JP2009139302A - Method of detecting cancer - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To find a cancer marker which is superior in sensitivity with respect to a cancer, and to provide a method of detecting cancer based on the cancer marker and a kit for detecting the cancer. <P>SOLUTION: In a humor analyte, all or a part of protein of the DLD (dihydrolipoamide dehydrogenase) or an antibody to all or a part of the protein is detected; and if the detected value of the protein or increased detected value corresponding to the amount of the protein or antibody is larger than the standard detection value, or if it is detected despite no detection in the standard, these are set as index for the existence of the cancer or progression of the cancer, determined immediately or temporally for a subject. By providing this method for detecting cancer or the kit for detecting the cancer, the problem is solved. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a cancer detection method and a cancer detection kit based on the method. More specifically, cancer is diagnosed by detecting a specific biological protein or an autoantibody of the biological protein, and further, monitoring the prognosis of cancer treatment and screening for sensitivity to anticancer agents. It is invention regarding the detection method of cancer which can be performed, and the kit for cancer detection based on the said method.

  Efforts are being made to conquer cancer, and its treatment continues to advance. However, cancer remains the leading cause of death and remains one of the most serious diseases. The most important factor for the treatment of cancer has not changed at all in the early detection, and many cancer diagnosis methods have been provided.

  As a main method for diagnosing cancer, diagnosis by so-called cancer markers can be mentioned. This is a method of detecting cancer by detecting that specific proteins in body fluid samples such as blood samples and urine samples change, appear, disappear or change due to the presence of cancer, and use these as indicators. is there.

  In particular, a form in which proteins in body fluids that increase with cancer are used as indicators is widely known. That is, it is known that many kinds of cellular proteins are present in increased amounts in the body fluids of various cancer patients [Gold P. et al., 1965, J. Exp. Med. 121: 439- 462 (Non-Patent Document 1); Gold P. et al., 1965, J. Exp. Med. 121: 467-481 (Non-Patent Document 2); Bast RC. Jr. et al., 1983, N. Engl. J. Med. 309: 883-887 (Non-Patent Document 3); Barry MJ., 2001, N. Engl. J. Med. 344: 1373-1377 (Non-Patent Document 4)], cells in such cancer patients Due to the increase in the level of sex protein, the quantitative value or qualitative result of the cellular protein in the body fluid sample is used as an indicator of cancer presence (cancer marker). For example, elevated serum levels of prostate specific antigen (PSA) are commonly used as an indicator of the presence of human prostate cancer.

  Recently, attempts have been made to use “autoantibodies” as cancer markers. In autoimmune diseases and cardiovascular diseases, it is known that autoantibodies against normal or modified cellular proteins can be produced by patients themselves before showing obvious symptoms. In addition, antibodies against many intracellular and surface antigens have been identified in various cancer patients and reported for humoral immune responses against human cancer [Gourevitch et al., 1995, Br. J. Cancer 72: 934-938 (Non-Patent Document 5); Yamamoto et al., 1996, Int. J. Cancer, 69: 283-289 (Non-Patent Document 6); Stockert et al., 1998, J.Exp Med. 187: 1349-1354 (non-patent document 7); Gure et al., 1998, Cancer Res. 58: 1034-1041 (non-patent document 8)]. For example, changes in the somatic p53 gene are known to cause a humoral immune response in 30-40% of affected patients (Soussi, 1996, Immunol. Today 17: 354-356: non-patented). Reference 9). It has also been reported that detection of anti-p53 antibodies precedes the diagnosis of cancer [Lubin et al., 1995, Nat. Med. 7: 701-702 (Non-patent Document 10); Cawley et al., 1998 , Gastroenterology 115: 19-27 (Non-Patent Document 11)]. In addition, US Pat. No. 5,405,749 (Patent Document 1) discloses a screening method for retinal disease autoantigens caused by cancer and a method for testing patient sera for autoantibodies against self antigens. In addition, it has been reported that increased relative synthesis rates of tumor cytoskeletal proteins were observed on the surface of leukemia cells, mutagens and lymphocytes transformed with Epstein-Barr virus (Bachvaroff, RJ et al. al., 1980, Proc. Natl. Acad. Sci. 77: 4979-4983: Non-patent document 12).

Most of the cancer-derived antigens that cause humoral immune responses that have been identified to date do not include the products of mutant genes, but include various antigens and gene products that are overexpressed in tumors (Old and Chen, 1998, J. Exp. Med. 187: 1163-1167: Non-patent document 13). However, it is not clear why the humoral response to individual antigens is observed only in certain types of cancer patients.
US Pat. No. 5,405,749 Gold P. et al., 1965, J. Exp. Med. 121: 439-462 Gold P. et al., 1965, J. Exp. Med. 121: 467-481 Bast RC.Jr.et al., 1983, N.Engl.J.Med.309: 883-887 Barry MJ., 2001, N.Engl.J.Med.344: 1373-1377 Gourevitch et al., 1995, Br. J. Cancer 72: 934-938 Yamamoto et al., 1996, Int. J. Cancer, 69: 283-289 Stockert et al., 1998, J. Exp. Med. 187: 1349-1354 Gure et al., 1998, Cancer Res. 58: 1034-1041 Soussi, 1996, Immunol. Today 17: 354-356 Lubin et al., 1995, Nat. Med. 7: 701-702 Cawley et al., 1998, Gastroenterology 115: 19-27 Bachvaroff, RJet al., 1980, Proc. Natl. Acad. Sci. 77: 4979-4983 Old and Chen, 1998, J. Exp. Med. 187: 1163-1167 James C., 1973, J. Bacteriol., 115: 1-8 Maeda T. et al., 1991, Hepatol. 6: 994-999 Tanaka H., et al., 1995, Liver 15: 121-125 Tontsch D. et al., 2000, Clin. Exp. Immunol. 121: 270-274 Wu Y.-Y. et al., 2002, Clin. Exp. Immunol. 128: 347-352

