JP2009108091A - Metabolic syndrome non-human model animal - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a model animal useful for researching a metabolic abnormal syndrome state process, namely a metabolic syndrome non-human model animal exhibiting a metabolic abnormal syndrome with an excessive nutritive food, and to provide a new medicinal use of adiponectin. <P>SOLUTION: The metabolic syndrome non-human model animal in which all or a part of an adiponectin gene are deleted, inserted, or replaced by another gene at an arbitrary site is characterized by exhibiting the syndrome of the metabolic abnormal syndrome by the intake of an excessive nutritive food. An endothelium-dependent hypertension-preventing/treating agent contains the adiponectin as an active ingredient. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a novel use of an adiponectin gene-deficient non-human animal. Specifically, the present invention relates to a novel use as a non-human model animal of metabolic abnormality syndrome of an adiponectin gene-deficient non-human animal, and a method for screening a substance that affects metabolic abnormality syndrome using the non-human animal model of metabolic abnormality syndrome .

  The present invention also relates to a novel use of adiponectin, and more particularly to a novel use as an active ingredient of an agent for preventing or improving hypertension, particularly endothelium-dependent hypertension.

  With the recent development of lifestyles such as high-fat diet and lack of exercise, an increase in lifestyle-related diseases such as diabetes, hypertension, and hyperlipidemia (lipid metabolism abnormality) has become one of the major social problems. Lifestyle-related diseases are said to be a group of diseases in which lifestyle habits such as eating habits, exercise habits, rest, smoking, and alcohol consumption are involved in the onset and progression.

  Diseases related to lifestyle such as diabetes (adult type), obesity, hyperlipidemia, hyperuricemia, cardiovascular disease, colon cancer, periodontal disease, etc. Diseases such as diabetes (adult), obesity, hyperlipidemia, and hypertension are related to smoking, and heart cancer such as lung shoulder squamous cell carcinoma, chronic bronchitis, emphysema, angina and myocardial infarction is related to smoking Diseases such as cardiovascular disease including periodontal disease and periodontal disease, and liver diseases such as alcoholic liver disease have been pointed out in relation to drinking habits.

  Regarding these diseases, even if the living environment is uniform, not all suffer from the same disease, but recent research has shown that it is based on the genetic constitution inherent in the patient, recently obesity, Genes that affect the onset and progression of cancer, diabetes, hypertension, hyperlipidemia, heart disease, and arteriosclerosis, and their polymorphisms have also been clarified.

  Since several risk factors are gathered for the promotion of arteriosclerosis such as obesity, diabetes, hypertension, lipid metabolism abnormality, myocardial infarction, etc., in recent years, in the clinical field, these are one syndrome (Multiple risk). There was a movement to be regarded as a factor syndrome, and following this movement, it was proposed in 1998 that the WHO (World Health Organization) named the syndrome as a metabolic syndrome. According to the proposal of WHO, patients with type 2 diabetes or impaired glucose tolerance (insulin resistance) are further affected by two or more risk factors among obesity, particularly visceral obesity (abdomen), lipid metabolism abnormality, hypertension, and microalbuminuria. It is decided to call it a metabolic abnormality syndrome.

  By the way, it is known that an inflammatory reaction is accompanied by vascular intima, endothelial cells, and smooth muscle cells, and the relationship between inflammation and the deposition of arterial wall of lipid components is attracting attention as one factor of the progression of arteriosclerosis (for example, And non-patent document 1). At this time, LDL in the blood is taken into the arterial wall by macrophages, whereby the macrophages that have taken in LDL are foamed, fat plaques accumulate in the arterial wall, and monocytes follow adhesion molecules and chemokines to follow the inner membrane. At the same time, it is said that a type of white blood cell lymphocyte also enters the intima together with macrophages and releases cytokines that increase the inflammatory activity of the arterial wall. In particular, tissue obesity is regarded as a common risk for insulin resistance and cardiovascular diseases (see, for example, Non-Patent Documents 2 and 3).

  Among several genes and polymorphisms that have been reported in connection with the onset of diabetes, PPARγ (peroxisome proliferator-activated receptor-γ), which is mainly considered to play an important role in adipocyte differentiation, mainly fat Although β-3 adrenergic receptors present in cells are known, it has been pointed out that there is a close relationship between adipose tissue volume and insulin action.

  Obesity and hyperlipidemia patients have insulin resistance and hyperinsulinemia, suggesting that changes in adipocyte function are deeply involved in the regulation of insulin action. In addition, the fact that the target of drugs that increase insulin sensitivity, such as thiazolidine derivatives, is PPARγ involved in transcriptional regulation in adipocytes, more closely links the relationship between adipose tissue and insulin sensitivity. Indeed, some plasma proteins such as leptin secreted from adipocytes, tumor necrosis factor-α (TNF-α), resistin and adiponectin are found in other tissues. It is known to affect insulin action.

  By the way, adiponectin is a secreted protein having a molecular weight of about 30 KDa that is specifically expressed in adipocytes (see, for example, Patent Document 1 and Non-Patent Document 4). This protein consists of 244 amino acid residues in the case of humans and 247 amino acid residues in the case of mice. In addition to having a complement Cqi globular domain on the C-terminal side, amino acid sequence similarity is also seen with type 8, type 10 collagen, precereberin, hibernation-regulated protein (hib) found in hibernating animals, etc. Yes, the three-dimensional structure is very similar to TNF-α.

  It is known that adiponectin in the circulating blood increases due to long-term calorie intake restriction, and conversely, adiponectin is low in severe obesity, hyperinsulinemia, hyperglycemia, and hyperlipidemia (for example, (See Non-Patent Document 5, etc.). It has been observed that hypoadiponectinemia occurs before the onset of hyperinsulinemia and diabetes, which are indicators of insulin resistance, in the onset of obese type 2 diabetes that develops due to overeating and lack of exercise in monkeys (For example, see Non-Patent Document 14 etc.). A low plasma concentration of adiponectin has been found in obese individuals with coronary artery disease (see, for example, Non-Patent Documents 6 and 7).

  Furthermore, the morbidity rate of cardiovascular disease death is known to be higher in patients with renal insufficiency who have low plasma adiponectin levels compared to humans with high plasma adiponectin levels (eg, non-patent literature). (Refer to 8). Further, it has been reported that when the inner skin of the arterial wall is damaged by balloon angioplasty, faster adiponectin infiltration is observed in the subendothelial space of the blood vessel wall (see, for example, Non-Patent Document 9). thing). Furthermore, in tissue culture, adiponectin has been reported to reduce adhesion of monocytes to endothelial cells by reducing the expression of adhesion molecules on endothelial cells (see, for example, Non-Patent Document 10). It has been found that adiponectin has the action of suppressing the proliferation of vascular smooth muscle cells by various growth factors, such as the phagocytic ability of macrophages and TNF-α production are also reduced (for example, see Non-Patent Documents 10 and 11, etc.). (See, for example, Non-Patent Document 20). As a result, adiponectin secreted from adipose tissue suppresses adhesion of monocytes to vascular endothelial cells, and interacts with various types of collagen in the vascular subendothelium, and at the same time, macrophage foamed endothelial cells, macrophages It is thought to exhibit an anti-arteriosclerotic action by inhibiting smooth muscle cell proliferation and migration by growth factors secreted from the body. In addition, adiponectin has been suggested to have the effect of preventing or ameliorating arteriosclerosis based on arterial vascular disorders such as angina pectoris and myocardial infarction based on the growth inhibitory action of smooth muscle (for example, (See, for example, Patent Document 2), usefulness as a monocyte cell growth inhibitor and anti-inflammatory agent is also shown (see, for example, Patent Document 3).

  Furthermore, it has been reported that adiponectin functions as an insulin sensitivity-enhancing hormone and improves certain diabetic conditions from the data that supplementation of adiponectin to a diabetes model mouse improves the diabetes (for example, non-patent literature) (See 13, 15, 16 etc.).

  The adiponectin mRNA expression level is decreased in obese model mice such as ob / ob mice and human obese patients. The human Acrp30 gene is present at 3q27, which is a responsible locus for diabetes, and a significant correlation has been observed between the single nucleotide polymorphism of this gene, insulin resistance, and blood adiponectin concentration (for example, non-patented). (See Reference 25 etc.).

  The present inventors have previously made a gene-deficient mouse deficient in the adiponectin gene and reported that it exhibits insulin resistance, impaired glucose tolerance, and arteriosclerosis (see, for example, Non-Patent Documents 17 to 19). ) In human arterial smooth muscle cells (HASMCs), adiponectin suppresses proliferation and migration induced by various growth factors including PDGF-AA, PDGF-BB, HB-EGF, and bFGF (for example, Non-Patent Document 12 and (See 20). In addition, the present inventors previously reported that the proliferation of neovascular intima of smooth muscle cells in arteries after catheter-induced detachment in mice was promoted by adiponectin gene disruption and conversely suppressed by its overexpression. (For example, see Non-Patent Document 20 etc.). Vascular endothelium dysfunction affects the occurrence of myocardial ischemia and is a key to the development of arteriosclerosis and thrombosis, which is a major etiology and cause of death in overeating people, obesity, insulin resistance It is characterized by pathological conditions such as diabetes, hypertension and abnormal lipid metabolism (for example, see Non-Patent Documents 21 to 23). Further, vascular endothelial dysfunction has been observed in the early stage of arteriosclerosis (see, for example, Non-Patent Documents 22 to 23).

Recently, transgenic mice that overexpress the 11β-HSD-1 enzyme (11β-hydroxysteroid dehydrogenase type 1) gene specifically in adipose tissue have been created as transgenic mice for visceral fat-type obesity / metabolic disorder syndrome. . The transgenic mice have increased 11β-HSD-1 enzyme activity and increased tissue glucocorticoid levels as observed in obese and hereditary obese mice, visceral fat obesity and insulin-resistant diabetes, The onset of hyperlipidemia has been confirmed, and it has been reported that it exhibits hyperleptinemia despite overeating and has a property that the expression of adiponectin is significantly suppressed (for example, non-patented) (Refer to Document 26).
Peter, L.L. , Nikkei Science, August issue, 46-55 (2002) Spiegelmann, B.M. M.M. Flier, J .; S. , Cell, Vol. 104, 531 (2001) Friedman, J .; M.M. , Nature, Vol. 404, 632 (2000) Maeda, k. , Et al. , B. B. R. C. , 221 (2) 286-289 (1996) Weyer, C.I. , Et al. , J. et al. Clin. Endocrinol, Metab. , 86, 1930-1935 (2001) Ouchi, N .; , Et al. , Circulation, Vol. 100, 2473-2476 (1999) Arita, Y. et al. , Et al. , Biochem, Biophys, Res, Commun. , Vol. 257, 79-83 (1999) Zoccali, C.I. , Et al. , J. et al. Am. Soc. Nephrol. , Vol. 13, 134 (2002) Okamoto, Y .; et al. Horm, Metab, Res. , Vol. 32, 47-50 (2000) Ouchi, N .; , Et al. , Circulation, Vol. 102, 1296-1301 (2000) Ouchi, N .; , Et al. , Circulation, 103, 1057-1063 (2001) Arita, Y. et al. , Et al. , Circulation, 105, 2893-2998 (2002). Berg, A.A. H. , Nature Medicine, 7 (8) 947-953 (2001). Hotta, K.M. , Et al. , Diabetes, 50, 1126-1133 (2001) Fleubis, J. et al. , Et al. , Proc. Natl. Acad. Sci. USA, 98, 2005-2010 (2001) Yamauchi, T .; Et al. , Nature Med. , 7, 941-946 (2001); Kubota, N.A. , Et al. , J. et al. Biol. Chem. , 277, 25863-25866 (2002) Maeda, N .; , Et al. , Nature Medine, 8, 731-737 (2002). Ma, K .; , Et al. , J. et al. Biol. Chem. , 277, 34658-34661 (2002) Matsuda, M .; , Et al. , J. et al. Biol. Chem. , 277, 37487-37491 (2002)). Ross, R.D. , N.A. Engl. J. et al. Med. , 340, 115-126 (1999) Luscher, hT. F. , N.A. Engl. J. et al. Med. , 330, 1081-1083 (1994) Vita, J .; A. Keanyy, J .; F. , Circulation, 106, 640-642 (2002) Harrison, D.D. G. , J. et al. Clin. Invest. , 100, 2153-2157 (1997) Hara K. et al. , Diabetes 51, 536-540 (2002) Masuzaki, H.M. , Et al. , Science, Vol. 294, 2166-2170 (2001) Sata, M.M. , Nature Med. , Vol. 8, 403 (2002) Hotamisligil, G.H. H. , Et al. , Science, 259, 87-91 (1993). Komai, N .; , Et al. , Am. J. et al. Hypertension. , 15, 499-506 (2002)) Karas, R.A. H. et al. , Circ. Res. , 89, 534-599 (2001) PCT International Publication WO 96/39429 PCT International Publication WO99 / 21577 Japanese Patent No. 3018186

  The purpose of the present invention is to elucidate further physiological functions of the adiponectin gene and its expression product, to elucidate various pathological conditions involving adiponectin, or to study new therapeutic methods and new therapeutic uses for treating the pathological conditions There is to do.

  More specifically, the object of the present invention is to use adiponectin gene-deficient non-human animal as a model useful for the study of metabolic disorders having risk factors such as obesity, type 2 diabetes, dyslipidemia, and hypertension. It is to serve as an animal. Another object of the present invention is to provide a screening method for an active ingredient of a preventive or ameliorating agent for metabolic abnormality syndrome using the model animal. Furthermore, another object of the present invention is to provide an agent for preventing or improving endothelium-dependent hypertension comprising adiponectin as an active ingredient.

  The present inventors have studied the relationship between adiponectin and endothelium-dependent vasodilation in humans and mice, and although plasma adiponectin levels are significantly correlated with vasodilator response to reactive hyperemia, what is nitroglycerin-induced hyperemia? There was no correlation, which revealed a positive relationship between plasma adiponectin levels and endothelium-dependent vasodilation. In addition, as a result of analysis of vascular reactivity in the arterial ring in comparison between adiponectin-deficient mice and wild-type mice, adiponectin-deficient compared to wild-type mice when fed with a high-fat, high-sucrose, high-salt hypertrophic diet Body weight and systolic blood pressure were significantly increased in mice. And acetylcholine-induced vasorelaxation reflecting endothelial cell-dependent vasodilation was significantly reduced in adiponectin-deficient mice compared to wild-type mice. In contrast, sodium nitroprusside-induced relaxation, which induces endothelial cell-independent vasodilation, was not different between the two mice, and adiponectin-deficient mice showed impaired endothelium-dependent vasorelaxation. These results indicate that adiponectin acts as one important molecule that links overnutrition and endothelial dysfunction.

  In addition, these results suggest that a high concentration of adiponectin plays a role in the maintenance of endothelium-dependent blood pressure, and adiponectin may be useful as an active ingredient for preventing or improving endothelium-dependent hypertension. Sex was suggested.

  Furthermore, the adiponectin gene-deficient mice that exhibit metabolic disorder syndrome symptoms due to the intake of the above-mentioned overnutrition diet are non-human animal models of metabolic abnormality syndromes. Useful. Furthermore, it is considered that the non-human animal model of metabolic abnormalities can be effectively used for detection and selection of substances that affect various states of metabolic abnormalities and lifestyle-related diseases. The present invention has been completed based on such findings.

  That is, the present invention has a new use as a model animal useful for the study of metabolic disorders syndrome having risk factors such as obesity, type 2 diabetes, abnormal lipid metabolism, hypertension, etc., for non-human animals deficient in adiponectin gene. It is to provide. The present invention also provides a screening method for selecting a substance that affects various pathological conditions of metabolic abnormality syndrome using the model animal. Furthermore, the present invention provides a preventive or ameliorating agent for endothelium-dependent hypertension containing adiponectin as an active ingredient.

Specifically, the present invention includes the following embodiments:
Item 1. A non-human metabolic syndrome syndrome model in which all or part of the adiponectin gene is deleted, or another gene is inserted or replaced at any site, which is characterized by abnormal metabolic syndrome caused by overnutrition intake animal.
Item 2. Item 2. The non-human model animal with metabolic syndrome according to Item 1, which is a mouse.
Item 3. Item 3. The metabolic disorder syndrome non-human according to Item 2, which is a transformed mouse in which the genomic region corresponding to positions 38 to 268 of the mouse cDNA of adiponectin is deleted or the genomic region is substituted with another base sequence Model animal.
Item 4. Item 4. The non-human animal model of metabolic abnormality syndrome according to any one of Items 1 to 3, wherein the symptom of metabolic abnormality syndrome expressed by overnutrition diet intake is at least vascular endothelial dysfunction.
Item 5. Item 5. The non-human animal model of metabolic abnormality syndrome according to any one of Items 1 to 4, wherein the endothelium-dependent vasorelaxant action is reduced as compared to a normal animal.
Item 6. Item 6. A metabolic disorder syndrome non-human model animal according to any one of Items 1 to 5, which is used after ingestion of an overnutrition diet.

The above items 1 to 6 can be rephrased as the following items 1 ′ to 6 ′:
Item 1 '. All or part of the adiponectin gene is deleted, or another gene is inserted or replaced at any site, and the symptoms of metabolic disorder syndrome caused by ingestion of overnutrition diet Use as a human model animal.
Term 2 '. Use as a non-human model animal of metabolic abnormalities described in Item 1 ′, wherein the non-human animal deficient in an adiponectin gene is a mouse.
Item 3 '. The term wherein the adiponectin gene-deficient non-human animal is a transformed mouse in which the genomic region corresponding to positions 38 to 268 of mouse adiponectin cDNA has been deleted or the genomic region has been replaced with another nucleotide sequence Use as a non-human model animal of metabolic abnormalities described in 2 '.
Item 4 '. Item 4. The use as a non-metabolic syndrome non-human animal model according to any one of Items 1 ′ to 3 ′, wherein the symptom of metabolic syndrome expressed by overnutrition diet intake is at least vascular endothelial dysfunction.
Item 5 '. The use of an adiponectin gene-deficient non-human animal as a non-human animal model of metabolic disorder syndrome according to any one of Items 1 'to 4', wherein the endothelium-dependent vasorelaxing action is reduced as compared to a normal animal .
Item 6 '. Item 6. Use as a non-metabolic syndrome non-human model animal according to any one of Items 1 ′ to 5 ′, wherein the adiponectin gene-deficient non-human animal is used after ingestion of an overnutrition diet.

