JP2009124993A - Method for producing virus protease - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for sufficiently and efficiently producing a virus protease relating to polyprotein processing. <P>SOLUTION: The method for producing the virus protease comprises a process for expressing a fused protein in an acellular protein synthetic system; wherein the fused protein comprises a sequence in which a sequence containing the recognition sequence at an N-terminal side, a virus protease relating to the polyprotein processing and a sequence containing the recognition sequence at a C-terminal are arranged in this order from the N-terminal, and the recognition sequence at the N-terminal and the recognition sequence at the C-terminal are adjacent to the protease; and after expressing the fused protein, the protease is matured from the fused protein by cleaving the recognition sequence at the N-terminal and the recognition sequence at the C-terminal of the protease. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a method for producing a viral protease in, for example, a cell-free protein synthesis system.

  Conventionally, it is known that viral protease is useful for removing a purification tag linked in a fusion protein expression system.

  In a specific virus, multiple viral proteins are synthesized together as a polyprotein, and each viral protein is produced by cleaving the polyprotein with a protease in the polyprotein or a protease possessed by the host cell. The

SARS coronavirus (hereinafter referred to as “SARS-CoV”) is a causative virus for severe acute respiratory syndrome (SARS). SARS-CoV is a plus-strand RNA virus. The plus-strand RNA functions as mRNA, and polyprotein is synthesized from this mRNA. Mechanisms and enzymes involved in SARS-CoV genome expression are known (Non-Patent Documents 1 and 2). SARS-CoV genomic expression is initiated by translation of two large polyproteins (pp1a and pp1ab) encoded by the viral replicase gene. The polyprotein is also called papain-like cysteine protease (hereinafter referred to as “PL2 ^pro ”) and 3C-like cysteine protease (main protease (M ^pro )) present in the polyprotein; hereinafter referred to as “3CL ^pro ”. ). PL2 ^pro cleaves three sites on the N-terminal proximal region side of the polyprotein. On the other hand, 3CL ^pro cleaves the central region and the C-terminal proximate region at 11 sites of the polyprotein. At this time, 3CL ^pro is expressed by cleaving cleavage sites at both ends of the self in the polyprotein. Therefore, 3CL ^pro is expressed from within the polyprotein by self-processing.

  When a host cell is transformed with an expression vector having a gene encoding a viral protease derived from polyprotein (hereinafter referred to as “protease gene”) to produce the viral protease, the start codon of the protease gene is methionine. Since it does not encode (Met), it is not possible to express a viral protease in the host cell with the intact gene form. Therefore, it is conceivable to add a codon encoding Met to the 5 ′ end side of the protease gene. However, in this case, the structure of the active site is destroyed by the addition of Met, and the resulting protease is lower than the activity of the natural protease (for example, 1/10 or less).

  It is also conceivable that a viral protease derived from a polyprotein is expressed as a fusion protein with a purification tag, and an artificially prepared cleavage site is cleaved with a commercially available protease (such as precision protease). However, in this case, a plurality of extra residues remain in the obtained protease.

Non-Patent Document 3 discloses that SARS-CoV 3CL ^pro having an additional sequence linked to the N-terminal and / or C-terminal was expressed in E. coli. The N-terminal addition sequence is, for example, a sequence containing a GST tag (AVLQ (SEQ ID NO: 3)) adjacent to the 3CL ^pro in the above-described SARS-CoV polyprotein (pp1a and pp1ab) at the N-terminus. On the other hand, the C-terminal addition sequence is, for example, a sequence containing a recognition site (GP) of a rhinovirus 3C protease and a His tag. However, in this method, the expression efficiency of SARS-CoV 3CL ^pro is low. Moreover, since SARS-CoV 3CL ^pro is expressed using E. coli as a host cell, there is a high risk of contamination with the produced SARS-CoV 3CL ^pro . Furthermore, SARS-CoV 3CL ^pro may be cleaved and degraded by proteases derived from E. coli.

  Therefore, a method for producing a polyprotein-derived viral protease sufficiently and efficiently in vitro has not been known so far.

Volker Thiel et al., "Journal of General Virology", 2003, Vol. 84, p. 2305-2315 John Ziebuhr, “Current Opinion in Microbiology”, 2004, Vol. 7, p. 412-419 Xiaoyu Xue et al., “Journal of Molecular Biology”, 2007, 366, p. 965-975

  In view of the above-described circumstances, an object of the present invention is to provide a method capable of producing a viral protease involved in polyprotein processing sufficiently and efficiently.

  As a result of earnest research to solve the above problems, in a cell-free protein synthesis system, a fusion comprising a sequence containing an N-terminal recognition sequence, a viral protease involved in polyprotein processing, and a sequence containing a C-terminal recognition sequence By expressing the protein, it was found that the viral protease was matured and produced from the fusion protein, and the present invention was completed.

  In the cell-free protein synthesis system, the present invention is a fusion comprising a sequence containing an N-terminal recognition sequence, a viral protease involved in polyprotein processing, and a sequence containing a C-terminal recognition sequence arranged in this order from the N-terminus. A protein comprising the step of expressing the fusion protein in which the N-terminal side recognition sequence and the C-terminal side recognition sequence are adjacent to the protease, and after the expression of the fusion protein, the N-terminal side recognition sequence of the protease And a method for producing a viral protease, wherein the protease is matured from the fusion protein by cleaving the C-terminal recognition sequence.

Examples of the viral protease include SARS-CoV 3CL ^pro . When the viral protease is SARS-CoV 3CL ^pro , the N-terminal recognition sequence includes the amino acid sequence represented by SEQ ID NO: 1, and the C-terminal recognition sequence is represented by SEQ ID NO: 2. Amino acid sequences.
Examples of the cell-free protein synthesis system include an E. coli cell-free protein synthesis system.