  As described above, the problem to be solved by the present invention is to find a cancer marker having excellent sensitivity, and to provide a cancer detection method and a cancer detection kit based on the cancer marker.

  As a result of studies on cancer markers, the present inventors have found that DLD (dihydrolipoamide dehydrogenase) is an in vivo protein that can be a very useful cancer marker, and have completed the present invention. In the DLD, for example, “autoantibody” or “non-antibody protein” can be used as a cancer marker.

  That is, the present invention detects DLD (dihydrolipoamide dehydrogenase) protein all or part of a body fluid sample, or antibodies against all or part of the protein, and increases according to the amount or amount of the protein. If the detected values are greater than the standard detected values, or if detected but not detected by the standard, these are detected immediately or over time of the presence of cancer in the subject or progression to cancer It is an invention that provides a cancer detection method (hereinafter also referred to as the present detection method) and a cancer detection kit (hereinafter also referred to as the present detection kit) for carrying out the present detection method, as typical indicators. .

  The term “body fluid specimen” literally means a human body fluid itself or a specimen provided by subjecting a body fluid to an appropriate treatment, and typically includes a blood specimen, lymph fluid, peritoneal fluid, Examples include pleural effusion, urine and saliva. Among these, the most suitable is a blood sample. As the blood sample, serum or plasma is mentioned as appropriate, and as the most appropriate blood sample, serum is mentioned. The “antibody” substantially means the above-mentioned “autoantibody” found in a body fluid sample in relation to cancer, and is not limited to a class or subclass at all.

  The cancer to be detected by this detection method is not particularly limited. Specific examples include uterine cancer, ovarian cancer, fallopian tube cancer, vulvar cancer, uterine sarcoma, and the like. Among these, uterine cancer (cervical cancer or endometrial cancer) is suitable as a detection target of the present invention, and particularly suitable for detection of cervical cancer. Cervical cancer is classified into cervical squamous cell carcinoma or cervical adenocarcinoma. In the present invention, both are referred to as “cervical cancer”.

  To describe recent trends in uterine cancer, cervical cancer has an increasing tendency in both younger morbidity and mortality, and endometrial cancer has an increasing tendency regardless of age. In uterine cancer screening, only cervical cancer cytology is often performed, and uterine cancer screening is rarely performed together. Furthermore, the current rate of cervical cancer screening in Japan is lower than in Europe and the United States. Uterine cancer, like other cancers, has good treatment results when detected early, so the establishment of highly sensitive and accurate diagnostic methods and improvement in the screening rate are the current issues. For that purpose, in addition to the biological tissue examination, a tumor marker examination in a body fluid, which is a simple examination method, is extremely useful. However, existing tumor markers are not sufficiently specific and sensitive.

  In this detection method, when the detection target is (1) “autoantibodies” against DLD produced in the body, that is, in the above detection method, the detection target is “the protein of DLD in the body fluid sample”. When “all or part of the antibody” is selected (also referred to as this detection method 1), or (2) “DLD itself” (non-antibody protein) produced in the body, that is, the above-described main detection. In the method, when “all or part of the protein of DLD in the body fluid specimen” is selected as the detection target (also referred to as the present detection method 2), it is roughly classified. Similarly, this detection kit is roughly divided into a main detection kit 1 related to DLD autoantibodies and a main detection kit 2 related to DLD itself.

(A) This detection method 1
As described above, the “self-antigen protein” in the present detection method 1, that is, the protein serving as the antigen of the autoantibody to be detected is DLD (dihydrolipoamide dehydrogenase) which is a protein derived from a living body. Here, “protein” includes not only those in which only amino acids are peptide-bonded but also those modified with sugar chains, phosphate groups, methyl groups, acetyl groups, etc. with this as the main chain. And In particular, proteins that serve as cancer autoantigens are relatively likely to be such modified proteins, and the antigenic determinants of autoantibodies in body fluid samples such as blood may contain these modified molecules. .

  DLD (dihydrolipoamide dehydrogenase) is known to be involved in pyruvate metabolism and TCA cycle, as well as amino acid metabolism (James C., 1973, J. Bacteriol., 115: 1-8 (Non-Patent Document 14)). In relation to disease, autoantibodies against DLD are known to increase in primary biliary cirrhosis, rheumatic heart disease, and hepatitis C virus infection (Maeda T. et al., 1991, Hepatol. 6: 994-999 (Non-Patent Document 15); Tanaka H., et al., 1995, Liver 15: 121-125 (Non-Patent Document 16); Tontsch D. et al., 2000, Clin. Exp. Immunol. 121: 270-274 (Non-patent document 17); Wu Y.-Y. et al., 2002, Clin. Exp. Immunol. 128: 347-352 (Non-patent document 18)). However, the relationship between DLD autoantibodies and the onset of these diseases is unclear. In addition, there is no report on the relationship between DLD and cancer.

