JP2009034061A - Method for identification of influenza a virus strain having strong infectiousness to human body - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for easily and quickly identifying an influenza A virus strain having high infectiousness to human body, and a phylactic agent for human against influenza A virus by lowering the infectiousness of influenza A virus to human body. <P>SOLUTION: An influenza A virus strain having high infectiousness to human body is identified by a step to analyze the presence of the glycosylation of the 158th position of a hemagglutinin protein of an influenza A virus, a step to analyze the presence of the deletion at the stem of the neuraminidase protein of an influenza A virus and, when there is no glycosilation at the 158th position of the hemagglutinin protein of the influenza A virus and no deletion at the stem of the neuraminidase protein, a step to judge the strain as the influenza A virus strain having high binding activity to a sugar chain having a sialyl α2,6 galactose bond at the terminal. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a method for identifying an influenza A virus strain having high binding activity to α2,6 sialylparagloboside, a method for identifying an influenza A virus strain having strong infectivity to humans, and a human against influenza A virus. It relates to an infection control agent.

  Influenza virus infection is an infectious disease that is prevalent every winter, and when it occurs in the elderly and infants in particular, it can cause serious life-threatening symptoms. In recent years, infection of humans with highly pathogenic H5N1 avian influenza virus has been confirmed, which is a global problem. When an H5N1 avian influenza virus infects humans, a high mortality rate is exhibited even in adults other than the elderly and infants unless effective treatment is given at the early stage of infection. According to the WHO website, since 2004, a total of 317 human infections with H5N1 avian influenza virus have been confirmed in 12 countries, and 191 people have died (as of June 29, 2007). . The H5N1 avian influenza virus has already become established in poultry in Asia, Europe, Africa and the Middle East, posing a risk of leading to a global epidemic in humans.

  Influenza viruses are isolated not only from humans but also from various animals such as pigs, horses, poultry, and wild birds. Epidemiological and molecular genetic studies have shown that influenza viruses isolated from mammals originally originated from wild birds (especially water fowls such as ducks). However, general avian influenza does not normally grow in humans as it is, and general human influenza does not normally grow in birds as it is. That is, there is basically a limitation on the host range of these influenza viruses. Therefore, infection from poultry to humans is still inefficient, and it can be said that it is basically rare that a virus transmitted from poultry to humans is further transmitted to humans. This also applies to the H5N1 avian influenza virus (Non-patent Document 1).

  As an important factor of the infection barrier between influenza virus species as described above, that is, the binding specificity of influenza virus to host cells, for example, primary and secondary receptor binding sites (RBS) (Non-patent Document 2) are used. RBS activity and specificity in hemagglutinin (HA) containing (Non-patent Documents 3 and 4), sialidase activity and specificity of neuraminidase (NA) (Non-patent Documents 5 to 7), molecular species of sialic acid on the host cell surface And terminal sialic acid-Gal bond (non-patent documents 8 to 10) of complex carbohydrates. A plurality of basic amino acids that bind peptides with HA1 and HA2 increase the vulnerability to cleavage of highly pathogenic H5N1 avian influenza virus HA by trypsin-like enzyme (Non-patent Document 11), while amino acids constituting RBS There is not much difference in the residues.

  More specifically, with regard to the infection barrier between birds and humans, most avian influenza viruses usually have receptors with galactose and α2,3-linked sialic acid (SAα2,3Gal) at the end of the sugar chain ( In contrast to the selective binding to the avian receptor, most human influenza viruses usually have a galactose and α2,6-linked sialic acid (SAα2,6Gal) at the sugar chain end (human) It is known to selectively bind to a type receptor (Non-patent Document 8). Therefore, the conversion of the receptor specificity from α2,3-linked sialic acid (α2,3-sialic acid) to α2,6-linked sialic acid (α2,6-sialic acid) is important for adaptation of avian viruses to human hosts. This is one of the decisive steps (Non-Patent Document 9, etc.).

  Sialic acid is a general term for substances in which the amino group or hydroxy group of neuraminic acid, a 9-carbon sugar, is substituted. N-acetylneuraminic acid (acetylated at the 5-position ( Neu5Ac) and N-glycolylneuraminic acid (Neu5Gc) modified with glycolic acid are well known. Sialic acid is widely distributed in the body as a component of glycoconjugates such as glycoproteins, glycolipids, glycopeptides, etc., and is especially present on the cell membrane surface and plays a major role in the specific recognition mechanism of cells. It is said that. The type of sialic acid residue as a substituent strongly affects the activity of metabolic enzymes, particularly sialidase, and affects the conversion rate of glycoconjugates. Complex carbohydrates are involved in a wide variety of cellular functions, for example, the surface of biological organs is protected from enzymatic and immunological attacks by acidic molecules in complex carbohydrates present on the surface of biological organs. . However, on the other hand, glycoconjugates on the surface of living organs become various physiological receptors, become recognition sites for microorganisms and toxins including viruses, and allow infection. Many viruses, particularly influenza viruses, are known to bind to sialic acid residues when infecting cells.

  On the other hand, in influenza virus infection, it is known that hemagglutinin (HA), which is a viral membrane antigen of influenza virus, and neuraminidase (NA) activity, which is a receptor disrupting enzyme, are important (Non-patent Documents 12- 15). Influenza virus epidemic mutations are due to HA and NA mutations, and all of the HA subtypes (H1-H15) and NA subtypes (N1-N9) are stored in the wild waterfowl world.

  The present inventors have previously clarified the chemical structure of a host cell receptor that recognizes influenza virus HA. As a result, influenza A virus and human influenza B virus isolated from humans, pigs, birds, and horses both specifically recognize and bind sugar chains containing sialic acid (Sia), It strongly binds to sialyllacto-type I sugar chains (SAα2-6 (2-3) Galβ1-3GlcNAcβ1-) or sialyllacto-type II sugar chains (SAα2-6 (2-3) Galβ1-4GlcNAcβ1-) Clearly, the molecular evolution of A and B virus HA appears as a change in the recognition of the sialic acid binding mode (SA2-3Gal, SA2-6Gal) and the sialic acid molecular species (Neu5Ac, Neu5Gc) at the end of the receptor sialo-sugar chain I found out. Furthermore, a single base substitution of influenza A virus HA gene (ie, a single amino acid substitution of Leu226 → Gln or Ser228 → Gly) can change the host range, and when an avian virus is transmitted to humans, swine While the natural host duck influenza virus is transmitted to poultry and circulates among the poultry host animals, it undergoes evolutionary selection by the host animal's receptor sugar chain, and the HA molecule In the case where the amino acid substitution of the above occurred, and the substitution had human-type receptor recognition specificity, the possibility of direct transmission to humans without passing through swine was clarified (Non-Patent Documents 9 and 16).

  The present inventors further found that the avian influenza virus NA and the human influenza virus NA differ in stability at acidic pH by only two amino acid substitutions, and NA is a virus pathogenicity, host range, pandemic ( It is clarified that it is deeply related to pandemic (Non-Patent Documents 16 and 17).