  Furthermore, the present invention relates to a viral protease expression vector or cassette in a cell-free protein synthesis system having DNA encoding the above fusion protein.

  According to the present invention, a viral protease involved in polyprotein processing can be produced with excellent productivity. In addition, according to the present invention, a stable viral protease can be provided without losing activity.

Hereinafter, the present invention will be described in detail.
The method for producing viral protease according to the present invention (hereinafter referred to as “viral protease production method”) includes a sequence containing an N-terminal recognition sequence, a viral protease involved in polyprotein processing, and a C-terminal side in a cell-free protein synthesis system. Expressing a fusion protein in which a sequence containing a recognition sequence is arranged in this order from the N-terminus. In the fusion protein, the N-terminal recognition sequence and the C-terminal recognition sequence are located adjacent to the viral protease. In addition, after expression of the fusion protein, the viral protease is matured and produced from the fusion protein by cleaving the N-terminal recognition sequence and the C-terminal recognition sequence of the viral protease.

Here, the viral protease involved in polyprotein processing means a viral protease that processes (or cleaves) a polyprotein to produce individual viral proteins. Hereinafter, a viral protease involved in polyprotein processing is simply referred to as “viral protease”. Examples of the viral protease in the present invention include SARS-CoV 3CL ^pro (cDNA: SEQ ID NO: 4, amino acid sequence: SEQ ID NO: 5) and HIV protease (cDNA: SEQ ID NO: 6, amino acid sequence: SEQ ID NO: 7; Coffin, JM ( Ed.), RETROVIRUSES; 757; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, NY, USA (1997) Petropoulos, CJ, Retroviral taxonomy, protein structure, sequences, and genetic maps and GenBank accession numbers: NC_001802).

The amino acid sequence of the viral protease described above and the base sequence of its cDNA are not limited to the amino acid sequence and base sequence shown in the above SEQ ID NO. The viral protease consists of an amino acid sequence in which one or several (for example, 1 to 10, 1 to 5) amino acids are substituted, deleted or added in the amino acid sequence shown in the above SEQ ID NO, and the viral protease activity It may be a protein having However, the amino acid to be substituted or deleted excludes the active site (active residue) of the viral protease. For example, SARS-CoV 3CL ^pro is a cysteine protease, and the 145th cysteine in the amino acid sequence shown in SEQ ID NO: 5 is the active residue of SARS-CoV 3CL ^pro . When the active residue is substituted with another amino acid, mutant SARS-CoV 3CL ^pro loses its self-processing activity.

  The cDNA encoding the viral protease also includes DNA that hybridizes under stringent conditions with a DNA consisting of a base sequence complementary to the cDNA shown in SEQ ID NO. And encodes a protein having viral protease activity. It is.

  Here, stringent conditions refer to, for example, conditions in which the sodium concentration is 25 to 500 mM, preferably 25 to 300 mM, and the temperature is 42 to 68 ° C, preferably 42 to 65 ° C. More specifically, 5 × SSC (83 mM NaCl, 83 mM sodium citrate), temperature 42 ° C.

N-terminal recognition sequence refers to the cleavage site present on the N-terminal side of the viral protein when the viral protease that forms the fusion protein together processes the natural polyprotein to produce the viral protein. To do. For example, when the viral protease is SARS-CoV 3CL ^pro , the N-terminal recognition sequence is XXXQ (SEQ ID NO: 1: the first X is A, V, P or T, and the second X is T, V, K or R, and the third X is L, F, M or V), and more specifically AVLQ (SEQ ID NO: 3). AVLQ (SEQ ID NO: 3) is composed of 3CL ^pro (called nonstructural protein (nsp (nonstructural protein) 5)) and its N-terminal trans in two polyproteins (pp1a and pp1ab) of SARS-CoV. This is a cutting site disposed between the membrane 2 (TM2) (referred to as nsp4) (Figure 2 of Non-Patent Document 2). That is, AVLQ (SEQ ID NO: 3) is a cleavage site when SARS-CoV 3CL ^pro cleaves a polyprotein by self-processing. When the viral protease is HIV protease, the N-terminal recognition sequence includes DRQGTVSFNF (SEQ ID NO: 8) (Coffin, JM (Ed.), RETROVIRUSES; 757; Cold Spring Harbor Laboratory Press, Cold Spring Harbor , New York, NY, USA (1997), Petropoulos, CJ, Retroviral taxonomy, protein structure, sequences, and genetic maps and GenBank accession number: NC_001802).

The amino acid length of the sequence including the N-terminal recognition sequence (hereinafter referred to as “N-terminal adjacent sequence”) is, for example, 4 to 500 amino acids, preferably 4 to 10 amino acids. When the viral protease is SARS-CoV 3CL ^pro , the flanking sequences are upstream amino acid residues (e.g., TM2) on the N-terminal side of 3CL ^pro (nsp5) in two polyproteins (pp1a and pp1ab) of SARS-CoV. (nsp4) up to the N-terminus (500 amino acid residues)).

On the other hand, the C-terminal recognition sequence is a cleavage site that is present on the C-terminal side of the viral protein when the viral protease that forms the fusion protein together processes the natural polyprotein and produces the viral protein. Means. For example, when the viral protease is SARS-CoV 3CL ^pro , the C-terminal recognition sequence is XXX (SEQ ID NO: 2: the first X is A, S, G or N, and the second X is Any amino acid other than P, and the third X is F, E or N), and more specifically GKF (SEQ ID NO: 9). GKF (SEQ ID NO: 9) is arranged between 3CL ^pro and transmembrane 3 (TM3) (referred to as nsp6) on the C-terminal side of two polyproteins (pp1a and pp1ab) of SARS-CoV. (Figure 2 of Non-Patent Document 2). That is, GKF (SEQ ID NO: 9) is a cleavage site when SARS-CoV 3CL ^pro cleaves a polyprotein by self-processing together with the above-mentioned AVLQ (SEQ ID NO: 3). When the viral protease is HIV protease, examples of the C-terminal recognition sequence include PISPIETVPV (SEQ ID NO: 10) (Coffin, JM (Ed.), RETROVIRUSES; 757; Cold Spring Harbor Laboratory Press, Cold Spring Harbor , New York, NY, USA (1997), Petropoulos, CJ, Retroviral taxonomy, protein structure, sequences, and genetic maps and GenBank accession number: NC_001802).