  In addition, the base sequence of the DLD gene (SEQ ID NO: 1) and the amino acid sequence of the DLD protein (SEQ ID NO: 2) have been published (GenBank Accession No. J03620).

  In the present invention, all or part of the above-mentioned autoantigen protein is used as an essential element in performing the present detection method 1. Note that the whole of the protein literally means that the entire amino acid sequence of the protein that has been published is included, and as described above, the whole protein that includes the entire amino acid sequence in part. Modified forms are also included. The term “part of the protein” means a modified protein in which a part of the entire amino acid sequence of the protein that has been published is deleted, substituted, or a heterologous amino acid sequence is inserted. In the present invention, any protein that specifically binds to an autoantibody present in a body fluid sample due to cancer corresponds to “all or part of the self-antigen protein”. It is already recognized by those skilled in the art (a person skilled in the art) that such amino acid sequence modification is performed without changing the essential antigenicity of the protein. Therefore, no special effort as a person skilled in the art is required to make the modification.

  The origin of the self-antigen protein in the present invention is not particularly limited, but considering that DLD is a trace protein, it is not an extract from a natural product but a recombinant protein produced by genetic engineering. It is natural and preferred. The production of this recombinant protein can be performed by a conventional method. For example, a primer for gene amplification is prepared based on the information on the gene sequence encoding the above-described self-antigen protein, and the primer for amplification is prepared. Based on the above, a gene amplification method such as PCR is performed using, for example, human genomic DNA, cancer cell genomic DNA, mRNA, etc. as a template, and gene amplification products obtained thereby from bacteria, insect cells, mammalian cells, etc. It is possible to obtain a desired autoantigen protein produced from the transformant by transforming a selected host cell and purifying it by a conventional purification means. At this time, if necessary, various amino acid modification means can be performed at the gene level to produce the modified protein described above. In consideration of the possibility that the antigenic determinant of the autoantibody in a body fluid sample such as blood contains a modifying molecule, the host cell is preferably a mammalian cell or an insect cell.

  In the present detection method 1, a DLD protein is brought into contact with a body fluid sample of a subject, whereby an autoantigen protein corresponding to the autoantibody in the body fluid sample is bound by an antigen-antibody reaction. By detecting the binding, the presence of autoantibodies serving as an indicator of cancer in the body fluid sample can be found quantitatively or qualitatively. As long as the detection method 1 is an embodiment capable of detecting autoantibodies in a body fluid sample, the specific detection method is not particularly limited, and a solid phase method or a batch method can be selected. Although possible, it is generally preferred to use a solid phase method. Specific methods that can be carried out include Western blotting, radioimmunoassay, enzyme immunoassay such as ELISA, immunoprecipitation measurement, precipitation reaction, gel diffusion measurement, latex agglutination, turbidimetry, Examples include complement binding assay, immunoradiometric assay, flow cytometry, multiplex assay using Luminex, microchip method, fluorescence immunoassay, protein A immunoassay, and the like.

  The detection signal is not particularly limited, and chromogenic enzymes such as horseradish peroxidase and alkaline phosphatase (by EIA and ELISA); fluorescent dyes such as fluorescein isothiocyanate, rhodamine, Cy3 and phycoerythrin; luminescent dyes such as luciferin, luciferase and aequorin Or a radioisotope (by RIA) or the like can be selected as necessary. Specifically, examples of the signal element include anti-human antibodies labeled with these detection signals. In addition, latex particles carrying a self-antigen protein can be used as a signal element for detecting turbidity that changes by agglutination according to the amount of autoantibodies in a body fluid sample. It is also possible to detect autoantibodies by labeling the self-antigen protein and using a reverse sandwich method or the like.

  When a positive signal for DLD in this body fluid sample is detected, that is, in the body fluid sample, the detection value that increases according to the amount of autoantibodies to be detected is greater than the standard detection value, or If detected in spite of not being detected by the standard, this indicates that the subject is at high risk of cancer. “A high risk of cancer” means that when the detection method 1 or the detection kit 1 is applied in the process of performing an initial screening for cancer, that is, when the detection method 1 or the detection kit 1 is applied. This means that there is a high possibility of being in a precancerous state. Further, when considered as a temporal index (monitoring index), that is, when the present detection method 1 or the present detection kit 1 is applied to a patient who has already been treated for cancer such as surgery or chemotherapy, It means that recurrence or deterioration is foreseen or detected, and further that the effect of the anticancer agent is not recognized.

  This detection kit 1 is a cancer detection kit for carrying out this detection method 1, which contains at least a DLD autoantigen protein as an essential element.