N. Engl. J. Med. 352, 333-340 (2005) Proc. Natl. Acad. Sci. USA 89, 324-328 (1992) Nature 289, 366-373 (1981) Nature 333, 426-431 (1988) J. Virol. 79, 11705-11715 (2005) J. Virol. 73, 6743-6751 (1999) J. Virol. 78, 12665-12667 (2004) Biol. Pharm. Bull. 28, 399-408 (2005) J. Virol. 74, 11825-11831 (2000) J. Virol. 71, 3357-3362 (1997) Proc. Natl. Acad. Sci. USA 85, 324-328 (1988) J. Virol. 74, 6015-6020 (2000) Virus Res. 79, 177-85 (2001) Rev. Med. Virol. 12, 159-166 (2002) Virology 339, 12-20 (2005) Biochemistry 76, 227-233 (2004) FEBS LETT. 557, 228-232 (2004)

  As described in the prior art, for example, when an avian-derived influenza virus such as H5N1 avian influenza virus, which is a type of influenza A, has acquired high infectivity to humans due to mutation, due to a slight delay in measures If the infection spreads even a little, it becomes extremely difficult to stop the spread of the secondary infection, and there is a high risk that a pandemic will occur in humans. In order to stop the epidemic in humans, when the number of human infections is very small, it is easy and quick to identify whether the influenza virus strain is a strong human infectious strain. If identified as a strong strain, it is critical to strictly limit the movement and isolation of infected individuals and to take maximum care to prevent secondary infections. An object of the present invention is to provide a method for easily and quickly identifying an influenza A virus strain having a strong infectivity to humans, and a human against influenza A virus by reducing the infectivity of influenza A virus to humans. It is to provide an infection control agent.

  Until now, assays for measuring influenza virus binding activity to receptors such as α2,6-sialic acid and α2,3-sialic acid have been performed under conditions such as 4 ° C. where neuraminidase protein activity decreases. . This is because neuraminidase is known as an enzyme that cleaves its own sialic acid residue or sialic acid residue of a host cell receptor when virus particles budding or releasing from the host cell. This is because, when investigating the binding activity of influenza virus to receptors such as sialic acid and α2,3 sialic acid, it was thought to be a noise of experimental results. The present inventors have overturned the common knowledge of those skilled in the art, and influenza against receptors such as α2,6 sialic acid and α2,3 sialic acid under a temperature condition suitable for the activity of neuraminidase protein (eg, 37 ° C.). A virus binding assay was attempted, which resulted in the absence of glycosylation at position 158 of the influenza A virus hemagglutinin protein and the absence of a deletion of the influenza A neuraminidase protein stem The influenza A virus strain was found to have high binding activity to α2,6 sialic acid and strong infectivity to humans, and the present invention was completed.

  That is, the present invention is (1) type A having high binding activity to a sugar chain having a sialyl α2,6 galactose bond at the end, which comprises the following steps (a1), (a2) and (b): Method for identifying influenza virus strain; analyzing the presence or absence of glycosylation at position 158 of the hemagglutinin protein of influenza A virus (a1), analyzing the presence or absence of deletion in the trunk of neuraminidase protein of influenza A virus (a2) ), When it is not glycosylated at position 158 of the hemagglutinin protein of influenza A virus and there is no deletion in the trunk of the neuraminidase protein, the binding activity to the sugar chain having a sialyl α2,6 galactose bond at the end Step (b) for determining a high influenza A virus strain (2) The identification method according to (1) above, wherein the deletion in the trunk of neuraminidase protein is a deletion of 20 amino acids in the trunk of neuraminidase protein, and (3) hemagglutinin of influenza A virus The identification method according to the above (1) or (2), further comprising a step (a3) of analyzing whether the position 227 of the protein is asparagine (Asn) or arginine (Arg); The influenza virus is an H5N1 influenza virus, and relates to the identification method according to any one of (1) to (3) above.

  The present invention also includes (5) a method for identifying an influenza A virus strain having strong infectivity to humans, comprising the following steps (a1), (a2) and (b); Analyzing the presence or absence of glycosylation at position 158 of the hemagglutinin protein of (a1), analyzing the presence or absence of deletion in the trunk of the neuraminidase protein of influenza A virus (a2), 158 of the hemagglutinin protein of influenza A virus (B) a step of determining a strain of influenza A virus having a strong infectivity to humans when there is no deletion in the trunk of neuraminidase protein and (6) the trunk of neuraminidase protein Deletion in the neuraminidase protein executive The identification method according to (5) above, wherein (20) the hemagglutinin protein of influenza A virus is at position 227 is asparagine (Asn) or arginine (Arg). (5) The identification method according to (5) or (6), further comprising a step (a3) for analysis, or (8) the influenza A virus is an H5N1 influenza virus It relates to the identification method according to any one of 5) to (7).

  Furthermore, the present invention relates to (9) an agent for controlling human infection against influenza A virus, which comprises a glycosylation active composition at position 158 of the hemagglutinin protein of influenza A virus.

  According to the method for identifying an influenza A virus strain having strong infectivity to humans according to the present invention, is the isolated and detected influenza A virus (avian influenza virus) strain a strain having strong infectivity to humans? In order to be able to easily and quickly identify whether or not an avian influenza virus strain that has been isolated and detected can be prevalent in humans, and if it is prevalent in humans, It can be predicted in advance whether it can be prevalent, and can be applied to the prediction of influenza pandemic. In addition, based on the above-mentioned identification results, it is possible to appropriately set restrictions on the movement and isolation of infected persons, so human rights violations such as restraining infected persons more than necessary, and humans with avian flu Can be avoided.

  A method for identifying an influenza A virus strain having a high binding activity to a sugar chain having a sialyl α2,6 galactose bond at the end thereof (for example, α2,6 sialylparagloboside) of the present invention, Is a method for analyzing the presence or absence of glycosylation at position 158 of the hemagglutinin protein of influenza A virus (a1). ), Analyzing the presence or absence of a deletion in the trunk of the neuraminidase protein of influenza A virus (a2), and in the trunk of the neuraminidase protein that is not glycosylated at position 158 of the hemagglutinin protein of influenza A virus When there is no deletion, α2,6 sialylparagro The identification method is not particularly limited as long as it has the step (b) of determining that it is a type A influenza virus strain having a high activity for binding to sid. Specifically, the type A influenza virus is preferably exemplified by H5N1 type influenza virus. can do. In addition, the amino acid number of hemagglutinin protein and neuraminidase protein in this specification is a numerical value converted into the amino acid number of hemagglutinin protein and neuraminidase protein in H3 type influenza virus according to practice. Conversion of the amino acid numbers of these proteins can be easily performed by comparing sequences using the influenza virus database described below.