The amino acid length of the sequence containing the C-terminal recognition sequence (hereinafter referred to as “C-terminal adjacent sequence”) is, for example, 3 to 290 amino acids, preferably 3 to 10 amino acids. When the viral protease is SARS-CoV 3CL ^pro , the flanking sequence is a downstream amino acid residue (e.g., TM3) on the C-terminal side of 3CL ^pro (nsp5) in two polyproteins (pp1a and pp1ab) of SARS-CoV. (nsp6) up to the C-terminus (290 amino acid residues)).

  In addition, maturation of viral protease means that it is cleaved from the fusion protein by self-processing and correctly folded, thereby exhibiting viral protease activity.

  In the viral protease production method, first, DNA encoding a fusion protein (hereinafter referred to as “fusion protein”) in which an N-terminal adjacent sequence, a viral protease, and a C-terminal adjacent sequence are arranged in this order from the N-terminal is prepared. To do. For example, DNA encoding a fusion protein can be amplified and isolated by PCR using a specific set of primers using viral genomic DNA or the like as a template. In addition, DNA encoding the fusion protein is prepared by PCR amplification of DNA encoding the N-terminal adjacent sequence, DNA encoding the viral protease, and DNA encoding the C-terminal adjacent sequence, followed by ligation. be able to.

  Alternatively, for the DNA encoding the fusion protein, DNA encoding the N-terminal flanking sequence, DNA encoding the viral protease, and DNA encoding the C-terminal flanking sequence should be introduced into the appropriate multiple vector cloning sites, etc. Can be prepared. For example, in the cell-free protein synthesis system of the following example, since T7 RNA polymerase is used to synthesize mRNA (transcription reaction), any vector having a T7 promoter may be used. Examples include pET series expression vectors (for example, pET3, pET9, pET11, pET15, pET21 and pET29a (Novagen)).

  Furthermore, DNA encoding the fusion protein can be prepared as an expression cassette.

  In these expression vectors or cassettes, the DNA encoding the fusion protein is placed under the control of a functional control region (eg, promoter, enhancer, terminator, etc.) in a cell-free protein synthesis system.

  Next, in the viral protease production method, an expression vector or an expression cassette having DNA encoding these fusion proteins is added to a cell-free protein synthesis system to express the fusion protein. Examples of the cell-free protein synthesis system include an E. coli cell-free protein synthesis system, a wheat germ cell-free protein synthesis system, and a silkworm baculovirus cell-free protein synthesis system.

  The amount of expression vector or expression cassette having a DNA encoding a fusion protein for the cell-free protein synthesis system can be appropriately adjusted depending on the cell-free protein synthesis system used.

  The expression conditions for the fusion protein in the cell-free protein synthesis system are, for example, 20 to 37 ° C. (preferably 30 ° C.) and 2 to 6 hours (preferably 4 hours).

  After the expression, the viral protease is matured from the fusion protein, and the viral protease is produced.

  The produced reaction solution containing the viral protease may be used as it is. Alternatively, after production of the viral protease, the viral protease can be purified from the reaction solution by one or more purification means such as dialysis, anion exchange column chromatography, isoelectric focusing chromatography, gel filtration chromatography, concentration, etc. Good.

  As a method for measuring the activity of the obtained viral protease, the viral protease is brought into contact with a peptide consisting of an amino acid sequence serving as a substrate (a fluorescent group and a quenching group are linked to the N-terminal and C-terminal, respectively), and then the fluorescence is used. A method for measuring the intensity change is mentioned. For example, when an Nma group is used as the fluorescent group and a Dnp group is used as the quenching group, the Dnp group quenches the Nma group in the peptide molecule as a substrate. When the peptide is cleaved by the viral protease, the fluorescence intensity of the Nma group that has been quenched by the Dnp group in the peptide molecule (maximum excitation wavelength (Ex) = 340 nm, maximum fluorescence wavelength (Em) = 440 nm) increases. . That is, the rate of cleavage by viral protease and the increase in fluorescence intensity show a positive correlation. Therefore, when the viral protease activity based on the fluorescence intensity change is statistically significant compared to the negative control, the obtained viral protease can be judged to have good viral protease activity. .

  According to the viral protease production method described above, an active viral protease can be produced with excellent productivity. The produced viral protease can be used, for example, in the fusion protein expression system to remove the purification tag linked via the viral protease substrate peptide.

  In the present invention, a cell-free protein synthesis system is used. For this reason, since host cells such as E. coli, yeast and animal cells are not used, contamination with the produced viral protease can be minimized. Moreover, since a protease derived from a host cell is not included in the cell-free protein synthesis system, there is no possibility that the viral protease is cleaved by other proteases. Furthermore, since the time required for protein expression in the cell-free protein synthesis system is shorter than when host cells are used, the production time of viral protease can be shortened.

  Additives can be appropriately added to the cell-free protein synthesis system. Thus, there is a possibility that the expression efficiency of the viral protease can be further improved by adding a protease inhibitor for a protease other than the production viral protease to the cell-free protein synthesis system.

  In the present invention, the viral protease is matured by utilizing self-processing of the viral protease for production. Therefore, it is not necessary to mature the viral protease using a tag or the like. That is, according to the present invention, a mature viral protease can be easily obtained without using other proteases necessary for tag cleavage.