Item 7. A screening method for substances that affect metabolic abnormality syndrome having the following steps:
(A) a step of causing a non-human animal model of metabolic disorder syndrome according to any one of items 1 to 6 to ingest an overnutrition diet and expressing at least vascular endothelial dysfunction as a symptom of the metabolic disorder syndrome;
(B) a step of administering a test substance to the non-human animal model of metabolic abnormality syndrome obtained in the step (a), and (c) a non-human animal model of metabolic abnormality syndrome obtained in the step (b). A step of selecting a substance that affects metabolic syndrome from test substances using as an index the dependence of vascular relaxation or systolic blood pressure.
Item 8-1. Item 7. A non-human animal model of metabolic syndrome according to any one of Items 1 to 6, wherein when fed with an overnutrition diet, [1] at least an endothelium-dependent blood vessel compared to a corresponding wild-type non-human animal [2] insulin resistance, [3] neointimal formation, [4] vascular smooth muscle cell proliferation induced by injury, 5) A non-human animal in which at least one selected from the group consisting of tumor necrosis factor (TNF) and [6] serum free fatty acid is increased or increased is used as a non-metabolic syndrome non-human model animal, A screening method for a substance that affects metabolic abnormality syndrome, comprising performing steps (1) to (3):
(1) a step of administering a test substance to the non-human animal model of metabolic disorder syndrome;
(2) (B) to (F) corresponding to the test of (A) and the above [2] to [6] for the non-human animal model of metabolic abnormality syndrome obtained in the step (1) Performing any one of the tests;
(A) The endothelium-dependent vasorelaxant action or systolic blood pressure is measured and compared with the measured value of endothelium-dependent vasorelaxant action or systolic blood pressure of a non-human animal model of a control metabolic disorder syndrome that is not administered with a test substance. ,
(B) Insulin resistance is measured and compared with the insulin resistance of a non-human animal model of a control metabolic disorder syndrome in which the test substance is not administered.
(C) Measure the degree of neovascular intimal hyperplasia and compare it with the degree of neovascular intimal hyperplasia in a non-human animal model of a control metabolic disorder syndrome in which the test substance is not administered.
(D) Measure the degree of proliferation of vascular smooth muscle cells induced by injury, and compare with the degree of proliferation of vascular smooth muscle cells induced by injury of a control non-metabolic syndrome non-human model animal to which a test substance is not administered,
(F) measuring the tumor necrosis factor (TNF) concentration in blood and comparing it with the tumor necrosis factor (TNF) concentration in the blood of a control non-metabolic syndrome non-human model animal to which the test substance is not administered,
(G) The serum free fatty acid (FFA) concentration is measured and compared with the serum free fatty acid (FFA) concentration of a control metabolic syndrome syndrome model animal to which no test substance is administered.
(3) Based on the results of any of the tests (A) and (B) to (F) carried out in (2), compared with the control metabolic syndrome non-human animal model to which the test substance is not administered, The step of selecting a test substance administered to a non-human metabolic animal model of metabolic abnormality syndrome that exhibits any of the characteristics of (a) and (b) to (f) as a substance that affects the metabolic abnormality syndrome:
(A) Increase or suppression of endothelium-dependent vasorelaxation, or decrease or increase of systolic blood pressure (b) Decrease / inhibition of insulin resistance, or increase / increase (c) Hyperplasia of neointimal Decrease / suppression, or increase / increase (d) Decrease / suppression of vascular smooth muscle cell proliferation induced by injury, or increase / increase (e) Decrease / suppression of tumor necrosis factor (TNF) concentration in blood Or increase / increase (f) decrease / suppression or increase / increase of serum free fatty acid (FFA) concentration.
Item 8-2. A transformed mouse in which the genomic region corresponding to positions 38 to 268 of the mouse cDNA of adiponectin has been deleted, or the genomic region has been replaced with another nucleotide sequence; [1] At least endothelium-dependent vasorelaxation or decreased systolic blood pressure, and [2] insulin resistance, [3] neovascular At least one selected from the group consisting of membrane formation, [4] vascular smooth muscle cell proliferation induced by injury, [5] tumor necrosis factor (TNF), and [6] serum free fatty acid is enhanced or increased Of a substance that affects metabolic syndrome, including performing the following steps (1) to (3) using a non-human animal model of metabolic disorder as a non-human animal model Cleaning method:
(1) a step of administering a test substance to the non-human animal model of metabolic disorder syndrome;
(2) (B) to (F) corresponding to the test of (A) and the above [2] to [6] for the non-human animal model of metabolic abnormality syndrome obtained in the step (1) Performing any one of the tests;
(A) The endothelium-dependent vasorelaxant action or systolic blood pressure is measured and compared with the measured value of endothelium-dependent vasorelaxant action or systolic blood pressure of a non-human animal model of a control metabolic disorder syndrome that is not administered with a test substance. ,
(B) Insulin resistance is measured and compared with the insulin resistance of a non-human animal model of a control metabolic disorder syndrome in which the test substance is not administered.
(C) Measure the degree of neovascular intimal hyperplasia and compare it with the degree of neovascular intimal hyperplasia in a non-human animal model of a control metabolic disorder syndrome in which the test substance is not administered.
(D) Measure the degree of proliferation of vascular smooth muscle cells induced by injury, and compare with the degree of proliferation of vascular smooth muscle cells induced by injury of a control non-metabolic syndrome non-human model animal to which a test substance is not administered,
(F) measuring the tumor necrosis factor (TNF) concentration in blood and comparing it with the tumor necrosis factor (TNF) concentration in the blood of a control non-metabolic syndrome non-human model animal to which the test substance is not administered,
(G) The serum free fatty acid (FFA) concentration is measured and compared with the serum free fatty acid (FFA) concentration of a control metabolic syndrome syndrome model animal to which no test substance is administered.
(3) Based on the results of any of the tests (A) and (B) to (F) carried out in (2), compared with the control metabolic syndrome non-human animal model to which the test substance is not administered, The step of selecting a test substance administered to a non-human metabolic animal model of metabolic abnormality syndrome that exhibits any of the characteristics of (a) and (b) to (f) as a substance that affects the metabolic abnormality syndrome:
(A) Increase or suppression of endothelium-dependent vasorelaxation, or decrease or increase of systolic blood pressure (b) Decrease / inhibition of insulin resistance, or increase / increase (c) Hyperplasia of neointimal Decrease / suppression, or increase / increase (d) Decrease / suppression of vascular smooth muscle cell proliferation induced by injury, or increase / increase (e) Decrease / suppression of tumor necrosis factor (TNF) concentration in blood Or increase / increase (f) decrease / suppression or increase / increase of serum free fatty acid (FFA) concentration.
Item 9. Item 9. A screening method for a substance that affects the metabolic abnormality syndrome according to Item 8, which is used as a screening method for an active ingredient of a prophylactic or improving drug for metabolic abnormality syndrome.
Item 10. The method for screening a substance affecting the metabolic disorder syndrome according to Item 9, wherein the following step is performed instead of the step (3) described in Item 8:
(3 ′) Based on the results of any of the tests (A) and (B) to (F) carried out in (2), compared with a non-human animal model of control metabolic syndrome where no test substance is administered A test substance administered to a non-human animal model of metabolic abnormality syndrome that exhibits any of the following characteristics (a ′) and (b ′) to (f ′) is used as an active ingredient of a prophylactic or ameliorating agent for metabolic abnormality syndrome Sorting process:
(A ′) Increase in endothelium-dependent vasorelaxation, or decrease in systolic blood pressure (b ′) Decrease / suppression of insulin resistance (c ′) Decrease / inhibition of neointimal hyperplasia (d ′ ) Decrease / suppression of proliferation of vascular smooth muscle cells induced by injury (e ′) Decrease / suppression of tumor necrosis factor (TNF) concentration in blood (f ′) Decrease of serum free fatty acid (FFA) concentration /Suppression.

  In the inventions according to the above items 8-1, 8-2, 9 and 10, “control metabolic disorder syndrome non-human animal model to which test substance is not administered” refers to non-metabolic syndrome syndrome non-human before administration of test substance Includes model animals. Therefore, for convenience, the inventions according to items 8-1, 8-2, 9 and 10 measure the respective characteristics of the same metabolic disorder syndrome non-human model animal after administration and before administration of the test substance, It can be implemented by evaluating the difference in contrast.

  Item 11. Substances that affect metabolic disorders are antihypertensive drugs, especially endothelium-dependent hypertension improvers, intimal thickeners, smooth muscle cell growth inhibitors, anti-arteriosclerosis improvers, anti-inflammatory drugs, tumor necrosis factor Item 9 which is any drug selected from the group consisting of a (TNF) production inhibitor, an insulin sensitizer, a glucose tolerance ameliorator, an obesity ameliorator, a lipid ameliorant, a tissue regeneration promoter, and an anticardiac agent Or 10. A screening method for a substance that affects the metabolic disorder syndrome described in 10.

Item 12. A hypertensive prophylaxis or amelioration agent comprising adiponectin as an active ingredient.
Item 13. An agent for preventing or ameliorating hypertension comprising the polypeptide described in (a) or (b) below as an active ingredient:
(A) a polypeptide having the amino acid sequence represented by SEQ ID NO: 1,
(B) A polypeptide comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence of (a) and having an endothelium-dependent vasodilatory action.
Item 14. Item 13. The agent for preventing or improving hypertension according to item 12, wherein adiponectin is a gene recombinant.
Item 15. Item 15. The hypertensive prophylaxis or amelioration agent according to any one of Items 12 to 14, wherein the hypertension is endothelium-dependent hypertension.

  ADVANTAGE OF THE INVENTION According to this invention, the non-human model animal of a metabolic abnormality syndrome which exhibits the symptom of a metabolic abnormality syndrome by ingestion of an overnutrition food can be provided.

  The non-human animal model of metabolic disorder is at least body weight and [1] endothelium-dependent vascular relaxation when fed a high-fat, high-sucrose, high-salt hypertrophic diet, compared to a wild-type non-human animal. The action is significantly decreased (systolic blood pressure is high), and [2] significant increase in insulin resistance, [3] significant thickening of neointimal, [4] induced by injury Significant increase in the degree of increase in vascular smooth muscle cell proliferation, [5] significant increase in tumor necrosis factor (TNF-α) concentration in blood, or [6] significant increase in serum free fatty acid concentration It has one of the characteristics.

  A test substance having an improving action or an enhancing action for each symptom of metabolic abnormality syndrome provided in the non-human model animal of metabolic abnormality syndrome administered with a high-fat, high-sucrose, high-salt supernutrient diet of the present invention is It is useful as a candidate compound for preventing / ameliorating abnormal syndrome. The screening method of affecting the metabolic abnormality syndrome of the present invention can be effectively used as a method for searching for candidate compounds for the preventive / ameliorating agent for the metabolic abnormality syndrome.

  In addition, according to the present invention, a novel use of adiponectin can be provided. In particular, according to the present invention, based on the newly found endothelium-dependent vasodilatory activity (endothelium-dependent vasorelaxant action) increasing action or promoting action, or hypotensive action, adiponectin is used for hypertension, particularly endothelium-dependent hypertension. The use as an active ingredient of the preventive / improving agent can be provided. A pharmaceutical composition comprising the adiponectin or a homologous polypeptide thereof as an active ingredient is effective for increasing or promoting the endothelium-dependent vasodilatory activity (endothelial-dependent vasorelaxation) of the active ingredient, or the antihypertensive effect. It is useful as a preventive / ameliorating agent, particularly as an agent for preventing / ameliorating endothelium-dependent hypertension. The pharmaceutical composition of the present invention has patients with hypertension, especially endothelium-dependent hypertension, coronary blood flow disorder, portal hypertension, endothelium-dependent vasorelaxation reaction disorder due to anti-cancer agents such as DXR, etc. It can be used as a preventive / ameliorating agent for patients.

(1) Definition of terms used in the present invention The abbreviations of amino acids, peptides, base sequences, nucleic acids, etc. in this specification are defined by IUPAC-IUB [IUPAC-IUB Communication on Biological Nomenclature, Eur. J. et al. Biochem. 138: 9 (1984)], “Guidelines for the preparation of specifications including base sequences or amino acid sequences” (edited by the Patent Office) and common symbols in the field.

  In addition, DNA synthesis, production of vectors containing exogenous genes (expression vectors), methods of transforming host cells using the vectors, methods of producing desired proteins using the host cells, etc. It can be easily carried out according to or according to genetic engineering techniques [Molecular Cloning 2d Ed, Cold Spring Harbor Lab. Press (1989); secondary biochemistry experiment course "gene research method I, II, III", Japanese Biochemical Society edition (1986) etc.].

  In the present invention, a gene is used to include not only double-stranded DNA but also each single-stranded DNA such as a sense strand and an antisense strand constituting the DNA, and the length is not limited at all. It is not a thing. Therefore, unless otherwise specified, the gene of the present invention includes double-stranded DNA containing animal genomic DNA, single-stranded DNA containing cDNA (sense strand), and 1 having a sequence complementary to the sense strand. Both double-stranded DNA (antisense strand) and fragments thereof are included.

  Further, in the present invention, unless otherwise specified, genes do not ask for distinction of functional regions such as leader sequences, coding regions, exons and introns, and include all. Examples of the polynucleotide include RNA and DNA. DNA includes all of cDNA, genomic DNA, and synthetic DNA, and a (poly) peptide comprising a specific amino acid sequence includes all of its equivalent effects (homologues, derivatives, mutants). The RNA includes single-stranded RNA and RNAi (double-stranded RNA).

  It should be noted that variants relating to genes and (poly) peptides include naturally occurring variants (for example, allelic variants) caused by mutations or post-translational modifications, natural genes or any part of the sequence of (poly) peptides. Variants created by artificial deletions, substitutions or additions (or insertions) are included.

(2) The adiponectin gene and its expression product The adiponectin gene is a gene that is specifically highly expressed in adipose tissue, which is known as one of the concepts of adipocytokines. The gene sequences are also known as apM1, Acrp30, AdipoQ and the like.

  The expression level of Acrp30 mRNA decreases in obese model mice such as ob / ob mice and human obese patients. The human Acrp30 gene is present at 3q27, which is a responsible locus for diabetes, and a significant correlation is observed between the single nucleotide polymorphism of this gene, insulin resistance, and blood adiponectin concentration (the above non-patent document). 13).

  In addition, adiponectin, which is an expression product thereof, is a secreted protein having a molecular weight of about 30 KDa (Non-patent Document 4). This protein consists of 244 amino acid residues for humans and 247 for mice, and has a complement Cqi-like globular domain on the C-terminal side. Its amino acid sequence is similar to type 8, 10 type collagen, precerebelin, hibernation-regulated protein (hib) found in hibernating animals, and the three-dimensional structure is very similar to TNF-α. ing.

(3) Metabolic abnormal syndrome non-human animal model (new use of adiponectin gene-deficient non-human animal)
The non-human animal model of metabolic abnormality syndrome targeted by the present invention is artificially mutated into an adiponectin genomic gene (or a gene related to transcription, translation and expression of adiponectin mRNA) of a non-human animal (non-human animal) ( Deletion, substitution, addition, insertion: Hereinafter, these mutations are collectively referred to as “deletions” in the present specification, whereby the expression ability of the gene is suppressed or lost, or the gene is The non-human animal (hereinafter referred to as adiponectin gene-deficient non-human animal or adiponectin gene deficiency) that manifests symptoms of metabolic disorders by ingesting an over-nutrition diet, with the activity of the encoded adiponectin being substantially suppressed or lost Also called non-human animals). In the present specification, an adiponectin gene-deficient non-human animal and an adiponectin gene-deficient non-human animal are used interchangeably.

  Here, the non-human animal is preferably a rodent such as a mouse or a rat that has a short ontogeny period and a life cycle and is relatively easy to reproduce in creating an animal model, but is not particularly limited thereto. Other mammals such as non-human rabbits, pigs, sheep, goats and cows are also included.

  Artificial alterations to the above-mentioned adiponectin genomic gene or genes related to its expression can be achieved by deleting the entire base sequence of the gene or shifting the codon reading frame by genetic engineering techniques. In order to destroy the function of the promoter or exon, it may be carried out by deleting a part of the base sequence of the above genomic gene or by inserting another gene at any site or replacing it with another gene it can. The artificial mutation method is described in, for example, Cytospecific Mutagenesis [Methods in Enzymology, 154, 350, 367-382 (1987); 100, 468 (1983); Nucleic Acids Res. , 12, 9441 (1984); genetic engineering techniques such as the Second Biochemistry Experiment Course 1 “Gene Research Method II”, edited by the Japanese Biochemical Society, p105 (1986)], the phosphate triester method, the phosphate amidite method, etc. Chemical synthesis means [J. Am. Chem. Soc. 89, 4801 (1967); 91, 3350 (1969); Science, 150, 178 (1968); Tetrahedron Lett. , 22, 1859 (1981); 24, 245 (1983)] and combinations thereof.

  The non-human animal model of metabolic abnormality syndrome of the present invention is characterized by exhibiting a metabolic abnormality syndrome symptom due to over-nutrition intake, compared to the wild type, based on the absence of the genomic gene of adiponectin. The model animal can be produced first according to the method disclosed in Maeda et al. (Non-patent Document 18). Specifically, for example, it can be prepared as follows: First, an adiponectin genomic gene of a target non-human animal is isolated, and the exon function is destroyed by inserting another gene into the exon part, or A DNA chain having a sequence constructed so that a complete messenger RNA cannot be synthesized by inserting a DNA sequence (for example, a polyA addition signal) that terminates gene transcription into an intron between exons. Abbreviated). This is introduced into the chromosome of the target non-human animal cell (embryonic stem cell) by a method such as electroporation to produce a recombinant embryonic stem cell. Next, for the obtained recombinant embryonic stem cells, adiponectin knockout embryonic stem cells in which the adiponectin gene has been disrupted are selected, injected into animal embryos, transplanted into the foster parent's uterus, and germline chimeric animals are obtained. Animals are mated with normal animals to create heterodeficient animals (+/−). Further, by crossing heterozygous mutants, homodeficient animals (-/-), that is, desired adiponectin gene-deficient non-human animals (knockout animals) that do not substantially encode adiponectin at both loci are obtained.

  In the above operation, the isolation of the target adiponectin genomic gene of the non-human animal can be performed using, for example, a known human adiponectin cDNA sequence (see Patent Document 1 above) (SEQ ID NO: 2: ORF region encoding human adiponectin) as a probe. It can be obtained by screening a genomic DNA library of a human animal, isolating a positive clone containing a protein coding region, inserting it into a vector, digesting with a restriction enzyme, and subcloning a chromosomal DNA containing a specific exon. For example, a mouse genomic DNA library can be prepared according to the method described in pages 100-112 of Lab Manual Genetic Engineering (published by Maruzen Co., Ltd., edited by Masaaki Muramatsu, 1990), and mouse adiponectin cDNA can be prepared, for example, Manual genetic engineering (published by Maruzen Co., Ltd., edited by Muramatsu Masami, 1990), pages 83-99 can be used.

  Further, as a method for confirming whether adiponectin of a non-human animal is a homologue of human adiponectin, chromosomal mapping of a non-human adiponectin cDNA clone is carried out by means of Radiation Hybrid Mapping (Cox, D. R., et al., Science, 250, 245-250 (1990)), the chromosome locus of the non-human adiponectin gene and whether or not the chromosome locus where the human homologous gene is present is a homologous region.

  Thus, an adiponectin genomic DNA clone is obtained from the above library, and this is used to destroy the structure of the target gene region for the preparation of the targeting vector.

  In creating a targeting vector, when inserting another gene into the exon portion of the adiponectin genomic gene, it is preferable to insert a gene that also functions as a selection marker (positive selection marker) for detecting a mutation in the adiponectin gene. Examples of such genes include neomycin resistance gene (hereinafter referred to as neo), drug resistance gene represented by hygromycin resistance gene, lacZ (β-galactosidase gene), and CAT (chloramphenicol acetyltransferase gene). A reporter gene etc. can be mentioned. A neomycin resistance gene (neo) is preferred. In this case, it can be determined that recombination has occurred by acquiring resistance to neomycin (or its analog G418). Furthermore, in order to eliminate random recombinants, genes that are lethal to cells, such as a diphtheria toxin A fragment gene (hereinafter referred to as “DT-A”) outside the homologous site so that positive-negative selection is possible. Is preferably introduced as a negative selection marker. The thus obtained targeting vector is introduced with a lethal gene by random recombination, and such cells become lethal. Therefore, by performing positive-negative selection using a positive selection marker and a negative selection marker in this way, it becomes possible to efficiently obtain homologous recombinants. In addition, insertion of these genes can be performed by a conventional DNA recombination technique in a test tube.

  In the practice of the present invention, when the non-human animal is a mouse, a specific site in the second exon region of the adiponectin gene (genome corresponding to the 38th to 268th positions of the adiponectin cDNA) is deleted, It is preferable that a selection marker gene is inserted. Specifically, a neomycin resistance gene and an SV40-derived poly A addition signal were linked downstream of MC1-neo-polyA (MC1 promoter (promoter consisting of a polyoma virus-derived mutant enhancer sequence and a thymidine kinase gene promoter sequence) as a positive selection marker. Things: Thomas, KR & Capechi.MR: Site-directed mutations by gene targeting in-embryo-derived stem cells .: Cell, 51, 503, Negative, 501 -DT-A (diphtheria toxin A fragment ligated downstream of MC1 promoter: Yagi, T. et al. A novel negative selection for homologous recombinants using diphtheria toxin A fragment:. Analyt Biochem, 214, 77, (1993)) is preferably used.

  In the examples described later, the SnaBI-AatII fragment (7 kb) upstream and the second VspI-EcoRI fragment (1.4 kb) upstream of the second exon as homologous regions, and pKO Select Neo (manufactured by Lexicon Genetics) as the positive selection marker. Homologous substitution was performed using pKOSelect DTA (manufactured by Lexicon Genetics) as a negative selection marker. The mouse adiponectin genomic gene that is a target for the preparation of the adiponectin gene-deficient non-human animal of the present invention is a gene consisting of at least three exons. In the examples described later, the region containing the second exon part is homologously substituted with the neomycin resistance gene, but the present invention is not limited to this. Alternatively, homologous substitution with a gene such as a neomycin resistance gene or deletion may be performed.