  The presence or absence of glycosylation at position 158 of the hemagglutinin protein of influenza A virus in step (a1) of the identification method of the present invention is specifically determined by whether the amino acid sequence at positions 158 to 160 of the HA protein of influenza A virus is glycosyl It can be performed by analyzing whether it is a modified motif (Asn-X-Ser / Thr; X at position 159 represents any amino acid residue). If the amino acid sequence at positions 158 to 160 of the HA protein does not correspond to the glycosylation motif (Asn-X-Ser / Thr), it can be determined that the position 158 of the HA protein is not glycosylated. If the amino acid sequence at positions 158 to 160 corresponds to a glycosylation motif (Asn-X-Ser / Thr), it can be determined that position 158 of the HA protein is glycosylated.

  The amino acid sequence at positions 158 to 160 of the HA protein can be analyzed by determining the base sequence of the HA protein, and the base sequence of the HA protein can be determined by a known method such as Southern hybridization or PCR. It is possible to use this means. The design of the HA probe used in the Southern hybridization method and the HA primer sequence used in the PCR method is “Influenza Virus Resource” (http://www.ncbi.nlm.nih.gov/genomes/) on the NCBI website. This can be easily performed based on the known HA sequence of influenza virus obtained using a database such as FLU / Database / select.cgi? Go = 1). As a primer for HA for determining the full-length base sequence of the HA protein, a 5BmHA forward primer (SEQ ID NO: 1: TATTCGTCTCAGGGAGCAAAAGCAGGGG) and a 3BmHA reverse primer (SEQ ID NO: 2: ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT) can be preferably exemplified. Further, as a primer for HA for determining the nucleotide sequence of the amino acid sequence at positions 158 to 160 of the HA protein, MtH5T158AF forward primer (SEQ ID NO: 3: GAACAATGCATACCCAAC) MtH5T158AR reverse primer (SEQ ID NO: 4: TTGGGTATGCATTGTTC) is preferably exemplified can do.

  More specific examples of the glycosylation motif include Asn-Ser-Thr (NST), Asn-Asn-Thr (NNT), and Asn-Ser-Ser (NSS). More specifically, Asn-Ser-Ala (NSA), Asn-Asn-Ala (NNA), Asp-Asn-Ala (DNA) and Asn-Asp-Ala (NDA) can be exemplified.

  The presence or absence of deletion in the trunk of the neuraminidase protein of influenza A virus in step (a2) of the identification method of the present invention can be determined by, for example, using the Southern hybridization method, PCR method or the like of the NA gene of influenza A virus. Determine the base sequence or amplify the base sequence corresponding to the region containing the NA protein stem using the PCR method, and the sequence length of the PCR product obtained by the amplification into the NA protein having the full length stem This can be done by analyzing whether there is a deletion in the trunk of the NA protein, such as by comparing with the length of the corresponding base sequence.

  The design of the NA probe used in the Southern hybridization method and the NA primer sequence used in the PCR method are described in “Influenza Virus Resource” (http://www.ncbi.nlm.nih.gov/) on the NCBI website. This can be easily carried out based on the known influenza virus NA sequence obtained using a database such as genomes / FLU / Database / select.cgi? go = 1). As a primer for NA for examining the presence or absence of the deletion of the stem part of NA protein, a 5BmNA forward primer (SEQ ID NO: 5: TATTCGTCTCAGGGAGCAAAAGCAGGAGT) and a 3B mNA reverse primer (SEQ ID NO: 6: ATATCGTCTCGTATTAGTAGAAACAAGGAGTTTTTT) can be preferably exemplified.

  In the present invention, as a NA protein having a deletion in the trunk, a virus plasmid using the NA gene encoding the NA protein as the NA gene of the virus plasmid in the examples described later is α2,3-sialylparagloboside. Α2,3 sialylparagloboside (α2,3SPG) (Neu5Acα2-3Galβ1-4GlcNAcβ1-3Galβ1-4Glcβ1-1′Cer), the α2, of the receptor in contact with the primary RBS of the virus plasmid HA This refers to an NA protein having a stem length that is incapable of cleaving the 3 sialic acid bond. For example, an NA protein lacking 20 amino acids at positions 49 to 68 of the amino acid sequence of the NA protein is preferably exemplified. it can.

  In the step (b) of the identification method of the present invention, if the influenza A virus hemagglutinin protein is not glycosylated at position 158 and there is no deletion in the trunk of the neuraminidase protein, such an influenza A virus strain Is a type A influenza virus strain having a high binding activity to a sugar chain having a sialyl α2,6 galactose bond at its terminal (for example, α2,6 sialylparagloboside), or a type A influenza virus strain having a strong infectivity to humans It is determined. For example, by applying the analysis results of step (a1) and step (a2) to the criteria shown in Table 1 below, first, it is classified into the following four stages of Degree III, II, I, 0, and from Degree 0 to III. As the degree of Degree increases, the influenza A virus has a higher binding activity to a sugar chain having a sialyl α2,6 galactose bond (for example, α2,6 sialylparagloboside), and has a higher infectivity to humans. Become stronger.

  Α2,6 sialylparagloboside (α2,6SPG) is a sugar chain composed of Neu5Acα2-6alβ1-4GlcNAcβ1-3Galβ1-4Glcβ1-1′Cer, and is present on the surface of human cells and functions as a virus receptor. Demonstrate. Therefore, a virus strain having a high binding activity to α2,6SPG can be said to be a virus strain having a high infectivity to humans. Here, infectivity to humans in the present invention includes infectivity from animals other than humans (particularly birds) such as birds and pigs, and infectivity from humans to humans. Α2,6SPG can be prepared from human meconium (FEBS Lett. 133, 197-200 (1981)) according to a conventional method.

  The above-mentioned influenza A strains classified as Degree III have a particularly high binding activity to α2,6SPG compared to influenza A strains classified as Degree 0, I and II. It can be determined that it is a high influenza A virus strain or a strong influenza A virus that can infect humans. In addition, in the experimental result of the virus plasmid in FIGS. 1A to C in the examples described later, the presence or absence of glycosylation at the 169th position of the HA protein relative to the binding activity to α2,6SPG depends on the glycosylation at the 158th position of the HA protein. It is suggested that it has the same effect as the presence or absence of. No influenza A virus HA protein has been identified that is not glycosylated at position 169, although glycosylation at position 169 may be essential for the virus to survive in the ecosystem. In the future, a virus in which the position 169 of the HA protein is not glycosylated may be generated due to mutation or the like. Therefore, in the identification method of the present invention, the hemagglutinin of influenza A virus is used instead of or together with the step (a1) of analyzing the presence or absence of glycosylation at position 158 of the hemagglutinin protein of influenza A virus. An identification method comprising the step (a1 ′) of analyzing the presence or absence of glycosylation at the position 169 of the protein is also included.

