cell-bound receptor construct is exposed to either a potential capture agent or a negative control (eg, a control antibody that does not activate the receptor). After cell lysis, the receptor construct is subjected to Western blot analysis using a labeled anti-phosphotyrosine antibody. See, for example, Glenney et al., Journal of Immunological Methods 109: 277-285 (1988); Kamps, Methods in Enzymology 201: 101-110 (1991); Kozma et al., Methods 91 in 191; , Science 256: 1205-10 (1992). To establish whether the capture agent induces receptor activation after cell lysis, trials of KIRA ELISA (using both the capture agent and negative control as described above) can be performed.

Finally, the ability of anti-phosphotyrosine antibodies (eg, biotinylated anti-phosphotyrosine antibodies) to bind activated receptors in the presence of potential capture agents is confirmed by trials in the KIRA ELISA disclosed herein.

Assuming that the capture agent meets all of the criteria specified above, it has good potential for use in the KIRA ELISA.

Once the appropriate capture agent is prepared, the second solid phase is coated with it. Between about 0.1 μg / ml and 10 μg / ml of capture agent can be added to each well of the second assay plate using, for example, a pipette. The capture agent is often provided in a high pH (e.g., about 7.5-9.6) buffer so that it has an increased overall charge and hence its second Shows increased binding to assay plates. Typically, the capture agent is incubated in the well for about 8-72 hours to allow a sufficient coating of capture agent to form on the inner wall of the well. This incubation is generally performed at low temperatures (eg, about 3-8 ° C.) to avoid or reduce degradation of the capture agent.

After incubation, the plate wells are decanted and lightly packed with adsorbent substrate. Non-specific binding is then blocked. To accomplish this, block buffer is added to the wells. For example, a block buffer containing bovine serum albumin (BSA) (eg, sold by Intergen Company Purchase, NY) is suitable. It was found that shaking of relaxation for 1-2 hours at room temperature following addition of about 100-200 μl of blocking buffer to each well is sufficient to block non-specific binding. Has been. It is also possible to add the block buffer directly to the cell lysate obtained in the previous step rather than the second assay plate.

After this, the capture drug coated plate is washed several times with wash buffer (usually about 3-8 times). The wash buffer can include, for example, phosphate buffered physiological buffer (PBS), pH 7.0-7.5. However, other wash buffers are also available and can also be used. Conveniently, an automated plate washer (eg, Scan Washer 300 (Skatron Instruments, Inc., Sterling, Va.) Can be used for this, and others can be used for the washing step of the assay.

(B. Measurement of tyrosine phosphorylation)
The activated and solubilized receptor construct is then added to the well with the capture agent attached to it. As a general proposition, about 80% of the cell lysate obtained as mentioned in the above section can be added to each well (ie about 60-160 μl depending on the original volume of the well). . This lysate is incubated with the capture agent for an appropriate period of time to allow the receptor construct to be captured in the well (eg, 1-3 hours). Incubations can be performed at room temperature.

Unbound cell lysate is then removed by washing with wash buffer. After this washing step, an amount of antiphosphotyrosine antibody equal to or less than the amount of previously added block buffer is added to each well. For example, about 50-200 μl of an anti-phosphotyrosine antibody preparation having about 0.3-0.5 μg / ml antibody in a suitable buffer (eg, detergents such as those contained in lysis buffer). Add PBS to the wells. This is followed by a washing step to remove unbound anti-phosphotyrosine antibodies.

Tyrosine phosphorylation is then quantified by the amount of anti-phosphotyrosine antibody binding to the second solid phase. Many systems for detecting the presence of antibodies are available to those skilled in the art. Continue with some examples.

In general, anti-phosphotyrosine antibodies are labeled either directly or indirectly with a detectable label. In general, many labels are available that can be grouped into the following categories: (a) Radioisotopes (eg, ³⁵ S, ¹⁴ C, ¹²⁵ I, ³ H and ¹³¹ I). The antibody can be labeled with a radioisotope using, for example, the techniques described above in Current Protocols in Immunology, and radioactivity can be measured using scintillation counting.

(B) Fluorescent labels (eg, rare earth chelates (europium chelates) or fluorescein and its derivatives, rhodamine and its derivatives, dansyl, lissamine, phycoerythrin, and Texas Red are available. This fluorescent label is, for example, Current Protocols in Immunology, can be conjugated with antibodies using the techniques disclosed above, and fluorescence can be quantified using a fluorimeter (Dynatech).

(C) Various enzyme substrate labels are available, and US Pat. No. 4,275,149 provides some overview of them. Enzymes generally catalyze chemical changes in chromogenic substrates, and the changes can be measured using various techniques. For example, the enzyme can catalyze a color change in the substrate, which can be measured spectrophotometrically. Alternatively, the enzyme can change the fluorescence or chemiluminescence of the substrate. Techniques for quantifying the change in fluorescence are described above. The chemiluminescent substrate is electrically excited by a chemical reaction, which can then be measured (e.g., using a Dynatech ML3000 chemiluminescence meter) or can give energy to the fluorescent acceptor. To do. Examples of enzyme labels include luciferases (eg, firefly and bacterial luciferases; US Pat. No. 4,737,456), luciferin, 2,3-dihydrophthalazinedione, maleate dehydrogenase, urease, peroxidase (eg, horseradish Peroxidase (HRPO)), alkaline phosphatase, β-galactosidase, glucoamylase, lysozyme, saccharide oxidase (eg, glucose oxidase, galactose oxidase, and glucose-6-phosphate dehydrogenase), heterocyclic oxidase (eg, urease and xanthine oxidase), Contains lactoperoxidase, microperoxidase and the like. Techniques for conjugating enzymes to antibodies are described in O'Sullivan et al., Methods for the Preparation of Enzyme-Antibody Conjugates for Use in Enzyme Immunoassay, Methods in Enzymes in. (Edited by J. Langone and H. Van Vunakis), Academic Press, New York, 73: 147-166 (1981) and Current Procotols in Immunology, supra.

Examples of enzyme-substrate combinations include, for example: (i) Horseradish peroxidase (HRPO) using hydrogen peroxidase as a substrate, where the hydrogen peroxidase is a dye precursor (eg, orthophenylenediamine (OPD)). Or 3,3 ′, 5,5′-tetramethylbenzidine hydrochloride (TMB)).

(Ii) Alkaline phosphatase (AP) using para-nitrophenyl phosphate as a chromogenic substrate
(Iii) β-D-galactosidase (β-D) using a chromogenic substrate (eg, p-nitrophenyl-β-D-galactosidase) or a fluorogenic substrate (4-methylumbelliferyl-β-D-galactosidase) -Gal)
Many other enzyme-substrate combinations are available to those skilled in the art. For a general review of these, see U.S. Pat. Nos. 4,275,149 and 4,318,980.

Sometimes the label is indirectly conjugated with the antibody. Those skilled in the art are aware of various techniques for accomplishing this. For example, the antibody can be conjugated with biotin, and any of the three broad categories of labels mentioned above can be conjugated with avidin or vice versa. Biotin selectively binds to avidin and thus the label can be conjugated with the antibody in this indirect manner. For a review of techniques related to biotin-avidin conjugates, see Current Protocols in Immunology, supra. Alternatively, to achieve indirect conjugation of the label with the antibody, the antibody is conjugated with a small hapten (eg, digoxin). Any one of the different types of labels referred to above is then conjugated to an anti-hapten antibody (eg, an anti-digoxin antibody). Thus, indirect conjugation of this label with the antibody can be achieved.

In another embodiment of the invention, the anti-phosphotyrosine antibody need not be labeled. Its presence can then be detected using a labeled anti-anti-phosphotyrosine antibody (eg, an anti-mouse anti-phosphotyrosine antibody conjugated with HRPO).

In a preferred embodiment, the anti-phosphotyrosine antibody is labeled with an enzyme label. This enzyme label catalyzes the color change of the substrate (eg, tetramethylbenzimidine (TMB) or orthophenylenediamine (OPD)). Thus, the use of radioactive material is avoided. The color change of the reagent can be determined spectrophotometrically at the appropriate wavelength (eg, 450 nm for TMB and 490 nm for OPD, where the reference wavelength is 650 nm).

(3. Intracellular kinase activity)
The assays described herein also involve phosphorylation and / or activation of intracellular kinase domains (eg, forming cytoplasmic tyrosine kinase and / or cytoplasmic serine threonine kinase) fused to the α subunit receptor. Used by measuring. Phosphorylation of these molecules can occur as a result of transphosphorylation of the intracellular kinase domain by a kinase receptor or “receptor complex”, which includes one or more kinase receptors present in the cell membrane. Examples of intracellular tyrosine kinases include, for example, insulin receptor substrate (IRS-1), Shc, Ras and GRB2. Antibodies against human Shc, human Ras and GRB2 can be obtained commercially from UBI, NY. This can be used as a capture agent for these tyrosine kinases. Examples of intracellular serine threonine kinases include MEK and MAPK.