(B) This detection method 2
The present detection method 1 is intended to detect cancer by measuring DLD autoantibodies, whereas the present detection method 2 is present in a DLD protein itself in a living body, that is, a body fluid sample or the like. It is characterized in that the “self-antigen protein” itself is measured and cancer is detected using this as an index. Therefore, in vivo DLD proteins to be detected are those modified with sugar chains, phosphate groups, methyl groups, acetyl groups, etc. in addition to those in which only amino acids are peptide-bonded. Is also included.

  As a precondition for obtaining an antibody (monoclonal antibody or polyclonal antibody) against the DLD protein used in this detection method 2, it is necessary to select and use an appropriate immune antigen. In the present invention, it is preferable to use a recombinant DLD protein as an immunizing antigen. The recombinant DLD is obtained by directly applying a gene amplification method such as a PCR method to a human genomic DNA based on the already known base sequence of the DLD gene. Genes can be obtained.

  In other words, a large amount of DLD gene should be amplified and obtained by gene amplification method such as PCR method using genomic DNA as a template and DNA fragment containing sequences of 5 'end and 3' end of DLD gene as primers. You can also.

  Furthermore, the DLD gene can be chemically synthesized using a generally known method such as the phosphite-triester method (Ikehara, M., et al., Proc. Natl. Acad. Sci. USA, 81, 5956 (1984)). It is also possible to synthesize, and the DLD gene can also be synthesized using a DNA synthesizer to which such a chemical synthesis method is applied.

  Using the DLD gene that can be obtained as described above, a recombinant DLD protein can be produced according to a general gene recombination technique and used as an immune antigen of an antibody.

  More specifically, the DLD gene is incorporated into a gene expression vector in an expressible form, the DLD gene is incorporated, and the recombinant vector is introduced into a host corresponding to the properties of the gene expression vector and transformed. The desired DLD can be produced by culturing the transformant or the like.

  As an immunizing antigen of an antibody, all or part of DLD obtained as described above can be used. Further, for example, when the DLD to be used has a small molecular weight as in the case where a part of the DLD is used as an antigenic determinant, the DLD bound to the hapten can be used as an immune antigen as necessary.

  In order to produce antibodies, animals immunized with the immunizing antigen obtained as described above are not particularly limited, and mice, rats, rabbits, etc. can be widely used and used for cell fusion. It is desirable to select in consideration of compatibility with myeloma cells.

  Immunization can be performed by a general method, for example, by administering the immunizing antigen to an animal to be immunized intravenously, intradermally, subcutaneously, intraperitoneally, or the like. More specifically, the immunizing antigen is used in combination with a normal adjuvant if desired, and is administered to an animal to be immunized several times by the above method every about two weeks, and then a polyclonal antibody or a monoclonal antibody Immune cells for production, such as post-immunization spleen cells, can be obtained.

  In the case of producing a monoclonal antibody, myeloma cells as the other parent cells to be fused with the immune cells are already known, for example, SP2 / 0-Ag14, P3-NS1-1-Ag4-1, MPC11- 45,6. TG 1.7 (from the mouse); 210. RCY. Ag1.2.3 (rat origin); SKO-007, GM 15006TG-A12 (above, human origin), etc. can be used.

Cell fusion between the above immune cells and the myeloma cells is performed according to a generally known method such as the method of Kohler and Milstein (Kohler, G. and Milstein, C., Nature , 256 , 495 (1975)). It can be carried out.

  More specifically, this cell fusion is carried out by using an auxiliary agent such as dimethyl sulfoxide in order to improve the fusion efficiency in the presence of a commonly known fusion promoter such as polyethylene glycol (PEG) or Sendai virus (HVJ). Hybridomas are prepared by carrying out in a normal culture medium added as necessary.

  Separation of a desired hybridoma can be performed by culturing in a normal selection medium such as HAT (hypoxanthine, aminopterin and thymidine) medium. That is, the hybridoma can be separated by culturing in this selection medium for a time sufficient for cells other than the target hybridoma to die. The hybridoma obtained in this way can be subjected to the search for a monoclonal antibody of interest and single cloning by the usual limiting dilution method.

  The target monoclonal antibody-producing strain can be searched according to a general search method such as ELISA method, plaque method, spot method, agglutination method, octalony method, RIA method.

  The hybridoma producing a monoclonal antibody against the DLD protein thus obtained can be subcultured in a normal medium, and can also be stored for a long time in liquid nitrogen.

  Monoclonal antibodies are collected from hybridomas by culturing the hybridoma according to a conventional method and obtaining it as a culture supernatant, or by administering the hybridoma to a compatible animal and allowing it to proliferate and obtaining it as ascites. Can be used.

In addition, immune cells are cultured in vitro in the presence of DLD protein or a part thereof, and after a certain period of time, a hybridoma of this immune cell and myeloma cell is prepared using the above cell fusion means, and antibody-producing hybridomas are screened To obtain monoclonal antibodies (Reading, CL, J. Immunol. Meth. , 53, 261 (1982); Pardue, RL, et al., J. Cell Biol., 96 , 1149 (1983)) .

  The monoclonal antibody obtained as described above can be further purified by ordinary means such as salting out, gel filtration, affinity chromatography and the like.

  In addition, an artificial antibody having reactivity specific to DLD can be obtained by using a genetic engineering technique exemplified by the phage display method (McGafferty J. et al., 1990, Nature 348: 552-). 554; Clackson T. et al., 1991, Nature 352: 624-628).