As an embryonic stem cell into which the targeting vector obtained by the above method is introduced, for example, an established embryonic stem cell may be used, or a new one according to the known Evans and Kaufmann method (Nature, 292, 154 (1981)). It may be established. For example, in the case of mouse embryonic stem cells, 129-type embryonic stem cells are generally used. However, the present invention is not limited to this, and in order to obtain embryonic stem cells that are pure and immunologically clear in genetic background, for example, the number of eggs collected from C57BL / 6 mice and C57BL / 6 is referred to as DBA / 2. Embryonic stem cells established using BDF1 mice (F1 of C57BL / 6 and DBA / 2) improved by crossing can be used well. Such embryonic stem cells have C57BL / 6 mice in the background in addition to the advantages of BDF1 mice that have a large number of eggs collected and strong eggs, so when a pathological model mouse is created from now on, it crosses back with C57BL / 6 mice. This can be advantageously used in that the genetic background can be changed to C57BL / 6 mice.
In addition, when establishing embryonic stem cells, blastocysts 3 to 5 days after fertilization are generally used, but in addition to that, many blastocysts can be efficiently obtained by collecting eggs and culturing them to blastocysts. It is also possible to obtain early embryos. Either male or female embryonic stem cells may be used, but male embryonic stem cells are usually more convenient for producing germline chimeras.

In order to introduce a targeting vector into an embryonic stem cell, it is necessary to culture and maintain the embryonic stem cell in an undifferentiated state so as to maintain the ability to differentiate into a germ cell. For this purpose, suitable vegetative cells are added to the medium as feeder cells, human LIF (Leukemia Inhibitory Factor) is added, and fetal calf serum, nucleosides, non-essential amino acids, 2-mercaptoethanol, etc. are added and cultured. It takes a thing. Preferred examples of vegetative cells (feeder cells) include STO cells (ATCC deposit number: CRL-1503) or mouse fetal fibroblasts. The addition concentration of vegetative cells (feeder cells) is 2.5 × 10 ⁵ cells / ml (10 ml / 100 mm culture dish, 2 ml / 35 mm culture dish, 4 ml / 60 mm culture dish, 0.5 ml / well: 24-well plate, etc.) ) Is preferred. The concentration of human LIF added is preferably 10 ³ units / ml, but may be higher. The addition concentration of fetal calf serum is preferably 20%, and the addition concentration of nucleoside is preferably 10 to 30 nM. As the non-essential amino acid, for example, a non-essential amino acid solution manufactured by Gibco is preferable, and the concentration is preferably 0.1 mM each. The concentration of 2-mercaptoethanol is preferably 0.1 mM.

  In order to introduce a targeting vector into embryonic stem cells by electroporation, embryonic stem cells are suspended in a buffer solution at a constant concentration, and a targeting vector that has been linearized by treatment with an appropriate restriction enzyme is added, Using an appropriate electroporation apparatus such as ECM600 (manufactured by BTX) or Gene Pulser (manufactured by Bio-Rad), for example, electroporation can be performed at 270 V / 1.8 mm, 250 V / 4 mm, and 500 μF. preferable. As the buffer, it is preferable to use PBS or the like whose pH is adjusted to 7.0. The restriction enzyme can be selected in consideration of the restriction enzyme site of the targeting vector.

  After introducing the targeting vector, embryonic stem cells are cultured in the above medium for 24-48 hours, and then replaced with a medium containing G418 (Geneticin: manufactured by Sigma). The medium is replaced with fresh G418 supplemented medium every day, and the culture is continued for about one week. Next, so-called adiponectin knockout embryonic stem cells into which the targeting vector has been introduced can be carried out by proliferating drug (G418) resistant embryonic stem cells in the above medium and isolating homologous recombinants from the resulting G418 resistant clones. it can.

  Homologous recombinants can be detected by Southern hybridization analysis using DNA having a sequence complementary to the nucleotide sequence on or near the adiponectin gene or a DNA sequence on the targeting vector other than the adiponectin gene used for the preparation of the targeting vector. It can be carried out by PCR analysis using DNA having a sequence complementary to the nucleotide sequence of the neighboring region as a primer. Specifically, DNA is extracted from a part of G418-resistant clones grown on the above-mentioned G418-added medium. After extraction of the genomic DNA, restriction enzyme treatment is performed, agarose electrophoresis is performed, and then Southern hybridization is performed using the genome of the adiponectin gene as a probe. Thus, if a fragment of the targeting vector can be detected, it is proved that the embryonic stem cell is a clone (hetero-deficient embryonic stem cell) in which one allele of the target adiponectin gene has undergone homologous recombination with the targeting vector.

  Subsequently, the production of a transgenic non-human animal having a germline chimeric animal and a modified gene having a disrupted adiponectin gene can be performed as follows.

  First, the hetero-deficient embryonic stem cells obtained above are injected into an embryo of a target non-human animal and transplanted to the uterus of a temporary parent. Here, blastocysts are used as animal embryos because they are suitable for chimera formation. About 10 to 15 embryonic stem cells are usually injected. In this way, the embryo into which the embryonic stem cells have been injected is immediately transferred to the foster parent's uterus. A chimeric animal is selected from the offspring born from the temporary parents who become pregnant by the above method. Chimera animals with a high contribution rate of embryonic stem cells are likely to be germline chimera animals. However, by mating the chimera animals with normal animals and using the color of the resulting offspring as an indicator, the germline chimera Confirmation that it is an animal is possible.

  Thus, a hetero-deficient animal can be obtained by mating a germline chimeric animal with a normal animal, and a homo-deficient animal in which both adiponectin alleles are disrupted can be obtained by mating the hetero-deficient animals.

  The thus obtained transgenic non-human animal, which is a homo-deficient animal, is deficient in the adiponectin gene and can be used as the metabolic abnormality syndrome model animal of the present invention.

  In the above, as a method for producing a non-human animal deficient in adiponectin gene expression, a targeting vector having an inactivated adiponectin gene fragment is introduced into a mouse embryonic stem cell or mouse egg cell, and the mouse embryonic stem cell or mouse egg cell on the chromosome Although the method of destroying the adiponectin gene by homologous recombination with the adiponectin gene has been described, other methods can be employed to have the same effect.

  The non-human animal model of metabolic disorders according to the present invention thus prepared is adiponectin whose gene is adiponectin compared to the same kind of non-human animal having a normal adiponectin gene due to inactivation (including deletion) of the adiponectin gene. Is not expressed or is expressed but its expression level is reduced (expression failure). In addition to the above-mentioned characteristics, the non-human animal model of metabolic syndrome can be obtained by ingesting a high fat, high sucrose, high salt supernutrient diet as shown in the examples below. In comparison, body weight and systolic blood pressure are significantly increased, and endothelium-dependent vasorelaxant action is significantly decreased. That is, the metabolic disorder syndrome non-human model animal exhibits a metabolic disorder syndrome, unlike the wild-type non-human animal, by ingesting an overnutrition diet. The property of the metabolic disorder syndrome non-human model animal can be effectively used to study the metabolic disorder syndrome process. For the above-mentioned desired purpose, the non-human animal model of metabolic disorder syndrome of the present invention preferably has a high-fat, high-sucrose, high-salt high-nutrient diet to form a metabolic disorder syndrome state. Used from

  Administration of a high-fat, high-sucrose, high-salt supernutrient diet to the non-human animal model of the metabolic disorder syndrome of the present invention can be achieved, for example, by giving the animal a supernutrient diet (eg, 30% fat, 15% sucrose, 8% (Contains salt) for about 4 weeks. Non-human model animals with metabolic disorders that have been fed an overnutrition diet have the characteristics that at least endothelium-dependent vasorelaxation is significantly reduced and systolic blood pressure is high compared to wild-type non-human animals. ing. In addition, non-human model animals with metabolic disorders that have received the overnutrition diet are induced by significantly increased insulin resistance, significant thickening of the neointima, and injury compared to wild-type non-human animals. Any increase in vascular smooth muscle cell proliferation, a significant increase in tumor necrosis factor (TNF-α) concentration in the blood, or a significant increase in serum free fatty acid concentration is observed.

  The use of the non-metabolic syndrome non-human model animal of the present invention enables research on risk factors for metabolic disorders such as obesity, hypertension, type 2 diabetes (increased insulin resistance), and abnormal lipid metabolism (hyperlipidemia) and arteries. Studying the initial state of sclerosis and affecting the endothelium-dependent vasorelaxant action or systolic blood pressure, which is related to these risk factors, and further, insulin resistance, neointimal formation, vascular smooth muscle cell proliferation It can be used for detection and selection of substances that affect the amount of tumor necrosis factor or serum free fatty acid in blood and tissues.

  Each characteristic of the non-human animal model of metabolic syndrome is evaluated by various macroscopic findings, X-ray findings, optical microscopic findings, immunohistochemical findings, biochemical findings (usually used in this field) For example, blood pressure, blood glucose level, blood insulin level, total cholesterol, HDL-cholesterol, neutral fat, free fatty acid, C-reactive protein (CRP), urinary albumin, etc.), body weight measurement, etc. can be used. . Specifically, for example, a method of using an automatic blood pressure meter in the caudal artery can be used for blood pressure measurement. In addition, examples of methods for evaluating vascular endothelial function include vasodilatory invasive methods using intravascular Doppler and non-invasive methods for measuring changes in vascular diameter using limb strain gauge plethysmography. it can.

  As a method for evaluating the endothelium-dependent vasorelaxing action, a test animal, for example, a non-human animal model of metabolic disorders according to the present invention (preferably high fat, high sucrose, high salt supernutrient diet is consumed for 2 to 4 weeks. After immersing the thoracic aorta site in any culture medium, equilibrating the artery ring using an isometric transducer, and determining the maximum contraction with norepinephrine A method of calculating the degree of relaxation by measuring the response of blood vessels when acetylcholine, nitroprusside sodium, or the like is cumulatively added can be mentioned. The relaxation ratio can be calculated from the maximum relaxation (100%) by papaverine. In the present invention, the endothelium-dependent vasorelaxant action means that the acetylcholine-induced vasorelaxation response varies according to the above test (the degree of vasorelaxation is increased / increased or suppressed / decreased), but induced by nitroprusside sodium. The vasorelaxant response by is not changed (not affected by the induction of sodium nitroprusside). In the present invention, the increase / increase in the endothelium-dependent vasorelaxant action means that the vasorelaxant action is increased (relaxation ratio is increased), and that the blood vessel is dilated or has a good vascular response. To do. In other words, it can be said that the vascular resistance to the blood flow is reduced, and as a result, the blood pressure (systolic blood pressure) is reduced. Conversely, suppressing / reducing endothelium-dependent vasorelaxant action means that the vasorelaxant action becomes smaller (relaxation ratio becomes smaller), which means that the blood vessels are contracted or vasoactive. To do. In other words, it can be said that the vascular resistance to the blood flow increases, and as a result, blood pressure (systolic blood pressure) increases.

  Insulin resistance refers to the presence or absence of a decrease in the expression of insulin action in the body, regardless of mechanism or cause. It means that the action expression of insulin in the living body is decreased or the degree of the decrease is high. Such insulin resistance can be measured and evaluated by a conventional insulin resistance test (insulin sensitivity test) (see Non-Patent Document 18, pages 736).

  More specifically, for a non-human model animal (for example, adiponectin homo-deficient mouse) at 10 weeks of age and a normal non-human animal (wild-type non-human animal, for example, mouse), Insulin tolerance test (Insulin Tolerance Test) is performed after ingesting a sucrose and high salt supernutrient diet for about 2 to 4 weeks, and an insulin resistance index (Insulin-resistance index) is measured together. Here, in the insulin resistance test, an arbitrary unit of insulin is administered into the abdominal cavity of each non-human animal, and then the blood glucose level is measured at 15, 30, and 60 minutes. The blood glucose level in the blood can be usually measured using a commercially available blood glucose measurement kit.

  When a significant delay is observed in a non-human model animal (eg, a mouse) having a metabolic syndrome compared to a normal non-human animal with respect to a blood glucose lowering effect 30 minutes or 60 minutes after insulin administration (significant difference: eg, a student P <0.05) is determined as “insulin resistant” for the non-human animal model of metabolic syndrome. When it is found that there is not a significant difference in the delay in the blood glucose lowering effect by insulin administration, it is recognized that “insulin resistance is increased”. In addition, the insulin resistance index is the same as described above, after ingesting a supernutrient diet for 2 to 4 weeks, glucose was orally administered at a rate of 2 mg / g body weight, and blood glucose level and blood insulin level were determined. Insulin resistance index can also be determined by measuring over time (Glucose Tolerance Test). Here, the blood glucose level and the insulin level can be usually measured using a commercially available blood glucose measurement kit and insulin measurement kit. The insulin resistance index can be calculated by the product of the areas shown by the curve of blood glucose level and blood insulin level over time according to the glucose tolerance test described above, and these test methods were performed with reference to the description of Yamauchi et al. (Non-Patent Document 16). In this test method, the larger the insulin resistance index, the stronger the insulin resistance (the lower the insulin sensitivity).

  In this test, if there is a failure in the decrease in blood glucose level after insulin administration as described above, or if there is a delay in the decrease compared to the decrease in blood glucose level in normal non-human animals, insulin resistance To be judged. These increases in insulin resistance may be a sign that represents an early stage of type 2 diabetes.

  Neointimal hyperplasia (thickening) refers to the degree of thickening of the neointima of an artery after a blood vessel or the like has been injured. Usually, the extent of neovascular intima hyperplasia (thickening) is determined by immunohistochemical staining of α-smooth muscle actin in the intima and media after 2 to 3 weeks after the vessel is damaged. The area of the tissue identified by smooth muscle actin-positive smooth muscle cells can be quantitatively measured by morphometry by comparing with an image processing or the like. A method for comparing the degree of neovascular intimal hyperplasia (thickening) can be performed by a conventional method, and can be performed, for example, according to the method described in Sata et al. (Non-patent Document 27).

  More specifically, high fat, high sucrose, preferably non-human animal models (eg, adiponectin homo-deficient mice) and normal non-human animals (wild-type non-human animals such as mice) After ingesting a high-salt supernutrient diet for 2-4 weeks, a bi-directional femoral artery trauma is applied to the femoral artery using a linear spring wire (diameter 0.36 m). The vascular endothelium is then exposed to cause neointimal hyperplasia. Two to three weeks after the vascular injury, each non-human animal is anesthetized, both femoral arteries are perfused and fixed with 10% formalin, and the tissue is embedded in paraffin. Following paraffin embedding, parallel sections of the femoral artery are excised and stained with hematoxylin-eosin. The excised femoral artery smooth muscle cells can be identified by immunostaining for α-smooth muscle actin using a primary antibody. The area of the intima and media and the I / M ratio (intima / media area ratio) in the injured artery can be measured using, for example, image analysis software (MacSCOPE).

  In this method, the increase / increase (aggravation) of neovascular intima hyperplasia (thickening) is identified by smooth muscle cells as compared to normal non-human animals (wild-type non-human animals). It means that the area of the tissue is increasing. Conversely, reduction / inhibition (improvement) of neovascular intimal hyperplasia (thickening) is an intimal tissue identified by smooth muscle cells compared to normal non-human animals (wild-type non-human animals). This means that the area of is decreasing.

  In this test, it goes without saying that the increase / increase (aggravation) of neovascular intima hyperplasia (thickening) is strongly related to the progression of arteriosclerosis in a sense. Substances that affect metabolic syndrome are different when compared to control non-human animals that do not administer the area of smooth muscle cells of the model animals when administered to non-human metabolic animals It is a substance that produces A substance that decreases the area of the intimal tissue can be a candidate substance as an active ingredient of a neovascular intimal hyperplasia improving agent or a metabolic abnormality syndrome preventing / ameliorating agent.

  In addition, the degree of proliferation of vascular smooth muscle cells induced by injury refers to the degree of proliferation of smooth muscle cells in arterial tissue after being damaged in blood vessels or the like, specifically, normal non-human animals ( It can be evaluated from the difference compared with wild type non-human animals. More specifically, it can be measured as follows: test animals such as non-metabolic syndrome non-human model animals (such as adiponectin homo-deficient mice) and normal non-human animals (wild-type non-human animals such as mice) ), Preferably a high fat, high sucrose, high salt overnutrition diet for 2-4 weeks and then using a straight spring wire (diameter 0.36 m) to the femoral artery Apply bilateral femoral artery trauma. The vascular endothelium is then exposed to cause neointimal hyperplasia. For each non-human animal, 100 μg / g bromodeoxyuridine (BrdU) is administered intraperitoneally every 24 hours until the femoral artery is obtained following vascular injury. Two to three weeks after the vascular injury, each non-human animal is anesthetized, both femoral arteries are perfused and fixed with 10% formalin, and the tissue is embedded in paraffin. Following paraffin embedding, a parallel section of the femoral artery is excised, and the section is immunostained using a BrdU staining kit (eg, Oncogene Research Products) to label the section with immunohistochemistry. To detect the degree of proliferation of vascular smooth muscle cells. About the section | slice from each obtained structure, the ratio of the BrdU dye | stained cell and the non-stained cell in the smooth muscle cell in a neointimal can be measured, and the proliferation index of a vascular smooth muscle cell can be calculated | required. The degree of proliferation of vascular smooth muscle cells can be calculated by dividing the number of BrdU-stained cells by the number of unstained cells according to the method and literature (Non-patent Document 30).

  That the degree of proliferation of vascular smooth muscle cells induced by injury is reduced / suppressed is the value obtained by dividing the number of BrdU-stained cells by the number of unstained cells compared to normal non-human animals (wild-type non-human animals). Indicates a low value. Conversely, the degree of proliferation of vascular smooth muscle cells induced by injury increases / increases when the number of BrdU-stained cells divided by the number of unstained cells is compared to that of normal non-human animals (wild-type non-human animals). Thus, a high value is indicated, which may indicate that the initial stage of progression of arteriosclerosis is enhanced.

  Furthermore, the tumor necrosis factor (TNF) concentration in blood is preferably high in non-metabolic syndrome non-human model animals (eg, adiponectin homo-deficient mice) and normal non-human animals (wild-type non-human animals, eg, mice). It can be determined by measuring the concentration of tumor necrosis factor (TNF) in the blood of both animals after ingesting a diet of fat, high sucrose, and high salt overnutrition for 2-4 weeks. The concentration of tumor necrosis factor (TNF-α) in blood can be determined from the ratio of tumor necrosis factor (TNF-α) in the blood that reacts with a commercially available anti-tumor necrosis factor (TNF-α) antibody. . Such measurement can be performed, for example, using a commercially available mouse TNF-α ELISA KIT (product code: KMC3012: manufactured by Biosource). And, the decrease in the tumor necrosis factor (TNF) concentration in blood means that the tumor necrosis factor (TNF) concentration in the metabolic disorder syndrome non-human model animal determined by the above measurement is a normal non-human animal (wild type non-human). When compared with the concentration of the animal), the compared difference indicates a negative value (minus% with respect to the normal non-human animal) as compared to the normal non-human animal (wild-type non-human animal). The increase / increase in blood tumor necrosis factor (TNF) value is a larger value compared to normal non-human animals (wild-type non-human animals) (plus% relative to normal non-human animals). ). TNF-α is said to inhibit peripheral insulin action and cause arteriosclerosis / inflammation, and TNF-α secreted from accumulated adipose tissue inhibits increased glucose utilization in muscle, adipose tissue, and liver However, it is said that abnormal sugar and lipid metabolism is caused through insulin resistance in obesity (Non-patent Document 28). Therefore, the increase / increase in the blood tumor necrosis factor (TNF) value means an increase in insulin resistance, an increase in abnormal sugar / lipid metabolism, a progress in arteriosclerosis, and an increased inflammatory condition. Conversely, reduction / inhibition of blood tumor necrosis factor (TNF) concentration means improvement or improvement of insulin resistance, improvement or improvement of abnormal sugar / lipid metabolism, improvement of arteriosclerosis, or improvement. It may be said that it represents an improvement or a trend of improvement in trend and inflammatory conditions.