To measure phosphorylation of receptor constructs containing catalytic domains from these kinases, the procedure is essentially as described above, and the chimera is referred to as the “kinase construct”. In general, eukaryotic organisms are transformed with a nucleic acid encoding a kinase construct. Upon expression of the nucleic acid, the kinase construct is present in the cell (ie, cytoplasm). Cells containing the kinase construct are subjected to the KIRA described above. Exposure to this agonist can result in transphosphorylation of the intracellular kinase construct, which can be quantified in an ELISA as detailed above. The capture agent in the ELISA binds to either the intracellular kinase construct or the flag polypeptide.

(4. Serine threonine kinase activity)
This assay is further used by measuring for phosphorylation and / or activation of the serine threonine kinase ICD domain fused to the α subunit receptor. The term “serine threonine kinase” refers to a kinase that phosphorylates a substrate having at least one phosphate-accepting alcohol group. Serine threonine kinase is usually a “receptor” as long as it has a ligand-binding ECD, TM domain and ICD. ICDs usually contain a catalytic kinase domain and generally have one or more phosphate-accepting serine and / or threonine residues. Examples of intracellular serine threonine kinases include MEL and MAPK. Measuring phosphorylation of intracellular serine-threonine kinases can be done as described herein. Examples of serine threonine kinase receptors that can provide an appropriate ICD domain for fusion to make a receptor construct are daf-1, activin type II receptor (ActR-II), activin type IIB receptor (ActR-IIB), TGF -Includes βII type receptor (TβR-II), activin receptor-like kinase (ALK) -1, ALK-2, ALK-3, ALK-4, and TGF-β type I receptor (TβR-1) / ALK-5. See ten Dijke et al., supra. The serine threonine kinase assay is essentially the same as that described above for tyrosine kinases, except that phosphate is quantified using anti-phosphoserine and / or anti-phosphothreonine antibodies. Anti-phosphoserine and anti-phosphothreonine monoclonal antibodies are described in, for example, Sigma Immuno Chemicals, St. May be purchased from Louis, MO.

(5. Phosphatase activity)
Phosphatase activity can also be measured using the assays described hereinabove. The phosphatase enzyme can dephosphorylate phosphorylated tyrosine, serine and / or threonine residues (ie, liberate inorganic phosphate from phosphate esters of such amino acid residues). In general, phosphatase enzymes are specific for either tyrosine or serine threonine residues, but sometimes they can dephosphorylate tyrosine, serine and threonine residues. Sometimes “endogenous” phosphatase activity is measured and referred to as the activity of a naturally occurring phosphatase enzyme in the selected cell. To quantify endogenous phosphatase activity, cells with at least one phosphatase are stimulated in the presence and absence of one or more phosphatase inhibitors. Examples of protein tyrosine phosphatase (PTPase) inhibitors include sodium orthovanadate and sodium molybdate (Sigma Chemical Co., St. Louis, MO). ICN Biochemicals supplies okadaic acid. This okadaic acid is an inhibitor of serine threonine phosphatase. As a general proposal, between about 1-10 μM phosphatase inhibitor can be added to each well of the assay plate. In all other aspects, the assay is performed essentially as described above. Thus, the ability of endogenous phosphatase to dephosphorylate a kinase in selected cells can be quantified.

In a preferred embodiment, the phosphatase enzyme of interest can be studied. Examples of protein tyrosine phosphatases (PTPases) include PTP1B, PTPMEG, PTP1c, Yop51, VH1, cdc25, CD45, HLAR, PTP18, HPTPα, and DPTP10D. Zhang and Dixon, Adv. Enzym. 68: 1-36 (1994). Examples of protein serine threonine phosphatases include PP1, PP2A, PP2B and PP2C. Meth. Enzym. See Hunter and Sefton, Academic press, New York, 201: 389-398 (1991). These proteins can be commercially available or can be made using the recombinant techniques described herein. To measure phosphatase activity, a KIRA ELISA can be performed with the following modifications, essentially as described above. Following capture of the kinase or kinase construct (eg, receptor construct) to the second solid phase and washing steps (to remove unbound cell lysate), the phosphatase of interest is transferred to the second assay plate. Add to wells and incubate with attached kinase or kinase construct. For example, between about 50-200 μl of phosphatase in a suitable dilution buffer (see Meth. Enzym. Hunter and Sefton, edited by Academic Press, New York, 201: 416-440 (1991)) Can be added. This is generally followed by gentle shaking at room temperature (or 37 ° C.) for about 30 minutes to 2 hours to cause the phosphatase to dephosphorylate the kinase. After washing to remove the phosphatase, the reduced degree of phosphorylation of the kinase relative to the control (ie, no phosphatase added) is quantified by ELISA as described herein above.

(6. Kit)
For convenience, a reagent is added to a kit (i.e., the reagent's) to be combined with the analyte in assaying its ability to activate or interfere with activation of the alpha subunit receptor of interest. Packaged combination). The components of this kit are provided in a predetermined ratio. Thus, the kit is either a specific second solid phase for the assay and an anti-flag polypeptide capture agent (packaged separately or captured on a second solid phase (eg, a microtiter plate). Any). Usually, other reagents (eg, anti-phosphotyrosine antibodies labeled directly or indirectly with an enzyme label) are also provided in the kit. Where the detectable label is an enzyme, the kit includes a substrate and cofactors required by the enzyme (eg, a substrate precursor that provides a detectable chromophore or fluorophore). In addition, other additives such as stabilizers, buffers (eg, block buffers and lysis buffers), and the like may also be included. Conveniently, the kit can also supply a homogeneous population of cells transformed with the receptor construct. The relative amounts of various reagents can be varied widely to provide a concentration of the reagent in the solution, which substantially optimizes the sensitivity of the assay. In particular, the reagent can be provided as a dry powder (usually lyophilized), which includes excipients that when dissolved provide a reagent solution having an appropriate concentration. The kit also suitably includes instructions for performing a KIRA ELISA.

(7. Use for assay)
The present application provides two assays that are useful for reliable, sensitive, and quantitative detection of kinase activation. Kinase activation reflects ligand binding by the α subunit receptor that occurs by homodimerization or homooligomerization. A first assay can be used if a receptor-specific capture antibody having the desired properties described herein is available or prepared. The second assay is a comprehensive assay that allows the activation of any receptor construct to be measured through the use of a flag polypeptide and a capture agent that specifically binds to it.

These assays are useful for identifying new agonists / antagonists for selected receptors. This assay also provides a means to study ligand-receptor interactions (ie, mechanical studies). Also, the presence of endogenous receptors in selected cell lines can be quantified using the assay. The assay is further useful for identifying the presence of a ligand for a selected receptor in a biological sample and, for example, establishing whether a growth factor has been isolated according to a purification procedure. is there. It would be desirable to have an assay to measure the ability of these growth factors to activate their respective receptors.

This assay also has clinical applications for detecting the presence of a ligand for a selected receptor (eg, GFRα3 receptor) in a biological sample taken from a human. Thus, patients with elevated or lowered levels of ligand can be identified. This is particularly desirable when elevated or lowered levels of ligand cause a pathogenic condition. Thus, candidates for administration of a selected ligand (eg, insulin) can be identified through this diagnostic method. The assays disclosed herein can be used to assay the pK of an agonist or antagonist administered to a patient. This assay also facilitates detection of hidden receptors in biological samples.

This assay is also useful for quantifying the phosphatase activity of endogenous phosphatase, or in a preferred embodiment, the phosphatase of interest. This can be used, for example, to screen for phosphatase inhibitors.

The following examples are provided for illustrative purposes only. And it is not intended to limit the scope of the invention in any way. All patent and publication references cited herein are hereby incorporated by reference in their entirety.

(Example)
Commercially available reagents referred to in the examples were used according to manufacturer's instructions unless otherwise indicated. In the examples below and throughout the specification, the source of those cells indicated by the ATCC accession number is the American Type Culture Collection, Rockville, Maryland.