  The monoclonal antibody thus obtained is an antibody having specific reactivity with DLD. The phrase “having specific reactivity with DLD” means that the monoclonal antibody exhibits cross-reactivity with at least human DLD.

  The antibody against the DLD protein thus obtained can be labeled with a labeling substance as necessary and used in the present detection method 2 and the like.

The labeling substance is a labeling substance that provides a detectable signal by reacting the labeling substance alone or with another substance. Specifically, for example, horseradish peroxidase, alkaline phosphatase, β -Enzymes such as D-galactosidase, glucose oxidase, glucose-6-phosphate dehydrogenase, alcohol dehydrogenase, malate dehydrogenase, penicillinase, catalase, apoglucose oxidase, urease, luciferase or acetylcholinesterase, fluorescein isothiocyanate, phycobiliprotein, rare earth metal chelate, dansyl chloride or fluorescent substances such as tetramethylrhodamine isothiocyanate, ¹²⁵ I, ¹⁴ C, ³ radioisotopes such as H, biotin, Avidin or chemicals such Jigokeshigenin, or chemiluminescent substances, and the like.

  As a method for labeling an antibody with these labeling substances, a known labeling method can be appropriately used according to the type of labeling substance to be selected.

  In addition, antibodies against DLD proteins (including those labeled) can also be used as immobilized antibodies in which they are immobilized on an insoluble carrier.

  The antibody can be used by immobilizing on an insoluble carrier, if necessary. As such an insoluble carrier, various insoluble carriers already used as an insoluble carrier for antibodies can be used. Specifically, for example, a plate represented by a microplate, a test tube, a tube, a bead, a ball, a filter, a membrane, or a cellulose carrier, an agarose carrier, a polyacrylamide carrier, a dextran carrier, a polystyrene carrier, Examples include insoluble carriers used in affinity chromatography such as polyvinyl alcohol carriers, polyamino acid carriers, and porous silica carriers.

  The antibody immobilization method in these insoluble carriers can be appropriately selected from the antibody immobilization methods already established in various insoluble carriers depending on the type of insoluble carrier to be selected.

  The direct or indirect binding between the antibody against the DLD protein thus prepared and DLD present in a body fluid sample or the like is measured, and the increase in the measured value or the qualitative presence is used as an indicator for cancer. Can be detected. The specific mode will be described later.

  The present invention provides a sensitive cancer detection method and detection kit capable of detecting cancer, particularly uterine cancer, using a DLD autoantibody or DLD protein in a body fluid specimen as a cancer marker. .

<This detection method 1>
As described above, the detection method 1 is preferably performed by a solid phase method. In this case, the target to be immobilized is preferably all or a part of the above-mentioned autoantigen protein, and the body fluid sample of the subject is diluted as it is or with an appropriate buffer or the like into the autoantigen protein. The autoantibodies to be detected in the specimen were bound to the autoantigen protein on the solid phase by an antigen-antibody reaction, and the conjugate was labeled, for example, By contacting an anti-human immunoglobulin antibody (secondary antibody), washing, and counting the label remaining on the solid phase, this can be detected as the presence signal of the autoantibody to be detected. The secondary antibody described herein can be unlabeled, and a labeled tertiary antibody can be brought into contact therewith, and the tertiary antibody label can be used as an autoantibody presence signal.

  The solid phase material used here is not particularly limited as long as it is a material capable of immobilizing proteins. For example, plastic, glass, metal, carbon fiber, rubber (latex) or the like can be freely selected. Further, the shape of the solid phase can be freely selected from a plate shape, a column shape, a particle shape, and the like as required. Typical solid phase forms include a perforated plate provided with a large number of recesses, a microchip provided with a fine protein fixing part, and latex particles. These solid phase detection parts, that is, the concave part of the perforated plate, the protein fixing part of the microchip, the surface of the latex particles, the self-antigen protein, or the whole of the protein using the usual method according to each embodiment By fixing in a form in which a part is exposed on the surface, a solid body carrying a desired autoantigen protein can be obtained. Further, in the solid phase body, for example, in the case of carrying an autoantigen protein other than DLD, it is the same solid phase body or the same solid phase body or self-antigen protein immobilized on the solid phase body. It is necessary to be supported in a clear state in different solid bodies. In the case of the same solid phase body, for example, in a perforated plate, the state of the type of self-antigen protein carried for each hole is clarified. This means a state in which the type of the self-antigen protein carried in each fixing region composed of the fixing portion is clarified. If they are different solid phase bodies, it means a state in which the type of self-antigen protein carried by each solid phase body is different and has become clear. The above-mentioned clear state includes a visually clear state as a main aspect, but the clarity may be ensured by other means.

  An appropriate signal element, for example, the above-mentioned chromogenic enzyme, fluorescent dye, luminescent dye, or anti-human immunoglobulin carrying a radioisotope is applied to the solid phase body in contact with the body fluid specimen of the subject. The presence or absence of autoantibodies to the DLD protein in the body fluid sample depending on the strength or absence of the selected signal by applying a secondary antibody or tertiary antibody or detecting turbidity due to aggregation of latex particles Can be revealed.