  The serum free fatty acid (FFA) concentration is preferably higher in high-fat, high-shock, non-metabolic syndrome non-human model animals (such as adiponectin homo-deficient mice) and normal non-human animals (wild-type non-human animals such as mice). After ingesting a supernutrient diet of sugar and high salt for 2 to 4 weeks, the concentration of serum free fatty acid (FFA) in the serum of both animals is measured using a commercially available biochemical test kit that is generally used. Can be determined. Serum free fatty acid (FFA) concentration in serum is reduced / suppressed when serum free fatty acid (FFA) concentration of metabolic disorder syndrome non-human model animal obtained by the above measurement is normal non-human animal (wild-type non-human animal) When compared with this concentration, it means that the compared difference shows a negative value (minus% with respect to normal non-human animals) as compared to normal non-human animals (wild-type non-human animals). The serum free fatty acid (FFA) concentration in serum is increased / increased as compared to a normal non-human animal (wild-type non-human animal) having a larger value (positive for normal non-human animal). %).

  Serum free fatty acid (FFA) is an important material for energy metabolism in the periphery, and excess free fatty acid reacts with sugar alcohol to produce neutral fat and become stored fat. Excess free fatty acids can cause obesity and abnormal lipid metabolism. From this, it may be said that an increase / increase in the value of serum free fatty acid (FFA) concentration in serum is expressed as an initial state of obesity or lipid metabolism abnormality now or in the future. It may also be said that the decrease / suppression of the value of serum free fatty acid (FFA) concentration in serum is expressed as an initial state for improving obesity at present or in the future, or an initial state for improving abnormal lipid metabolism. .

  The non-human animal model of metabolic disorders of the present invention is effectively used to study lifestyle-related diseases such as metabolic disorders and arteriosclerosis having risk factors such as obesity, type 2 diabetes, abnormal lipid metabolism, and hypertension. be able to. For example, a non-human animal model of metabolic disorder syndrome of the present invention is fed a high-fat, high-sucrose, high-salt supernutrient diet to express symptoms of metabolic disorder syndrome, and then administered a test substance, By investigating the improvement or deterioration of the test substance, it can be used to select a substance that has an influence (good effect, adverse effect) on the pathological condition of the metabolic abnormality syndrome from the test substance. Specifically, such a method comprises administering a test substance to a non-human animal model of metabolic syndrome that has been fed an overnutrition diet, followed by endothelium-dependent vasorelaxation or systolic blood pressure, insulin resistance, neovascularization This can be done by experimentally or clinically evaluating either intimal formation, vascular smooth muscle cell proliferation, the amount of tumor necrosis factor in blood or tissue, or the amount of serum free fatty acids. In this way, it becomes possible to select a substance (candidate substance) effective as an agent for improving / preventing metabolic abnormality syndrome from the test substance.

  Substances that affect metabolic syndrome include hypertension improving agents, particularly endothelium-dependent hypertension improving agents, intimal thickening improving agents, smooth muscle cell proliferation suppressing agents, anti-arteriosclerosis improving agents, anti-inflammatory agents, Examples include tumor necrosis factor (TNF) production inhibitor, insulin resistance improving drug, glucose tolerance improving drug, obesity improving drug, lipid improving drug, tissue regeneration promoting drug and anticardiogenic drug.

(4) Metabolic abnormality syndrome Non-human model animal detection method for substances affecting metabolic abnormality syndrome (screening method)
The present invention provides a method for detecting a substance that affects the metabolic abnormality syndrome using the above-described non-human animal model of metabolic abnormality syndrome of the present invention. According to the detection method, a substance (improvement / prevention substance) that may improve the pathological condition of the metabolic abnormality syndrome by affecting the metabolic abnormality syndrome state is selected and obtained from the test substances. it can. Further, according to the above detection method, a substance (exacerbation / progressive substance) that may develop the pathology of metabolic abnormality syndrome can be selected and determined from test substances, and the substance can be determined in advance by specifying the substance. Can be prevented, and can contribute to prevention of deterioration of metabolic syndrome.

The method for detecting or screening for a substance affecting the metabolic disorder syndrome of the present invention comprises the following steps:
(A) a step of causing a non-human animal model of metabolic disorder to ingest a supernutrient diet to express at least vascular endothelial dysfunction as a symptom of metabolic disorder;
(B) a step of administering a test substance to the non-human animal model of metabolic abnormality syndrome obtained in the step (a), and (c) a non-human animal model of metabolic abnormality syndrome obtained in the step (b). A step of selecting a substance that affects metabolic syndrome from test substances using as an index the dependence of vascular relaxation or systolic blood pressure.

Alternatively, the method for detecting or screening for a substance affecting a non-human animal model of metabolic disorder syndrome according to the present invention is [1] at least endothelium-dependent as compared to the corresponding wild-type non-human animal by ingesting an overnutrition diet. Vascular smooth muscle cells induced by injury [2] insulin resistance, [3] neovascular intima formation, [4] injury Using a non-human animal model of metabolic abnormality syndrome in which at least one selected from the group consisting of proliferation, [5] tumor necrosis factor (TNF), and [6] serum free fatty acid is enhanced or increased, the following 1 ) To 3) can be carried out by carrying out the steps:
1) a step of administering a test substance to the above-mentioned metabolic disorder syndrome non-human model animal;
2) The test of (A) and any of (B) to (F) corresponding to the above [2] to [6] for the non-human animal model of metabolic abnormality syndrome obtained in the step 1) Performing a test for
(A) A control non-human animal model of metabolic syndrome that includes endothelium-dependent vasorelaxant action or systolic blood pressure and does not administer the test substance (including non-human animal model of metabolic syndrome prior to administration of the test substance) Contrast with measurements of endothelium-dependent vasorelaxation or systolic blood pressure of
(B) Insulin resistance is measured and compared with the insulin resistance of a non-human animal model of a control metabolic disorder syndrome (including a non-human animal model of metabolic syndrome prior to administration of the test substance) to which the test substance is not administered,
(C) New blood vessels of non-human animal model of control metabolic syndrome (including non-human animal model of metabolic syndrome before administration of test substance) in which the degree of hyperplasia of neovascular intima is measured and test substance is not administered Contrast with the degree of hyperplasia of the intima,
(D) A measure of proliferation of vascular smooth muscle cells induced by injury, and a non-human animal model of a metabolic disorder syndrome that is not administered with a test substance (including a non-human animal model of metabolic syndrome before administration of the test substance) In contrast to the degree of proliferation of vascular smooth muscle cells induced by injury)
(F) The measurement of the tumor necrosis factor (TNF) concentration in blood and the control non-human animal model of metabolic syndrome (including non-human animal model of metabolic syndrome prior to administration of the test substance) to which the test substance is not administered Contrast with blood tumor necrosis factor (TNF) concentration,
(G) Serum free fatty acid (FFA) concentration is measured, and serum free fatty acid in a control metabolic syndrome syndrome model animal (including non-metabolic syndrome syndrome non-human model animal before administration of the test substance) in which the test substance is not administered (FFA) Contrast with concentration,
3) Based on the results of the tests (A) and (B) to (F) carried out in 2), a control non-human animal model of metabolic syndrome without administration of the test substance (before administration of the test substance) A test substance administered to a non-metabolic syndrome non-human model animal that exhibits any of the following characteristics (a) and (b) to (f) Screening as a substance that affects abnormal syndrome:
(A) Increase or suppression of endothelium-dependent vasorelaxation, or decrease or increase of systolic blood pressure (b) Decrease / inhibition of insulin resistance, or increase / increase (c) Hyperplasia of neointimal Decrease / suppression, or increase / increase (d) Decrease / suppression of vascular smooth muscle cell proliferation induced by injury, or increase / increase (e) Decrease / suppression of tumor necrosis factor (TNF) concentration in blood Or increase / increase (f) decrease / suppression or increase / increase of serum free fatty acid (FFA) concentration.

  Here, as the metabolic disorder syndrome non-human model animal, the above-mentioned metabolic disorder syndrome non-human model animal of the present invention can be used, preferably an adiponectin gene-deficient mouse, particularly preferably an adiponectin homo-deficient mouse. More preferably, it is a transformed mouse in which the genomic region corresponding to the 38th to 268th positions of the mouse cDNA of adiponectin is deleted or the genomic region is replaced with another nucleotide sequence.

  The substance that can be a test substance is not particularly limited, and examples thereof include nucleic acids, peptides, proteins, organic compounds, and inorganic compounds. Specifically, a sample (test sample) containing a substance that can be a test substance is administered to a non-human animal model of metabolic syndrome. Examples of such test samples include, but are not limited to, nucleic acid-containing vehicles (such as vectors and cells), cell extracts, gene library expression products, synthetic low or high molecular compounds, synthetic peptides, or natural plant extracts. Is done. Preferable examples include nucleic acid-containing vehicles including nucleic acids, peptides or proteins, cell extracts, synthetic peptides, or expression products of gene libraries. These include adiponectin and derivatives thereof, partial fragments of adiponectin, and thiazoline derivatives.

  As shown in the examples, the metabolic syndrome syndrome non-human model animal fed with a high fat, high sucrose, high salt supernutrient diet is deficient in any part of the adiponectin genomic gene, [1] Endothelium-dependent vasorelaxing action is reduced or systolic blood pressure is increased as compared to wild-type non-human animals having normal adiponectin genomic genes. Furthermore, compared to wild-type non-human animals, [2] insulin resistance, [3] neointimal formation, [4] vascular smooth muscle cell proliferation induced by injury, [5] tumor necrosis factor ( TNF) and [6] Serum free fatty acids are either enhanced or increased. From this finding, [1] endothelium-dependent blood vessels for non-human animal models of metabolic disorders (preferably non-human animal models of metabolic disorders that have been fed a high-fat, high-sucrose, high-salt supernutrient diet) Reduced relaxation effect or improved systolic blood pressure (increased endothelium-dependent vasorelaxation or decreased systolic blood pressure to be equal to or greater than that of wild type non-human animals), and above Improve at least one of [2] to [6], preferably 2 or more, more preferably 3 or more, 4 or more, and even more preferably all 5 (decrease enhancement / increase of [2] to [6] The substance that makes it equal to or greater than that of wild-type non-human animals) lacks the adiponectin genomic region and is metabolized by ingesting a high-fat, high-sucrose, high-salt supernutrient diet Abnormal syndrome / Initial Stage (especially obesity, hypertension, insulin resistance, type 2 diabetes, dyslipidemia, coronary artery disease, arteriosclerosis) or slow the progression of, or believed to be useful as active agents for improving. That is, the screening method of the present invention is characterized by the characteristics of the non-human model animal (wild Compared with type non-human animals, [1] endothelium-dependent vasorelaxing action is reduced or systolic blood pressure is increased, and any of [2] to [6] is increased or increased For a substance that can be converted into a corresponding characteristic of a normal non-human animal, and further, the obtained substance is an active ingredient of a prophylactic / therapeutic drug for metabolic disorders It is provided as a candidate compound.

Specifically, candidate compounds can be selected as follows. That is, a test substance is administered to a non-human animal model of metabolic syndrome that has been fed a high-fat, high-sucrose, high-salt supernutrient diet, [1] endothelium dependence Vasorelaxant (endothelial-dependent vasodilatory), or changes in systolic blood pressure, [2] insulin resistance, [3] degree of neovascular intimal hyperplasia, [4] vascular smooth muscle cells induced by injury [5] Blood tumor necrosis factor (TNF-α) concentration, [6] Serum free fatty acid (FFA) concentration was measured, and each characteristic was compared before and after administration. Candidate compounds are selected from the test substances by using the test substance as an indicator that the non-human animal model of metabolic abnormality syndrome shows any one of (a) and (b) to (c):
(A) Increase (increase) in endothelium-dependent vasorelaxant action (endothelium-dependent vasodilator action), or decrease in systolic blood pressure,
(B) reduction or improvement of insulin resistance (c) reduction or suppression of neointimal hyperplasia,
(D) reduction or suppression of the degree of proliferation of vascular smooth muscle cells induced by injury,
(E) reduction or suppression of blood tumor necrosis factor (TNF) concentration, or
(F) Reduction or suppression of serum free fatty acid (FFA) concentration.

  Preferred candidate compounds exhibit the effects (b) to (f) as much as possible, and preferably 2 or more, more preferably 3 or more, still more preferably 4 or more, and most preferably all 5 effects. Is.

  Endothelium-dependent vasorelaxation (endothelial-dependent vasodilatory), or systolic blood pressure, insulin resistance, degree of neovascular intimal hyperplasia, degree of vascular smooth muscle cell proliferation induced by injury, tumor in blood Wound necrosis factor (TNF-α) concentration and serum free fatty acid (FFA) concentration can be measured by conventional methods. Specifically, it can be measured according to the method described in the column (1) above (see also non-patent literature and patent literature).

  The candidate compound selected by the above method is a drug efficacy test, safety test, obesity, hypertension, insulin resistance, type 2 diabetes using other non-human metabolic animal models or lifestyle-related disease models. In addition, it may be subjected to clinical trials for patients suffering from metabolic disorders such as abnormal lipid metabolism, and more practical preventive / ameliorating drugs can be obtained by conducting these tests. The substance thus selected can be industrially produced by chemical synthesis, biological synthesis (fermentation), or genetic manipulation based on the structural analysis result.

(5) Polypeptide containing active agent for preventing or ameliorating hypertension of the present invention The present invention provides a pharmaceutical composition that is effectively used for preventing or ameliorating hypertension. The hypertension targeted by the present invention is preferably endothelium-dependent hypertension.

  The polypeptide (hereinafter, also simply referred to as “the polypeptide of the present invention”) which is an active ingredient for the agent for preventing or improving hypertension of the present invention comprises (a) the amino acid sequence represented by SEQ ID NO: 1, or (b ) A polypeptide comprising an amino acid sequence in which one or more amino acids are deleted, inserted, substituted or added in SEQ ID NO: 1, and having an endothelium-dependent vasodilatory action or a hypotensive action.

  The polypeptide of the present invention is, for example, human cells, particularly human adipocytes, vascular endothelial cells, smooth muscle cells, fibroblasts, hepatocytes, cardiomyocytes, epithelial cell adipose tissue, or human tissues, particularly vascular endothelial cells, It may be a human cell or tissue-derived polypeptide isolated from adipose tissue, arterial blood vessels, liver, portal vein blood vessels, heart, granulation tissue, or a polypeptide obtained by synthesis according to the amino acid sequence information. There may be.

  The amino acid sequence of the polypeptide of the present invention is not limited to that represented by SEQ ID NO: 1, and can have a certain homology with this. The homology is, for example, about 80% or more, preferably about 95% or more, more preferably about 98% or more. However, such a polypeptide having an amino acid sequence having a certain homology needs to have an endothelium-dependent vasodilatory action or an antihypertensive action substantially the same as the polypeptide having the amino acid sequence represented by SEQ ID NO: 1. Here, “substantially the same quality” means that the action is the same in nature (for example, physiochemically or pharmacologically). Quantitative factors such as the degree of endothelium-dependent vasodilatory action or antihypertensive action may be different.

  In addition, in the above (b), the “amino acid sequence in which one or more amino acids are deleted, inserted, substituted or added in the amino acid sequence represented by SEQ ID NO: 1” is the amino acid sequence represented by SEQ ID NO: 1. The degree of amino acid modification, ie, “deletion, insertion, substitution or addition” and the positions thereof are such that the polypeptide comprising the modified amino acid sequence is the same as the polypeptide comprising the amino acid sequence represented by SEQ ID NO: 1. There is no particular limitation as long as it has the same effect. The degree of modification is usually preferably about 1 to several. Here, the homogeneous action has the above-mentioned meaning. More preferably, as an action of the same quality as the polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 1, in addition to the endothelium-dependent vasodilatory action or the antihypertensive action, for example, antigenicity and immunogenic activity of the protein are exemplified. Can do.

  The endothelium-dependent vasodilatory action of the polypeptide of the present invention is an endothelium-dependent vasodilator in a reduced state of endothelium-dependent vasodilation (endothelium-dependent vasorelaxation), which is a symptom of hypertension, particularly endothelium-dependent hypertension. It is exemplified as including the action of promoting or increasing the diastolic activity (vascular relaxation action). The endothelium-dependent vasodilatory action measures the vasodilator response by an invasive method using an intravascular Doppler, and promotes or increases endothelium-dependent vasodilatory activity (vasorelaxant action) based on a decrease in blood flow. Endothelium using a method of evaluation or a non-invasive method of measuring changes in blood vessel diameter (method by limb strain gauge plethysmography), for example, a method similar to the method of Komai et al. It can be evaluated by a method of measuring the reactivity of the dependent vasodilation reaction (endothelium-dependent vasorelaxation reaction). In this method, the forearm blood flow was expanded by cuff expansion at 300 mmHg pressure for 5 minutes using a strain gauge plethysmograph (volume fluctuation recorder) as shown in the examples described later, and then the pressure was released and reactive hyperemia. Maximum forearm blood flow is measured as a post-ischemic vasodilator response to. The reactive hyperemia / baseline value of the forearm blood flow is calculated as the reactive hyperemia ratio partially reflecting the endothelial cell-dependent vasodilation, and then 0.3 mg of nitroglycerin is sprayed with one spray with a spray device. Administer below and measure maximum brachial blood flow as nitroglycerin-induced hyperemia. The nitroglycerin-induced hyperemia / baseline value of forearm blood flow is measured as a nitroglycerin-induced hyperemia ratio that partially reflects endothelial cell-independent vasodilation. For example, by comparing the change in reactivity before and after substance administration, whether nitroglycerin-induced hyperemia does not depend on forearm blood flow reactivity, and whether it depends on changes in post-ischemic vasodilator response to reactive hyperemia By doing so, the reactivity of the endothelium-dependent vasodilatation reaction (endothelium-dependent vasorelaxation reaction) can be measured.

  In addition, as a method for evaluating endothelium-dependent vasorelaxing action (endothelium-dependent vasodilator response) in vitro, for example, a thoracic aorta site of a non-human animal model of metabolic syndrome is immersed in an arbitrary culture solution, Use isometric transducers to equilibrate the arterial ring, determine the maximum contraction with norepinephrine, and then measure the vascular response when acetylcholine, nitroprusside sodium, etc. are added cumulatively. Thus, a method for measuring the degree of relaxation can be mentioned. The relaxation ratio can be calculated from the maximum relaxation (100%) by papaverine. In the present invention, the endothelium-dependent vasorelaxant action indicates an increase / increase or suppression / decrease in vasorelaxation by acetylcholine having an endothelium-dependent vasodilator action, but has an endothelium-independent vasodilator action. Nitroprusside sodium indicates vascular reactivity that does not affect vascular relaxation. The decrease in the endothelium-dependent vasorelaxant action means that the acetylcholine-induced vasorelaxant action is reduced as compared to the wild-type non-human animal.

  Therefore, the increase or increase in the endothelium-dependent vasorelaxant action means that the vasorelaxant action increases (relaxation ratio increases), which means that the blood vessel is dilated or has a good vascular response, in other words. In other words, it can be said that vascular resistance to blood flow is reduced. As a result, blood pressure (systolic blood pressure) decreases. Conversely, suppression / reduction of endothelium-dependent vasorelaxant action means that the vasorelaxant action becomes smaller (relaxation ratio becomes smaller), which means that the blood vessel contracts or the vascular reactivity decreases. In other words, it can be said that vascular resistance to blood flow increases. As a result, it means that blood pressure (systolic blood pressure) increases.

The homology of the polypeptide is determined by analyzing the amino acid sequence of the polypeptide or the base sequence of the polynucleotide encoding the polypeptide using sequence analysis software such as FASTA program (Clustal, V., Methods Mol. Biol. , 25, 307-318 (1994)). The most preferable and simple method for homology search is an amino acid sequence or a base encoding the same in a computer-readable medium (for example, floppy disk, CD-ROM, hard disk drive, external disk drive and DVD). The sequence is stored and then the sequence database is searched using well-known search means using the stored sequence. Specific examples of public databases include:
DNA Database of Japan (DDBJ) (http://www.ddbj.nig.ac.jp/);
Genebank (http://www.ncbi.nlm.nih.gov/web/Genebank/Index.html); and the European Molecular Biology Lab. / Ebib docs / embl db.html).