(Example 1: Cloning of mouse GFRα3)
Using the sequence from the neurturin receptor (now known as GFRα2 (known as “glial cell line-derived neurotrophic factor family receptor α”), new potential members of the GFRα family are (Accession number, W99197 (SEQ ID NO: 1), AA041935 (SEQ ID NO: 2), and AA050083 (SEQ ID NO: 3)) The DNA fragment corresponding to this potentially new receptor was identified as mouse E15 cDNA. (Clontech, Inc. USA) was obtained as a template and by Marathon PCR using PCR primers derived from mouse EST, which was then used to generate a λgt10 mouse E15 library (Cl ontech, Inc. USA) to obtain a full-length clone, the nucleotide sequence of this full-length mouse cDNA is provided in SEQ ID NO: 4 (FIGS. 1A-1B) Protein sequence encoded by the isolated DNA (See SEQ ID NO: 5; see FIGS. 1A-1B) was named GFRα3 because it was sequenced with GFRα1 (formerly GDNF receptor α) and GFRα2 (formerly Newturin receptor α; NTNRα). A comparison of the 397 amino acid mouse GFRα3 protein sequence (SEQ ID NO: 5) with rat GFRα1 (SEQ ID NO: 8) and rat GFRα2 (SEQ ID NO: 9) was determined to be a novel protein with identity. Provided in Figure 2. The mGFRα3 sequence belongs to the GFR receptor family. It is believed that a novel series of mologs will be identified, potential N-linked glycosylation sites are shaded in Figure 2. Hydrophobic sequences involved in GPI anchors are overwritten in Figure 2. Potential GPI binding The site is indicated with an asterisk.The variant of mouse GFRα3 DNA contains a deletion of the “T” base at position 290 in FIG.1A, which results in a frameshift and a truncated protein variant. Variant DNA is useful for hybridization, diagnostics, and other uses of DNA discussed throughout this specification (except for full-length protein production) DNA containing the GFRα3 coding region immediately upstream of this base (89 Positions-289) find use in the present invention.DNA containing sequences immediately downstream (291-1279) It provides another useful embodiment of the light.

In situ hybridization studies with DNA encoding mouse GFRα3 showed a pattern of expression in peripheral and sympathetic neurons (data not shown).

(Example 2: Isolation of cDNA clone encoding human GFRα3)
To quickly identify whether a human homologue of this new receptor may be present, search the expressed sequence tag (EST) DNA database (proprietary EST database, LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA), and EST (INC3574209) was identified as having the following sequence:

This sequence had 61% identity with mouse GFRα3.

To clone the corresponding full length cDNA, a panel of cDNA libraries was screened using the following primers:

DNA from this library was screened by PCR amplification using its PCR primer pair as per Ausubel et al., Current Protocols in Molecular Biology (1995).
Strong PCR products were identified in all analyzed libraries (fetal lung, fetal kidney, and placenta).

In order to isolate a cDNA clone encoding this protein, a human fetal lung pRK5 vector library was constructed using new3. Positive cDNA clones were selected and enriched by extension of single stranded DNA from plasmid libraries grown in breast / anal (dug- / bung-) hosts using R primers. RNA for construction of the cDNA library was isolated from human fetal lung tissue. The cDNA library used to isolate the cDNA clones was constructed by standard methods using commercially available reagents (eg, Invitrogen, San Diego, CA; Clontech, etc.). This cDNA is primed with an oligo dT containing a NotI site, ligated with blunt ends against a SalI hemikinase adapter, cut with NotI, appropriately sized by gel electrophoresis, and in an appropriate cloning vector. Cloned in unique XhoI and NotI sites (pRKB or pRKD; pRK5B is a precursor of pRK5D without the SfiI site; Holmes et al., Science 253; 1278-1280 (1991)). See To enrich for positive cDNA clones, the primer extension reaction was 10 μl of 10 × PCR buffer (Perkin Elmer, USA), 1 μl dNTP (20 mM), 1 μl library DNA (200 ng), 1 μl primer, 86.5 μl. H 2 O and 1 μl Amplitaq (Perkin Elmer, USA), which was added after the hot start. The reaction was denatured at 95 ° C. for 1 minute, annealed at 60 ° C. for 1 minute, and then extended at 72 ° C. for 15 minutes. The DNA was extracted with phenol / chloroform, precipitated with ethanol, and then transformed into DH10B host bacteria by electroporation. The entire transformation mixture was seeded on 10 plates and allowed to form colonies. Colonies are lifted onto nylon membranes and using an oligonucleotide probe derived from Incyte EST (newa3.probe: 5'TCT CGC AGC CGG AGA CCC CCT TCC CAC AGA AAG CCG ACT CA3 '(SEQ ID NO: 13)) Screened. Filter with the probe at 42 ° C., 50% formamide, 5 × SSC, 10 × Denhardt's solution, 0.05 M sodium phosphate (pH 6.5), 0.1% sodium pyrophosphate, and 50 μg / ml ultrasound Hybridization was overnight in treated salmon sperm DNA. Filters were then rinsed in 2 × SSC, washed in 0.1 × SSC, 0.1% SDS, and then exposed to Kodak X Ray film overnight. Five positive clones were identified. Pure positive clones were obtained after colony purification and secondary screening.

Two of the isolated clones were sequenced. These cDNA sequences were named DNA48613 (SEQ ID NO: 14) and DNA48614 (SEQ ID NO: 16). Amino acid sequence analysis of DNA48163 showed a 400 amino acid long open reading frame sequence (SEQ ID NO: 15) with an estimated 26 amino acid long N-terminal signal peptide. The putative mature protein has a calculated molecular weight of approximately 41 kDa and is 374 amino acids long. Potential N-linked glycosylation sites are similar to horses in the mouse sequence. Mouse and human GFRα3 protein sequences are compared in FIG.

By comparison to the deduced amino acid sequence of DNA48164 (SEQ ID NO: 17) and SEQ ID NO: 15, this deduced amino acid sequence was found to have a 30 amino acid deletion (amino acids 127-157, counting from the starting methionine, as shown in FIG. It was shown to be a alternatively spliced form of DNA48163. Interestingly, no cysteine was deleted in this clone. Clones DNA48613, DNA48614 and mGFRα3 (clone 13) variants have been deposited with the ATCC and assigned ATCC deposit numbers 209752 (name: DNA48613-1268), 209751 (name: DNA48614-1268) and respectively. A comparison of the nucleic acid sequence encoding DNA48613 with the nucleic acid sequence encoding human GFRα1 and the nucleic acid sequence encoding GFRα2 is provided in FIGS. The 5 'untranslated GFRα3 sequence immediately upstream of the start ATG in the cloned DNA48613 is:

As discussed below, the sequence comparison of the protein encoded by DNA48613 to GFRα1 and GFRα2 (FIG. 6) shows that the two human proteins are new members of the GFRα receptor family and are human homologs of mouse GFRα3. showed that. Accordingly, DNA48613 encodes a protein designated human GFRα3 and DNA48614 encodes its splice variant.

Amino acid sequence comparison between GFRα family members is provided in Table 1 based on BLAST-2 and FastA sequence alignment analysis of the full-length sequence.

From the sequence comparison, it can be seen that human GFRα3 is less related to its rodent homolog than either GFRα1 or GFRα2. Furthermore, GFRα3 appears to be farther related to GFRα1 and GFRα2 than GFRα1 and GFRα2 are related to each other.

Example 3: Use of GFRα3 as a hybridization probe
The following method describes the use of a nucleotide sequence encoding GFRα3 as a hybridization probe.

Homologous DNA (eg, a naturally occurring GFRα3 or a variant of GFRα3) using a DNA comprising a coding sequence of GFRα3 (shown in SEQ ID NO: 4, SEQ ID NO: 14, or SEQ ID NO: 16) or a fragment thereof as a probe Are screened for in human tissue cDNA libraries, human tissue genomic libraries, RNA isolated from tissues, tissue preparations in situ, or chromosomal preparations (eg, for chromosomal mapping).

Hybridization and washing of filters containing either library is performed under the following high stringency conditions. Hybridization of the radiolabeled GFRα3-derived probe to the filter was performed using 50% formamide, 5 × SSC, 0.1% SDS, 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH 6.8, 2 × Denhardt's solution, And in a solution of 10% dextran phosphate for 20 hours at 42 ° C. The filter is washed at 42 ° C. in an aqueous solution of 0.1 × SSC and 0.1% SDS.

DNA having the desired sequence identity with the DNA encoding the full length native GFRα3 sequence can then be identified using standard techniques known in the art.

(Example 4: Northern blot analysis)
The expression of GFRα3 mRNA in human tissues was examined by Northern blot analysis. Multiple human tissue RNA blots were hybridized to a ³² P-labeled DNA probe containing the entire coding region of human GFRα3 cDNA labeled by random priming. Human fetal RNA blots MTN (Clontech, Inc. USA) and human adult RNA blots MTN-1 and MTN-II (Clontech) are incubated with DNA probes. Blots were in hybridization buffer (5 × SSC; 10 × Denhardt's solution; 0.05 M sodium phosphate pH 6.5, 50 μg / ml sonicated salmon sperm DNA; 50% formamide; 0.1% sodium pyrophosphate). Incubated overnight at 42 ° C. with 1 × 10 ⁶ cpm / ml probe. The blot was washed in 2 × SSC for 10 minutes at room temperature and then washed in 0.2 × SSC in 0.1% SDS for 30 minutes at 42 ° C. The blot was exposed to x-ray film and developed overnight by phosphorimager analysis (Fuji).

