JP2009095264A - Codon-optimized royalisin gene - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a codon-optimized royalisin gene that can express royalisin, a protein of Apis mellifera, in a yeast host at a high level. <P>SOLUTION: Provided are an optimized royalisin gene obtained by replacing bases in 21 codons among the total 51 codons of the royalisin gene of Apis mellifera on the basis of a codon-using frequency table in a yeast, an expression vector containing the gene, a yeast host containing the expression vector, and a method for producing the royalisin with the host. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a codon-optimized royalisin gene, an expression vector containing the royalisin gene, a yeast host containing the expression vector, and a method for producing royalisin using the host.

  Royal jelly is a milky-white jelly-like liquid. Bees honeybee eats pollen mainly between 3 and 10 days after emergence, which is metabolized in organ called heart tube, pharyngeal gland and large jaw of head Secreted from the gland. Royal jelly is given as a special meal for the queen bee in the bee society. A queen bee fed with royal jelly grows twice as large as other working bees and can maintain a long life span of 3-5 years compared to the average 35-40 days of working bees. become able to. During this time, the queen bee lays as many as 2,000-3,000 eggs a day, maintaining the high sociality of the bees.

  This royal jelly is said to contain well-balanced over 40 kinds of nutrients essential for maintaining human health such as proteins, essential amino acids, vitamins, minerals, fatty acids and enzymes. It has been used as a food.

  In recent years, various physiologically active substances contained in royal jelly are being analyzed, and one of them is an antibacterial peptide. Several types of antibacterial peptides contained in royal jelly are known, and one of them is royalisin.

  Royalisin is a basic peptide composed of 51 amino acids and having a molecular weight of about 5,500. In addition, there are six cysteines (C) in the amino acid sequence, which are involved in three pairs of disulfoid bonds (Non-patent Document 1).

  This royaricin generally does not show antibacterial activity against gram-negative Escherichia coli or Salmonella, but shows strong antibacterial activity against gram-positive bacteria such as staphylococci. In addition to causing infectious food poisoning, staphylococci have become a serious problem in hospitals and the like as a resistant bacterium MRSA (methicillin-resistant Staphylococcus aureus) to which most antibiotics do not work. For this reason, there is a possibility of taking food royalties by taking royal jelly, and it can be expected to be applied as a therapeutic agent for MRSA. Gram-positive bacteria include tetanus, botulinum, and anthrax, and royaricin is expected to exhibit antibacterial activity against these medically important bacteria.

However, since the amount of royal ricin contained in natural royal jelly is very small, and royal jelly contains various active substances other than roy ricin, a method for producing roy ricin stably at low cost has been demanded. .
Fujiwara et al., J Biol ・ Chem., 256 (19): 11333-11337, 1990

  An object of the present invention is to provide a codon-optimized royalisin gene, an expression vector containing the royalisin gene, a yeast host containing the expression vector, and a method for producing royalisin using the host.

  As a result of intensive studies, the present inventors have found that the codon-optimized royalisin gene represented by SEQ ID NO: 1 has a particularly excellent expression level in a yeast host, and completed the present invention.

Accordingly, the present invention provides the following:
1. A codon-optimized royalisin gene represented by SEQ ID NO: 1,
2. An expression vector comprising the gene of 1 above,
3. A yeast host comprising the expression vector of 2 above,
4). A method for producing royaricin using the above host (3).

  The present invention provides a codon-optimized royaricin gene that is expressed at high levels in yeast hosts, royaricin, a protein of Apis mellifera.

  The codon-optimized royalisin gene of the present invention can be prepared by modifying the base sequence of the native honeybee royalisin gene (substituting a base at a specific site with another base). The honeybee roycin gene can be produced by preparing a genomic DNA library according to a conventional method and selecting a desired clone from the library using an appropriate probe or the like specific to the gene of the present invention. A method for screening the gene from a genomic DNA library is not particularly limited, and various conventional methods can be used. Examples thereof include a plaque hybridization method and a colony hybridization method using a probe that selectively binds to a target nucleic acid sequence.

  Moreover, as a means for the modification, it can be prepared using a known technique such as site-directed mutagenesis. For example, a commercially available mutagenesis kit using site-directed mutagenesis can be used.