  Then, when the detected value that increases according to the amount of autoantibodies to the protein of DLD in the body fluid sample, which is clarified by the above process, is larger than the standard detected value, or is not detected by the standard. Nevertheless, these can be used as an immediate or time-lapse indicator of the presence of cancer in the subject or progression to cancer.

<This detection kit 1>
The detection kit for carrying out the present detection method 1 of the embodiment described herein is the above-mentioned solid phase, that is, “all or part of the protein of DLD is exposed on the surface, and any kind of protein. It is a kit for cancer detection comprising as an essential element a “solid phase carrier that is supported in a state where it is clear whether all or part of it is fixed”. The kit preferably carries a signal element for detecting an antibody bound to the DLD protein, specifically, a chromogenic enzyme, a fluorescent dye, a luminescent dye, or a radioisotope. Anti-human antibody or latex particles carrying the in vivo protein.

  In addition, a solvent for diluting a body fluid sample, a control antibody, a washing solution, a reaction tube, and the like can be contained as selective elements.

  By performing the present detection method 1 using the present detection kit 1 configured as described above, cancer can be efficiently detected.

<This detection method 2>
As described above, the present detection method 2 is a method for measuring cancer based on the binding between an antibody against a DLD protein and a DLD protein in vivo, which is a non-antibody protein, and detecting cancer using the measurement content as an index.

  This detection method 2 can be performed in the same manner as in the case of detecting an existing cancer marker protein. That is, an enzyme immunoassay method, a radioimmunoassay method, an analysis by fluorometry, a Western blot method, and the like can be mentioned. In general, it is desirable to select a method by an analysis by an enzyme immunoassay method. The enzyme immunoassay method is also called an enzyme immunoassay method, and is a detection method using an enzyme as a labeling substance among the labeled immunoassay methods. Enzyme immunoassay methods are roughly classified into “heterogeneous enzyme immunoassay” that requires so-called B / F separation and “homogeneous enzyme immunoassay” that does not require this B / F separation. In the detection method of the present invention, among these, it is preferable to select the former “heterogeneous enzyme immunoassay”, which is generally said to have high measurement sensitivity, and an “enzyme-linked immunosorbent assay (ELISA)” using an immunosolvent. More preferably, is selected.

  As a more specific detection mode, an immunoassay method using a so-called sandwich method (hereinafter also referred to as a sandwich method) can be exemplified. Such a sandwich method is one of particularly preferable detection modes particularly considering the convenience in operation, the convenience in economy, and the versatility as a clinical test.

  When performing this sandwich method, the monoclonal antibody against the DLD protein is immobilized on a microplate having a large number of wells, such as a 96-well microplate, or a microsphere represented by the Luminex method. It is preferable to use a monoclonal antibody and a monoclonal antibody labeled with an enzyme such as horseradish peroxidase or biotin or a fluorescent dye.

  The sandwich method is an immunoassay method including at least the following steps (a) and (b).

  (a) A step of reacting a specimen such as a blood specimen with an immobilized monoclonal antibody in which a monoclonal antibody against a DLD protein is immobilized on an insoluble carrier.

  In this step (a), usually, after the reaction, the used microplate or microsphere is washed, and the unreacted specimen is removed from the immobilized monoclonal antibody.

  (b) a step of reacting a monoclonal antibody against a DLD protein labeled with horseradish peroxidase, biotin or a fluorescent dye to an antigen-antibody complex formed by binding of an immobilized monoclonal antibody and a DLD protein in a sample .

  In this step (b), usually, after the reaction, the used microplate or microsphere is washed, and the monoclonal antibody against the unreacted labeled DLD protein is removed from the immobilized monoclonal antibody.

  Further, in this step (b), the labeled signal can be revealed using a means for expressing a labeled signal corresponding to the type of the labeled substance in the reacted second antibody. For example, when biotin is selected as the labeling substance, the labeling signal can be revealed using avidin or streptavidin. In addition, for example, when horseradish peroxidase is selected as the labeling substance, the substrate can be added together with a coloring substance as necessary to reveal the labeling signal.

  In this manner, the DLD protein in the specimen can be detected by detecting the chromogenic signal that has become apparent by using a signal specifying means corresponding to the type of the chromogenic signal.

<This detection kit 2>
A detection kit for carrying out the present detection method 2 of the embodiment described herein is a cancer detection kit containing an antibody against the above-mentioned DLD protein, labeled or unlabeled, or fixed or non-fixed. . In the kit, preferably, a signal element for detecting an antibody bound to the DLD protein bound to the antibody, specifically, a chromogenic enzyme, a fluorescent dye, a luminescent dye, or a radioisotope is used. It contains an anti-human antibody carrying a body or latex particles carrying a DLD protein.

  In addition, a solvent for diluting a body fluid sample, a control antibody, a washing solution, a reaction tube, and the like can be contained as selective elements.

  By performing the present detection method 2 using the present detection kit 2 configured as described above, cancer can be efficiently detected.

  Hereinafter, the present invention will be described more specifically with reference to examples. However, this example is illustrative and does not limit the scope of the present invention.

(1) Cell culture A HeLa cell line derived from a human cervical cancer patient was cultured at 37 ° C., 5% using Ham's F12 (GIBCO) containing 10% FBS (GIBCO) and 1% Antibiotic Antimycotic (GIBCO) as a medium. Cultivation was performed under CO ₂ conditions.