As shown in FIG. 7, a GFRα3 mRNA transcript was detected. High levels of expression were observed in the heart, gastrointestinal tract (pancreas, small intestine, colon), thymus, testis and prostate.

(Example 5: Position determination by in situ hybridization of GFRα3)
The following tissues were investigated for GFRα3 mRNA expression by in situ hybridization: 13 day mouse embryos, 15 and 17 day embryonic mouse brains, postnatal day 1 mouse brains, adult mouse brain (optic nerve) Together), adult mouse spinal cord, adult mouse trigeminal ganglion and trigeminal root, adult mouse retina, and several stages of embryonic ovarian sac.

For in situ hybridization, E13.5 mouse embryos were fixed by immersion in 4% paraformamide overnight at 4 ° C., frozen in 15% sucrose overnight, and O.D. T.A. C. Embedded in and frozen in liquid nitrogen. Adult mouse spinal cord, trigeminal ganglia, retina, and P1 mouse brain were T.A. C. Embedded in and frozen fresh in liquid nitrogen. Adult mouse brains were freshly frozen with powdered dry ice. Sections were cut at 16 μm and processed by previously described methods (Phillips et al., Science 250: 290 (1990)) for in situ hybridization for GFRα3. Using 33P-UTP, a labeled RNA probe was made as described (Melton et al., Nucleic Acids Res. 12: 7035 (1984)) using T7 polymerase with a 326 bp fragment encoding mouse GFRα3.

In E13 mice, GFRα3 mRNA was very strongly expressed in dorsal root ganglia, sympathetic ganglia, and peripheral nerves. The vestibular ganglion also showed a strong signal. Moderate expression was seen in the whisker pad, in the area of the axilla, and around the bladder. Moderate expression was also found in cell clusters in the medial lateral area of the gray matter of the thoracic spinal cord, ventromedial hypothalamus, and dorsal rhombocephalus. Most other areas of the brain lacked demonstrable signals. Many other organs (including lung, heart, liver, gastrointestinal tract, and kidney) expressed signals that were either weak or undetectable.

In late development (E15, E17, P1, and adult), GFRα3 expression in the CNS was very limited. Most regions of the brain and spinal cord did not show a hybridization signal above the background level seen in control sections hybridized with the sense strand control probe. The exception to this was the cell cluster found in the hindbrain. In adults, a subpopulation of trigeminal ganglion neurons was very strongly labeled, but not in satellite cells or nerve roots. The optic nerve also showed no detectable signal.

In adult mouse heart sections, there was a diffusible signal in the atrial and ventricular myocardium with an increased signal focus area associated with the cardiac conduction system.

A comparison of labeling with GFRα1, GFRα2 and GFRα3 is shown in FIG. The expression of GFRα3 is very limited and localized compared to other receptors.

Using a primer containing the sense sequence GCGCGCGACCTCCCACTGCTG (designated gfrp1; SEQ ID NO: 22) and the antisense sequence CGTTGGGGAGGCGCGCGCG (designated gfrp2.rc); SEQ ID NO: 23), 671 bp derived from mouse GFRα3 Hybridization probes were generated. A primer containing the sense sequence CCTGAACCTATGTAACTGG (SEQ ID NO: 24) and the antisense sequence ACCCAGTCCTCCCACC (SEQ ID NO: 25) was used to generate a 378 bp hybridization probe derived from mouse GFRα3.

Human fetal tissues tested at weeks E12 to E16 were placenta, umbilical cord, liver, kidney, adrenal gland, thyroid, lung, heart, large blood vessel, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, spinal cord, body wall ( body wall), pelvis and lower limbs. Adult tissues tested included kidney (normal and end stage), adrenal gland, myocardium, aorta, lung, skin, eye (including retina), bladder, liver (normal, cirrhosis, and acute failure), renal carcinoma, and soft tissue sarcoma Included. Non-human primate tissues tested included chimpanzee salivary glands, stomach, thyroid, parathyroid, skin and thymus. Hybridization to a 378 base pair antisense strand probe was detected in fetal and adult human DRG, fetal peripheral nerves (as seen in fetal body walls and lower limbs), and mesenteric nerves. No expression was observed in the fetal spinal cord or brain. No expression was observed in the neuroblastoma tested.

Using a 671 base pair antisense probe, GFRα3 mRNA hybridization was performed in E14 ganglia, trigeminal nerves, skin and skeletal muscle peripheral nerves; E17 skin, dorsal root node, peripheral nerves in early and late and adult rats. , Cartilage, skeletal muscle and brain; detected in E19 dorsal root node, peripheral nerve, brain, stratum corneum of skin, teeth, skeletal muscle, cartilage, liver and intestine. No specific signal was detected in either the fetal rat pancreas or the adult rat pancreas. In all of the example examples in this section, the corresponding sense probe did not hybridize as expected.

(Example 6: Expression of GFRα3 in E. coli)
The DNA sequence encoding GFRα3 (eg, human GFRα3) was first amplified using selected PCR primers. This primer should contain a restriction enzyme site corresponding to the restriction enzyme site on the selected expression vector. A variety of expression vectors can be used. An example of a suitable vector is pBR322 (from E. coli; see Bolivar et al., Gene 2:95 (1977)), which contains ampicillin and tetracycline resistance genes. The vector is digested with restriction enzymes and dephosphorylated. The PCR amplified sequence is then ligated into a vector. The vector is preferably an antibiotic resistance gene, trp promoter, polyhis leader (including the first 6STII codon, polyhis sequence, and enterokinase cleavage site), mammalian GFRα3 coding region, λ transcription terminator, and argU gene The sequence encoding is included.

The ligation mixture is then used to select the selected E. coli. The E. coli strain is transformed using the method described in Sambrook et al. Transformants are identified by their ability to grow on LB plates and then antibiotic resistant colonies are selected. Plasmid DNA can be isolated and confirmed by restriction analysis and DNA sequencing.

Selected colonies can be grown overnight in liquid culture medium (eg, LB broth supplemented with antibiotics). The overnight culture can be subsequently used to inoculate a large scale culture. The cells are then grown to the desired optical density during which the expression promoter is turned on.

After further culturing the cells for several hours, the cells can be harvested by centrifugation. The cell pellet obtained by centrifugation can be solubilized using various agents known in the art, and the solubilized mammalian GFRα3 protein is then metallized under conditions that allow for tight binding of the protein. It can be purified using a chelating column.

(Example 7: Expression of GFRα3 in mammalian cells)
This example illustrates the preparation of a glycosylated form of mammalian GFRα3 by recombinant expression in mammalian cells.

The vector pRK5 (see, for example, European Patent 307,247 published March 15, 1989) is used as an expression vector. Optionally, GFRα3 DNA is ligated to pRK5 with a selected restriction enzyme using a ligation method such as that described in Sambrook et al. (Supra) to allow insertion of GFRα3 DNA. The resulting vector is called pRK5-GFRα3.

In one embodiment, the selected host cell can be 293 cells. Human 293 cells (ATCC CCL 1573) are grown to confluence in tissue culture plates in medium such as DMEM supplemented with fetal calf serum and, optionally, nutrients and / or antibiotics. About 10 μg of pRK5-GFRα3 DNA is mixed with about 1 μg of DNA encoding the VA RNA gene (Thimmappaya et al., Cell 31: 543 (1982)) and 500 μl of 1 mM Tris-HCl, 0.1 mM EDTA, 0.227 M dissolved in CaCl _2. To this mixture, 500 μl of 50 mM HEPES (pH 7.35), 280 mM NaCl, 1.5 mM NaPO ₄ is added dropwise and a precipitate is formed at 25 ° C. for 10 minutes. The precipitate is suspended and added to 293 cells and allowed to settle for about 4 hours at 37 ° C. The culture medium is aspirated and 2% 20% glycerol in PBS is added over 30 seconds. The 293 cells are then washed with serum free medium, fresh medium is added, and the cells are incubated for about 5 days.

Approximately 24 hours after transfection, the culture medium is removed and replaced with culture medium (alone) or culture medium containing 200 μCi / ml ³⁵ S-cysteine and 200 μCi / ml ³⁵ S-methionine. After 12 hours of incubation, the conditioned medium is collected, concentrated on a spin filter, and loaded onto a 15% SDS gel. The treated gel can be dried and the gel exposed to film for a selected time to reveal the presence of a mammalian GFRα3 polypeptide. The culture containing the transfected cells can undergo further incubation (in serum-free medium) and the medium is tested in the selected bioassay.