  Although it does not specifically limit as a vector of this invention, For example, pPIC9K, pPIC3.5K, pAO815 can be utilized. The host yeast of the present invention is not particularly limited, and for example, Pichia pastoris GS115, Pichia pastoris KM71, and Pichia pastoris SMD1168 can be used.

  In order to transform host yeast using the vector thus obtained, a protoplast method, a competent cell method, an electroporation method, or the like can be used. The obtained transformant may be cultured under appropriate conditions. Proteins can be collected and purified from the obtained culture broth by a general method.

  Hereinafter, the present invention will be described in more detail with specific experimental examples.

  The nucleotide sequence of the honeybee royaricin gene and the amino acid sequence of royaricin are shown in SEQ ID NOs: 2 and 3, respectively. Regarding the amino acid sequence of royaricin, a mutation of R and Y has been reported at the 50th amino acid (Klaudiny et al., Insect Biochem. Molecular Biol., 35: 11-22, 2005). The former R was selected based on the sequence of Genebank U1955.

  The present invention aims to express a large amount of the above-mentioned royalycin gene in yeast, and codon optimization was performed for that purpose. Based on the codon usage frequency table in yeast of FIG. 1, base substitution (codonation) was performed at 21 codons (41.2%) out of all 51 codons of the royalisin gene.

  Regarding the optimization of the royalisin gene, the results of the base exchange and the comparison of codon usage before and after the exchange are shown together in FIG. At this time, based on the literature of Anjali Yadava et al., Infection and Immunity 2003, the codon with the second frequency of use was adopted for the replacement of 3 codons (caa → cag; aac → aat; gat → gac).

  The royaricin base sequence (codon-optimized sequence) with the codon optimized in this way is shown in SEQ ID NO: 1. The finally obtained codon optimized royalisin gene (gene sequence expected to be expressed in yeast) is replaced with 30 bases corresponding to 19.6% of all 153 bases of natural royalisin, and the amino acid sequence is determined. This means that the base was replaced at 21 codons (41.2%). In natural royaricin, the 13th amino acid is Asn (N), but in P. pastoris it is known that sugar chain (mannose) modification occurs here. Codon replacement (aac → caa) was performed to replace Gln (Q), which is expected not to cause the above change.

Cloning of target gene sequence and construction of plasmid vector Based on the designed codon optimized gene sequence, six types of DNA oligomers were synthesized as follows to prepare the target gene.
Fwd1: tgtagaaaaacttcttttaaagacttgtgggacaaaagatttcatcatcaccatcatcattaa (SEQ ID NO: 4)
Fwd2: gtctttgggtaaagctggtggtcattgtgagaaagttggttgtatttgtagaaaaacttcttttaaag (sequence number 5)
Fwd3: gcggaattcgttacttgtgacttgttgtcatttaaaggtcaggttcaagactctgcttgtgctg (SEQ ID NO: 6)
Rev1: caagtctttaaaagaagtttttctacaaatacaaccaactttctcacaatgaccaccagctttacccaa (SEQ ID NO: 7)
Rev2: gcgaattcttaatgatgatggtgatgatgaaatcttttgtccc (SEQ ID NO: 8)
Rev3: cacaatgaccaccagctttacccaaagacaaacaattagcagcacaagcagagtcttgaacctgacc (SEQ ID NO: 9)

  These DNA oligomers were combined in the following order to prepare double-stranded DNA using Klenow enzyme. 5'-Fwd3 (EcoRI-royalysin 1-64) + Rev3 (royalysin 103-37) + Fwd2 (royalysin 75-142) + Rev1 (royalysin 147-78) + Fwd1 (royalysin 121-153 + histidine tag) + Rev2 (histidine tag + EcoRI) -3 '

  The target gene amplified by the PCR method was inserted into a T / A vector (pGEM-T, Promega) for cloning. After confirming the nucleotide sequence of the target gene of the cloned T / A vector, an optimized royalisin gene was obtained from which both ends were enzymatically treated by enzymatic treatment (EcoRI). Next, this was inserted into a yeast expression vector plasmid (pPIC9K) to construct an expression vector (FIG. 3).