  In the identification method of the present invention, as long as the identification method of the present invention is not impaired, in addition to the aforementioned steps (a1) and (a2), asparagine (Asn) or arginine (position 227 of hemagglutinin protein of influenza A virus) Arg) may be included in the analysis step (a3). When the position 227 of the A-type hemagglutinin protein is Asn or Arg, the A-type has higher binding activity to α2,6 sialylparagloboside than when the site is an amino acid residue other than Asn or Arg It can be identified as an influenza virus strain. Step (a3) is performed by the same method as the above-mentioned step (a1), that is, by determining the sequence of the HA gene of influenza A virus using the Southern hybridization method, the PCR method or the like. Can do.

  The agent for controlling human infection against influenza A virus of the present invention (hereinafter also referred to as “human infection control agent of the present invention”) contains a glycosylation active composition at position 158 of the hemagglutinin protein of influenza A virus. The composition is not particularly limited as long as it is a human infection control agent, and these glycosylation active compositions can be administered to humans, birds, pigs and the like.

  Examples of the glycosylation activity composition include a composition containing a compound having an activity to glycosylate position 158 of hemagglutinin protein of influenza A virus (preferably H5N1 influenza virus), for example, a composition containing glycosyltransferase. Products, glycosylation promoters and the like, and among them, sialyltransferase and the like can be preferably exemplified.

  In addition, a substance capable of substituting the amino acid residue at position 227 of the hemagglutinin protein of influenza A virus with an amino acid residue other than Asn or Arg can also be used as a human infection control agent. For example, an influenza A virus such as a nucleic acid sequence having a sequence complementary to the HA gene of influenza A virus and a codon corresponding to the amino acid residue at position 227 of the HA protein that is neither AAT nor AAC The substance which has the activity which recombines the gene which codes hemagglutinin protein of this can be mentioned.

  As long as the human infection control effect is not impaired, one or more of the glycosylation active compositions may be used as the human infection control agent of the present invention. Acceptable ordinary carriers, excipients, diluents, pH buffers, water-soluble solvents such as physiological saline, isotonic agents such as sodium chloride, glycerin and D-mannitol, stabilization of human serum albumin, etc. Various preparation ingredients such as a preservative such as a drug, methylparaben, and a narcotic such as benzyl alcohol can be added. In addition to the human infection control agent of the present invention, a component having an effect of controlling infection with influenza A virus can further be used.

  The dosage and administration method of the human infection control agent of the present invention can be appropriately selected according to the properties of Compound A, Compound B and Compound C used and the administration target. The administration target of the human infection control agent of the present invention may be a non-human animal such as a bird or pig (preferably a bird) or a human. That is, by administering the human infection control agent of the present invention to animals other than humans, infection of humans with influenza A virus may be controlled, or the human infection control agent of the present invention is administered to humans. May control human infection.

  EXAMPLES Hereinafter, although an Example demonstrates this invention more concretely, the technical scope of this invention is not limited to these illustrations.

[Preparation of receptor substrate]
Two types of sialylparagloboside (SPG) were used as receptor substrates, namely the avian receptor α2,3SPG and the human receptor α2,6SPG. α2,3SPG and α2,6SPG were prepared from human placenta (Lipids 23, 192-198 (1988)) and human placenta (FEBS Lett. 133, 197-200 (1981)), respectively, according to a conventional method.

[Receptor specificity assay]
A virus binding assay using enzyme-linked immunosorbent assay (ELISA) was conducted on 55 wild-type A viruses listed in Table 2 obtained from the WHO collaborative laboratory in Asia (Hong Kong University). The binding specificity of the H5N1 subtype virus to the SPG was determined.

The virus binding assay using ELISA was performed as follows. First, in a 96-well microtiter plate, substrates (α2, 3SPG and α2, 6SPG) at a concentration of 50 pm / ml were serially diluted 2-fold with methanol. The plate was dried with hot air, and then blocked with PBS containing 2% by weight bovine serum albumin (Invitrogen) for 1 hour at room temperature. The plate was washed 5 times with PBS and then incubated overnight at 37 ° C. with a virus suspension at a concentration of 64 HA units. The plate was then washed 5 times with PBS, and SPG and virus remaining on the plate were fixed with PBS containing 4% by weight paraformaldehyde for 30 minutes at room temperature. The plate was then washed 5 times with PBS before anti-H5N1 rabbit serum was added to the plate and incubated for 2 hours at room temperature. After removing serum from the plate and washing well with PBS, the plate was incubated with HRP-conjugated protein A (ICN Pharmaceuticals, Inc.) for 2 hours. Plates were washed 10 times with PBS, and incubated 0.01 _wt% H 2 _{O 2} containing O- phenylenediamine (Sigma Co.) with PBS and room temperature for 10 minutes. The color reaction was then stopped by adding 1N HCl to the plate. The absorbance of the solution in the wells of the plate was measured at a wavelength of 490 nm using an MTP-32 microplate reader (Corona Electric Co., Ltd).

  Table 2 shows the results of expressing the binding activity of each virus to the avian receptor α2,3SPG and the human receptor α2,6SPG in a relative ratio (%). Most isolates, including human isolates, selectively recognized the avian receptor, but only 12.7% (7) of 55 strains selectively bound to the human receptor. (Table 2). These viruses could be classified into three groups (I-III) by binding specificity. Group I (n = 24) selectively binds to the avian receptor, group III (n = 7) selectively binds to the human receptor, and group II (n = 24) Also joined.

[Sequence analysis]
Next, analysis of hemagglutinin (HA) sequence and neuraminidase (NA) sequence of 55 strains of type A virus used in Example 2 was attempted. The sequence was determined by the following method.
Viral RNA was extracted from each virus using RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. The reverse transcription reaction from the viral RNA extracted from the virus was performed according to the manufacturer's instructions using U12 primer and reverse transcriptase (SuperScript III; manufactured by Invitrogen), which are complementary sequences at the 3 ′ end of the viral RNA. Using the cDNA obtained by this reverse transcription reaction as a template, the sequences of the HA gene and NA gene were amplified by a standard polymerase chain reaction (PCR) method. 5BmHA forward primer (SEQ ID NO: 1: TATTCGTCTCAGGGAGCAAAAGCAGGGG) and 3BmHA reverse primer (SEQ ID NO: 2: ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT) are used for the amplification of the HA gene, and 5B mNA forward primer (SEQ ID NO: 5: TATTCGTCTCAGGGAGCAAAAGCAGGAGT). A reverse primer (SEQ ID NO: 6: ATATCGTCTCGTATTAGTAGAAACAAGGAGTTTTTT) was used. The sequences of the HA gene and NA gene thus cloned were determined. These gene sequences were determined in accordance with a conventional method at the Department of Microbiology, Hong Kong University School of Medicine.