EXAMPLES Hereinafter, although this invention is demonstrated in detail using an Example, the technical scope of this invention is not limited to these Examples.
[Example 1] Expression of SARS-CoV 3CL ^pro in a cell-free protein synthesis system Construction of SARS-CoV 3CL ^pro expression vector
DNA encoding SARS-CoV 3CL ^pro by PCR using a plasmid containing DNA (cDNA: SEQ ID NO: 4) encoding SARS-CoV 3CL ^pro (amino acid sequence: SEQ ID NO: 5) as a template. Was amplified.

Forward primer:
5'-CGT GGATCC CAGACATCAATCACTTCTGCTGTTCTGCAGAGTGGTTTTAGGAAAATGGC-3 '(SEQ ID NO: 11)
Reverse primer:
5'-GGTG CTCGAG AGTGCCCTTAACAATTTTCTTGAACTTACCTTGGAAGGTAACACCAGAGC-3 '(SEQ ID NO: 12)

According to the forward primer (SEQ ID NO: 11), 10 amino acids derived from natural pp1a polyprotein added to the DNA encoding SARS-CoV 3CL ^pro at the BamHI restriction site (underlined) and the N-terminus of SARS-CoV 3CL ^pro 30 nucleotides encoding (QTSITSAVLQ: SEQ ID NO: 13) are introduced. The 10 amino acids (SEQ ID NO: 13) are amino acid sequences adjacent to the N-terminal side of 3CL ^pro (nsp5) in the pp1a polyprotein (FIG. 2 of Non-Patent Document 2).

On the other hand, according to the reverse primer (SEQ ID NO: 12), the DNA derived from the natural pp1a polyprotein added to the DNA encoding SARS-CoV 3CL ^pro , the XhoI restriction site (underlined) and the C-terminus of SARS-CoV 3CL ^pro . 30 nucleotides encoding 10 amino acids (GKFKKIVKGT: SEQ ID NO: 14) are introduced. The 10 amino acids (SEQ ID NO: 14) is an amino acid sequence adjacent to the C-terminal side of 3CL ^pro (nsp5) in the pp1a polyprotein (FIG. 2 of Non-Patent Document 2).

  PCR conditions were heat denaturation (98 ° C., 20 seconds), annealing (50 ° C., 30 seconds) and extension reaction (68 ° C., 90 seconds), and the number of cycles was 25.

  Subsequently, the obtained PCR product was cleaved with restriction enzymes BamHI and XhoI. On the other hand, the pET29a expression vector (Novagen) was cleaved with restriction enzymes BamHI and XhoI. The pET29a expression vector has an N-terminal S tag / thrombin configuration and a C-terminal His tag sequence.

The cleaved PCR product was introduced between the BamHI cleavage site and the XhoI cleavage site of the pET29a expression vector and cloned to prepare an expression vector having a DNA encoding SARS-CoV 3CL ^pro . The obtained expression vector is called “pET29a / SARS-3CLP wild-type (WT)”. FIG. 1 shows the nucleotide sequence (SEQ ID NO: 15) of DNA encoding SARS-CoV 3CL ^pro in pET29a / SARS-3CLP WT. In FIG. 1, the two underlined base sequences each encode a DNA encoding a sequence containing an N-terminal recognition sequence (QTSITSAVLQ: SEQ ID NO: 13) and a sequence containing a C-terminal recognition sequence (GKFKKIVKGT: SEQ ID NO: 14). DNA to be used. On the other hand, the base sequence between the two underlined base sequences represents DNA (SEQ ID NO: 4) encoding SARS-CoV 3CL ^pro .

FIG. 2 shows the amino acid sequence of a fusion protein containing SARS-CoV 3CL ^pro encoded by pET29a / SARS-3CLP WT. FIG. 2 (A) shows the fusion protein (SEQ ID NO: 16) before processing. FIG. 2 (B) is a diagram showing SARS-CoV 3CL ^pro (SEQ ID NO: 5) after processing.

  In FIG. 2A, the amino acid sequence of (1) is an S tag. The amino acid sequence of (2) is 10 amino acids (SEQ ID NO: 13) derived from natural pp1a polyprotein. The amino acid sequence of (3) is 10 amino acids (SEQ ID NO: 14) derived from natural pp1a polyprotein. The amino acid sequence of (4) is a His tag.

In addition, it encodes a C145A mutant of SARS-CoV 3CL ^pro (in the amino acid sequence shown in SEQ ID NO: 5, the 145th cysteine is substituted with alanine: hereinafter referred to as “SARS-CoV 3CL ^pro- C145A”). DNA was generated by the oligonucleotide-directed mutagenesis method using pET29a / SARS-3CLP WT as a template (Braman et al., “Methods in Molecular Biology”, 1996, Vol. 57, p. 31-44). The primers used were as follows.

Forward primer:
5'-GGTTCTTTCCTTAATGGATCAGCTGGTAGTGTTGGTTTTAAC-3 '(SEQ ID NO: 17)
Reverse primer:
5'-GTTAAAACCAACACTACCAGCTGATCCATTAAGGAAAGAACC-3 '(SEQ ID NO: 18)

The PCR conditions were the same as those when the DNA encoding SARS-CoV 3CL ^pro was amplified.

  In the obtained plasmid, the base sequence corresponding to the above-mentioned mutation was confirmed by dideoxynucleotide sequencing analysis. The obtained vector is hereinafter referred to as “pET29a / SARS-3CLP-C145A”.

  FIG. 3 is a schematic diagram of the fusion protein encoded by pET29a / SARS-3CLP WT and pET29a / SARS-3CLP-C145A, respectively. In FIG. 3, “S” indicates an S tag, and “HIS” indicates a His tag. “N10” represents 10 amino acids (SEQ ID NO: 13) derived from natural pp1a polyprotein, and “C10” represents 10 amino acids (SEQ ID NO: 14) derived from natural pp1a polyprotein.