In an alternative technique, mammalian GFRα3 is obtained from Somaryrac et al., Proc. Natl. Acad. Sci. 12: 7575 (1981) and can be transiently introduced into 293 cells using the dextran sulfate method. 293 cells are grown to maximal density in a spinner flask and 700 μg pRK5-GFRα3 DNA is added. Cells are first concentrated from the spinner flask by centrifugation and washed with PBS. The DNA-dextran precipitate is incubated on the cell pellet for 4 hours. Cells are treated with 20% glycerol for 90 seconds, washed with tissue culture medium, and reintroduced into a spinner flask containing tissue culture medium, 5 μg / ml bovine insulin and 0.1 μg / ml bovine transferrin. After about 4 days, the conditioned medium is centrifuged and filtered to remove cells and debris. The sample containing the expressed mammalian GFRα3 can then be concentrated and purified by any selected method (eg, dialysis and / or column chromatography).

In another embodiment, mammalian GFRα3 can be expressed in CHO cells. pSUi-GFRα3 can be transfected into CHO cells using known reagents such as CaPO ₄ or DEAE-dextran. As described above, the cell culture can be incubated and the medium can be replaced with culture medium (alone) or medium containing a radioactive label (eg, ³⁵ S-methionine). After determining the presence of the mammalian GFRα3 polypeptide, the culture medium can be replaced with serum-free medium. Preferably, the culture is incubated for about 6 days and then the conditioned medium is collected. The medium containing the expressed mammalian GFRα3 can then be concentrated and purified by any selected method.

Epitope tagged mammalian GFRα3 can also be expressed in host CHO cells. Mammalian GFRα3 can be subcloned from the pRK5 vector. The subclone insert can be subjected to PCR and fused in frame to the expression vector using a selected epitope tag (eg, a poly his tag). The poly-his tagged mammalian GFRα3 insert can then be subcloned into an SV40 driven vector containing a selectable marker (eg, DHFR) for selection for stable clones. Finally, CHO cells can be transfected with an SV40 driven vector (as described above). Labeling can be performed as described above to confirm expression. The culture medium containing the expressed poly-His tagged mammal GFRα3 can then be concentrated and purified by any selected method (eg, Ni ²⁺ chelate affinity chromatography).

(Example 8: Expression of GFRα3 in baculovirus-infected insect cells)
The following method describes recombinant expression of GFRα3 in baculovirus infected insect cells.

GFRα3 was fused upstream of the epitope tag contained within the baculovirus expression vector. Such epitope tags include poly-his tags and immunoglobulin tags (such as the Fc region of IgG). The amino acid sequence of the GFRα3-IgG fusion is provided in SEQ ID NO: 18. A variety of plasmids may be utilized, including plasmids derived from commercially available plasmids such as pVL1393 (Novagen). Briefly, the GFRα3 sequence encoding the extracellular domain was amplified by PCR using primers complementary to the 5 'and 3' regions. This 5 'primer incorporates an adjacent (selected) restriction enzyme site. This product was then digested with those selected restriction enzymes and subcloned into an expression vector. Vectors for expression of GFRα3-IgG in insect cells are pb. PH (where expression in baculovirus was under the control of the polyhedrin promoter).

Recombinant baculovirus is co-transfected with the above plasmid and BaculoGold ^™ viral DNA (Pharmingen) into Spodoptera frugiperda (“Sf9”) cells (ATCC CRL 1711) using lipofectin (commercially available from GIBCO-BRL). Produced by. After 4-5 days of incubation at 28 ° C., free virus was collected and used for further amplification. Viral infection and protein expression were performed as described in O'Reilley et al., “Baculovirus expression vectors: A Laboratory Manual”, Oxford: Oxford University Press (1994). Purification of IgG-tagged (or Fc-tagged) GFRα3 was performed using known chromatographic techniques (including protein A or protein G column chromatography).

Alternatively, the expressed poly his-tagged GFRα3 can be purified, for example, by Ni ²⁺ chelate affinity chromatography as follows. Extracts are prepared from recombinant virus infected Sf9 cells as described in Rupert et al., Nature 362: 175-179 (1993). Briefly, Sf9 cells were washed and sonicated buffer (25 ml Hepes, pH 7.9; 12.5 mM MgCl ₂ ; 0.1 mM EDTA; 10% glycerol; 0.1% NP-40; 0.4M Suspended in KCl) and sonicated twice on ice for 20 seconds. The sonicated material is clarified by centrifugation, and the supernatant is diluted 50-fold with loading buffer (50 mM phosphate, 300 mM NaCl, 10% glycerol, pH 7.8) and passed through a 0.45 Fm filter. Filter. A Ni ²⁺ -NTA agarose column (commercially available from Qiagen) is prepared in 5 ml bed volume, washed with 25 ml water and equilibrated with 25 ml loading buffer. The filtered cell extract is loaded onto this column at 0.5 ml per minute. The column is washed with loading buffer until A ₂₈₀ is baseline, at which point fraction collection is started. The column is then washed with a secondary wash buffer (50 mM phosphate; 300 mM NaCl, 10% glycerol, pH 6.0) that elutes non-specifically bound protein. After A ₂₈₀ reaches baseline again, the column is developed with a gradient of 0-500 mM imidazole in the secondary wash buffer. 1 mL fractions are collected and analyzed by SDS-PAGE and Western blot using Ni ²⁺ -NTA (Qiagen) conjugated to silver stain or alkaline phosphatase. Fractions containing the eluted His _10- tagged GFRα3 are pooled and dialyzed against loading buffer.

(Example 9: Binding to GFRα3)
To determine whether any known GDNF family member (ligand GDNF, Neuturin (NTN) or Persephin (PSN)) can bind to GFRα3, each ligand is placed on a microtiter plate. And incubated with either GFRα1-IgG, GFRα2-IgG, or GFRα3-IgG (SEQ ID NO: 18) prepared in Example 8. GFRα-IgG binding was then detected using a secondary antibody against the IgG portion. GDNF, NTN, and PSN were coated overnight at 4 ° C. on microtiter plates at 1 μg / ml in 50 mM carbonate buffer (pH 9.6). The plates were then washed with PBS / 0.05% Tween 20 and then blocked with PBS / 0.05% BSA / 0.05% Tween 20 for 1-2 hours at room temperature. Various concentrations of IgG-tagged chimeric receptors (GFRα1-IgG, GFRα2-IgG, GFRα3-IgG; 1 μg / ml to 1.95 ng / ml) were added to each well and the plates were incubated for 1 hour at room temperature. The plates were then washed as above and incubated for 1 hour at room temperature in the presence of goat anti-human IgG (Fc) -HRP (1: 1000). After washing, the bound HRP was exposed to OPD substrate for 5-10 minutes and then the plate was read at 490 nm. The results are shown in FIGS.

GFRα1 binds to GDNF (FIG. 9A), GFRα2 binds to GDNF and NTN (FIG. 9B), but GFRα3 does not bind to any of these molecules (FIG. 9C). Therefore, GFRα3 is an orphan receptor.

Example 10: Assay for GFRα3 agonist
The GDNF family of ligands uses a unique receptor system: GPI-linked ligand binding protein (α component) and signaling component, tyrosine kinase receptor Ret. The mechanism of activation of this multicomponent receptor complex is still unknown, but tyrosine kinase receptors are known to be activated upon ligand-induced dimerization. Thus, a possible mechanism of GFR activation is by a binding ligand for the α component that induces α component dimerization. The two α chains then complex two Ret molecules, which leads to activation of the kinase domain and phosphorylation of target tyrosine residues on receptors and / or other signaling molecules.

Consists of the extracellular domain of rat GFRα2 and the transmembrane and intracellular domains of TPO receptor (c-mpl) or Rse tyrosine kinase receptor to demonstrate that the ligand certainly induces dimerization of the α component A chimeric receptor was constructed. These two receptors belong to different receptor families, but both are known to be activated by ligand-induced dimerization or agonist-antibody-induced dimerization.

(GFRα2-c-mpl) gD epitope tag, then rGFRα2 extracellular domain (excluding GPI signal), then chimeric receptor composed of TPO receptor transmembrane domain and intracellular domain under the control of CMV promoter And assembled into the pRKtkneo vector by recombinant PCR. Ba / F3 cells were electroporated with pRKtkneo-GFRα2-mpl that was linearized with NotI, and clones were obtained by limiting dilution. Individual clones were analyzed for receptor expression by FACS analysis using anti-gD antibodies. Positive clones were selected and further characterized for their ability to proliferate in response to NTN stimulation (ligand for GFRα2). As shown in FIG. 10, Ba / F3 cells expressing GFRα2-mpl can proliferate in response to NTN stimulation as assessed by ³ H thymidine incorporation.

(GFRα2-Rse) Using chimeric receptor with gD epitope tag, then rat GFRα2 extracellular domain (excluding GPI signal), then transmembrane and intracellular domains of Rse tyrosine kinase receptor, and another gD epitope tag And assembled by recombinant PCR into the pSVi vector under the control of the SV40 promoter. This gD-GFRα2-Rse-gD sequence is shown in SEQ ID NO: 19. CHO cells were transfected by the lipofectamine method (GIBCO-BRL). Single transfected CHO clones were picked and analyzed for receptor expression by FACS analysis using anti-gD antibody. Receptor positive clones were then analyzed for receptor-induced phosphorylation upon NTN stimulation using a KIRA assay (eg, US Pat. No. 5,709,858). As shown in FIG. 11, NTN stimulation caused receptor autophosphorylation.