  As a result of sequence analysis, there was a clear difference in the glycosylation motif and the amino acid of the receptor binding site between these type A virus groups. The glycosylation motif at positions 158-160 (Asn-X-Ser / Thr) was shared by all strains in Group I, but not in Groups II and III. The 220 loop sequence consisting of the receptor binding pocket was GQSGR at positions 225-229 in most Group I and II HAs, while Ser at position 227 was changed to Asn or Arg in group III. Furthermore, group I and II viruses had a deletion of 20 amino acid residues in the NA trunk (J. Virol. 79, 9926-9932 (2005), Proc. Natl. Acad. Sci. USA 101, 8156- 8161 (2004)), but it was absent from group III viruses (Table 2).

[Preparation of reassortant virus plasmid]
From the experimental results of Example 3, it cannot be denied that the difference in binding activity to α2,3SPG and α2,6SPG is due to factors other than the sequences of HA and NA. Therefore, in order to examine whether the difference in the sequence of HA or NA actually affects the change in binding activity to α2,3SPG or α2,6SPG, a reassortant virus plasmid was first prepared.

A / Hong Kong / 212/03 (A / HK212), A / Ck / Vietnam / 20/03 (A / VNM20), A / Ck / Vietnam / 133/04 (A / VNM133), A / PuertoRico / 8 / 34 (A / PR8), A / GS / Shantou / 2086/06 (A / ST2086), A / Ck / Yunnan / 115/04 (A / YN115) 6 wild-type A viruses Obtained from the WHO Collaborative Experiment Facility (Hong Kong University). Isolates from animals were cultured in embryonated chicken eggs, and allantoic fluid collected after the first passage was stored frozen at -80 ° C and used in this experiment. Isolates from humans were cultured in MDCK cells. These MDCK cells were maintained at 34.5 ° C. and 5% CO _{2 in} minimal essential medium supplemented with 5% newborn calf serum (Sigma) and antibiotics (penicillin and streptomycin). All these experiments were performed at the BL3 + facility of the Department of Microbiology, Hong Kong University School of Medicine.

Using the above-mentioned six wild-type A viruses (A / HK212, A / VNM20, A / VNM133, A / YN115, A / ST2086 and A / PR8) obtained by culturing, plasmids as follows: Constructed.
By using an RNA extraction kit (QiAamp; manufactured by Qiagen) in accordance with the manufacturer's instructions, HA cDNA and NA cDNA derived from these viruses are amplified by reverse transcription PCR, and the resulting PCR fragment is subjected to pHW2000 vector 2 It was subcloned into the BsmBI site (Proc. Natl. Acad. Sci. USA 97, 6108-6113 (2000)). In addition, introduction of point mutations into HA as described in Table 3 is carried out in accordance with the manufacturer's instruction manual for QuikChange Site-Directed Mutagenesis Kit (Stratagene) and H5 type virus HA specific primer set. It was done by using.

  In addition, when the display method of the abbreviation in the column of the gene name of Table 3 is demonstrated, for example, "HA (A160T)" is the alanine (A) residue of 160th position of the amino acid sequence of HA in a threonine (T) residue. It is an abbreviation for the mutated HA gene, and “HK212HA” is an abbreviation for HA of the HK212 strain.

  By using a reverse genetics system (Proc. Natl. Acad. Sci. USA 97, 6108-6113 (2000)) of eight plasmids such as a plasmid containing the HA gene and a plasmid containing the NA gene thus obtained, A reassortant virus plasmid was generated. That is, using an internal gene such as the HK212 strain and the VNM133 strain as a center, appropriate HA genes and NA genes, or mutant genes thereof were expressed therein. Viral plasmids prepared for this experiment are shown in Table 4, and information on the HA genes and NA genes of these viral plasmids is shown in Table 3.

All virus plasmids were subcultured in MDCK cells for only one passage and then frozen at -80 ° C for use in this experiment. In addition, about the viral plasmid used for this experiment, the HA gene and NA gene were amplified by RT-PCR, the sequence was determined, and it confirmed that the arrangement | sequence of those genes was the target arrangement | sequence.

[Receptor binding assay for reassortant virus plasmid]
For the reassortant virus plasmid prepared in Example 4, virus binding assay using thin layer chromatography (TLC) described later and virus binding using enzyme-linked immunosorbent assay (ELISA) similar to Example 2 An assay was conducted to examine the binding activity and specificity of the H5N1 virus plasmid to the avian receptor α2,3SPG and the human receptor α2,6SPG described in Example 1.

The virus binding assay using TLC was performed as follows.
Substrates (α2,3SPG and α2,6SPG, 0.25 nm each) were spotted on silica plastic TLC, then mixed with water containing chloroform, methanol and 12 mM MgCl ₂ (chloroform: methanol: 12 mM MgCl ₂ The volume ratio of water containing 5 = 4: 1) was developed. TLC plates were blocked for 1 hour at room temperature with PBS containing 1 wt% polyvinylpyrrolidone and 1 wt% ovalbumin. Binding of the viral plasmid (256 HA units / ml) to the receptor was performed overnight by incubation at 37 ° C., and then the SPG and virus remaining on the plate were washed with PBS containing 4% by weight paraformaldehyde. Fix for 30 minutes at room temperature. The plate was then washed 5 times with PBS before anti-H5N1 rabbit serum was added to the plate and incubated for 2 hours at room temperature. After removing serum from the plate and washing well with PBS, the plate was incubated with HRP-conjugated protein A (ICN Pharmaceuticals, Inc.) for 2 hours. Finally, the substrate solution I [100 mM citrate buffer (pH 6.0), 60 mM N, N-dimethyl-p-phenylenediamine dihydrochloride, 100 mM 4-chloro-1-naphthol, and 3 wt% H ₂ O ₂ aqueous solution (volume ratio 5: 1: 1: 0.005) was added and allowed to stand for 15 minutes at room temperature, SPG showing an immune reaction (SPG virus plasmid bound) visualized.

  The result of the virus binding assay using TLC is shown in the upper left panel in each graph of FIG. Moreover, the result of the virus binding assay using the above-mentioned ELISA performed for each of these virus plasmids is shown in the line graph of FIG. The assay using ELISA was repeated three times for each virus plasmid, and the “average value ± standard deviation” of the obtained results is shown in the graph.

  FIGS. 1A-C show the binding of HA with glycosylation at positions 158 and 169 to α2,3SPG and α2,6SPG of viral plasmids with HK212HA (FIG. 1A), VNM133HA (FIG. 1B) and VNM20HA (FIG. 1C). It shows the effect on activity and binding specificity.

  As can be seen from FIG. 1A, the receptor binding specificity of the HK212 virus plasmid (A / HK212HA) is similar to that of its wild-type virus, and selectively binds to the human receptor α2,6 sialic acid. Medium binding to α2,3 sialic acid. On the other hand, a mutant viral plasmid (A / HK212HA (A160T)) introduced with a substitution of Ala to Thr at position HA160, which enables glycosylation at Asn at position HA158, has α2,3 sialic acid and α2,6 sialic acid. The binding activity to both acids was reduced. In addition, mutant virus plasmids (A / HK212HA (N169S) and A / HK212HA (A160T, N169S)) introduced with a substitution of Asn to Ser at position HA169 that disable glycosylation at position 169 are HK212 virus plasmids. And had similar binding specificity.