2. Expression of SARS-CoV 3CL ^{pro in} cell-free protein synthesis system
Recombinant SARS-CoV 3CL ^pro was synthesized by dialysis mode of cell-free protein synthesis system using pET29a / SARS-3CLP WT. The cell-free protein synthesis system is described in Kigawa et al. (“FEBS Letters”, 1999, 442, p. 15-19; “Journal of Structural and Functional Genomics”, 2004, 5, p. 63-68. ). The cell-free protein synthesis system used is an E. coli cell-free protein synthesis system using an E. coli S30 extract.

  For the cell-free protein synthesis system, a feed solution having the composition shown in Table 1 below and a reaction solution having the composition shown in Table 2 were used.

  In Table 2, the template DNA is a solution containing pET29a / SARS-3CLP WT.

  The reaction mixture was then incubated with shaking at 30 ° C. for 4 hours. After incubation, the reaction mixture was collected and subjected to centrifugation at 16,000 rpm for 20 minutes at 4 ° C. to separate the supernatant.

FIG. 4 shows the results of SDS-PAGE of SARS-CoV 3CL ^pro synthesized in a cell-free protein synthesis system. In FIG. 4, each lane shows the following.
Lane M: molecular weight marker, lane 1: reaction mixture sample before incubation, lane 2: reaction mixture sample after incubation, lane 3: supernatant sample derived from reaction mixture after incubation In addition, the band indicated by the arrow in FIG. SARS-CoV 3CL ^pro band.

As shown in FIG. 4, SARS-CoV 3CL ^pro was expressed and then self-processed, and there was a band around 34 kDa.

In addition, recombinant SARS-CoV 3CL ^pro- C145A was synthesized in a cell-free protein synthesis system using pET29a / SARS-3CLP-C145A. The synthesis method was the same as that using pET29 / SARS-3CLP WT.

FIG. 5 is a diagram showing the results of SDS-PAGE and Western blotting of SARS-CoV 3CL ^pro and SARS-CoV 3CL ^pro- C145A synthesized in a cell-free protein synthesis system.

FIG. 5 (A) is a schematic diagram of SARS-CoV 3CL ^pro self-processing expression and SARS-CoV 3CL ^pro -C145A non-processing. Abbreviations in FIG. 5A are the same as the abbreviations shown in FIG.

FIG. 5 (B) is a diagram showing the results of SDS-PAGE of SARS-CoV 3CL ^pro and SARS-CoV 3CL ^pro -C145A synthesized by a cell-free protein synthesis system. Each lane shows:
“Lane Ctrl”: control (supernatant derived from the reaction mixture after incubation with pET29a), “lane WT”: supernatant derived from the reaction mixture after incubation with pET29a / SARS-3CLP WT, “Lane C145A”: supernatant derived from the reaction mixture after incubation with pET29a / SARS-3CLP-C145A

In FIG. 5B, a band indicated by an arrow in the lane WT is a band of SARS-CoV 3CL ^pro after self-processing. Meanwhile, a band indicated by an arrow in lane C145A is a band of SARS-CoV 3CL ^pro -C145A uncleaved for unprocessed.

FIG. 5 (C) is a diagram showing the results of Western blotting of SARS-CoV 3CL ^pro and SARS-CoV 3CL ^pro -C145A synthesized in a cell-free protein synthesis system. Each lane shows:
“Lane WT”: supernatant derived from the reaction mixture after incubation with pET29a / SARS-3CLP WT, “Lane C145A”: top from the reaction mixture after incubation with pET29a / SARS-3CLP-C145A Clear liquid

In FIG. 5C, the result of “α-3CLpro” is a result of using an anti-SARS-CoV 3CL ^pro antibody (Genesis Biotech) as a primary antibody. The result of “α-His” is a result of using an anti-His tag antibody (Novagen) as a primary antibody. The result of “S-protein” is a result of using an anti-S tag antibody (Novagen) as a primary antibody. In FIG. 5C, the band indicated by arrow (1) is the band of SARS-CoV 3CL ^pro after self-processing. On the other hand, the band indicated by the arrow (2) is a band of SARS-CoV 3CL ^pro- C145A that is not cut due to non-processing.

As shown in FIG. 5, SARS-CoV 3CL ^pro self-processes and expresses, whereas SARS-CoV 3CL ^pro- C145A does not self-process and remains in the form of a fusion protein.

Non-Patent Document 3 discloses that SARS-CoV 3CL ^pro is expressed in E. coli. Expression of SARS-CoV 3CL ^pro in E. coli shown in Non-Patent Document 3 when compared with (Figure 1 (d)), the synthesized SARS-CoV 3CL ^pro in a cell-free protein synthesis system shown in FIG. 5 (B) It can be seen that the expression level is very high.

3. Purification of SARS-CoV 3CL ^pro The recombinant SARS-CoV 3CL ^pro synthesized in Section 2 above was purified. The buffers used for purification were as follows.
(1) Buffer A: 20 mM Tris-HCl, pH 7.6, 1 mM EDTA, 1 mM DTT
(2) Buffer B: 20 mM Tris-HCl, pH 7.6, 1 mM EDTA, 1 mM DTT, 1 M NaCl
(3) Buffer C: 25 mM Imidazole-HCl, pH 7.6, 1 mM DTT
(4) Buffer D: 1/8 Polybuffer74, pH 5.0, 1mM DTT
(5) Buffer E: 20 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1 mM DTT, 0.1 M NaCl
(6) Buffer F: 10 mM Tris-HCl, pH 7.5, 0.1 mM EDTA, 1 mM DTT

First, the reaction mixture (27 ml) containing the recombinant SARS-CoV 3CL ^pro synthesized in Section 2 was recovered. The recovered reaction mixture was then subjected to dialysis against buffer A (2 L).