  Many different search algorithms are available to those skilled in the art, one example being a set of programs called a BLAST program. There are five BLAST instruments, three of which are designed for querying nucleotide sequences (BLASTN, BLASTX and TBLASTX) and two designed for querying protein sequences (BLASTP and TBLASTN) (Coulson, Trends in Biotechnology, 12: 76-80 (1994); Birren et al., Genome Analysis, 1: 543-559 (1997)). Additional programs, such as sequence alignment programs, programs for the identification of more distant sequences, are available in the art for analysis of identified sequences and are well known to those skilled in the art .

  The amino acids that can be substituted with each other are listed below. This information can be effectively used for the preparation of the polypeptide of the present invention obtained by modifying the amino acid sequence of SEQ ID NO: 1 while preserving the activity.

<Original amino acid residue conserved substitution amino acid residue>
Ala; Ser
Arg; Lys
Asn; Gln or His
Asp; Glu
Cys; Ser
Gln; Asn
Glu; Asp
Gly; Pro
His; Asn or Gln
Ile; Leu or Val
Leu; Ile or Val
Lys; Arg, Asn, or Glu
Met; Leu or Ile
Phe; Met, Leu or Tyr
Ser; Thr
Thr; Ser
Trp; Tyr
Tyr; Trp or Phe
Val; Ile or Leu.

Also, by substituting amino acids, for example,
a) the structural background of the polypeptide in the substituted region,
b) charge or hydrophobicity of the polypeptide at the target site,
c) Amino acid side chain size (volume).
Is known to change. The substitutions that are said to produce the greatest changes in protein properties include the following:
a) substituting a hydrophilic residue such as Ser or Thr with a hydrophobic residue such as Leu, Ile, Phe, Val or Ala,
b) Replacing Cys or Pro with any other residue,
c) replacing residues having electropositive side chains, eg Lys, Arg, His, with electronegative residues, eg Val or Asp,
d) Substituting a residue with a very large side chain, such as Phe, with no side chain such as Gly.

  As a specific example of the polypeptide as an active ingredient in the pharmaceutical composition of the present invention, a polypeptide encoded by a PCR product named “adiponectin” shown in the Examples described later can be mentioned. The full length DNA sequence of human adiponectin is 4517 bp and the DNA sequence encoding ORF is 732 bp as shown in SEQ ID NO: 2, and the amino acid sequence encoded by the ORF is as shown in SEQ ID NO: 1. It consists of a 244 amino acid sequence. The DNA sequence of mouse adiponectin is 1276 bp in total length, and the amino acid sequence encoded by ORF (741 bp) consists of a 247 amino acid sequence as shown in SEQ ID NO: 3. In addition, human and mouse adiponectin is specifically expressed in adipose tissue.

  The human and mouse adiponectin genes are disclosed in the above-mentioned Non-Patent Document 4 and Patent Document 2 as human Acrop30 and mouse Acrop30 in Patent Document 1 and human adiponectin as apM1. The polypeptide used as the active ingredient of the pharmaceutical composition of the present invention has a deduced amino acid sequence described in Patent Document 2, but in Patent Document 2, the usefulness of the polypeptide for preventing arteriosclerosis There is only a statement that it can be used as an improving agent, an inhibitory action on smooth muscle cell proliferation, an agent for preventing or treating restenosis after vascular reconstruction, and an anti-inflammatory agent. In addition, Patent Document 3 merely discloses the usefulness as a monocyte cell growth inhibitor and an anti-inflammatory agent. Furthermore, from the data that adiponectin supplementation in diabetic mice improves the diabetes, it has been reported that adiponectin is an insulin sensitivity-enhancing hormone and improves certain diabetic states (Non-Patent Document 13; Non-Patent Document 13). References 15-16). In human arterial smooth muscle cells (HASMCs), adiponectin is known to suppress proliferation and migration induced by various growth factors including PDGF-AA, PDGF-BB, HB-EGF, and bFGF. (Non-patent documents 12 and 20 above).

  Upon completion of the present invention, the present inventors have analyzed the forearm vascular reactivity of human patients with hypertension, diabetes, and hyperlipidemia by strain-gauge plethysmograph. A positive correlation between plasma adiponectin levels and endothelial cell-dependent vasodilatation, although there is a positive correlation between dependent vasodilator response and blood adiponectin concentration but not nitroglycerin-induced hyperemia Found that there is. The present invention provides a novel use of adiponectin based on such findings. That is, the present invention provides an antihypertensive agent containing these polypeptides as active ingredients based on the endothelium-dependent vasodilatory activity (vasorelaxant action) of adiponectin and related polypeptides. The therapeutic agent for hypertension is particularly effective as a treatment / amelioration agent for endothelium-dependent hypertension, and further, endothelium-dependent relaxation reaction by anticancer agents such as coronary blood flow improving agent, portal hypertension improving agent, (DXR) It can also be used as a new pharmaceutical application such as a disorder ameliorating agent.

(6) Gene encoding the polypeptide of the present invention Hereinafter, the gene encoding the polypeptide of the present invention (hereinafter also simply referred to as “the gene of the present invention”) will be described in detail.

  The gene of the present invention is specifically shown as a gene comprising a polynucleotide having a base sequence encoding the amino acid sequence represented by SEQ ID NO: 1 or a complementary sequence thereof. As a specific embodiment of such a gene, a gene containing the base sequence of SEQ ID NO: 2 can be exemplified. This base sequence shows one combination example of codons indicating each amino acid residue of the amino acid sequence shown in SEQ ID NO: 1. The gene of the present invention is not limited to such a specific base sequence, and may have a selected base sequence by combining arbitrary codons for each amino acid residue shown in SEQ ID NO: 1. The selection of codons can follow conventional methods, for example, the codon usage frequency of the host to be used can be taken into account [Ncleic Acids Res. , 9, 43 (1981)].

  The gene of the present invention is not particularly limited to these, for example, a gene having a polynucleotide encoding the amino acid sequence of the equivalent of a polypeptide having the amino acid sequence represented by SEQ ID NO: 1 (adiponectin equivalent), Alternatively, it can be a synergistic product of a polynucleotide having the base sequence represented by SEQ ID NO: 2 (synthetic product of adiponectin gene) (hereinafter also referred to as “a variant of the gene of the present invention”). The above-mentioned “adiponectin gene equivalent” has sequence homology with the nucleotide sequence of the polynucleotide having the nucleotide sequence represented by SEQ ID NO: 2, and is common in structural characteristics and gene expression patterns and biology. It refers to a series of related genes that are recognized as a gene family based on the similarity of their functions. This includes alleles (alleles) of the adiponectin gene.

  The modified gene of the present invention specifically includes an amino acid sequence (modified amino acid sequence) in which one or several amino acids are deleted, inserted, substituted or added in the amino acid sequence shown in SEQ ID NO: 1. Genes containing the coding base sequence are included. Here, the degree of “amino acid deletion, insertion, substitution or addition” and the positions thereof are substantially the same as those of the polypeptide (adiponectin) in which the modified protein has the amino acid sequence represented by SEQ ID NO: 1. There is no particular limitation as long as it has the same effect. Here, “substantially the same action” can be exemplified by the endothelium-dependent vasodilatory activity (vascular relaxation action) or blood pressure lowering action of adiponectin. Examples of the adiponectin equivalents include those having a certain homology with the amino acid sequence shown in SEQ ID NO: 1, for example, at least 80%, preferably 95% or more, more preferably 98% or more, most preferably Can be exemplified by a polypeptide having a homology of 99% or more and substantially the same quality as adiponectin.

  In addition, as described above, the modified gene of the gene of the present invention includes those consisting of a base sequence having a certain homology with the base sequence shown in SEQ ID NO: 2 over its entire length. The homology includes at least 80% identity, preferably at least 95% identity, more preferably at least 99% identity over the entire length with the base sequence shown in SEQ ID NO: 2, and adiponectin and A polynucleotide encoding a polypeptide having substantially the same action and a complementary strand polynucleotide thereof are included. The homologous polynucleotide can be evaluated by whether or not it hybridizes with a polynucleotide comprising the base sequence shown in SEQ ID NO: 2 under stringent conditions. Here, “stringent conditions” can include conditions at 60 ° C. in 0.1% SSC containing 0.1% SDS.

  Amino acid sequence alterations (mutations) may occur in nature, for example, by mutation or post-translational modification, and may be artificially altered based on naturally occurring genes (eg, the human adiponectin gene of the present invention). You can also The gene of the present invention encompasses all modified genes having the above characteristics regardless of the cause and means of such modification and mutation.

  Examples of the artificial means include cytospecific mutagenesis [Methods in Enzymology, 154, 350, 367-382 (1987); 100, 468 (1983); Nucleic Acids Res. , 12, 9441 (1984); genetic engineering methods such as the Second Biochemistry Experiment Course 1 “Gene Research Method II”, edited by the Japanese Biochemical Society, p105 (1986)], the phosphate triester method, the phosphate amidite method, etc. Chemical synthesis means [J. Am. Chem. Soc. 89, 4801 (1967); 91, 3350 (1969); Science, 150, 178 (1968); Tetrahedron Lett. , 22, 1859 (1981); 24, 245 (1983)] and combinations thereof. More specifically, DNA synthesis can be performed by chemical synthesis by the phosphoramidite method or triester method, and can also be performed on a commercially available automatic oligonucleotide synthesizer. Double-stranded fragments are chemically synthesized by synthesizing complementary strands and annealing them together under appropriate conditions, or by adding complementary strands using DNA polymerase with appropriate primer sequences. It can also be obtained from chain products.

(7) Production of a gene encoding the polypeptide of the present invention The gene of the present invention can be easily produced and produced by a general genetic engineering technique based on the sequence information on the specific examples of the gene of the present invention disclosed in the present specification. [Molecular Cloning 2d Ed, Cold Spring Harbor Lab. Press (1989); secondary biochemistry experiment course "gene research method I, II, III", Japanese Biochemical Society edition (1986) etc.].

  Specifically, a cDNA library is prepared from an appropriate source from which the gene of the present invention is expressed according to a conventional method, and a desired clone is selected from the library using an appropriate probe or antibody specific to the gene of the present invention. [Proc. Natl. Acad. Sci. USA. 78, 6613 (1981); Science, 222, 778 (1983), etc.].

  In the above, examples of the origin of cDNA include various cells and tissues that express the gene of the present invention, cultured cells derived therefrom, and the like. Isolation of total RNA from these sources, isolation of mRNA, purification, acquisition of cDNA, and cloning thereof can all be performed according to conventional methods. mRNA or cDNA libraries are also commercially available, and in the present invention, these commercially available mRNA or cDNA libraries, such as various mRNA or cDNA libraries commercially available from Clontech Lab. An adipose tissue mRNA or cDNA library can also be used. The method for screening the gene of the present invention from a cDNA library is not particularly limited, and can be carried out in accordance with ordinary methods.

  Specifically, for example, for a protein produced by cDNA, a method of selecting a corresponding cDNA clone by immunoscreening using a specific antibody of the protein, a probe that selectively binds to a target DNA sequence Examples thereof include plaque hybridization, colony hybridization, and combinations thereof.

  The probe used is generally DNA chemically synthesized based on information on the base sequence of the gene of the present invention, but may be a gene of the present invention already obtained or a fragment thereof. Sense primers and antisense primers set based on the DNA sequence information of the gene of the present invention can also be used as screening probes. The nucleotide used as a probe is a partial nucleotide corresponding to SEQ ID NO: 2, and is at least 15 contiguous DNAs, preferably 100 contiguous DNAs, more preferably 150 contiguous DNAs, most preferably It has 200 consecutive DNAs. A positive clone itself having the sequence can also be used as a probe.

  In obtaining the gene of the present invention, a DNA / RNA amplification method by the PCR method [Science, 230, 1350 (1985)] can be suitably used. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method [Rapid amplification of cDNA ends; experimental medicine, 12 (6), 35 (1994)], particularly the 5′-RACE method [M . A. Frohman, et al. , Proc. Natl. Acad. Sci. USA. , 8, 8998 (1988)] or the like.

Primers used for carrying out the PCR method can be appropriately set based on the sequence information of the gene of the present invention clarified by the present invention, and can be synthesized according to a conventional method. The amplified DNA / RNA fragment can be isolated and purified by a conventional method, for example, gel electrophoresis.
The gene of the present invention or various DNA fragments obtained above can be obtained by a conventional method such as the dideoxy method [Proc. Natl. Acad. Sci. USA. , 74, 5463 (1977)], Maxam-Gilbert method [Methods in Enzymology, 65, 499 (1980)], etc., or simply using a commercially available sequence kit or the like, the DNA sequence can be determined. .

  The presence or absence of expression of the gene of the present invention in an individual or various tissues can be specifically detected using a part or all of the DNA sequence of the gene of the present invention. This detection can be performed according to a conventional method. Examples of the method include RT-PCR [Reverse transcribed-Polymerase chain reaction; S. Kawasaki, et al. , Amplification of RNA. In PCR Protocol, A Guide to methods and applications, Academic Press, Inc. , San Diego, 21-27 (1991)], Northern blot analysis [Molecular Cloning, Cold Spring Harbor Lab. (1989)], in situ RT-PCR [Nucl. Acids Res. , 21, 3159-3166 (1993)], measurement at the cell level using in situ hybridization, NASB A method [Nucleic acid sequence-based amplification, Nature, 350, 91-92 (1991)] and others Various methods can be mentioned. A detection method by RT-PCR is preferable.

  The primer used for detection employing the PCR method is not particularly limited as long as it is unique to the gene capable of specifically amplifying only the gene of the present invention. This primer can be appropriately set based on the sequence information of the gene of the present invention. Usually, as the primer, a partial partition sequence of the gene of the present invention having a length of about 10-35 nucleotides, preferably about 15-30 nucleotides can be used. Thus, the gene of the present invention also includes a DNA fragment used as a specific primer and / or a specific probe for detecting the human adiponectin gene according to the present invention.

  The DNA fragment can be defined as DNA characterized by hybridizing under high stringency conditions with DNA consisting of the base sequence shown in SEQ ID NO: 2. Here, the high stringent conditions include normal conditions used as primers or probes, and are not particularly limited, but in 0.1% SSC including 0.1% SDS as described above, A condition of 60 ° C. can be exemplified.

(8) Genetic engineering production of the polypeptide of the present invention The polypeptide of the present invention can be easily produced as an expression product of the gene or as a protein containing the gene according to a normal genetic engineering technique using the gene of the present invention. It can be manufactured in large quantities and stably.

  The present invention relates to a protein encoded by the gene of the present invention, a vector containing the gene of the present invention for the production of the protein, a host cell transformed with the vector, the host cell cultured, A method for producing a peptide is also provided.

  Specific examples of the polypeptide of the present invention include a polypeptide (human adiponectin) having the amino acid sequence shown in SEQ ID NO: 1. The polypeptide of the present invention includes not only adiponectin protein but also homologues thereof. Are also included. The homologue has an amino acid sequence in which one or more amino acids are deleted, inserted, substituted or added in the amino acid sequence shown in SEQ ID NO: 1, and endothelium-dependent vasodilator activity (endothelial-dependent activity). Examples thereof include a protein having a blood vessel relaxing action or an antihypertensive action. As an example of endothelium-dependent vasodilatory activity (endothelium-dependent vasorelaxation), as exemplified in the above (4), for humans, an invasive method using intravascular Doppler, strain gauge plethysmography Method: For animals, such as mice, place the thoracic aorta of a non-human animal model of metabolic disorders in an arbitrary culture medium, and determine the isometric tension of the blood vessels using an isometric transducer. After equilibration, the maximum contraction is determined with norepinephrine, and then the degree of relaxation is measured by measuring the response of the blood vessel when acetylcholine, nitroprusside sodium, etc. are cumulatively added (relaxation ratio is the maximum relaxation by papaverine ( A method of measuring (calculated from 100%) can be exemplified. Specific examples include gene products of homologues of human adiponectin gene (human adiponectin equivalent gene including alleles).

  Homologues of the polypeptide of the present invention include yeast, nematode, plant tissue and mammalian proteins having the same activity as the adiponectin protein having the amino acid sequence shown in SEQ ID NO: 1. Examples of mammals include humans, horses, sheep, cows, dogs, monkeys, cats, bears, rats, mice, rabbits and the like.

  The polypeptide (expressed product) of the present invention can be obtained by a conventional gene recombination technique [eg, Science, 224, 1431 (1984); Biochem. Biophys. Res. Comm. , 130, 692 (1985); Proc. Natl. Acad. Sci. USA. 80, 5990 (1983) etc.]. More specifically, the method produces a recombinant DNA (expression vector) capable of expressing a gene encoding a desired protein in a host cell, introduces it into the host cell, and transforms the transformant. And then recovering the target protein from the resulting culture.

  As a host cell, both prokaryotic organisms and eukaryotic organisms can be used. For example, the prokaryotic host may be any commonly used host such as Escherichia coli, Bacillus subtilis, etc., preferably E. coli, especially Escherichia coli K12 strain. Eukaryotic host cells include cells such as vertebrates and yeast. Examples of the former include COS cells that are monkey cells [Cell, 23: 175 (1981)], Chinese hamster ovary cells and their dihydrofolate reductase-deficient strains [Proc. Natl. Acad. Sci. USA. 77: 4216 (1980)], and the latter is preferably a Saccharomyces yeast cell. Of course, it is not necessarily limited to these.

  When a prokaryotic cell is used as a host, a promoter and SD (Shine and Dalgarno) are used upstream of the gene so that the gene of the present invention can be expressed in the vector. An expression plasmid provided with a sequence and an initiation codon (for example, ATG) necessary for initiation of protein synthesis can be suitably used. In general, plasmids derived from Escherichia coli, such as pBR322, pBR325, pUC12, and pUC13, are often used as the vector. However, the present invention is not limited to these, and various known vectors can be used. Examples of commercially available vectors used in the expression system using E. coli include pGEX-4T (Amersham Pharmacia Biotech), pMAL-C2, pMAL-P2 (New England Biolabs), pET21, pET21 / lacq (Invitrogen). And pBAD / His (Invitrogen).

  Examples of the expression vector in the case of using a vertebrate cell as a host usually include a promoter located upstream of the gene of the present invention to be expressed, an RNA splice site, a polyadenylation site and a transcription termination sequence. If necessary, this may have a replication origin. As an example of the expression vector, specifically, pSV2dhfr [MoI. Cell. Biol. , 1: 854 (1981)]. In addition to the above, various known commercial vectors can be used. Examples of commercially available vectors used in expression systems using animal cells include animal cells such as pEGFP-N, pEGFP-C (Clontech), pIND (Invitrogen), pcDNA3.1 / His (Invitrogen), etc. Vectors for insect cells such as pFastBac HT (GibciBRL), pAc GHLT (PharMingen), pAc5 / V5-His, pMT / V5-His, and pMT / Bip / V5-his (above Invitrogen) It is done.

  In addition, specific examples of expression vectors in the case of using yeast cells as a host include, for example, pAM82 [Proc. Natl. Acad. Sci. USA. , 80: 1 (1983)]. Examples of commercially available expression vectors for yeast cells include pPICZ (Invitrogen) and pPICZ / Invitrogen).

  The promoter is not particularly limited, and when a bacterium belonging to the genus Escherichia is used as a host, for example, tryptophan (trp) promoter, lpp promoter, lac promoter, recA promoter, PL / PR promoter and the like can be preferably used. When the host is Bacillus, SP01 promoter, SP02 promoter, penP promoter and the like are preferable. As a promoter in the case of using yeast as a host, for example, pH05 promoter, PGK promoter, GAP promoter, ADH promoter and the like can be suitably used. Examples of preferred promoters when animal cells are used as hosts include SV40-derived promoters, retrovirus promoters, metallothionein promoters, heat shock promoters, cytomegalovirus promoters, SRα promoters, and the like.

  As the expression vector of the gene of the present invention, a normal fusion protein expression vector can also be preferably used. Specific examples of the vector include pGEX (Promega) for expression as a fusion protein with glutathione-S-transferase (GST).

  In addition, examples of the polynucleotide sequence in which the coding sequence of the mature polypeptide assists the expression and secretion of the polypeptide from the host cell include a secretory sequence and a leader sequence. These sequences include a marker sequence (hexahistidine tag, histidine tag) that is used to purify the fusion mature polypeptide against a bacterial host, and a hemagglutinin (HA) tag in the case of mammalian cells.