  FIG. 1B shows the results of a virus binding assay of VNM133 virus plasmid. Unlike the HK212 virus plasmid, the HA of the VNM133 virus plasmid is glycosylated at position 158, which is in common with the latest human H5N1 isolate that binds only to α2,3 sialic acid (FIG. 1B). . On the other hand, a mutant viral plasmid (A / VNM133HA (T160A)) introduced with a Thr to Ala substitution at position HA160 that disables glycosylation at Asn at position HA158 is not only α2,3-sialic acid but also α2 , 6 came to bind well to sialic acid. In addition, mutant virus plasmids (A / VNM133HA (N169S) and A / VNM133HA (T160A, N169S)) in which Asn at HA169 is replaced with Ser in order to disable glycosylation at Asn at HA169 are also used. It bound well to both α2,6 sialic acid and α2,3 sialic acid.

  Further, FIG. 1C shows the results of the virus binding assay of the VNM20 virus plasmid. For the VNM20 viral plasmid, a mutant viral plasmid (A / VNM20HA (A160T)) in which Ala at position 160 on HA is replaced with Thr, which allows glycosylation at Asn at position 158, is specifically α2,6 sial. Receptor binding activity to acid receptors was reduced (FIG. 1C). In addition, mutant virus plasmids (A / VNM20HA (N169S) and A / VNM20HA (T160A, N169S)) in which Asn at HA169 is replaced with Ser to disable glycosylation at Asn at HA169 are also used. , Well bound to both α2,6 sialic acid and α2,3 sialic acid.

Considering FIGS. 1A-C together, allowing glycosylation at Asn at positions HA158 and 169 reduces binding activity to α2,6 sialic acid and conversely disabling glycosylation at positions HA158 or 169. It was found that the binding activity to α2,6 sialic acid was increased.
It should be noted that the sialosugar chain of the host cell receptor is the primary receptor binding site (primary RBS) of the group I virus plasmid in which both HA positions 158 and 169 are glycosylated (Nature 289, 366-373 (1981). )) (Fig. 2), but is thought to be capable of binding to infected host cells through secondary RBS that binds only to sialic acid α2,3Gal-linked glycoconjugates (Proc. Natl. Acad. Sci. USA 89, 324-328 (1992)).

FIGS. 1D and E show the effect of glycosylation at position 227 of HA on the binding specificity of viral plasmids containing HK212HA, VNM133HA, VNM20HA, and the like.
FIG. 1D shows virus plasmids [A / HK212HA (N227S) virus plasmid, A / VNM133HA (T160A) virus plasmid, A / VNM20HA virus plasmid] in which the 227 position of HA is Ser and the 227 position of HA in those virus plasmids. FIG. 1E shows the results for viral plasmids [A / HK212HA viral plasmid, A / VNM133HA (T160A, S227N) viral plasmid, A / VNM20HA (S227N) viral plasmid] wherein Ser is Asn. Ser plasmids [A / HK212HA (A160T, N227S) virus plasmid, A / VNM133HA virus plasmid, A / VNM20HA (A160T) Virus plasmids] and virus plasmids [A / HK212HA (A160T) virus plasmid, A / VNM133HA (S227N) virus plasmid, A / VNM20HA (A160T, S227N) virus whose Ser at position 227 of HA is Asn in these virus plasmids The result about a plasmid] is shown. From the results of FIGS. 1D and E, it was suggested that when the amino acid at position HA227 was replaced with Asn, the binding activity to α2,6-sialic acid was slightly increased.

As mentioned in the prior art of this application, it has been pointed out that the balance between HA and NA activity is important in influenza virus infection. Therefore, we focused on the effect of NA stem length on receptor binding specificity. FIGS. 1F and G show the results of experiments examining the effect of NA trunk length on binding specificity. The upper panel of FIG. 1F and the lower panel of FIG. 1G represent a viral plasmid (Full) with NA having a full length stalk, and the lower panel of FIG. 1F and the upper panel of FIG. 1G show deletions in the NA trunk. It represents a viral plasmid (short).
As shown in FIGS. 1F and G, the binding activity of the HK212 virus plasmid to α2,3 sialic acid is determined by determining the NA of HK212 as a stem such as VNM133, VNM20 or YN115 [A / Chicken / Yunnan / 115/04 (H5N1)]. However, the NA of HK212 has been increased by replacing the NA of HK212 with PR8NA [NA of A / PR / 8/34 (H1N1)] or ST2086NA [A / goose / Shantou / 2086/05 (H5N1)]. There was no change when replaced with normal NA with no deletion in the trunk (FIG. 1F). On the other hand, the VNM133 viral plasmid that selectively binds to α2,3 sialic acid lost its activity when NK212, PR8 or ST2086 NA without deletion in the trunk was introduced. In contrast, when NA having a deletion in the trunk (VNM20NA or YN115NA) was introduced, there was no change in the selective binding activity of VNM133 virus plasmid to α2,3-sialic acid (FIG. 1G).
From the results of these data, NA without a deletion in the trunk (NA having a full-length trunk) shows sialic acid-Gal binding of the receptor in contact with the primary RBS of HA, particularly α2,3-sialic acid binding. NA, which has a deletion in the trunk, is the α2,3 sialic acid binding portion of the receptor in contact with the primary RBS of HA, whereas the binding activity of HA can be clearly reduced as a result. As a result, it was considered that the α2,3 sialic acid bond could not be cleaved and the binding activity was not changed. That is, it is considered that NA having a deletion in the stem in the progeny virus budding from the host cell membrane could not cleave the sialic acid at the end of the sialo-sugar chain of the host cell membrane that interacts with the primary RBS of HA.

  In addition, none of the viral plasmids used in FIG. 1F is glycosylated at position 158 of HA, and all of the viral plasmids used in FIG. 1G are glycosylated at position 158 (and position 169). Has been. Considering the results of FIG. 1F and FIG. 1G together, in the virus plasmid in which NA has a full-length stem (Full) and the 158th position of HA is not glycosylated, the binding activity to α2,6-sialic acid It has been found that is increasing.

[Cell infection experiment]
In order to investigate the relationship between the binding specificity of influenza A virus (H5N1 strain) and its replication, the following cell infection experiment was performed.