The dialyzed protein was subjected to Econopack HighQ cartridge (5 ml) column chromatography (Bio-Rad). Buffer A and buffer B were used as buffers, and the NaCl concentration gradient was adjusted to 0 to 0.15M. The apply volume was 5 or 10 ml. FIG. 6 is a diagram showing absorbance waveforms of fractions by Econopack HighQ cartridge column chromatography. The fraction containing the recombinant SARS-CoV 3CL ^pro (the fraction surrounded by a square in FIG. 6) was confirmed by SDS-PAGE, and the fraction was collected.

  The collected fraction was then subjected to dialysis against buffer C (2 L). At this time, the buffer was changed twice.

The dialyzed protein was subjected to isoelectric focusing using a Mono P 5/200 GL column (GE Healthcare). Buffer C and buffer D were used as buffers. The apply volume was 25 or 50 ml. FIG. 7 is a diagram showing the absorbance waveform of fractions by isoelectric point chromatography using a Mono P 5/200 GL column. Fractions containing the recombinant SARS-CoV 3CL ^pro (fraction numbers 19 to 21 in FIG. 7) were collected.

The obtained fraction was further subjected to gel filtration chromatography using HiPrep 26/60 Sephacryl S-300 column (GE Healthcare). The buffer used was buffer E. The apply volume was 2 ml. FIG. 8 is a diagram showing the absorbance waveform of a fraction obtained by gel filtration chromatography using a HiPrep 26/60 Sephacryl S-300 column. Fractions containing recombinant SARS-CoV 3CL ^pro (fraction number 66-82 in FIG. 8) were collected.

Next, the recombinant SARS-CoV 3CL ^pro concentration in the collected fraction was determined using the Quick Start protein assay (Bio-Rad).

After determining the concentration, the recombinant SARS-CoV 3CL ^pro in the collected fraction was concentrated to about 10 mg / ml by ultrafiltration (Millipore). At this time, buffer exchange using buffer F was performed.

As described above, about 7 mg of recombinant SARS-CoV 3CL ^pro was purified from 27 ml of the reaction mixture of the cell-free protein synthesis system. On the other hand, according to the disclosure of Non-Patent Document 3, it is considered that a large amount of cell culture is required to obtain about 7 mg of recombinant SARS-CoV 3CL ^pro when expressed in E. coli and purified. (Id., Figure 1 (d)).

FIG. 9 is a diagram showing the results of SDS-PAGE of purified recombinant SARS-CoV 3CL ^pro . Each lane shows:
“Lane 1”: molecular weight marker, “Lane 2”: supernatant from the reaction mixture after synthesis in a cell-free protein synthesis system (SARS-CoV 3CL ^pro sample before purification), “Lane 3”: purified Recombinant SARS-CoV 3CL ^pro sample

Moreover, the band shown by the arrow in FIG. 9 is the band of SARS-CoV 3CL ^pro .
As shown in FIG. 9, SARS-CoV 3CL ^pro was successfully purified completely by the method described above.

4). Viral protease activity of SARS-CoV 3CL ^pro The viral protease activity of the recombinant SARS-CoV 3CL ^pro purified in Section 3 above was measured.

The substrate used was a peptide consisting of Nma-TSAVLQSGFRK (Dnp) -NH2 (SEQ ID NO: 19). The peptide is a partial amino acid sequence on the N-terminal side of 3CL ^pro (nsp5) in two polyproteins (pp1a and pp1ab) of SARS-CoV and an amino acid sequence (TSAVLQ / SGFRK: "/" Is the cutting point). Note that an Nma group and a Dnp group are added to the N-terminus and C-terminus of the peptide, respectively.
The buffer was prepared as a stock solution (62.5 mM Tris-HCl, pH 7.3, 1.25 mM DTT).

The reaction solution composition of the assay was as follows.
Final concentration (total volume: 200 μl)
(1) 50 mM buffer (50 mM Tris-HCl, pH 7.3, 1 mM DTT)
(2) 0 ~ 200nM recombinant SARS-CoV 3CL ^pro
(3) 100 μM substrate
(4) Distilled water (DW): Up to the total capacity

First, 160 μl of buffer stock solution was added to each well of a 96-well microtiter plate. DW was then added to each well followed by a solution containing recombinant SARS-CoV 3CL ^pro . Further, 20 μl of 1 mM substrate solution was added to each well, and the solution in the well was mixed.

  After incubation for 10 minutes, the fluorescence intensity (Ex = 340 nm, Em = 440 nm) was measured with a fluorescence spectrometer (TECAN).

Similarly, a fusion protein in which GPLG (SEQ ID NO: 20) or GP is linked to the N-terminus of SARS-CoV 3CL ^pro (hereinafter referred to as “GPLG-SARS-CoV 3CL ^pro ” and “GP-SARS-CoV 3CL ^pro ”, respectively) The viral protease activity was also measured.

In addition, GPLG-SARS-CoV 3CL ^pro and GP-SARS-CoV 3CL ^pro were produced as follows.

Using the DNA containing GPLG-SARS-CoV 3CL ^pro as a template with a plasmid containing DNA (cDNA: SEQ ID NO: 4) encoding SARS-CoV 3CL ^pro (amino acid sequence: SEQ ID NO: 5), and using the following primers: Amplified by PCR.

Forward primer:
5'-GGTGGATCCGGTTTTAGGAAAATGGCATTCCCGTC-3 '(SEQ ID NO: 21)
Reverse primer:
5'-GTCCTCGAGTCATTGGAAGGTAACACCAGAGC-3 '(SEQ ID NO: 22)

The PCR conditions were the same as those when the DNA encoding SARS-CoV 3CL ^pro was amplified.