  A method for introducing a desired recombinant DNA (expression vector) into a host cell and a transformation method using the method are not particularly limited, and various general methods can be employed.

  The obtained transformant can be cultured according to a conventional method, and the target protein encoded by the gene designed as desired by the culture is expressed, produced (accumulated) in the cell, outside of the transformant or on the cell membrane. Secreted).

  As the medium used for the culture, various media commonly used according to the employed host cells can be appropriately selected and used, and the culture can also be performed under conditions suitable for the growth of the host cells.

  The recombinant protein thus obtained (the polypeptide of the present invention) can be subjected to various separation operations utilizing its physical properties, chemical properties, etc. [“Biochemical Data Book II”, pages 1175-1259, first edition, as desired. First printing, June 23, 1980, published by Tokyo Chemical Co., Ltd .; Biochemistry, 25 (25), 8274 (1986); Eur. J. et al. Biochem. , 163, 313 (1987) etc.].

  Specific examples of the method include normal reconstitution treatment, treatment with a protein precipitating agent (salting out method), centrifugation, osmotic shock method, ultrasonic crushing, ultrafiltration, molecular sieve chromatography (gel filtration). , Adsorption chromatography, ion exchange chromatography, affinity chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography, dialysis methods, and combinations thereof can be exemplified, and particularly preferred methods include those for the polypeptide of the present invention. Examples include affinity chromatography using a column to which a specific antibody is bound.

  In designing the gene encoding the polypeptide of the present invention, the DNA sequence of the adiponectin gene shown in SEQ ID NO: 2 can be used favorably. The gene can be used by appropriately selecting and changing a codon indicating each amino acid residue as desired.

  In addition, in the amino acid sequence encoded by the adiponectin gene, when a part of the amino acid residue or amino acid sequence is modified by substitution, insertion, deletion, addition, etc., for example, the above-mentioned various methods such as cytospecific mutagenesis The method can be adopted.

(9) Chemical synthesis of the polypeptide of the present invention The polypeptide of the present invention can be produced by a general chemical synthesis method according to the amino acid sequence information shown in SEQ ID NO: 1. The method includes peptide synthesis methods by a normal liquid phase method and a solid phase method.

  More specifically, the peptide synthesis method is based on the amino acid sequence information, and a so-called stepwise elongation method in which each amino acid is sequentially linked one by one to extend the chain, and a fragment consisting of several amino acids is synthesized in advance. And then a fragment condensation method in which each fragment is subjected to a coupling reaction. The polypeptide of the present invention may be synthesized by any of them.

  Condensation methods employed for peptide synthesis can also follow conventional methods. For example, azide method, mixed acid anhydride method, DCC method, active ester method, redox method, DPPA (diphenylphosphoryl azide) method, DCC + additive (1-hydroxybenzotriazole, N-hydroxysuccinamide, N-hydroxy-5 -Norbornene-2,3-dicarboximide etc.) method, Woodward method, etc. can be followed.

  The solvent used in each of these methods can also be appropriately selected from general solvents known to be used in this kind of peptide condensation reaction. Examples thereof include dimethylformamide (DMF), dimethyl sulfoxide (DMSO), hexaphosphoroamide, dioxane, tetrahydrofuran (THF), ethyl acetate, and a mixed solvent thereof.

  In the peptide synthesis reaction, an amino acid or a carboxyl group in a peptide that is not involved in the reaction is generally converted to a lower alkyl ester such as methyl ester, ethyl ester or tertiary butyl ester such as benzyl ester, p- It can be protected as aralkyl esters such as methoxybenzyl ester and p-nitrobenzyl ester.

  In addition, amino acids having a functional group in the side chain, such as a hydroxyl group of a tyrosine residue, may be protected with an acetyl group, a benzyl group, a benzyloxycarbonyl group, a tertiary butyl group, etc., but such protection is necessarily required. There is no. Further, for example, the guanidino group of the arginine residue may be a suitable nitro group, tosyl group, p-methoxybenzenesulfonyl group, methylene-2-sulfonyl group, benzyloxycarbonyl group, isobornyloxycarbonyl group, adamantyloxycarbonyl group, etc. Can be protected by various protecting groups.

  The deprotection reaction of these protecting groups in amino acids having a protecting group, peptides and finally obtained polypeptides of the present invention can also be carried out by conventional methods such as catalytic reduction, liquid ammonia / sodium, hydrogen fluoride, bromide. It can be carried out according to a method using hydrogen, hydrogen chloride, trifluoroacetic acid, acetic acid, formic acid, methanesulfonic acid or the like.

  The polypeptide of the present invention thus obtained can be appropriately purified according to the various methods described above, for example, methods commonly used in the field of peptide chemistry such as ion exchange resin, distribution chromatography, gel chromatography, and countercurrent distribution. it can.

(10) Preparation of pharmaceutical composition containing the polypeptide of the present invention The pharmaceutical composition of the present invention increases or promotes the endothelium-dependent vasodilatory activity (endothelium-dependent vasorelaxing action) of the polypeptide of the present invention as an active ingredient. The action can be used effectively for prevention or improvement of hypertension, particularly endothelium-dependent hypertension. In addition, it can be used for prevention or improvement of coronary blood flow disorder, portal hypertension, endothelium-dependent vasorelaxation reaction disorder caused by anticancer agents such as (DXR).

  Examples of the method for confirming the endothelium-dependent vasodilatory activity (endothelium-dependent vasorelaxant action) exhibited by the polypeptide as the active ingredient of the pharmaceutical composition of the present invention include the methods described above in (3) and the examples described later. As described, for humans, an open blood method using intravascular Doppler, a method using strain gauge plethysmography, for animals such as mice, the thoracic aorta region of a non-human metabolic model non-human animal After immersing the tube in any culture medium, equilibrating the isometric tension of the blood vessel using an isometric transducer, determining the maximum contraction with norepinephrine, and then acetylcholine or sodium nitroprusside A method of measuring the degree of relaxation by measuring the response of the blood vessel when cumulative addition is made can be exemplified.

  More specifically, in the human method, human forearm blood flow is measured with a strain-gauge plethysmograph (volume fluctuation recorder) before and after administration of an arbitrary dose of the polypeptide as the active ingredient of the pharmaceutical composition of the present invention. : EC5R, DE Horkkanson, Inc.). That is, after cuff inflation at 300 mmHg pressure for 5 minutes, decompression is performed, and the maximum forearm blood flow is measured as a post-ischemic vasodilator response to reactive hyperemia. Then, the reactive hyperemia / baseline value of the forearm blood flow is calculated as the reactive hyperemia ratio partially reflecting the endothelial cell-dependent vasodilation. Thereafter, 0.3 mg of nitroglycerin is administered sublingually by one spray using a spray device, and the maximum brachial blood flow as nitroglycerin-induced hyperemia is measured. Then, the nitroglycerin-induced hyperemia / baseline value of the forearm blood flow is measured as a nitroglycerin-induced hyperemia ratio that partially reflects endothelial cell-independent vasodilation. As described above, by evaluating the value obtained by each measurement, it is possible to determine whether it is an endothelial cell-independent vasodilatory action or an endothelial cell-independent vasodilatory action.

In animals, for example, mice, a section of the thoracic aorta from the target mouse (normal type or adiponectin gene deficient type) is taken out and corrected before and after administration of an arbitrary dose of the polypeptide as the active ingredient of the pharmaceutical composition of the present invention. Krebs-Henseleit solution (composition NaCl 119, KCl 14.8, KH ₂ PO ₄ 1.2, MgSO ₄ 1.2, CaCl ₂ 2.5, NaHCO ₃ 24.9, glucose 10.0 mM) Later, isometric tension is measured with an isometric transducer. After equilibrating the arterial ring (3 mm long), maximum contraction was determined with ^10-6 M norepinephrine, relaxation was acetylcholine ( ^10-9 to ^10-5 M) or nitroprusside sodium ( ^10-9 to Measured as a response to a cumulative addition of 10 ⁻⁵ M). The relaxation ratio is implemented by measuring, for example, by expressing it as a percentage of the maximum relaxation (100%) induced by 10 ⁻⁴ M papaverine.

  The polypeptide as an active ingredient in the pharmaceutical composition of the present invention also includes a pharmaceutically acceptable salt thereof. Such salts include non-toxic alkali metal salts such as sodium, potassium, lithium, calcium, magnesium, barium, ammonium, alkaline earth metal salts, ammonium salts and the like prepared by methods well known in the art. The Further, the above salts include nontoxic acid addition salts obtained by reacting the polypeptide of the present invention (expressed product) with an appropriate organic acid or inorganic acid. Representative non-toxic acid addition salts include, for example, hydrochloride, hydrochloride, hydrobromide, sulfate, bisulfate, acetate, oxalate, valerate, oleate, laurate, Borate, benzoate, lactate, phosphate, p-toluenesulfonate (tosylate), citrate, maleate, fumarate, succinate, tartrate, sulfonate, glycolic acid Examples thereof include salts, maleates, ascorbates, benzenesulfonates, napsilates and the like.

  The pharmaceutical composition of the present invention is further prepared into a pharmaceutical preparation form containing the polypeptide (expressed product) of the present invention or a salt thereof as an active ingredient and a pharmaceutically effective amount thereof together with a suitable pharmaceutical carrier or diluent. . As a pharmaceutical carrier used for the preparation of the pharmaceutical preparation, dilutions such as a filler, a bulking agent, a binder, a moistening agent, a disintegrant, a surfactant, a lubricant, etc., which are usually used depending on the form of the preparation. Agents or excipients can be exemplified. These are appropriately selected and used depending on the dosage unit form of the preparation to be obtained. Particularly preferred pharmaceutical preparations include various ingredients used in normal protein preparations, such as stabilizers, bactericides, buffering agents, isotonic agents, chelating agents, pH adjusters, surfactants and the like as appropriate. Prepared.

  In the above, examples of the stabilizer include human serum albumin, ordinary L-amino acids, saccharides, and cellulose derivatives. These can be used alone or in combination with a surfactant or the like. In particular, according to this combination, the stability of the active ingredient may be further improved. The L-amino acid is not particularly limited, and may be any of glycine, cysteine, glutamic acid and the like. The saccharide is not particularly limited, for example, monosaccharides such as glucose, mannose, galactose, and fructose; sugar alcohols such as mannitol, inositol, and xylitol; disaccharides such as sucrose, maltose, and lactose; dextran, hydroxypropyl starch, chondroitin Polysaccharides such as sulfuric acid and hyaluronic acid, and derivatives thereof can be used. The cellulose derivative is not particularly limited, and methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and the like can be used.

  The addition amount of the saccharide is appropriately about 0.0001 mg or more, preferably about 0.01-10 mg per 1 μg of the active ingredient. The amount of the surfactant added is appropriately about 0.00001 mg or more, preferably about 0.0001-0.01 mg per 1 μg of the active ingredient. The amount of human serum albumin added is suitably about 0.0001 mg or more, preferably about 0.001 to 0.1 mg, per μg of active ingredient. The amount of L-amino acid added is suitably about 0.001 to 10 mg per μg of active ingredient. The amount of cellulose derivative added is suitably about 0.00001 mg or more, preferably about 0.001-0.1 mg per 1 μg of active ingredient.

  The surfactant is not particularly limited, and both ionic and nonionic surfactants can be used. Specific examples thereof include polyoxyethylene glycol sorbitan alkyl ester, polyoxyethylene alkyl ether, sorbitan monoacyl ester, and fatty acid glyceride.

  Buffers used as optional ingredients include boric acid, phosphoric acid, acetic acid, citric acid, ε (epsilon) -aminocaproic acid, glutamic acid and / or their corresponding salts (for example, their sodium salts, potassium salts, calcium salts) Salt, alkali metal salt such as magnesium salt, and alkaline earth metal salt). Examples of isotonic agents include sodium chloride, potassium chloride, sugars, glycerin and the like. Examples of chelating agents include sodium edetate and citric acid.

  The pharmaceutical preparation of the present invention can be prepared as a solution preparation, lyophilized and stored, and then dissolved in a buffer solution containing water for use, saline solution, etc. to an appropriate concentration. It can also be in the form of a lyophilized agent to be prepared.

  The dosage unit form of the pharmaceutical preparation of the present invention can be appropriately selected depending on the therapeutic purpose. Representative examples include solid dosage forms such as tablets, pills, powders, powders, granules, capsules, and liquid dosage forms such as solutions, suspensions, emulsions, syrups, elixirs and the like. These are further classified into oral preparations, parenteral preparations, nasal preparations, vaginal preparations, suppositories, sublingual preparations, ointments and the like according to the administration route, and can be prepared, molded or prepared according to usual methods. it can.

  For example, in the case of molding into a tablet form, as the above-mentioned preparation carrier, for example, lactose, sucrose, sodium chloride, glucose, urea, starch, calcium carbonate, kaolin, crystalline cellulose, silicic acid, potassium phosphate and other excipients; water , Ethanol, propanol, simple syrup, glucose solution, starch solution, gelatin solution, carboxymethylcellulose, hydroxypropylcellulose, methylcellulose, polyvinylpyrrolidone and other binders; sodium carboxymethylcellulose, carboxymethylcellulose calcium, low substituted hydroxypropylcellulose, dry starch Disintegrating agents such as sodium alginate, agar powder, laminaran powder, sodium bicarbonate, calcium carbonate; polyoxyethylene sorbitan fatty acid esters, lauryl sulfate Surfactants such as sodium and stearic acid monoglycerides; disintegration inhibitors such as sucrose, stearin, cocoa butter and hydrogenated oil; absorption promoters such as quaternary ammonium base and sodium lauryl sulfate; humectants such as glycerin and starch; Adsorbents such as starch, lactose, kaolin, bentonite and colloidal silicic acid; lubricants such as purified talc, stearate, boric acid powder and polyethylene glycol can be used. Furthermore, the tablet can be a tablet coated with a normal coating as necessary, for example, a sugar-coated tablet, a gelatin-encapsulated tablet, an enteric-coated tablet, or a film-coated tablet, and can also be a double tablet or a multilayer tablet.

  When forming into a pill form, excipients such as glucose, lactose, starch, cocoa butter, hydrogenated vegetable oil, kaolin, talc, etc. as binders; binders such as gum arabic powder, tragacanth powder, gelatin, ethanol; Disintegrants such as laminaran and agar can be used.

  Capsules are usually prepared by mixing the active ingredients of the present invention with the various preparation carriers exemplified above and filling them into hard gelatin capsules, soft capsules and the like according to conventional methods.

  Liquid dosage forms for oral administration include pharmaceutically acceptable solutions, emulsions, suspensions, syrups, elixirs, etc., containing conventional inert diluents such as water, as well as wetting agents, emulsions, suspensions. Auxiliaries such as suspending agents can be included and these are prepared according to conventional methods.

  In preparing liquid dosage forms for parenteral administration, such as sterile aqueous or non-aqueous solutions, emulsions, suspensions, etc., diluents such as water, ethyl alcohol, propylene glycol, polyethylene glycol, ethoxylated isostearyl alcohol Polyoxylated isostearyl alcohol, polyoxyethylene sorbitan fatty acid esters and vegetable oils such as olive oil can be used, and injectable organic esters such as ethyl oleate can be blended. Furthermore, usual solubilizers, buffers, wetting agents, emulsifiers, suspending agents, preservatives, dispersing agents and the like can be added to these. Sterilization can be performed by, for example, filtration operation through a bacteria retaining filter, blending of a bactericide, irradiation treatment, heat treatment, and the like. They can also be prepared in the form of sterile solid compositions that can be dissolved in sterile water or a suitable sterilizable medium immediately before use.

  When forming into a suppository or a preparation for vaginal administration, for example, polyethylene glycol, cacao butter, higher alcohol, esters of higher alcohol, gelatin, semi-synthetic glyceride and the like can be used as a pharmaceutical carrier.

  When forming into the form of an ointment such as a paste, cream or gel, for example, white petrolatum, paraffin, glycerin, cellulose derivatives, propylene glycol, polyethylene glycol, silicone oil, vegetable oils such as bentonite and olive oil can be used as a diluent. .

  The composition for nasal or sublingual administration can be prepared according to a conventional method using a known standard excipient.

  In addition, in the chemical | medical agent of this invention, a coloring agent, a preservative, a fragrance | flavor, a flavoring agent, a sweetening agent, other pharmaceuticals, etc. can also be contained as needed.

  The administration method of the pharmaceutical preparation is not particularly limited, and is determined according to various preparation forms, patient age, sex and other conditions, the degree of disease, and the like. For example, tablets, pills, solutions, suspensions, emulsions, granules, and capsules are administered orally, and injections are administered intravenously alone or mixed with normal fluids such as glucose and amino acids. Independently administered intramuscularly, intradermally, subcutaneously or intraperitoneally, suppositories are administered rectally, vaginal agents are administered intravaginally, nasal agents are administered intranasally, sublingual agents are administered orally, Ointments are topically administered transdermally.

  The amount of the active ingredient to be contained in the pharmaceutical preparation and the dose thereof are not particularly limited, and are appropriately selected from a wide range depending on the desired therapeutic effect, administration method, treatment period, patient age, sex, and other conditions. Selected. The amount of the active ingredient (the polypeptide of the present invention) contained in the pharmaceutical preparation of the present invention is appropriately selected from a wide range, and is usually about 0.00001-70% by weight, preferably about 0.0001-5% by weight in the preparation. It is appropriate that the amount contains. In addition, the dose is usually such that the active ingredient (the polypeptide of the present invention) can be administered in an amount of about 0.01 μg-10 mg, preferably about 0.1 μg-1 mg per kg body weight per day, The preparation can be administered 1 to several times a day.

  In the case of a percutaneous absorption agent that is applied topically by a method such as a solution, ointment, cream, gel, or vapour, the concentration of the active ingredient (the polypeptide of the present invention) is about 0.001 to 1000 μg / ml, More preferably, it can be adjusted to 0.01 to 100 μg / ml, and more preferably 0.1 to 100 μg / ml.

  In addition to the polypeptide of the present invention, which is an active ingredient, it can be used in combination with calcium antagonists, ACE inhibitors, beta blockers, and other vasodilators. In combination with the above-described polypeptide of the present invention, an amount of about 0.01 to 100 μg / ml, more preferably 0.01 to 100 μg / ml per day can be administered in a timely manner or simultaneously.

Formulation examples are shown below.
Injection formulation 1 : Adiponectin 0.5 mg, sodium chloride 80 mg, mannitol 20 mg, sodium phosphate 34.5 mg, PEG 45 mg are dissolved in 10 ml of distilled water for injection, and after sterile filtration, 1.0 ml is dispensed into sterile vials and frozen. An injection preparation was prepared by drying.

  In the pharmaceutical composition of the present invention, the polypeptide of the present invention (for example, adiponectin) as an active ingredient has an action of increasing or promoting an endothelium-dependent vasodilatory activity (endothelium-dependent vasorelaxation), or an antihypertensive action. Based on this, it can be effectively used as an agent for preventing / ameliorating hypertension, particularly as an agent for preventing / ameliorating endothelium-dependent hypertension. The diseases to which the pharmaceutical composition of the present invention is applied include patients with hypertension as described above, particularly endothelium-dependent hypertension, coronary blood flow disorders, portal hypertension, anticancer agents such as DXR, etc. And the like, and the like.

EXAMPLES The present invention will be specifically described below with reference to examples, but it goes without saying that the present invention is not limited to these examples.
Reference Example 1 Preparation of Adiponectin Gene Disruption Vector (Targeting Vector) Based on the base sequence of mouse Acrop30 (mouse homologue of adiponectin gene) obtained from the Genbank database, oligonucleotides (SEQ ID NO: 6: AcrpPrl: ATGCACTGTTGCACATCTCTCCT, SEQ ID NO: 7: P2: CTTCAGCTCCCTGTCATTCCAACA) was synthesized and PCR was performed using mouse genomic DNA as a template, and a 129 / SvJ mouse phage library (Stratagene) was screened using the product as a probe. As a result, a genomic DNA fragment of about 16 kb containing a protein translation initiation exon of the mouse adiponectin gene was recovered and subcloned into pBluescript II (BSK: manufactured by Stratagene). Next, the shotgun method [Kawasaki, et al. , Protein / Nucleic acid / Enzyme, Vol. 24, no. 58, 41 (1996)], the base sequence of the DNA fragment was determined. As a result, it was found that the mouse adiponectin gene consists of three exons and has an ORF region (SEQ ID NO: 4) encoding a sequence consisting of 247 amino acids shown in SEQ ID NO: 3. SEQ ID NO: 5 shows the base sequence (1276 bases) of cDNA containing the 5 ′ and 3 ′ untranslated regions and the protein translation region (positions 39-782). The homology between the mouse adiponectin cDNA clone and the human adiponectin cDNA clone was 83% at the nucleic acid level and 83% at the deduced amino acid sequence level.