Together, (GFRα3-Rse) The above data indicate that activation of GFR is mediated by ligand-induced dimerization, and in addition to those ligands, various receptors are sensitive to antibody-mediated activation. Thus, in one embodiment, assays identifying agonist antibodies and natural ligands (or other agonists) for mammalian GFRα3 follow the methods described above for GFRα2-Rse. The chimeric GFRα3 receptor is transformed into a gD epitope tag, then the mouse GFRα3 extracellular domain (excluding the GPI signal; preferably human GFRα3 is used), then the transmembrane and intracellular domains of the Rse tyrosine kinase receptor and the second Was constructed under the control of the SV40 promoter into the pSVi vector using recombinant PCR. CHO cells were transfected by the lipofectamine method (GIBCO-BRL). Single transfected clones were picked and analyzed for expression of the GFRα3 chimeric receptor by FACS analysis using anti-gD antibody. Positive clones were then analyzed for receptor-induced phosphorylation upon treatment with either GDNF, NTN or PSN. The results are shown in FIG. This result confirmed that GFRα3 is a receptor for a novel ligand of the GDNF family. The sequence of gD-GFRα3-Rse-gD is shown in SEQ ID NO: 20. As is apparent from the sequence of this construct and its homology to other GFR family members, a sufficient ligand binding region is amino acids 110-386 of SEQ ID NO: 20, which is amino acid residue 84 of SEQ ID NO: 15. Corresponds to ~ 360. The natural ligand of GFRα3 of the present invention has been identified as artemin (Baloh et al., Neuron 21: 1291-1302 (1998)), which is a GFRα3 of the present invention and its gD-GFRα3-Rse-gD fusion. Was found to bind to. Antibodies generated against GFRα3 (or other candidate agonist) can be screened for agonist activity using the GFRα3 construct expressed in CHO cells. Alternatively, antagonists are screened by their ability to inhibit agonist function in this assay.

(Example 11: Preparation of antibody binding to GFRα3)
This example illustrates the preparation of a monoclonal antibody that can specifically bind to GFRα3. Techniques for preparing monoclonal antibodies are known in the art and are described, for example, in Goding (supra). Immunogens that can be used include purified GFRα3, fusion proteins comprising GFRα3, and cells expressing recombinant GFRα3 on the cell surface. The selection of the immunogen can be made by one skilled in the art without undue experimentation. Mice (eg, Balb / c) are immunized with a GFRα3 immunogen emulsified in Freund's complete adjuvant and injected subcutaneously or intraperitoneally in an amount of 1-100 μg. Alternatively, the immunogen is emulsified in MPL-TDM adjuvant (Ribi Immunochemical Research, Hamilton, MT) and injected into the animal's hind limb pad. The immunized mice are then boosted 10 to 12 days later with additional immunogen emulsified in the selected adjuvant. Thereafter, over several weeks, the mice can also be boosted with additional immunizations. Serum samples can be obtained from mice periodically by orbital bleed to be tested in an ELISA assay to detect GFRα3 antibodies.

After the appropriate antibody titer has been determined, the antibody “positive” animals can be injected by the last intravenous injection of GFRα3. After 3-4 days, the mice are sacrificed and spleen cells are harvested. The spleen cells are then fused (using 35% polyethylene glycol) with a selected mouse myeloma cell line (eg, P3X63AgU.1, available from ATCC under the number CRL 1597). This fusion is then plated into 96 well tissue culture plates containing HAT (hypoxanthine, aminopterin, and thymidine) media to inhibit the growth of non-fused cells, myeloma hybrids, and spleen cell hybrids. Hybridoma cells are produced.

Hybridoma cells are screened by ELISA for reactivity against GFRα3. Determination of “positive” hybridoma cells that secrete the desired monoclonal antibody against GFRα3 is within the skill of the art. Positive hybridoma cells can be injected intraperitoneally into syngeneic Balb / c mice to produce ascites containing the anti-GFRα3 monoclonal antibody. Alternatively, the hybridoma cells can be grown in tissue culture flasks or roller bottles. Purification of monoclonal antibodies produced in ascites can be accomplished using ammonium sulfate precipitation followed by gel exclusion chromatography. Alternatively, affinity chromatography based on antibody binding to protein A or protein G may be utilized.

(Example 12: Dimerization screening assay)
Candidate agonists (eg, antibodies generated against α subunit receptors of the GFR family (eg, GFRα3, GFRα2, or GFRα1)) expressed in CHO cells or other suitable cells in a KIRA assay -Rse-like constructs can be used to screen for agonist activity. FIG. 3 shows an exemplary KIRA protocol using a monoclonal antibody against the gD portion of the gD-GFRα2-Rse construct.

A CHO cell culture expressing the gD-GFRα2-Rse fusion protein was prepared and cultured as follows. On the first day, the transfected CHO cells from the culture flask are preferably 70-90% confluent (almost free (detached) cells). The culture plate was a Falcon (1270) flat bottom 96 well sterile tissue culture plate with a cover. The stripping buffer was 1:50 diluted PBS containing 5 mM EDTA (250 mM stock). The cell culture medium was NaHCO3 (50:50) + 10% diafiltered FBS, 25 mM HEPES, 2 mM L-glutamine-free Ham F-12, and glycine-free low glucose DMEM. On day 2, the stimulation medium was Excell-401 insect cell medium (JRH Biosciences catalog number 14401-78) and 0.5% BSA. The lysis buffer was 150 mM NaCl containing 50 mM HEPES and 0.5% Triton-X 100. Protease inhibitors added to lysis buffer prior to use use 100 × AEBSF (100 mM) stock using 1: 100 dilution, 1000 × aprotinin (liquid) stock using 1: 1000 dilution, and 1: 1000 dilution 1000x leupeptin (50 mM) stock. The phosphatase inhibitor added to the lysis buffer before use was a 50 × orthovanadate sodium (100 mM) stock using a 1:50 dilution.

The following materials were used for the ELISA format. The solid support was a Nunc Maxisorp immunoplate 4-39454. The coating buffer was PBS pH 7.4. The washing buffer was PBS (pH 7.4) containing 0.05% Tween20. The blocking buffer was PBS containing 0.5% BSA. The assay buffer was PBS (pH 7.4) containing 0.5% BSA, 0.05% Tween 20 and 5 mM EDTA. The substrate was a TMB substrate kit from Kirkegard and Perry (2 bottles: A; TMB substrate, B; TMB peroxide solution). The stop solution was 1.0 MH ₃ PO ₄ . The antigen was solubilized and transfected “Receptor.gD” from cell culture wells (cell lysate). The antibodies are (primary) 3C8 (anti-gD peptide) concentrate 1.0 μg / ml, 1: 1300 dilution of 1.3 mg / ml stock (lot 24564-7 # 1766), (secondary) biotinylated 4G10 (UBI ) Concentrate, 1: 1000 from 4 ° C. stock (50 μg / ml) # 10076. The conjugate was streptavidin / HRP Zymed concentrate 1: 50000, lot # 26246-91, (1: 100 frozen stock).

Cells were harvested by aspirating the cell culture supernatant from the tissue culture flask, rinsed once with sterile PBS, and 10 ml of cell detachment buffer was added. The cells were incubated at 37 ° C. for about 10 minutes until the cells detached. The detached cells were transferred to a centrifuge tube and an equal volume of cell culture medium was added. Cell counts were performed on a hemocytometer. The cells were centrifuged, the supernatant was removed by aspiration, and the cells were suspended to 1 × 10 ⁶ cells / ml. 100 μl of cell suspension was added to each well (final, approximately 1 × 10 ⁵ cells / well). Plates were incubated overnight at 37 ° C.

Receptor activation was performed as follows. Typically, a stock of ligand (in this example 2 mg / ml hNTNFP preparation) is used to give a final concentration of NTN in each well of 0.1, 0.05, 0.025,. 0125, 0.00625, 0.00312, 0.001, and 0.0 μg / ml. The solution in the microtiter plate was mixed gently by external shaking. 100 μl of sample, control, or NSB was added to each well and incubated at 37 ° C. for 25 minutes. Gently mixed the plates. 130 μl of protease inhibitor and phosphatase inhibitor-containing lysis buffer was added to each well. Cell lysis was allowed to proceed for 30 minutes in the tissue culture plate. Cell lysates were placed at -70 ° C for storage.