  Subsequently, the obtained PCR product was cleaved with restriction enzymes BamHI and XhoI. On the other hand, pGEX-6P-1 vector (GE Healthcare) was similarly cleaved with restriction enzymes BamHI and XhoI.

The cleaved PCR product was introduced between the BamHI cleavage site and XhoI cleavage site of the pGEX-6P-1 vector, cloned, and an expression vector having a DNA encoding GPLG-SARS-CoV 3CL ^pro was constructed.

In addition, DNA encoding GP-SARS-CoV 3CL ^pro was prepared by an oligonucleotide-directed mutagenesis method using the above-described expression vector having DNA encoding GPLG-SARS-CoV 3CL ^pro as a template. The primers used were as follows.

Forward primer:
5'-GGAAGTTCTGTTCCAGGGGCCCTCCGGTTTTAGGAAAATGGC-3 '(SEQ ID NO: 23)
Reverse primer:
5'-GCCATTTTCCTAAAACCGGAGGGCCCCTGGAACAGAACTTCC-3 '(SEQ ID NO: 24)

The PCR conditions were the same as those when the DNA encoding SARS-CoV 3CL ^pro was amplified.

Using each of the expression vector having the DNA encoding GPLG-SARS-CoV 3CL ^pro and the expression vector having the DNA encoding GP-SARS-CoV 3CL ^pro produced as described above, E. coli BL21 was transformed, The protein of was expressed.

The obtained transformant (Escherichia coli) was disrupted, and GPLG-SARS-CoV 3CL ^pro and GP-SARS- using an affinity gel for purification of GST fusion protein (GE Healthcare) and UnoQ (Bio Rad) column chromatography. CoV 3CL ^pro was completely purified. The thus-purified GPLG-SARS-CoV 3CL ^pro and GP-SARS-CoV 3CL ^pro were used for measurement of viral protease activity.

The viral protease activities of recombinant SARS-CoV 3CL ^pro , GPLG-SARS-CoV 3CL ^pro and GP-SARS-CoV 3CL ^pro are shown in FIG. The vertical axis in FIG. 10 is the fluorescence intensity (F) generated by the cleavage of the substrate. On the other hand, the horizontal axis represents the incubation time (minutes) starting from mixing with the substrate. In FIG. 10, “WT” is a recombinant SARS-CoV 3CL ^pro , “GP-WT” is a GP-SARS-CoV 3CL ^pro , and “GPLG-WT” is a GPLG-SARS-CoV 3CL ^pro . .

As shown in FIG. 10, it was revealed that the enzyme activity of recombinant SARS-CoV 3CL ^pro was considerably higher than that of GP-SARS-CoV 3CL ^pro and GPLG-SARS-CoV 3CL ^pro .

Non-Patent Document 3 discloses the protease activity of recombinant SARS-CoV 3CL ^pro expressed in Escherichia coli and a fusion protein having an additional sequence at the N-terminus or C-terminus of the recombinant SARS-CoV 3CL ^pro. (Id., Table 3). Compared with the results in Table 3 of Non-Patent Document 3, the enzyme activities of the recombinant SARS-CoV 3CL ^pro , GP-SARS-CoV 3CL ^pro and GPLG-SARS-CoV 3CL ^pro produced in this example are almost the same. It was the same.

[Comparative Example 1] Expression of recombinant SARS-CoV 3CL ^pro in E. coli
pET29a / SARS-3CLP WT was used to transform E. coli (BL21 (DE3)). The transformant thus prepared (BL21 (DE3) / pET29a / SARS-3CLP WT strain) is added to LB / ampicillin liquid medium, cultured with shaking at 37 ° C., and the target protein is induced by IPTG, and then transformed into E. coli. Was used to express SARS-CoV 3CL ^pro .

In the same manner, pET29a / SARS-3CLP-C145A was used to transform E. coli to express SARS-CoV 3CL ^pro- C145A.

The results are shown in FIG. FIG. 11 shows the results of SDS-PAGE of SARS-CoV 3CL ^pro and SARS-CoV 3CL ^pro- C145A synthesized in E. coli and a cell-free protein synthesis system. The results shown in FIG. 11 (A) are the results of SDS-PAGE of SARS-CoV 3CL ^pro and SARS-CoV 3CL ^pro- C145A synthesized in E. coli, and the results shown in FIG. 11 (B) are in the cell-free protein synthesis system. It is the result in SDS-PAGE of the synthesized SARS-CoV 3CL ^pro and SARS-CoV 3CL ^pro -C145A. Note that FIG. 11B is the same as FIG.

Each lane in FIG. 11A shows the following.
“Lane WT”: lysate derived from transformant (E. coli) using pET29a / SARS-3CLP WT, “Lane C145A”: derived from transformant (E. coli) using pET29a / SARS-3CLP-C145A Lysate

Further, the band indicated by an arrow in FIG. 11A is a band of SARS-CoV 3CL ^pro -C145A that is not cut due to non-processing.

As shown in FIG. 11, the expression level of SARS-CoV 3CL ^pro was low in E. coli. However, in Escherichia coli, SARS-CoV 3CL ^pro- C145A was expressed by mutating active residues and losing activity. This was thought to be because the active SARS-CoV 3CL ^pro stimulated some mechanism in E. coli and was degraded.

[Reference Example 1] Substrate specificity of SARS-CoV 3CL ^pro
A crystal structure analysis of a SARS-CoV 3CL ^Pro- C145A mutant that is correctly processed at the N-terminus and has a C-terminal adjacent sequence (SEQ ID NO: 14) of 10 residues at the C-terminus Since the C-terminal region was bound to the active site of the adjacent asymmetric unit in the crystal, this was considered to indicate a mode of substrate recognition as well as self-processing.