  Of the nucleotide sequence of mouse adiponectin cDNA, as a homologous region of the gene disruption vector, the SnaBI-AatII fragment upstream of the second exon (upstream fragment: 7 kb) and the downstream VspI-EcoRI fragment (downstream fragment: 1.4 kb) ) Was used. Further, pKO Select Neo (manufactured by Lexicon Genetics) is used as a positive selection marker and pKO Select DTA (manufactured by Lexicon Genetics) is used as a negative selection marker, respectively, and these are respectively used between the upstream fragment and the downstream fragment and downstream. A gene disruption vector (targeting vector) was constructed downstream of the side fragment (see FIG. 1).

Reference Example 2 : Production of adiponectin gene-deficient mice Mouse embryonic stem cells, feeder cells, and culture media into which the mouse adiponectin gene disruption vector (targeting vector) prepared in Reference Example 1 was introduced were used as The Mouse Kit (The Mouse). Kit: manufactured by Lexicon Genetics). Mouse embryonic stem cells were cultured according to the instruction manual of the product, and then digested with NotI, and 50 μg of a linearized gene disruption vector was introduced into 3 × 10 ⁷ embryonic stem cells by electroporation. ECM600 (manufactured by BTX Inc.) was used as a material for gene introduction, and the conditions were 270 V / 1.8 mm and 500 μF. Geneticin (250 μM, Sigma: Sigma) was added 48 hours after the introduction, and then drug selection using the resistance to the drug as an index was performed for 7 days, and 2896 geneticin-resistant colonies 120 clones were collected from the inside. Genomic DNA was extracted from these recovered embryonic stem cells and prepared by PCR using 5 ′ probe (513 bp mouse genomic DNA as a template and the following synthetic oligonucleotide: apMP1: CGATGCTGTGTCAATGAGC (SEQ ID NO: 8), apMP2: CCTTTCGGTCCCACAAGCTTGA (SEQ ID NO: 9)), and 3 ′ probe located downstream of the homologous region (199 bp, generated by PCR, apM3, Pr1: GCGAATGGGTATATGGGGAACA (SEQ ID NO: 10), apM3, Pr2: CTCACTTTCTAGGTCTTCTTTG (SEQ ID NO: 11)), and neo As a result of Southern blot analysis using a probe, 8 strains were identified as homologous recombinants. Of these, 6 strains (clone numbers 633, 644, 649, 666, 667 and 668) were injected into C57BL / 6J mouse blastocysts to produce chimeric mice.

  Next, the produced chimeric mouse was mated with a C57BL / 6J mouse (obtained from CLEA Japan, Inc.). As a result, a hetero-deficient mouse (+/−) was obtained from the chimeric mouse derived from clone number 649. Further, hetero-deficient mice (+/−) were crossed to produce homo-deficient mice (− / −).

  In addition, fertilized eggs prepared by fertilizing ova extracted from females of the obtained wild-type mice (+ / +) with sperm extracted from males of hetero-deficient mice (+/−) were prepared in August 2002. On the 2nd, the display of microorganisms at the National Institute of Advanced Industrial Science and Technology, which has an address in 1-1-1 Higashi 1-1-1 Tsukuba City, Ibaraki Prefecture, Japan: (For identification given by the depositor) Indications) Fertilized eggs derived from adiponectin-deficient mice, (Accession Number) FERM P-18960.

Reference Example 3 : Determination of genotype The genotype was determined for adiponectin gene wild-type mice (+ / +) and adiponectin gene hetero-deficient mice (+/-).

  For genotype determination, a 5 ′ probe (apMPl: CGATGCTGTGTTCAATGAGC (SEQ ID NO: 8), apMP2: CCTTTCGGTCCACAAGCTTTGA (SEQ ID NO: 9)) located upstream of the homologous region used for constructing the gene disruption vector, and the homologous region A 3 ′ probe (apM3Pr1: GC GAATGGGTATATTGGGAACA (SEQ ID NO: 10), apM3Pr2: CTCACTTTCTAGGTCTTCTTGG (SEQ ID NO: 11)) located downstream was used (see FIG. 1). Adiponectin gene wild-type mouse (+ / +) and adiponectin gene hetero-deficient mouse (+/-) genomic DNA was digested with restriction enzyme SpeI, and each of the 5 'probe and the 3' probe was used. Southern blot hybridization was performed according to a conventional method (Maniatis et a1.1990).

  In the Southern blot analysis using the 5 'probe, a 17 kb band was detected for both the wild type and the defective type, but a 10 kb band was detected for the defective type. On the other hand, in the Southern blot analysis using the 3 'probe, a 17 kb band was detected for both the wild type and the defective type, but a 7 kb band was detected for the defective type. From this, it was confirmed that the adiponectin gene hetero-deficient mouse (+/−) was deficient in the second exon site and replaced with the neomycin resistance gene.

Reference Example 4 : Production of recombinant adiponectin (expression of adiponectin in E. coli)
The base sequence of the human adiponectin gene and the amino acid sequence encoded by the gene sequence are registered under the accession number D45371 in Genebank. The coding region (CDS) is shown at 27-761th. The deduced amino acid sequence is as shown in SEQ ID NO: 1. In the sequence, the 1-14th position is a signal peptide, and the 15th-244th position is a mature adiponectin.

  Of the adiponectin gene base sequence, 693-761 693 base pairs were amplified, designed to add an NdeI site at the 5 ′ end and a BamHI site at the 3 ′ end, and were produced by an automated DNA synthesizer. A PCR product was obtained. The PCR product obtained above was subcloned into pT7BlueT-Vector (manufactured by Novagen), and it was confirmed that there was no mutation in its base sequence (pT7-adiponectin). Subsequently, the expression vector pET3c (manufactured by Novagen) was digested with NdeI and BamHI to obtain a fragment of about 4600 base pairs. The pT7-adiponectin obtained above was digested with NdeI and BamHI to obtain a fragment of about 700 base pairs. These fragments were ligated, and the resulting expression vector was designated as pET3c-adiponectin.

  Next, host E. coli BL21 (DE3) pLysS was transformed with the pET3c-adiponectin obtained above, and 2 × T. Y. Amp. (Tryptone 16 g, yeast extract 10 g, chloramphenicol 25 μg / ml and NaCl 15 g), and the next day, the culture solution was 100 times 2 × T. Y. Amp. Diluted with, and further cultured. IPTG (isopropyl β-D-thiogalactopyranoside) is added when cells having a final concentration of 0.4 mM having an OD550 of 0.3 to 0.5 are cultured for 2 to 3 hours and enter a logarithmic growth phase. Added to induce the production of recombinant adiponectin. The E. coli before and after induction with IPTG and the inclusion body (insoluble fraction of E. coli) after induction with IPTG were sampled, and the expression of adiponectin was confirmed by SDS-PAGE and Western blotting.

  Then, about 3 to 5 hours after the addition of IPTG, the culture solution was centrifuged (5000 rpm, 20, 4 ° C.), and the resulting E. coli precipitate was stored frozen. Next, an inclusion body was prepared from E. coli as follows. Specifically, the E. coli precipitate was suspended in 50 mM Tris-HCl (pH 8.0), treated with lysozyme at 37 ° C. for 1 hour, and then the final concentration of 0.2% Triton X-100 (Triton X-100, manufactured by Katayama Chemical Co., Ltd.). ) Was added. The solution was sonicated (BRANSON SONIFIER, output control 5, 30 seconds) and centrifuged (12000 rpm, 30 minutes, 4 ° C.) to recover the precipitate. The precipitate was suspended in 25 ml of 50 mM Tris-HCl (pH 8.0) supplemented with 0.2% Triton X-100, and sonicated (same conditions as above).

  The obtained solution was centrifuged, and the precipitate was washed again by the same operation, and the obtained precipitate was used as an inclusion body. Subsequently, the inclusion body was refolded. The inclusion body was solubilized in a small amount of 7M guanidine hydrochloride, 100 mM Tris-HCl (pH 8.0), 1% 2ME. The solution was added dropwise to 200 volumes of 2M urea, 20 mM Tris-HCl (pH 8.0), diluted, and allowed to stand at 4 ° C. for 3 nights. Concentration of the refolding solution was performed by centrifuging the refolded solution (9000 rpm, 30 minutes, 4 ° C.), and the resulting supernatant was concentrated about 100 times by ultrafiltration using Amicon YM-10 membrane. The concentrated solution was dialyzed against 20 mM Tris-HCl (pH 8.0) and filtered through a 0.45 μm filter. Next, the obtained sample was separated and purified by anion exchange high performance liquid chromatography (HPLC) using DEAE-5PW (manufactured by Tosoh Corporation). The starting buffer was 20 mM Tris-HCl (pH 7.2) and elution was performed with a 1 M NaCl gradient (0 → 1 M NaCl / 60 ml) and monitored by absorbance at 280 nm. Fractions were 1 ml each, and each fraction was analyzed by SDS-PAGE. Since recombinant adiponectin was expressed as an inclusion body in E. coli, the inclusion body was solubilized and refolded during purification. As a result, recombinant adiponectin was solubilized and separated on an anion exchange column. When the fraction of the peak (fraction No. 30-37) was analyzed by SDS-PAGE, a band of about 30 kDa was observed.

Example 1
Vascular reactivity in the arterial ring was analyzed in adiponectin deficient (KO) mice and wild type (WT) mice.

  Adiponectin-deficient male mice were prepared according to Reference Examples 1 and 2 above. Eight-week-old adiponectin-deficient male mice (KO) and wild-type mice (WT) are fed with high fat, high sucrose and high salt diet (30% fat, 15% sucrose, 8% sodium chloride), and then for 4 weeks Continued feeding nutrition. Body weight was measured before the test. Systolic blood pressure was measured in the caudal artery using an automatic pulsometer (MK-2000, manufactured by Muromachi) under restraint. Blood samples were collected after an overnight fast. Plasma glucose, total cholesterol, triglyceride and HDL-cholesterol values were measured with an enzyme kit (manufactured by Wako Pure Chemical Industries, Ltd.). The study protocol was approved by the Ethics Committee for Animal Experiments at Osaka University School of Medicine.

The vascular relaxation test in mice was performed as follows. That is, vascular reactivity in the arterial ring was analyzed in adiponectin-deficient (KO) mice and wild type (WT) mice. A section of the thoracic aorta from a WT mouse (n = 5) or a KO mouse (n = 5) was taken out and a modified Krebs-Henseleit solution (composition NaCl 119, KCl 14.8, KH ₂ PO ₄ 1.2, MgSO ₄ . 2, CaCl ₂ 2.5, NaHCO ₃ 24.9, glucose 10.0 mM).

Isometric tension was measured with an isometric transducer (TB-611T, manufactured by Nihon-Corden). After equilibrating the arterial ring (3 mm long), the maximum contraction was determined with 10 ⁻⁶ M norepinephrine (Sigma Chemical Co.). Relaxation is cumulative accumulation of acetylcholine (ACh: Daiichi Pharmaceutical Co., Ltd., 10 ⁻⁹ to 10 ⁻⁵ M) or nitroprusside sodium (SNP: Wako Pure Chemical Industries, Ltd., 10 ⁻⁹ to 10 ⁻⁵ M). Measured as response to addition. The relaxation ratio was expressed as% of maximum relaxation (100%) induced by 10 ⁻⁴ M papaverine (Sigma Chemical Co.). The data is shown as mean ± SE. Statistical differences were analyzed by unpaired t-test. A value of p <0.05 was considered statistically significant.

  The results are shown in Table 1 and FIG.

  As this result shows, when mice were fed a high-fat, high-sucrose, high-salt hypertrophic diet for 4 weeks, the body weight and systolic blood pressure (SBP) of adiponectin gene-deficient mice (KO) became wild type ( WT) significantly higher than mice (weight: 29.4 ± 0.9 g (KO) vs. 25.0 ± 0.6 g (WT), SBP: 120 ± 4 mmHg (KO) vs. 103). ± 5 mmHg (WT)). There was no significant difference in heart rate between wild type (WT) mice and adiponectin gene-deficient mice (KO) (heart rate: 714 ± 9 nights / minute (KO) vs. 723 ± 15 nights / minute). (WT)). Plasma glucose was significantly higher in adiponectin gene-deficient mice (KO), but there was no significant difference in lipids.

  In addition, acetylcholine-induced vascular relaxation (acetylcholine-induced vascular relaxation) that induces endothelial cell-dependent vasodilation is adiponectin gene-deficient mice (KO) as compared to wild-type (WT) mice, as shown in FIG. Significantly decreased. In contrast, sodium nitroprusside-induced vasodilation that induces endothelial cell-independent vasodilation (sodium nitroprusside-induced vasorelaxation) was observed in wild type (WT) mice and adiponectin gene-deficient mice (see FIG. 2B). There was no difference between the two. From this, it was confirmed that the adiponectin gene-deficient mouse (KO) has a functional disorder (decreased function) in endothelium-dependent vascular relaxation.

  On the other hand, the body weight, systolic blood pressure, and acetylcholine-induced vasorelaxation in the normal diet are not significantly different between wild-type (WT) mice and adiponectin gene-deficient mice (KO). It was. These results indicate that adiponectin acts as one important molecule that links overnutrition and endothelial dysfunction.

  The present inventors have thus found that adiponectin gene-deficient mice may have a disorder in endothelium-dependent vascular relaxation. Obesity caused by overnutrition is often accompanied by impaired glucose tolerance, hypertension, and lipid metabolism, presenting a factor of metabolic disorders, and eventually resulting in arteriosclerosis. Clinically, hypoadiponectinemia has been observed in diseases associated with obesity, including insulin resistance, type 2 diabetes and coronary artery disease. Endothelial dysfunction found in the present invention is observed particularly in metabolic syndrome occurring in the early stages of arteriosclerosis. This indicates that hypoadiponectinemia can cause endothelial dysfunction, particularly in metabolic disorders. Together with the information obtained in the past, the above data indicate that the adiponectin gene-deficient mice are pathological model animals that mimic metabolic abnormalities that can be induced by overnutrition.

Example 2 Method for Detection of Substances Affecting Metabolic Disorder Syndrome Using Metabolic Abnormality Syndrome Model Animal (1) Metabolic Abnormality Syndrome Non-Human Model Animal Prepared by Reference Examples 1-3 (for example, Adiponectin Gene Homo-Deficient Mice (KO mice)) (male, 8-11 weeks old) given high fat, high sucrose and high salt diet (30% fat, 15% sucrose, 8% salt) and then fed the overnutrition diet for 4 weeks Keep giving. Body weight is measured before the test. Systolic blood pressure is measured in the caudal artery using an automatic pulsometer (MK-2000, manufactured by Muromachi) under restraint.

  The test substance is dissolved in an appropriate concentration of solvent and intravenously injected into the tail vein, or orally with any carrier, or daily, or at any interval, for a period of 1 to 4 weeks. Perform the following measurements before and after administration of the test substance. Blood samples from both mice are taken after an overnight fast. Plasma glucose, total cholesterol, triglyceride, and HDL-cholesterol levels are measured with an enzyme kit (manufactured by Wako Pure Chemical Industries, Ltd.).

  In addition, X-ray findings, optical microscopic findings, immunohistochemical findings, blood sugar levels, blood insulin levels, free fatty acids, C-reactive protein (CRP), biochemical findings such as urinary albumin, etc. Use to measure.

  At the same time, [1] endothelium-dependent vasorelaxant action or systolic blood pressure is measured before and after administration of the test substance, and the measurement value after administration of the test substance is compared with the measurement value before administration. In addition, [2] insulin resistance Measuring the sex, and comparing the measured value after administration of the test substance with the measured value before administration, or [3] measuring the degree of neovascular intima hyperplasia, Whether the degree of hyperplasia is compared or [4] the degree of proliferation of vascular smooth muscle cells induced by injury is measured, and the degree of proliferation after administration of the test substance is compared with the degree of proliferation before administration, or [5] in blood The tumor necrosis factor (TNF) concentration of the test substance is measured and the concentration after administration of the test substance is compared with the concentration before administration, or [6] the concentration of free fatty acid (FFA) in the serum is measured and the test substance is administered. Concentrate the concentration before administration. It is sufficient to measure at least one of [2] to [6], but preferably 2 or more, more preferably 3 or more, still more preferably 4 or more, and most preferably all 5 measurements. Each characteristic after administration of the test substance may be compared with each characteristic obtained by measuring before administering the test substance to the metabolic disorder syndrome non-human animal model as described above. A control non-human metabolic model animal (overnutrition food intake treatment) that is not administered may be prepared and compared with each characteristic obtained for the model animal. Hereinafter, the metabolic abnormality syndrome non-human model animal before administration of the test substance and the metabolic abnormality syndrome non-human model animal not administered with the test substance are collectively referred to as “test substance non-administration group” or “non-administration group”.

  [1] As a method for evaluating the endothelium-dependent vasorelaxing action, for example, the thoracic aorta site of a metabolic disorder syndrome model animal in a test substance administration group and a non-administration group is immersed in an arbitrary culture solution, Use isometric transducers to equilibrate the arterial ring, determine the maximum contraction with norepinephrine, and then measure the vascular response when cumulative addition of acetylcholine, sodium nitroprusside, etc. Thus, the degree of relaxation (relaxation ratio is calculated from maximum relaxation (100%) by papaverine) can be measured. If the relaxation rate is improved in the test substance administration group when compared with the non-administration group, the administered test substance is identified as a candidate substance that affects the improvement of the endothelium-dependent vascular relaxation.

  [2] Insulin resistance is determined at 15 minutes, 30 minutes, and 60 minutes after administration of an arbitrary unit of insulin into each abdominal cavity of the metabolic disease syndrome model animal in the test substance administration group and the non-administration group. Measure blood glucose level. The blood glucose level in the blood can be usually measured using a commercially available blood glucose measurement kit.

  For example, in an animal model of metabolic syndrome, the degree of improvement in the delay in blood glucose lowering effect occurring 30 minutes and 60 minutes after insulin administration is compared between the test substance administration group and the non-administration group, When the impaired improvement of the glucose lowering action is observed, the test substance is identified as a candidate substance that affects the improvement of insulin resistance.

  The insulin resistance index can be determined by orally administering glucose at a rate of 2 mg / g body weight, and measuring blood glucose level and blood insulin level over time (glucose tolerance test (Glucose Tolerance Test)). )). Here, the blood glucose level and the insulin level can be usually measured using a commercially available blood glucose measurement kit and insulin measurement kit. The insulin resistance index can be calculated by the product of the areas indicated by the curve of blood glucose level and blood insulin level over time according to the glucose tolerance test.

  In this test method, the larger the insulin resistance index, the stronger the insulin resistance (lower insulin sensitivity), and this insulin resistance is improved (weakened) in the test substance administration group. The test substance is identified as a candidate substance that affects the improvement in insulin resistance.

  [3] Hyperplasia (thickening) of the neovascular intima can be evaluated as follows. First, bilateral femoral artery trauma is applied to the femoral artery using a linear spring wire (diameter 0.36 m) for the metabolic syndrome syndrome model animals in the test substance administration group and the non-administration group. The vascular endothelium is then exposed to cause neointimal hyperplasia. Two to three weeks after the vascular injury, each model animal is anesthetized, both femoral arteries are perfused and fixed with 10% formalin, and the tissue is embedded in paraffin. Following paraffin embedding, parallel sections of the femoral artery are excised and stained with hematoxylin-eosin. The excised femoral artery smooth muscle cells can be identified by immunostaining for α-smooth muscle actin using a primary antibody. The area of the intima and media and the I / M ratio (intima / media area ratio) in the injured artery can be measured using, for example, image analysis software (MacSCOPE).