  First, Madin-Darby canine kidney (MDCK) cells and A549 cells derived from human lung cancer cells were prepared as cells to be infected with the aforementioned viral plasmid. In order to examine the presence or absence of sialic acid α2,6Gal-binding glycan and sialic acid α2,3Gal-binding glycan in MDCK cells and A549 cells, the proteins of both cells were isolated according to a conventional method, and these proteins and molecular weight marker protein (MK) Was electrophoresed on a 10% SDS-PAGE gel at 10 μg per lane and transferred to a PVDF membrane. FIG. 3 shows the results of SNA lectin (binding to sialic acid at α2,6 position) staining, MAA lectin (binding to sialic acid at α2,3 position) staining or CBB staining for this PDVF membrane. From the results of FIG. 3, the content of sialic acid α2,6Gal glycan in A549 cells is about three times the content in MDCK cells, and the content of sialic acid α2,3Gal glycans in MDCK cells is the content in A549 cells. It was found to be about 5 times the amount. That is, MDCK cells preferentially express sialic acid α2,3Gal-linked glycans over sialic acid α2,6Gal-linked glycans and are advantageous for avian virus replication, whereas A549 cells are sialic acid α2,3Gal-linked. It expresses sialic acid α2,6Gal-linked glycan over bound glycan and is advantageous for human virus replication.

The above-mentioned MDCK cells and A549 cells were contacted with 21 types of viral plasmids described in Table 4, respectively. The following immunohistochemical assay was used to determine if these cells were infected with a viral plasmid.
Cells that had passed 12 hours after contact with the viral plasmid were fixed on the plate with PBS containing 4% by weight of paraformaldehyde for 10 minutes at room temperature. Cells fixed on the plate were washed 5 times with PBS, and then incubated with a monoclonal antibody (4E6) against the nucleoprotein of the viral plasmid at 37 ° C. for 1 hour. After removing the antibody solution from the plate and washing well, the cells on the plate were incubated with horseradish peroxidase (HRP) conjugated anti-mouse IgG + M antibody (ICN Pharmaceuticals, Inc.) for 1 hour. Thereafter, infected cells were visualized using the substrate solution I described above, and the number of infected cells was measured under a microscope. The result is shown in the item “Infected cell number” in Table 4.

Viral plasmid replication was examined by plaque assay. The plaque assay was performed as follows.
First, 21 types of diluted virus plasmids listed in Table 4 were brought into contact with MDCK cells or A549 cells at 37 ° C. for 1 hour, respectively. These cells were washed with PBS for 3 hours to remove viral plasmid attached around these cells, and then the cells were seeded on MEM medium containing 1% by weight agarose and 2 μg / ml acetylated trypsin. 72 hours after contact with the viral plasmid, the cells were stained with a 0.5 wt% amide black solution (ethanol: acetic acid: water volume ratio = 45: 10: 45) and finally the size and number of plaques were measured. did. The result is shown in the item “Plaque size” in Table 4.
In addition, Rate (%) in Table 4 is a value representing the number of infected cells or plaque size (mm) in MDCK cells at a fraction of 100 with respect to that of A549 cells.

Based on the results of the aforementioned immunohistochemical assay and plaque assay, 23 types of viral plasmids were classified into four stages according to the degree of adaptation to human cells (Table 4).
The virus plasmids of the “Degree 0” group have low infectivity for both MDCK cells (α2,3 sialic acid> α2,6 sialic acid) and A549 cells (α2,6 sialic acid> α2,3 sialic acid) (Infected). Not only the cell number was small) but also the replication ability in MDCK cells was weak (Plaque size was small), and replication could not be detected in A549 cells. It should be noted that the virus plasmid “Degree 0” had HA that was glycosylated at position 158 (and position 169), and full-length NA without deletion in the trunk.

  The virus plasmids of the “Degree I” group were similar to the virus plasmids of “Degree 0” in infectivity, but the replication ability was weak, but not only in MDCK cells but also in A549 cells. It was. The virus plasmid “Degree I” had HA glycosylated at position 158 (and position 169) and NA having a deletion in the trunk.

  The virus plasmids of the “Degree II” group showed higher infectivity and replication than the virus plasmids of “Degree 0” and “Degree I”, but the infectivity was lower in A549 cells than in MDCK cells, and replication power Was significantly inferior in A549 cells than in MDCK cells. The virus plasmid “Degree II” was glycosylated at position HA169, but was not glycosylated at position HA158 and had an NA with a deletion in the trunk.

  The virus plasmids of the “Degree III” group showed higher infectivity and replication than the virus plasmids of “Degree 0” and “Degree I”, but the infectivity was lower in MDCK cells than in A549 cells, and the replication ability Was significantly inferior in MDCK cells than A549 cells. The “Degree III” viral plasmid was glycosylated at the HA169 position, but was not glycosylated at the HA158 position and had a deletion-free NA.

  From the above results, the fact that the HA158 position is not glycosylated and that the NA trunk does not have two deletions promote efficient replication in cells having sialic acid α2,6Gal-linked glycans. It was shown to be a factor. Degree III viral plasmids that combine both of these factors are likely to infect humans from person to person, and the epidemic is expected to pose a major threat.

[Virus analysis in virus database]
In order to investigate the presence or absence of glycosylation at HA158 of recently isolated influenza H5N1 virus and the presence or absence of deletion in the NA trunk, “Influenza Virus Resource” (http: //www.ncbi.nlm.nih) on the NCBI homepage .gov / genomes / FLU / Database / select.cgi? go = 1) and Fluwikis homepage database (http://www.fluwikie.com/pmwiki.php?n=Main.HomePage) Analysis was performed on 1240 HA sequences and 861 NA sequences in H5N1A influenza virus. The result is shown in FIG. The proportion of viruses with glycosylation at position HA158 (FIG. 4A) and the percentage of viruses with NA with deleted stems (FIG. 4B) has been on a gradual increase since 2000, but There has been a downward trend for glycosylated viruses since 2005.

  Moreover, the result of having analyzed the amino acid sequence of HA158-160th position using the same database is shown in FIG. 4C. As shown in FIG. 4C, there are as many as 20 types of amino acid sequences in the amino acid sequences at positions HA158 to 160, and it can be seen that the H5N1A influenza virus is rapidly evolving with respect to the amino acid sequence of this portion. The major types of non-glycosylated motifs are NSA, NNA, DNA and NDA, and the major types of glycosylated motifs are NST, NNT and NSS.

  Further, FIG. 4D shows the result of classifying the amino acid sequences at positions HA158 to 160 by virus isolation source (human, goose, chicken) using the same database. As shown in FIG. 4D, the major glycosylation motifs are NST (31.1% of all isolates) and NNT (27.4% of all isolates), which are non-glycosylated motifs. Major was NSA (14.0% of all isolates).

  In addition, the ratio of NST glycosylation motif in human isolates (59.5% of 109 human isolates) was the same as that in chicken isolates (51 of 393 chicken isolates). The ratio in goose isolates (in 371 goose isolates) was only 16.1% (Figure 4D). This seems to reflect that human infections are more often caused by chickens than by geese. Further, FIG. 4E shows the transition of the number of strains for each classification when the 834 strain of H5N1 influenza virus is classified according to the above-described classification (Degree 0 to III) according to the degree of adaptation to human cells. As shown in FIG. 4E, Degree III most suitable for human infection has been decreasing since 200, but Degre II virus suitable for human infection after Degree III has increased since 2000. There was a trend.