The ELISA was performed as follows. To coat the ELISA plate, 100 μl of primary mAb (primary; 3C8 1 μg / ml) solution was added to each well and allowed to coat at 4 ° C. overnight. To perform the assay in a capture (ELISA) plate, the coating solution was discarded and 150 μl of blocking buffer was added to each well. Blocking was continued for 1 hour. Thaw cell lysate with gentle agitation. The ELISA plate was rinsed 3 times with wash buffer (using a Skatron Scan Washer 300). 100 μl of cell lysate was transferred to each capture ELISA plate well using a new pipette tip for each transfer. Plates were incubated for 2 hours at room temperature with gentle agitation. A 1: 1000 dilution of biotinylated 4G10 (secondary Ab; secondary antibody; 4 ° C.) was prepared in assay buffer. Each well was rinsed 10 times with wash buffer. 100 μl of secondary Ab was added to each well and then incubated for 2 hours at room temperature with gentle agitation. The plate was washed 6 times with wash buffer. A 1: 50000 dilution of streptavidin / HRP was prepared in assay buffer. 100 μl of diluted StrAv / HRP was added to each well and then incubated with gentle agitation for 1 hour at room temperature. The plate was washed 6 times with wash buffer. To each well, 100 μl of substrate solution: 1 volume of K & P TMB substrate and 1 volume of K & P TMB peroxide solution were added. The reaction color was developed for 15 minutes and then the color development was quenched by the addition of 50 μl 1.0 MH ₃ PO ₄ . O. for each well. D. (450 nm) was read. FIG. 13 shows the results of activation using three different agonist antibodies--in this case, the antibody was raised against the gD flrag epitope, but the α subunit oligomerization and subsequent tyrosine kinase domain (Rse region) ) Activation could be induced.

(Deposition of materials)
The following materials were deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, MD, USA (ATCC).

This deposit was made under the provisions of the Budapest Treaty on the International Approval of Deposits of Microorganisms in Patent Procedures and Regulations Based on the Treaty (Budapest Treaty). This ensures maintenance of possible culture viability of the deposit for at least 30 years from the date of deposit. The deposits will be sold by the ATCC under the terms of the Budapest Treaty and can be found at Genentech, Inc. Subject to an agreement between the U.S. and ATCC, this deposit will be issued upon the issuance of an appropriate U.S. patent, whichever one will be published first when any U.S. patent application or foreign patent application is published publicly, Ensure that the progeny of the culture of the deposit are publicly available without limitation and by the Commissioner of the United States Patent and Trademark Office Guarantee the availability of this offspring to those determined to grant rights in accordance with US Patent Enforcement Regulations Section 1.14 (including in particular 886OG638).

If the culture of the deposited material is killed, lost or destroyed when cultivated under the appropriate conditions, this culture will be sent to the same another culture in response to the notice. The assignee of this patent application agreed to be replenished quickly. The availability of deposits should not be construed as a license to practice the invention in violation of the rights assigned in accordance with its patent law under any government agency authority.

The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention should not be limited in scope by the deposited construct. The deposited embodiments are intended as an illustration of certain aspects of the invention, and any construct that is functionally equivalent is within the scope of the invention. The material deposits herein are unsuitable for the description contained herein (including its best mode) to be able to practice any aspect of the invention. It does not constitute an authentication, nor is it construed to limit the scope of the claims to the specific illustrations it shows. In fact, in addition to those shown and described herein, various modifications of the present invention will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims.

1A-B show the nucleotide sequence and deduced amino acid sequence of the native sequence of mouse GFRα3. FIG. 2 shows an alignment of the amino acid sequences of mouse GFRα3 (SEQ ID NO: 5), rat GFRα1 (SEQ ID NO: 8), and rat GFRα2 (SEQ ID NO: 9). N-terminal signal peptide is shown. A line is placed above the C-terminal hydrophobic sequence associated with the GPI anchor. An asterisk indicates an amino acid for GPI anchor attachment. Potential glycosylation sites are indicated by shaded boxes. The conserved identical residues are boxed. FIG. 3 shows an alignment comparison between the mouse GFRα3 amino acid sequence and the human GFRα3 amino acid sequence. The conserved residue is boxed. FIG. 4 shows an alignment comparison between human GFRα3 (from DNA48613) and its splice variant (from DNA48614). Surround the saved array with a square. A 30 amino acid deletion sequence is shown. 5A-B show a DNA sequence encoding human GFRα3 (SEQ ID NO: 14), a DNA encoding human GFRα1 (SEQ ID NO: 6) and a DNA encoding human GFRα2 (SEQ ID NO: 7), respectively. The nucleic acid sequence alignment with (SEQ ID NO: 22) is shown. FIG. 6 shows an amino acid sequence alignment of human GFRα3 (SEQ ID NO: 15), human GFRα1 (SEQ ID NO: 6), and human GFRα2 (SEQ ID NO: 7). FIG. 7 shows a Northern blot of multiple tissues using GFRα3 as a probe. FIG. 8 compares RNA expression localization determined by in situ hybridization using DNA probes specific for GFRα1, GFRα2 and GFRα3. FIGS. 9A-C show ligand binding (rat GDNF, human neuturin (NTN), or human percefin (PSN) to IgG-tagged receptors GFRα1 (FIG. 9A), GFRα2 (FIG. 9B), or GFRα3 (FIG. 9C). )) Result. FIGS. 9A-C show ligand binding (rat GDNF, human neuturin (NTN), or human percefin (PSN) to IgG-tagged receptors GFRα1 (FIG. 9A), GFRα2 (FIG. 9B), or GFRα3 (FIG. 9C). )) Result. FIGS. 9A-C show ligand binding (rat GDNF, human neuturin (NTN), or human percefin (PSN) to IgG-tagged receptors GFRα1 (FIG. 9A), GFRα2 (FIG. 9B), or GFRα3 (FIG. 9C). )) Result. FIG. 10 shows amplification of cells expressing recombinant chimeric GFRα2-mpl in response to NTN or GDNF. FIG. 11 shows autophosphorylation of recombinantly expressed receptor GFRα2-Rse in response to NTN. FIG. 12 shows an assay for stimulation of the receptors GFRα2 or GFRα3 by GDNF, NTN, or PSN. FIG. 13 shows the agonist activity of various anti-gD antibodies in the gD-GFRα2-RseKIRA assay.

Claims (62)