  In this method, decrease / inhibition (improvement) of neovascular intimal hyperplasia (thickening) is identified by smooth muscle cells in the metabolic syndrome syndrome model animal in the test substance administration group compared to the test substance non-administration group. The test substance in this case can be identified as a candidate substance that improves (decreases / suppresses) hyperplasia (thickening) of the neovascular intima.

  [4] The degree of proliferation of vascular smooth muscle cells induced by injury can be evaluated as follows. First, bilateral femoral artery trauma is applied to the femoral artery of the metabolic disorder syndrome model animal in the test substance administration group and the non-administration group using a linear spring wire (diameter 0.36 m). The vascular endothelium is then exposed to cause neointimal hyperplasia. For each model animal, 100 μg / g bromodeoxyuridine (BrdU) is intraperitoneally administered every 24 hours until the femoral artery is obtained following vascular injury. Two to three weeks after the vascular injury, each mouse is anesthetized and both femoral arteries are perfused and fixed with 10% formalin before the tissue is embedded in paraffin. Following paraffin embedding, a parallel section of the femoral artery is excised, the section is immunostained using a BrdU staining kit (eg, Oncogene Research Products), and the section is labeled with immunohistochemistry. Detect. From the above, the proliferation degree of vascular smooth muscle cells can be examined. Specifically, with respect to the sections from the obtained tissues, the ratio of BrdU-stained cells and non-stained cells in the smooth muscle cells in the neointima is measured to determine the proliferation index of vascular smooth muscle cells. it can. The degree of proliferation of vascular smooth muscle cells can be calculated by dividing the number of BrdU-stained cells by the number of unstained cells.

  Decrease / suppress the degree of proliferation of vascular smooth muscle cells induced by injury means that the value obtained by dividing the number of BrdU-stained cells of metabolic disorder syndrome model animals in the test substance-administered group by the number of unstained cells in the non-administered group Compared to that of the metabolic disorder syndrome model animal, it means a low value. Conversely, the increase / increase in the degree of proliferation is the value obtained by dividing the number of BrdU-stained cells by the number of unstained cells in the non-administered group. Compared with the metabolic syndrome model animal, it indicates a high value, which seems to indicate that the initial stage of the progression of arteriosclerosis is enhanced. Therefore, when the value of the test substance administration group is lower than that of the non-administration group, the test substance is a candidate for improving the degree of proliferation of vascular smooth muscle cells induced by injury (having a reduction / inhibition effect). It can be certified as a substance.

  [5] The tumor necrosis factor (TNF) concentration in the blood is determined using a commercially available anti-tumor necrosis factor (TNF-α) antibody and the tumor necrosis factor (TNF-α) in the blood that reacts with the antibody. It can obtain | require from the density | concentration of. Specifically, the concentration of tumor necrosis factor (TNF-α) in the blood can be measured using, for example, a commercially available mouse TNF-α ELISA KIT (product code: KMC3012: manufactured by Biosource). The decrease / suppression of tumor necrosis factor (TNF) concentration in blood means that the test substance administration group has a negative value (non-administration group) when comparing the tumor necrosis factor concentration between the test substance administration group and the non-administration group. Indicate minus% with respect to the tumor necrosis factor concentration of the metabolic disorder syndrome model animal. When the value of the test substance administration group is lower than that of the non-administration group, the test substance is a candidate substance that decreases / suppresses the concentration of tumor necrosis factor (TNF) in the blood of the metabolic disorder syndrome model animal Can be certified.

  [6] Serum free fatty acid (FFA) concentration can be measured by a widely used method in measuring serum free fatty acid (FFA) concentration. Decrease / suppression of serum free fatty acid (FFA) concentration means that the test substance-administered group has a negative value (metabolic abnormality in the non-administered group) when the serum free fatty acid concentration in the test substance-administered group and the non-administered group is compared. A minus% relative to the free fatty acid concentration of the syndrome model animal). When the value of the test substance administration group is lower than that of the test substance non-administration group, the test substance is a candidate substance that decreases / suppresses the free fatty acid (FFA) concentration in the blood of the metabolic syndrome syndrome model animal Can be certified.

Based on the results of the tests [1] and [2] to [6] performed above, the following (a) and (b) ) To (f) can be selected as a candidate substance that gives an improvement to the initial state of the metabolic abnormality syndrome, the test substance administered to the metabolic abnormality syndrome model animal obtained with any improvement effect:
(A) Increase or inhibition of endothelium-dependent vasorelaxation (b) Decrease / suppression of insulin resistance (c) Decrease / suppression of neointimal hyperplasia (d) Vascular smooth muscle induced by injury Reduction / inhibition of cell proliferation (e) reduction / inhibition of blood tumor necrosis factor (TNF) concentration (f) reduction / inhibition of serum free fatty acid (FFA) concentration,
In addition, based on the results of any of the tests [1] and [2] to [6] performed above, the following (a) and The test substance administered to the metabolic abnormality syndrome model animal in which any of the improvement effects of (b) to (f) is obtained can be selected as a substance that affects the metabolic abnormality syndrome:
(A) Increase or suppression of endothelium-dependent vasorelaxation, or decrease or increase of systolic blood pressure (b) Reduction / inhibition of insulin resistance, or increase / increase (c) Decrease of neovascular intimal hyperplasia / Suppression, or increase / increase (d) decrease / suppression of vascular smooth muscle cell proliferation induced by injury, or increase / increase (e) decrease / suppression of tumor necrosis factor (TNF) concentration in blood, Or increase / increase (f) decrease / suppression or increase / increase in serum free fatty acid (FFA) concentration.

  (2) With respect to the non-human animal model of metabolic disorder syndrome of the present invention, the test substance (adiponectin) for the neointimal thickening is targeted for the neointimal thickening (hyperplasia) induced by vascular injury of [3]. The effect was investigated.

  For the experiment, mouse adiponectin production-recombinant adenovirus (apM1 adenovirus (Ad-APN)) that produces full-length mouse adiponectin was obtained using an adenovirus expression vector kit (manufactured by Takara, Kyoto, Japan). Prepared.

First, 2 × 10 ⁸ pfu of apM1 adenovirus (Ad-APN) or β-galactosidase adenovirus (Ad-βgal) were isolated from wild type mice (adiponectin gene wild type mice (+ / +) 3 days prior to femoral artery trauma. )) And the non-human animal model of metabolic syndrome of the present invention (adiponectin gene homo-deficient mouse (− / −)) was injected into each jugular vein for infection. Mouse adiponectin production-14 days after administration of recombinant adenovirus, blood was collected and adiponectin levels in plasma were measured by immunoblotting analysis.

  As a result, compared to the wild type mouse infected with β-galactosidase adenovirus (Ad-βgal), the wild type mouse infected with adiponectin adenovirus (Ad-APN) and the non-metabolic syndrome of the present invention The plasma levels of adiponectin in human model animals were 2-3 times higher. On the 14th day after virus injection (on the 11th day after trauma), the femoral artery of each mouse was excised and obtained, and stained with hematoxylin and eosin. The result is shown in FIG. 3A. As shown in FIG. 3A, in the non-human animal model (mouse) of the metabolic disorder syndrome of the present invention, infection with adiponectin and adenovirus (that is, administration of adiponectin (test substance)) suppressed neointimal formation due to vascular injury. Rukoto has been shown.

  Then, wild-type mice treated with β-galactosidase adenovirus (WT: n = 5 ± SEM), wild-type mice treated with adiponectin adenovirus (WT: n = 5 ± SEM), β-galactosidase Non-human model of metabolic disorder syndrome of the present invention treated with adenovirus Mice (Ad-βgal-KO: n = 5 ± SEM) and non-human model of metabolic disorder syndrome of the present invention treated with adiponectin adenovirus For mice (APN-KO: n = 5 ± SEM), the I / M ratio (ratio of intima / media area) in the injured artery was quantitatively measured by computerized morphometry.

  The result is shown in FIG. 3B. As shown in FIG. 3B, the I / M ratio of the femoral artery of the metabolic syndrome syndrome model mouse of the present invention treated with β-galactosidase adenovirus is higher than that of the wild-type mouse treated with β-galactosidase adenovirus. It became clear that it was significantly large (#: p = 0.002) (intimal thickening due to adiponectin deficiency). And from the result of the I / M ratio of the metabolic disorder syndrome model mouse of the present invention (APN-KO: n = 5 ± SEM) treated with adiponectin adenovirus, it was treated with the β-galactosidase adenovirus. It was confirmed that intimal thickening (thickening due to adiponectin deficiency) observed in the metabolic disorder syndrome model mouse of the present invention was decreased by treatment with adiponectin adenovirus (test substance).

  From these results, administration of adiponectin (test substance) to the metabolic disorder syndrome model mouse of the present invention reduced neointimal thickening (hyperplasia) of the metabolic disorder syndrome model mouse of the present invention. Rukoto has been shown.

  From the results of Example 2 (2) above, when the adiponectin (test substance) is administered via adenovirus to the non-human animal model of metabolic syndrome (mouse) of the present invention, the above neointimal hyperplasia is suppressed. Of the metabolic disorder syndrome selected by the detection method of the substance that affects the metabolic disorder syndrome used as a metabolic disorder syndrome model animal (adiponectin) administered to a non-human metabolic animal model animal (mouse) Can be selected as a candidate substance that improves the condition.

Example 3
To assess partial endothelial function, a total of 390 subjects were analyzed for vasodilator response to reactive hyperemia by the strain-gauge plethysmograph (volumetric recorder) used.

  Venous blood was collected from a patient with metabolic disorder at Osaka University Hospital, and plasma adiponectin concentration was measured by ELISA kit (Adipectin ELISA Kit; manufactured by Otsuka Pharmaceutical Co., Ltd.) according to the previously reported method (the above non-patent document). Reference 20). Serum total cholesterol (T-chol), triglyceride (TG) and high density lipoprotein (HDL-chol) concentrations were measured by enzymatic methods. Serum glucose was measured by the glucose oxidase method. BMI was calculated as weight / (height x height).

  Patient characteristics are shown in Table 2. All patients who participated in this study were Japanese and received informed consent in a form. The study was approved by the university ethics committee.

  The evaluation of endothelium-dependent function was performed by measuring the forearm blood flow for the forearm blood vessel reactivity. That is, it was analyzed by a strain-gauge plethysmograph (volume fluctuation recorder: EC5R, DE Horkkanson, Inc.) in the same manner as the method of Komai et al. (Non-patent Document 29). Briefly, the cuff was inflated at 300 mmHg pressure for 5 minutes, then depressurized, and the maximum forearm blood flow was measured as a post-ischemic vasodilator response to reactive hyperemia. The reactive hyperemia / baseline value of the forearm blood flow was calculated as the reactive hyperemia ratio partially reflecting the endothelial cell-dependent vasodilation. Thereafter, 0.3 mg of nitroglycerin was administered sublingually with one spray using a spray device, and the maximum brachial blood flow as nitroglycerin-induced hyperemia was measured. The inventors measured the nitroglycerin-induced hyperemia / baseline value of forearm blood flow as a nitroglycerin-induced hyperemia ratio that partially reflects endothelial cell-independent vasodilation. The coefficient of variation within the observer was 2.4 ± 1.4%, and the coefficient of variation between the observers was 2.6 ± 1.5%. The data is shown as mean ± SE. Statistical differences were analyzed by unpaired t-test. A linear regression analysis was used to compare plasma adiponectin levels and brachial blood flow parameters. A value of p <0.05 was considered statistically significant.

  The results are shown in FIGS. 4A and 4B.

  As is clear from FIGS. 4A and B, the plasma adiponectin level was significantly correlated with the vasodilator response to reactive hyperemia (r = 0.197, p <0.0005) (FIG. A), but nitroglycerin. Since there was no correlation with inductive hyperemia (Fig. B), it was revealed that there was a positive relationship between plasma adiponectin levels and endothelium-dependent vasodilation.

  Thus, a strong positive correlation was found between the plasma adiponectin level and endothelium-dependent vasorelaxation in human subjects, and the adiponectin gene-deficient mice showed endothelium-dependent vasorelaxation in the adiponectin gene-deficient mice as found from the findings in Example 1 above. Disability was recognized. These findings indicate that hypoadiponectinemia can cause endothelial dysfunction, particularly in metabolic disorders.

  Adiponectin may act as a unique molecule that regulates vascular function either alone or in concert with accompanying metabolic diseases. Therefore, supplementation of adiponectin to patients with reduced endothelial function, for example, patients with endothelium-dependent hypertension, increases or promotes the endothelium-dependent vasodilator action (vasorelaxation) of adiponectin. Useful for preventing improvement or progress.

The structure diagram of the gene of mouse adiponectin wild type (Intact Allele) (Fig. A) and deletion type (Mutant Allele) (Fig. B) is shown. 1 is a drawing showing the results of endothelial cell-dependent vasodilation (vasorelaxation) action in Example 1. FIG. 2A shows the results of acetylcholine-induced vasorelaxation of endothelial cell-dependent vasodilation, and FIG. 2B shows the results of relaxation induced by sodium nitroprusside of endothelial cell-independent vasodilation. A is a drawing showing the results of neointimal formation due to vascular injury in Example 2. FIG. B is a drawing showing the results of neointimal formation by vascular injury in the metabolic disorder syndrome model mouse of the present invention and wild type mouse in Example 2. FIG. Correlation results between plasma adiponectin levels and endothelium-dependent vascular relaxation (Figure A) and endothelium-independent vascular relaxation (Figure B) analyzed by strain-gauge plethysmograph in human subject patients in Example 3 FIG.

Claims (15)

A non-human metabolic syndrome syndrome model in which all or part of the adiponectin gene is deleted, or another gene is inserted or replaced at any site, which is characterized by abnormal metabolic syndrome caused by overnutrition intake animal. The non-human model animal of metabolic abnormality syndrome according to claim 1, which is a mouse. The non-metabolic syndrome syndrome according to claim 2, which is a transformed mouse in which the genomic region corresponding to positions 38 to 268 of the mouse cDNA of adiponectin is deleted or the genomic region is substituted with another nucleotide sequence. Human model animal. The non-human animal model of metabolic abnormality syndrome according to any one of claims 1 to 3, wherein the symptom of metabolic abnormality syndrome expressed by overnutrition diet intake is at least vascular endothelial dysfunction. The non-human animal model of metabolic abnormality syndrome according to any one of claims 1 to 4, wherein the endothelium-dependent vasorelaxant action is reduced as compared to a normal animal. The non-human animal model of metabolic abnormality syndrome according to any one of claims 1 to 5, which is used as a pathological model of metabolic abnormality syndrome after ingestion of overnutrition food. A screening method for substances that affect metabolic abnormality syndrome having the following steps:
(A) a step of causing a non-human animal model of metabolic disorders according to any one of claims 1 to 6 to ingest an overnutrition diet to express at least vascular endothelial dysfunction as a symptom of metabolic disorders;
(B) a step of administering a test substance to the non-human animal model of metabolic abnormality syndrome obtained in the step (a), and (c) a non-human animal model of metabolic abnormality syndrome obtained in the step (b). A step of selecting a substance that affects metabolic syndrome from test substances using as an index the dependence of vascular relaxation or systolic blood pressure. A transformed mouse in which the genomic region corresponding to the 38th to 268th positions of the mouse cDNA of adiponectin has been deleted, or the genomic region has been replaced with another nucleotide sequence, and fed with an overnutrition diet [1] At least endothelium-dependent vasorelaxation or decreased systolic blood pressure, and [2] insulin resistance, [3] neovascularization compared to the corresponding wild-type mouse At least one selected from the group consisting of intima formation, [4] vascular smooth muscle cell proliferation induced by injury, [5] tumor necrosis factor (TNF), and [6] serum free fatty acid is enhanced or A substance that affects metabolic abnormality syndrome, including performing the following steps (1) to (3) using an increasing number of mice as a non-human animal model of metabolic abnormality syndrome The screening method of:
(1) a step of administering a test substance to the non-human animal model of metabolic disorder syndrome;
(2) (B) to (F) corresponding to the test of (A) and the above [2] to [6] for the non-human animal model of metabolic abnormality syndrome obtained in the step (1) Performing any one of the tests;
(A) The endothelium-dependent vasorelaxant action or systolic blood pressure is measured and compared with the measured value of the endothelium-dependent vasorelaxant action or systolic blood pressure of a non-human model animal of a metabolic disorder syndrome as a control to which no test substance is administered. ,
(B) Insulin resistance is measured and compared with the insulin resistance of a non-human model animal of a control metabolic disorder syndrome in which a test substance is not administered,
(C) Measure the degree of neovascular intimal hyperplasia and compare it with the degree of neovascular intimal hyperplasia in a non-human animal model of a control metabolic disorder syndrome in which the test substance is not administered.
(D) Measure the degree of proliferation of vascular smooth muscle cells induced by injury, and compare with the degree of proliferation of vascular smooth muscle cells induced by injury of a control non-metabolic syndrome non-human model animal to which a test substance is not administered,
(F) measuring the tumor necrosis factor (TNF) concentration in blood and comparing it with the tumor necrosis factor (TNF) concentration in the blood of a control non-metabolic syndrome non-human model animal to which the test substance is not administered,
(G) The serum free fatty acid (FFA) concentration is measured and compared with the serum free fatty acid (FFA) concentration of a control metabolic syndrome syndrome model animal to which no test substance is administered.
(3) Based on the results of any of the tests (A) and (B) to (F) carried out in (2), compared with the control metabolic syndrome non-human animal model to which the test substance is not administered, The step of selecting a test substance administered to a non-human metabolic animal model of metabolic abnormality syndrome that exhibits any of the characteristics of (a) and (b) to (f) as a substance that affects the metabolic abnormality syndrome:
(A) Increase or suppression of endothelium-dependent vasorelaxation, or decrease or increase of systolic blood pressure (b) Decrease / inhibition of insulin resistance, or increase / increase (c) Hyperplasia of neointimal Decrease / suppression, or increase / increase (d) Decrease / suppression of vascular smooth muscle cell proliferation induced by injury, or increase / increase (e) Decrease / suppression of tumor necrosis factor (TNF) concentration in blood Or increase / increase (f) decrease / suppression or increase / increase of serum free fatty acid (FFA) concentration. The screening method for a substance that affects the metabolic abnormality syndrome according to claim 8, which is used as a screening method for an active ingredient of a prophylactic or improving drug for metabolic abnormality syndrome. The method for screening a substance affecting a metabolic disorder syndrome according to claim 9, wherein the following step is performed instead of the step (3) described in claim 8.
(3 ′) Based on the results of any of the tests (A) and (B) to (F) carried out in (2), compared with a non-human animal model of control metabolic syndrome where no test substance is administered A test substance administered to a non-human animal model of metabolic abnormality syndrome that exhibits any of the following characteristics (a ′) and (b ′) to (f ′) is used as an active ingredient of a prophylactic or ameliorating agent for metabolic abnormality syndrome Sorting process:
(A ′) Increase in endothelium-dependent vasorelaxation, or decrease in systolic blood pressure (b ′) Decrease / suppression of insulin resistance (c ′) Decrease / inhibition of neointimal hyperplasia (d ′ ) Decrease / suppression of proliferation of vascular smooth muscle cells induced by injury (e ′) Decrease / suppression of tumor necrosis factor (TNF) concentration in blood (f ′) Decrease of serum free fatty acid (FFA) concentration /Suppression. Substances affecting metabolic syndrome are antihypertensive drugs, especially endothelium-dependent hypertension improvers, intimal thickeners, smooth muscle cell growth inhibitors, anti-arteriosclerosis improvers, anti-inflammatory drugs, tumor necrosis factor (TNF) production inhibitor, insulin resistance improver, glucose tolerance improver, obesity improver, lipid improver, tissue regeneration accelerator and anticardiologist Item 11. A screening method for a substance that affects the metabolic abnormality syndrome according to Item 9 or 10. A hypertensive prophylaxis or amelioration agent comprising adiponectin as an active ingredient. An agent for preventing or ameliorating hypertension comprising the polypeptide described in (a) or (b) below as an active ingredient:
(A) a polypeptide having the amino acid sequence represented by SEQ ID NO: 1,
(B) A polypeptide comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence of (a) and having an endothelium-dependent vasodilatory action. The agent for preventing or improving hypertension according to claim 12, wherein adiponectin is a gene recombinant. The agent for preventing or improving hypertension according to any one of claims 12 to 14, wherein the hypertension is endothelium-dependent hypertension.

Images