Further, when all the H5N1 influenza viruses on both databases described above were classified according to the above classification (Degree 0 to III), it was found that 90% or more of them belonged to Degree I or II.
Degree II virus, which lacks the NA but lacks glycosylation at position HA158 and has acquired the adaptability to bind to the human receptor (α2,6-sialic acid) since 2006 There is a dramatic increase, especially in Africa, Europe and the Middle East (FIG. 4F). Thus, investigation of the phenotypic variation of the receptor binding specificity of the virus for Degree II would be particularly important for predicting human-to-human transmission of the virus.

  Moreover, although it has been found that sialic acid α2,3Gal-linked sugar chain is expressed in epithelial cells of the lower respiratory tract of humans (Non-patent Document 8, Nature 440, 435-436 (2006), Science 312, 399 (2006)), it is generally said that human influenza viruses infect epithelial cells of the upper respiratory tract through α2,6-sialic acid receptors. These ideas are based on the 1918 H1N1 virus (Science 303, 1838-1842 (2004), Science 303, 1866-1870 (2004)), the 1957 H2N2 virus, and the 1968 H3N2 virus. Early isolates selectively recognize α2,6 sialic acid despite their HA origin from avian viruses (J. Virol. 74, 8502-8512 (2000), Virus Res. 56, 169-176 (1998)). However, by the present inventors, most of the recent H5N1 viruses, including human isolates (about 87.5% of the isolates investigated) still bind selectively to the α2,3-sialic acid receptor. There was found.

It was considered that human isolates classified as Degree II may infect human cells by binding of secondary RBS to α2,3-sialic acid receptor. According to the WHO website, 60-70% of H5N1 influenza virus patients are children or under 20 years of age. This was also expected to be related to the child's airway being physiologically shorter than adults and the virions reaching the end of the airway easily.
In fact, H5N1 human influenza virus infects type II alveoli of the lower respiratory tract through α2,3-sialic acid receptors (Nature 440, 435-436 (2006), Science 312, 399 (2006)). This is considered to contribute to the inefficient human-to-human infection of the H5N1 virus. If the H5N1 virus is mutated into a human adaptive virus that binds easily to the α2,6-sialic acid receptor, it can replicate in the upper respiratory tract and be easily transmitted to other hosts by sneezing and coughing. The infectivity of this virus from person to person will improve dramatically. Since 2005, human and poultry-derived H5N1 viruses have dramatically increased in Africa, Europe and the Middle East, including the Degree II group that binds to both α2,3 sialic acid and α2,6 sialic acid receptors. (FIG. 4F). Therefore, studies of phenotypic variation of the receptor binding specificity of the virus of Degree II appear to be particularly important for predicting human-to-human viral infection.

It is a figure which shows the result of the binding assay about each reassembled virus. The line graph shows the results of the virus binding assay using ELISA, and the upper left panel in the graph shows the results of the virus binding assay using TLC. The figure which shows the presumed arrangement | positioning (Virology 189, 121-131 (1992)) of glycosylation in 158 and 169 position on HA, and a sialic acid-galactose binding ligand in primary RBS of A / Vietnam / 1203/2004 (2FK0). is there. The dotted line forming a triangle at the center separates the three monomers of HA (a, b and c). A dotted line forming a circle at the center separates the three units of the primary RBS in the HA. In the upper dotted unit forming a circle in the middle, the sugar chain attached to Asn at position 158 covers the primary RBS of HA together with the sugar chain attached to Asn at position 169 on another adjacent HA monomer, It is believed that the primary RBS of HA is unable to contact the receptor sialo-sugar residues. The lower right and lower left dotted units forming a circle in the center have sugar chains bound to either the 169-position Asn or the 158-position Asn of the monomer a, respectively. Therefore, the primary RBS of HA is the receptor sial. It is thought that it can contact the sugar chain. SNA lectin was used to examine whether Madin-Darby canine kidney (MDCK) cells and A549 cells derived from human lung cancer cells have sialic acid α2,6Gal-binding glycans and sialic acid α2,3Gal-binding glycans. It is a figure which shows the result of having performed dyeing | staining (it couple | bonds with the sialic acid of (alpha) 2, 6 position), MAA lectin (binding | bonding with the sialic acid of (alpha) 2, 3 position), and CBB staining. In order to investigate the presence or absence of glycosylation at HA158 and 169 of recently isolated influenza H5N1 virus and the presence or absence of deletion in the NA trunk, in H5N1A influenza virus downloaded from databases on NCBI homepage and Fluwikis homepage, It is a figure which shows the result of having analyzed about 1240 HA arrangement | sequences and 861 NA arrangement | sequences.

Claims (9)

A method for identifying an influenza A virus strain having a high binding activity to a sugar chain having a sialyl α2,6 galactose bond at the end, comprising the following steps (a1), (a2) and (b):
Step (a1); Step of analyzing presence or absence of glycosylation at position 158 of hemagglutinin protein of influenza A virus Step (a2); Step of analyzing presence or absence of deletion at the trunk of neuraminidase protein of influenza A virus Step (b) ); When it is not glycosylated at position 158 of the hemagglutinin protein of influenza A virus and there is no deletion in the trunk of the neuraminidase protein, the binding activity to the sugar chain terminated with a sialyl α2,6 galactose bond The process of judging a high influenza A virus strain The identification method according to claim 1, wherein the deletion of the neuraminidase protein in the trunk is a deletion of 20 amino acids in the trunk of the neuraminidase protein. The identification method according to claim 1 or 2, further comprising a step (a3) of analyzing whether position 227 of the hemagglutinin protein of influenza A virus is asparagine (Asn) or arginine (Arg). The identification method according to any one of claims 1 to 3, wherein the influenza A virus is an H5N1 influenza virus. A method for identifying an influenza A virus strain having strong infectivity to humans, comprising the following steps (a1), (a2) and (b):
Step (a1); Step of analyzing presence or absence of glycosylation at position 158 of hemagglutinin protein of influenza A virus Step (a2); Step of analyzing presence or absence of deletion at the trunk of neuraminidase protein of influenza A virus Step (b) ); A step of determining an influenza A virus strain having strong infectivity to humans when it is not glycosylated at position 158 of the hemagglutinin protein of influenza A virus and there is no deletion in the trunk of neuraminidase protein 6. The identification method according to claim 5, wherein the deletion in the trunk of the neuraminidase protein is a deletion of 20 amino acids in the trunk of the neuraminidase protein. The identification method according to claim 5 or 6, further comprising a step (a3) of analyzing whether position 227 of the hemagglutinin protein of influenza A virus is asparagine (Asn) or arginine (Arg). The identification method according to any one of claims 5 to 7, wherein the influenza A virus is an H5N1 influenza virus. An agent for controlling human infection against influenza A virus, comprising a glycosylation active composition at position 158 of hemagglutinin protein of influenza A virus.

Images