(2) Preparation of cell extract The cultured cells obtained in (1) above were washed twice with phosphate buffered saline (PBS) and collected. Next, a solubilization buffer (7M urea, 2M thiourea, 4% CHAPS, 60 mM DTT, and 2% IPG Buffer 3-10 NL (GE Healthcare)) was added, and the cells were solubilized by sonication. A cell extract was obtained. The cell extract was stored at −80 ° C. until use after measuring the protein concentration.

(3) Two-dimensional electrophoresis and Western blot Two-dimensional electrophoresis is a method well known to those skilled in the art used to separate proteins in complex mixtures. The first stage electrophoresis generally separates proteins based on electric charge, and the second stage electrophoresis separates proteins based on molecular weight.

  100 μg of the HeLa cell extract prepared in (2) above was added onto an amphoteric carrier gel (pH 3-11 NL) (GE Healthcare). After the gel was swollen overnight, first-dimensional isoelectric focusing was performed according to the method attached to the instrument. The gel after the first dimension electrophoresis treatment was equilibrated with an SDS equilibration buffer (50 mM Tris-Hcl (pH 8.8), 6M urea, 30% glycerol, 2% SDS, 0.002% bromophenol blue), and alkylated. And then added to a cassette containing a two-dimensional gel. Two-dimensional electrophoresis using SDS-PAGE was performed using a 9% acrylamide gel until the tracking dye contained in the SDS equilibration buffer reached the lower end of the gel.

  After two-dimensional electrophoresis, the separated protein was transferred to a PVDF membrane (Millipore), and first labeled with Cy5 Mono-reactive Dye (GE Healthcare). Next, this membrane was immersed in blocking buffer (5% skim milk, PBS supplemented with 0.1% Tween 20) and incubated for 2 hours. Subsequently, the membrane was washed with PBS supplemented with 0.1% Tween 20, and then immersed in patient serum or control serum diluted 1: 500 with blocking buffer, and incubated at room temperature for 3 hours. Thereafter, the plate was washed with PBS containing 0.1% Tween 20, and the membrane was incubated with a horseradish peroxidase-labeled goat anti-human Ig (G + A + M) antibody (Cosmo Bio) for 1 hour. After washing, the membrane was treated with ECL Plus Western Blotting Detection Reagents (GE Healthcare), and antibody reaction spot (for ECL-Plus, 520 nm) and total protein spot (for Cy5, for Typhoon 9400 variable mode imager (GE Healthcare) 670 nm) was analyzed, and the migration position of the antigen protein showing the antibody reaction was confirmed by superimposing the spot of the antibody reaction on the spot of the total protein. FIG. 1 is a diagram showing the results of detection of an antigen protein that reacts with a serum antibody of a uterine cancer patient using this two-dimensional electrophoresis and Western blotting. FIG. 1A shows an antigen spot (indicated as p54) that reacts with an antibody, and B shows a spot image of the total protein overlaid with an image of an A antibody reaction spot.

(4) Identification of protein As described above, in (3), one spot of the antigen that reacts with the antibody in the patient serum but does not react with the control serum was observed (spot p54 in FIGS. 1A and B). . The antigen protein is visualized by Coomassie blue staining of the protein transferred to another PVDF membrane prepared for mass spectrometry, the protein at the corresponding spot position is cut out from the membrane, and a peptide fingerprint method using a mass spectrometer Thus, the protein was identified. As a result, DLD as a tumor marker candidate for cervical cancer could be identified (FIG. 2).

  In the upper graph in FIG. 2, the horizontal axis shows the reliability of protein identification, the vertical axis shows the number of candidate proteins at each reliability, and a protein identified with a high reliability with a score of 100 or more is only one type of DLD. It is shown that. The lower row shows the peptide that was detected by the mass spectrometer in the process of protein identification, became the basis for DLD identification, the reliability of identification, and the amino acid sequence of DLD.

(5) Preparation of DLD recombinant protein expression vector
Total RNA prepared from HeLa cells is converted to cDNA by reverse transcriptase, and the oligonucleotide represented by SEQ ID NO: 3 (forward (BamHI): gagggatccatgcagagct ggagtcgtg) and SEQ ID NO: 4 (reverse (SalI): gtggtcgactcaaaagttgattgatttgcc) is amplified. A PCR reaction was carried out using the primers for amplification, and the base sequence (cDNA) encoding the DLD protein was amplified. The amplified DLD cDNA was cloned into the BamHI / SalI site of the expression vector pCMV-Tag 2B (Stratagene) that gives the gene sequence corresponding to the FLAG peptide at the 5 ′ end.

(6) Expression and purification of recombinant protein A DLD expression vector was introduced into human fetal HEK293 cells to cause transient gene expression. Next, the cells were solubilized with PBS containing 1% Triton X-100, and the expressed DLD protein was recovered with FLAG-M2 beads (Sigma) on which an antibody against the FLAG peptide sequence was immobilized, and the FLAG peptide was further recovered. Elution was performed by adding excess.