In the three-dimensional structure model of SARS-CoV 3CL ^Pro bound to the substrate peptide shown in Fig. 12, the N-terminal side is shown with a blue backbone from the cleavage site of the substrate to be cleaved, and the C-terminal side is shown with a red backbone. Shown with a stick. The enzyme side is shown by a surface model, and the Ala residue corresponding to the active residue C145 is shown in yellow. Here, in the amino acid sequence of the substrate peptide (SEQ ID NO: 19), amino acid residues are defined as P1, P2, P3,... Sequentially from the cleavage point to the upstream (N-terminal side). On the other hand, amino acid residues are defined as P1 ′, P2 ′, P3 ′... In order from the cleavage point to the downstream (C-terminal side).

Non-patent document 1 discloses the substrate specificity of SARS-CoV 3CL ^pro (same document, Fig. 6).

  Comparing the results shown in FIG. 12 with FIG. 6b of Non-Patent Document 1, the specificity of P4, P3, P2, P1, P1 ′, and P2 ′ can be well explained from the structure of FIG. However, the specificity of P3 ′ is low in Non-Patent Document 1, whereas the presence of a pocket to which a side chain binds was found on the three-dimensional structure. Therefore, recognition of the P3 ′ site is also important at least for self-processing. It became clear that there was.

It is a figure which shows the base sequence (sequence number 15) of DNA which codes SARS-CoV 3CL ^pro in pET29a / SARS-3CLP WT. It is a figure which shows the amino acid sequence of the fusion protein containing SARS-CoV 3CL ^pro encoded by pET29a / SARS-3CLP WT. FIG. 2 is a schematic diagram of fusion proteins encoded by pET29a / SARS-3CLP WT and pET29a / SARS-3CLP-C145A, respectively. It is a figure which shows the result in SDS-PAGE of SARS-CoV 3CL ^pro synthesize | combined with the cell-free protein synthesis system. It is a figure which shows the result in SDS-PAGE and Western blotting of SARS-CoV 3CL ^pro and SARS-CoV 3CL ^pro- C145A which were synthesize | combined with the cell-free protein synthesis system. It is a figure which shows the light absorbency waveform of the fraction by Econopack HighQ cartridge column chromatography. It is a figure which shows the light absorption waveform of the fraction by the isoelectric point chromatography using a Mono P 5/200 GL column. It is a figure which shows the light absorption waveform of the fraction by the gel filtration chromatography using a HiPrep 26/60 Sephacryl S-300 column. It is a figure which shows the result by SDS-PAGE of purified recombinant SARS-CoV 3CL ^pro . It is a characteristic view which shows the viral protease activity of recombinant SARS-CoV 3CL ^pro , GPLG-SARS-CoV 3CL ^pro, and GP-SARS-CoV 3CL ^pro . It is a figure which shows the result in SDS-PAGE of SARS-CoV 3CL ^pro and SARS-CoV 3CL ^pro- C145A which were synthesize | combined with E. coli and a cell-free protein synthesis system. This is a three-dimensional structure model of SARS-CoV 3CL ^pro bound to a substrate peptide.

Claims (9)

In a cell-free protein synthesis system, a fusion protein comprising a sequence containing an N-terminal recognition sequence, a viral protease involved in polyprotein processing, and a sequence containing a C-terminal recognition sequence in this order from the N-terminus. Expressing the fusion protein in which the N-terminal recognition sequence and the C-terminal recognition sequence are adjacent to the protease,
A method for producing a viral protease, wherein after the expression of the fusion protein, the protease is matured from the fusion protein by cleaving the N-terminal recognition sequence and the C-terminal recognition sequence of the protease.   The viral protease is a SARS coronavirus 3C-like cysteine protease, the N-terminal recognition sequence is the amino acid sequence represented by SEQ ID NO: 1, and the C-terminal recognition sequence is the amino acid sequence represented by SEQ ID NO: 2. The method of claim 1, wherein:   2. The method according to claim 1, wherein the cell-free protein synthesis system is an E. coli cell-free protein synthesis system.   A fusion protein comprising a sequence containing an N-terminal recognition sequence, a viral protease involved in polyprotein processing, and a sequence containing a C-terminal recognition sequence in this order from the N-terminus, the N-terminal recognition sequence A viral protease expression vector in a cell-free protein synthesis system, comprising a DNA encoding the fusion protein in which the C-terminal recognition sequence is adjacent to the protease.   The viral protease is a SARS coronavirus 3C-like cysteine protease, the N-terminal recognition sequence is the amino acid sequence represented by SEQ ID NO: 1, and the C-terminal recognition sequence is the amino acid sequence represented by SEQ ID NO: 2. The viral protease expression vector according to claim 4, wherein the vector is a viral protease expression vector.   The viral protease expression vector according to claim 4, wherein the cell-free protein synthesis system is an E. coli cell-free protein synthesis system.   A fusion protein comprising a sequence containing an N-terminal recognition sequence, a viral protease involved in polyprotein processing, and a sequence containing a C-terminal recognition sequence in this order from the N-terminus, the N-terminal recognition sequence And a cassette for expressing a viral protease in a cell-free protein synthesis system, wherein the C-terminal recognition sequence has a DNA encoding the fusion protein adjacent to the protease.   The viral protease is a SARS coronavirus 3C-like cysteine protease, the N-terminal recognition sequence is the amino acid sequence represented by SEQ ID NO: 1, and the C-terminal recognition sequence is the amino acid sequence represented by SEQ ID NO: 2. 8. The viral protease expression cassette according to claim 7, wherein the cassette is for expression of viral protease.   8. The viral protease expression cassette according to claim 7, wherein the cell-free protein synthesis system is an E. coli cell-free protein synthesis system.

Images