(A) a nucleic acid molecule encoding a GFRα3 (glial cell line-derived neurotrophic factor family receptor α-3) polypeptide comprising the sequence of amino acids 27 to 369 of SEQ ID NO: 17, or (b) complementation of the nucleic acid molecule of (a) An isolated nucleic acid comprising a nucleic acid having at least 65% sequence identity to the body. (A) having at least 65% sequence identity to a nucleic acid molecule encoding a GFRα3 polypeptide comprising the sequence of amino acids 1 to 379 of SEQ ID NO: 17, or (b) the complement of the nucleic acid molecule of (a) 2. The isolated nucleic acid of claim 1 comprising a nucleic acid. At least 75% of the nucleic acid sequence relative to (a) a nucleic acid molecule encoding a GFRα3 polypeptide comprising the sequence of amino acids 27 to 369 of SEQ ID NO: 17, or (b) the complement of the nucleic acid molecule of (a) 2. The nucleic acid of claim 1 having identity. The isolated nucleic acid of claim 1, comprising a nucleic acid encoding a GFRα3 polypeptide having amino acid residues 27 to 369 of SEQ ID NO: 17. 2. The isolated nucleic acid of claim 1, comprising DNA encoding a GFRα3 polypeptide having amino acid residues 1-369 of SEQ ID NO: 17. At least 65 to (a) a nucleic acid molecule encoding the same mature polypeptide encoded by the cDNA in ATCC Deposit No. 209751 (named DNA 48614-1268), or (b) the complement of the DNA molecule of (a). An isolated nucleic acid comprising a nucleic acid having% sequence identity. 7. The isolated nucleic acid of claim 6, comprising the GFRα3 coding sequence of the cDNA in ATCC Accession No. 209751 (named DNA 48614-1268), or a sequence that hybridizes under stringent conditions to that sequence. (A) having at least 65% sequence identity to a nucleic acid molecule encoding a GFRα3 polypeptide comprising the sequence of amino acids 84-329 of SEQ ID NO: 17, or (b) the complement of the nucleic acid molecule of (a) An isolated nucleic acid, including a nucleic acid. A GFRα3 code that hybridizes under stringent conditions to (a) a nucleic acid molecule encoding a GFRα3 polypeptide comprising the sequence of amino acids 84-329 of SEQ ID NO: 17, or (b) the complement of the nucleic acid molecule of (a) 9. The isolated nucleic acid of claim 8, comprising a sequence. A vector comprising the nucleic acid according to claim 1. 11. The vector of claim 10, operably linked to a regulatory sequence recognized by a host cell transformed with the vector. A host cell comprising the vector of claim 10. The cells are CHO cells, E. coli; The host cell according to claim 12, which is an E. coli or yeast cell. A method for producing a GFRα3 polypeptide comprising culturing a host cell according to claim 12 under conditions suitable for expression of GFRα3, and recovering GFRα3 from the cell culture. A polypeptide comprising a sequence having at least 65% sequence identity with amino acid residues 84-329 of SEQ ID NO: 17. 16. A polypeptide according to claim 15, which is an isolated native sequence GFRα3 polypeptide. The polypeptide of claim 16, comprising amino acid residues 27 to 369 of SEQ ID NO: 17. 16. A chimeric molecule comprising the GFRα3 polypeptide of claim 15 fused to a heterologous amino acid sequence. 19. The chimeric molecule of claim 18, wherein the heterologous amino acid sequence is an epitope tag sequence. 19. The chimeric molecule of claim 18, wherein the heterologous amino acid sequence is an immunoglobulin Fc region. An antibody that specifically binds to the GFRα3 polypeptide of claim 15. The antibody of claim 21, which is an agonist antibody. Use of the antibody according to claim 21 for treating peripheral neuronal disorders. A method for measuring agonist binding to a polypeptide comprising an agonist binding domain of an α-subunit receptor, comprising exposing the polypeptide located in a cell membrane to a candidate agonist, and a homodimer of the polypeptide Measuring the conversion or homo-oligomerization. 25. The method of claim 24, wherein the [alpha] -subunit receptor is a GFR [alpha] -receptor. The polypeptide further comprises a dimerization activating enzyme domain or an oligomerization activating enzyme domain, and homodimerization or homooligomerization is detected by measuring the enzymatic activity of the polypeptide; 25. A method according to claim 24. 27. The enzyme domain is an intracellular autocatalytic domain of a receptor tyrosine kinase, and homodimerization or homooligomerization is detected by measuring autophosphorylation of the polypeptide. the method of. A method for measuring autophosphorylation of a polypeptide receptor construct comprising a ligand binding domain of an α-subunit receptor, an intracellular catalytic domain of a tyrosine kinase receptor, and a flag epitope, comprising the following steps: (a) a eukaryote Coating the first solid phase with a uniform population of cells such that the cells attach to the first solid phase, wherein the cells are located within the membrane of the polypeptide receptor construct. Having a process;
(B) exposing the attached cells to the analyte;
(C) lysing the attached cells, thereby releasing the cell lysate from the cells;
(D) coating the second solid phase with the capture agent such that a capture agent that specifically binds to the flag epitope is attached to the second solid phase;
(E) exposing the attached capture agent to the cell lysate obtained in step (c) such that the receptor construct is attached to the second solid phase;
(F) washing the second solid phase to remove unbound cell lysate;
(G) exposing the attached receptor construct to an anti-phosphotyrosine antibody that identifies a phosphorylated tyrosine residue in the tyrosine kinase receptor; and (h) the anti-phosphotyrosine to the attached receptor construct. Measuring the binding of the antibody. 29. The method of claim 28, wherein the cell is transformed with a nucleic acid encoding the receptor construct prior to step (a). 30. The method of claim 28, wherein the cell comprises a mammalian cell line. 30. The method of claim 28, wherein the cell is adherent. 30. The method of claim 28, wherein the capture agent comprises a capture antibody. 30. The method of claim 28, wherein the first solid phase comprises a well of a first assay plate. 30. The method of claim 28, wherein the anti-phosphotyrosine antibody is labeled. 35. The method of claim 34, wherein the label comprises an enzyme exposed to a chromogenic reagent, and the color change of the chromogenic reagent is measured in step (h). 30. The method of claim 28, wherein the flag polypeptide is fused to the amino terminus of the [alpha] -subunit receptor ligand binding domain. 29. The method of claim 28, wherein the flag polypeptide is fused to the carboxyl terminus of the tyrosine kinase receptor intracellular catalytic domain. 29. The method of claim 28, wherein the tyrosine kinase receptor is an Rse receptor, trk A receptor, trk B receptor or trk C receptor. 30. The method of claim 28, wherein the [alpha] -subunit receptor is a GFR [alpha] -receptor. 40. The method of claim 38, wherein the receptor construct further comprises a transmembrane domain of the Rse receptor and the flag epitope comprises the gD polypeptide. 30. The method of claim 28, wherein the analyte comprises an agonist for the [alpha] -subunit receptor. 30. The method of claim 28, wherein the analyte comprises an antagonist for the [alpha] -subunit receptor. The antagonist competitively inhibits binding or activation of the α-subunit receptor by an agonist to the α-subunit receptor, and after step (b), the attached cells are exposed to the agonist. 43. The method of claim 42, wherein the process continues. The antagonist is a composition comprising an antagonist and an agonist for the α-subunit receptor, and the assay binds to the agonist and thereby reduces activation of the polypeptide construct by the agonist. 30. The method of claim 28, wherein the ability is measured. A method for measuring autophosphorylation of a polypeptide receptor construct comprising a ligand binding domain of an α-subunit receptor, an intracellular catalytic domain of a tyrosine kinase receptor, and a flag epitope comprising the following steps: (a) attachment Coating the well with a uniform population of cells such that the sex cells attach to the wells of the first assay plate, wherein the cells are located within the cell membrane of the polypeptide receptor construct. Having a process;
(B) exposing the attached cells to the analyte;
(C) lysing the attached cells, thereby releasing the cell lysate from the cells;
(D) coating the well with the capture agent such that a capture agent that specifically binds to the polypeptide receptor construct attaches to a well of a second assay plate;
(E) exposing the attached capture agent to the cell lysate obtained in step (c) such that the polypeptide construct is attached to the well;
(F) washing the well to remove unbound cell lysate;
(G) exposing the attached polypeptide receptor construct to an anti-phosphotyrosine antibody that selectively binds to a phosphorylated tyrosine residue in the polypeptide receptor construct; and (h) the attached poly receptor. Measuring the binding of the anti-phosphotyrosine antibody to a peptide receptor construct. 46. The method of claim 45, wherein the [alpha] -subunit receptor is a GFR- [alpha] receptor. A polypeptide comprising a ligand binding domain of an α-subunit receptor, a flag polypeptide, and an intracellular catalytic domain of a tyrosine kinase receptor. 48. The polypeptide of claim 47, wherein the flag polypeptide comprises a gD flag epitope. 48. The polypeptide of claim 47, wherein the tyrosine kinase receptor is an Rsc receptor. 50. The polypeptide of claim 49, further comprising a transmembrane domain of the Rse receptor. 48. The polypeptide of claim 47, wherein the [alpha] -subunit receptor is a GFR [alpha] receptor. A kit comprising a solid phase coated with a capture agent that specifically binds to a flag polypeptide, and a polypeptide comprising a ligand binding domain of an α-subunit receptor, a flag polypeptide, and an intracellular catalytic domain of a tyrosine kinase receptor. . 53. The kit of claim 52, wherein the solid phase comprises a microtiter plate well. 54. The kit of claim 52, further comprising a labeled anti-phosphotyrosine antibody. 55. The kit of claim 54, wherein the label comprises an enzyme. 53. The kit of claim 52, further comprising a cell transformed with a nucleic acid encoding a polypeptide comprising a ligand binding domain of an α-subunit receptor, a flag polypeptide, and an intracellular catalytic domain of a tyrosine kinase receptor. An assay for measuring phosphorylation of a polypeptide receptor construct comprising a ligand binding domain of an α-subunit receptor, an intracellular catalytic domain of a kinase receptor, and a flag epitope comprising the following steps: (a) a eukaryote Coating the first solid phase with a uniform population of cells such that the cells attach to the first solid phase, wherein the cells comprise the polypeptide receptor construct;
(B) exposing the attached cells to the analyte;
(C) lysing the attached cells, thereby releasing the cell lysate from the cells;
(D) coating the second solid phase with the capture agent such that the capture agent that specifically binds to the flag polypeptide is attached to the second solid phase;
(E) exposing the attached capture agent to the cell lysate obtained in step (c) such that the receptor construct is attached to the second solid phase;
(F) washing the second solid phase to remove unbound cell lysate;
(G) exposing the attached kinase construct to an antibody that identifies a phosphorylated residue in the receptor construct; and (h) binding of the antibody to the attached receptor construct. Measuring. Comprising assaying. 58. The assay of claim 57, wherein the [alpha] -receptor is a GFR [alpha] -receptor. 58. The assay of claim 57, wherein the kinase receptor is a serine-threonine kinase receptor. 58. The assay of claim 57, wherein phosphatase activity is measured. 61. The assay of claim 60, wherein the eukaryotic cell further comprises a phosphatase and further comprising exposing the cell to a phosphatase inhibitor prior to step (c). Between steps (f) and (g) further comprising exposing the attached kinase construct to phosphatase and then washing the second solid phase to remove unbound phosphatase. 61. The assay of claim 60.

Images