(7) Detection of anti-DLD autoantibodies derived from cancer patients Anti-DLD autoantibodies derived from cancer patients were detected by slot blotting. The DLD antigen prepared in (6) above was separated by 10% SDS gel electrophoresis and then transferred to a solid phase on a PVDF membrane, and 27 cervical cancer patients (including 14 stage I patients) Sera collected from 25 healthy individuals were individually reacted with a slot blot apparatus. Furthermore, after incubating the PVDF membrane with a horseradish peroxidase-labeled goat anti-human Ig (G + A + M) antibody (Cosmo Bio) for 1 hour, anti-DLD autoantibodies in serum bound by chemiluminescence were detected.

  According to the results shown in FIG. 3, the presence of DLD-specific autoantibodies was observed in 6 out of 27 cervical cancer patients (22.2%). In the early cancer (stage I), the presence of the autoantibodies was observed in 5 (14. 5%) of 14 cases. On the other hand, in healthy individuals, the presence of DLD-specific autoantibodies was observed in only 1 of 25 cases (4.1%). This result shows that DLD is an in vivo protein suitable as a cancer marker for at least cervical cancer. That is, it has been revealed that detecting DLD autoantibodies is a suitable in-vivo DLD measuring means for detecting cervical cancer.

  In addition, the upper stage A of FIG. 3 has shown the result of the cervical cancer patient, and the lower stage B has shown the result of the healthy person.

(8) Comparison with the positive rate of other tumor markers in cervical cancer The positive rate of DLD autoantibodies examined by slot blotting on the serum of 27 uterine cancer patients shown in (7) above and other tumor markers The positive rates of (CA19-9, CEA, CA125, STN) were compared. Here, CA19-9, CEA, and CA125 were measured by chemiluminescence immunoassay, and STN was measured by radioisotope immunoassay.

  The results are shown in FIG. The vertical axis of FIG. 4 shows the ratio of specimens that show a positive reaction in each assay shown on the horizontal axis (expressed as positive rate (%)). The positive rate of DLD autoantibodies (22.2%) was higher than the positive rate (3.7% to 11.1%) of any of the above four existing tumor markers. Moreover, the result is comparable to the ratio (25.9%) of specimens that are positive in one or more of the existing four types of tumor markers. More conveniently, the number of specimens positive for any one of the above four existing tumor markers or DLD antibodies reached 44.4% of the total. This indicates that the overlap between DLD autoantibodies and existing tumor markers is small, and that cervical cancer can be detected very frequently by combining DLD autoantibodies with other tumor markers. Show. In addition, considering that the existing tumor marker used this time is not necessarily used as a tumor marker for cervical cancer, this total value is a detection marker for cancer in general or cancer other than uterine cancer. Is also considered appropriate.

It is a figure which shows the result of having detected the antigen protein which reacts with a uterine cancer patient serum antibody using two-dimensional electrophoresis and a western blotting method. It is a figure which shows the result of the identification in the mass spectrometry analysis of the reaction antigen detected in the Western blot It is the figure which showed the result of having measured the autoantibody with respect to DLD in a cervical cancer patient and a healthy person by the slot blot method. It is the figure which compared the positive rate of the DLD autoantibody in the cervical cancer patient serum, and the positive rate of the existing tumor marker.

Claims (11)

In a body fluid sample, all or part of a protein of DLD (dihydrolipoamide dehydrogenase), or an antibody against all or part of the protein is detected, and a detection value that increases according to the amount of the protein or the amount of the antibody is a standard value. If they are greater than the detected values, or if detected but not detected by the standard, these are immediate or timed indicators of the presence of cancer in the subject or progression to cancer, Cancer detection method. The method for detecting cancer according to claim 1, wherein the body fluid sample is a blood sample. The method for detecting cancer according to claim 1 or 2, wherein the blood sample is serum. The method for detecting cancer according to any one of claims 1 to 3, wherein the cancer is uterine cancer. The method for detecting cancer according to claim 4, wherein the uterine cancer is cervical cancer. The detection target is an antibody against all or part of the DLD protein, where all or part of the DLD protein is exposed on the surface, and whether all or part of the DLD protein is fixed The body fluid specimen is brought into contact with the solid phase carrier carried in step, and the binding between each protein carried on the solid phase carrier and the antibody in the body fluid specimen is caused by the presence of cancer in the subject or progression to cancer. The method for detecting cancer according to any one of claims 1 to 5, wherein The method for detecting cancer according to any one of claims 1 to 6, wherein the detection target is an antibody against all or part of a recombinant protein of DLD in a body fluid sample. A detection kit for performing the cancer detection method according to claim 1, wherein the detection kit contains all or part of a DLD protein. 9. The detection kit according to claim 8, wherein all or a part of the protein of DLD is exposed on the surface, and all or a part of which kind of protein is fixed is carried in a clear state. A cancer detection kit comprising a solid phase carrier. 10. The cancer detection kit according to claim 8 or 9, wherein the detection kit contains a signal element for detecting an antibody bound to all or a part of the protein of DLD. 11. The detection kit according to claim 10, wherein the signal element is a chromogenic enzyme, a fluorescent dye, a luminescent dye, an anti-human antibody carrying a radioisotope, or a latex particle carrying a DLD protein. Cancer detection kit.

Images