Recombination into yeast strain (GS115 strain) and expression In order to recombine the completed plasmid vector into the yeast strain (GS115, Invitrogen), the plasmid vector was linearized with restriction enzyme SalI, and this was electroporated (1. 5KV) into Pichia pastoris (GS115).

Comparison of peptide expression level with large-scale culture of recombinant yeast The vector (pPIC9K) used this time contains a marker when a large number of target genes are inserted into yeast at the same time as the system for transferring the expressed protein to the outside of the cell. Yes.

In order to select a recombinant yeast in which a large number of target genes have been inserted, first, a combination with MD medium (Minimal Dextrose Medium: 1.34% YNB, 4 × 10 ⁻⁵ % biotin, 2% glucose, 2% agarose) The replacement yeast is selected and then further cultured in YPD medium (Yeast extract Peptone Dextrose Medium: 1% yeast extract, 2% peptone, 2% glucose) containing high concentration geneticin (G418; 3, 0 mg / ml). The grown recombinant yeast was selected.

The selected recombinant yeast was transformed into BMGY medium (Buffered Glycerol-complex Medium: 1% yeast extract, 2% peptone, 100 mM potassium phosphate pH 6.0, 1.34% YNB, 4 × 10 ⁻⁵ % biotin, 1% % Glycerin) at 28-30 ° C., 200-250 rpm, shaken overnight to grow, then BMMY medium (Buffered Methanol-complex Medium: 1% yeast extract, 2% peptone, 100 mM potassium phosphate pH 6. (0, 1.34% YNB, 4 × 10 ⁻⁵ % biotin, 0.5% methanol), and further cultured with shaking at 28-30 ° C. and 200-250 rpm. During this time, methanol (100%) is added at 0.5% of the volume every 24 hours, and 1 ml of the culture solution is taken at the same time every 24, 48, 72, 96, 120 hours, and they are used on a nickel-coated plate. The expression level was examined by ELISA. For the measurement of the expression level, an anti-histidine tag antibody (rabbit) was used as the primary antibody, and an alkaline phosphatase-labeled anti-rabbit antibody (goat) was used as the secondary antibody. After coloring with p-NPP, the absorbance (OD405 nm) was measured, and the protein expression levels were compared.

  The amount of expressed royalisin peptide obtained by mass-cultivating recombinant yeast strains is about twice that of the case where the base sequence without codon optimization was directly recombined into yeast, A significant increase in recombinant peptide expression level due to codon optimization was confirmed (FIG. 4).

  In addition, when necessary, in recombination of the codon-optimized gene, a histidine tag composed of 6 histidines was inserted at the C-terminal side, thereby enabling the expression peptide to be separated and purified simultaneously with a nickel column.

  As the epidemic of various emerging and re-emerging infectious diseases becomes a social problem on a global scale, one of the problems is the problem of drug-resistant bacteria. In particular, multi-drug resistant Staphylococcus aureus (MRSA) is important as a major causative agent of nosocomial infection, and its countermeasure is highly medically important. Loyaricin has been shown to exert antibacterial effects against Gram-positive bacteria containing MRSA, and antibacterial peptides are thought to be difficult to acquire drug resistance because they act directly on the cell walls of pathogenic bacteria. Yes. The invention can be expected to be applied and industrialized as an antibacterial agent effective for measures against nosocomial infection by MRSA. In particular, since staphylococci such as MRSA are common as skin resident bacteria, by developing ointments containing roylicin, etc. in the medical field as an easy means to prevent nosocomial infection of MRSA It is useful.

The codon usage in yeast (Pichia pastoris) is shown. Shows codons before and after conversion and codon usage. The structure of the expression vector pPIC9K is shown. The comparison of the expression level of the recombinant peptide in yeast of codon-optimized royaricin and native royaricin is shown. Black bars represent codon-optimized royaricin and white bars represent native royaricin.

Claims (4)

  A codon-optimized royalisin gene represented by SEQ ID NO: 1.   An expression vector comprising the gene of claim 1.   A yeast host comprising the expression vector of claim 2.   A method for producing royaricin using the host of claim 3.

Images