JP2009022274A - Position-mapping method on chromosomal dna and method for analyzing composition of nucleic acid mixture - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To develop an efficient position mapping on chromosomal DNA having high accuracy and a method for analyzing a composition of a nucleic acid mixture. <P>SOLUTION: The method for carrying out position mapping on chromosomal DNA comprises hybridizing a nucleic acid to a one kind of repeated base sequence in a developed or extended chromosomal DNA, measuring a mutual distance on the chromosomal DNA about a plurality of repeated base sequences of chromosomal DNA by using a labeled material introduced into a hybridized nucleic acid and then determining a region or a position on the chromosome of the repeated base sequence contained in the composition, based on characteristics of the measured distance. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a method for mapping a position on chromosomal DNA, a method for analyzing the composition of a nucleic acid mixture, and the like.

  In recent years, active research has been conducted on the relationship between mutant genes and diseases, and it has become possible to diagnose diseases by detecting abnormal genes or detecting abnormal chromosome structures. . To do this more efficiently, it is desirable to obtain a continuous series of global information about the genome and chromosomal modification from the long chromosomal DNA. Methods used to obtain a series of genomic information from long chromosomal DNA include contig determination of a cloned chromosomal DNA library (see Non-Patent Document 1, etc.), and comparative genomic hybridization using a DNA chip ( Non-patent literature 2 etc.), chromosome fluorescence in situ hybridization (FISH) and chromosomal fiber FISH method (see non-patent literature 3-8 etc.) are exemplified.

  In library screening for determining contigs, fragmented long chromosomal DNA is incorporated into a vector sequence that can be purified and amplified and prepared into library DNA. When a single DNA species population called a clone purified and amplified from library DNA is used, sufficient detection sensitivity can be obtained even with a detection method that provides only weak detection sensitivity when a single fragment is used. There is an advantage. However, since cloning requires multiple steps of fragment insertion into a vector, purification, and amplification, and reproducible cloning is difficult, genome information is obtained by forming the same contig in multiple samples. It is difficult to make a comparative analysis.

  The Comparative Genome Hybridization method using a DNA chip is a method using a DNA chip in which base sequences located at equally spaced positions on a chromosome are arranged. Global amplification / deletion of the sequence can be determined by hybridizing the sample chromosomal DNA fragmented on the DNA chip (or its amplification product) and measuring the amount of the chromosomal fragment bound to each position. However, it is not suitable for the determination of translocation in which amplification / deletion at individual positions of the repetitive nucleotide sequence or the amount of fragments does not change. In addition, the DNA chip itself is expensive.

  Chromosome fluorescence in situ hybridization (FISH) and chromosomal fiber FISH are methods for analyzing chromosomal DNA in the nucleus or in an aggregated state as mitotic chromosomes without fragmentation. There are multiple genome information in this aggregate, and it is necessary to resolve the congested signals generated from these by a method having spatial resolution such as microscopic observation. However, it is difficult to detect a position on the genome sequence that is substantially 1 Mb or less on the base sequence. One method for solving this problem is to perform deproteinization and observe the fiberized chromosomal DNA in which the full length of the chromosomal DNA is expanded / extended, but there has been no successful extension over the full length. This is because the chromosomal DNA after expansion / elongation is composed of a very weak double helix, which is entangled and divided if not properly arranged. Therefore, there is an example of fiberization that avoids entanglement and fragmentation by partial expansion / extension by gentle deproteinization. In this case, the expansion / extension of the target portion cannot be controlled, leaving a problem of reproducibility.

In any case, it is necessary to analyze with high resolution over a wide range including the gene buried inside the chromosome. For that purpose, it is desirable to analyze after fully expanding and extending the chromosome while suppressing damage. If sufficiently expanded and elongated chromosomal DNA is used, position mapping on the chromosomal DNA and composition analysis of the nucleic acid mixture can be performed successfully.
Olson MV, et al., Proc Natl Acad Sci USA 83: 7826-7830 (1989), Green ED and Olson MV Proc Natl Acac Sci USA 87: 1213-1217 (1990) Kallioniemi A., et al., Science 258: 818-821 (1992), Pinkel D. et al., Nat Genet 20: 207-211 (1998) Wiegant J., et al., Hum Mol Genet 1: 587-591 (1992) Heng HHQ, et al., Proc Natl Acac Sci USA 89: 909-9513 (1992) Senger G., et al., Cytogenet Cell Genet 64: 49-53 (1993) Parra I. and Windle B. Nat Genet 5: 17-21 (1993) Haaf T. and Ward DC, Hum Mol Genet 3: 697-709 (1994) Bensimon A., et al., Science 265: 2096-2098 (1994)

  It was an object of the present invention to develop a method for highly accurate and efficient chromosomal DNA location mapping and composition analysis of nucleic acid mixtures. At the same time, it was an object of the present invention to develop means / methods that can expand and extend chromosomes while suppressing damage, and can analyze with high resolution over a wide range including genes in the chromosome.

The inventors of the present invention have made extensive studies in view of the above circumstances, and the following steps:
In the expanded or elongated chromosomal DNA, the nucleic acid is hybridized to one type of repeated base sequence,
By using a labeling substance introduced into the hybridized nucleic acid, a mutual distance on the chromosomal DNA is measured for a set of a plurality of repetitive base sequences of the chromosomal DNA;
Develop a position mapping method on chromosomal DNA, including determining the region or position on the chromosome of the set and the repetitive base sequences included in the set based on the characteristics of the measured distance, and complete the present invention It came to.

Furthermore, the inventors have the following steps:
Select from a mixture of nucleic acids consisting of multiple types of nucleic acids extracted from biological samples, a mixture of nucleic acids fragmented from them, a mixture of nucleic acids replicated using them as a template, and a mixture of nucleic acids subjected to both fragmentation and replication Prepare any one mixture that will be
The expanded or elongated chromosomal DNA is used as a nucleic acid for hybridization, the mixture of the prepared nucleic acids is used as a nucleic acid for hybridization, hybridization is performed, and then
Developed a method for analyzing the composition of a nucleic acid mixture contained in a sample, including measuring the type and amount of nucleic acid contained in the prepared nucleic acid mixture by using a label introduced into the hybridized nucleic acid. Thus, the present invention has been completed.

  In addition, the present inventors made a fibrous substrate having a receptor-modified region on the surface, bound the chromosome to this, and expanded / extended the chromosome using flow or electrophoresis, while suppressing damage. The present inventors have found that a chromosome can be expanded and extended, and can be analyzed with high resolution over a wide range including genes in the chromosome, and a further aspect of the present invention has been completed.

  That is, the present invention can analyze a chromosomal DNA itself after developing and extending the chromosomal DNA, which is a linear ultrapolymer that is extremely long and easily damaged, into a form suitable for analysis, or other It is used for sample analysis. Until now, the extremely long and easily damaged nature of chromosomal DNA has made it difficult to deploy, expand and place in a form suitable for analysis. A means to solve this is given.

The process for realizing the above is summarized as follows.
(1) The chromosome is bound to the fibrous substrate. (2) The chromosome is expanded and elongated from the fibrous substrate and fixed on another substrate. (3) The methods (1) and (2) above, or Acquire genomic information on chromosomal DNA that has been expanded / extended and fixed using other methods, or acquire information on the composition of sample DNA using chromosomal DNA that has been expanded / extended and fixed as a comparison / reference target It is to do.
In particular, the present invention relates to (3) above.

Specifically, the present invention provides the following to solve the above problems:
(1) The following steps:
In the expanded or elongated chromosomal DNA, the nucleic acid is hybridized to one type of repeated base sequence,
By using a label that is introduced into the hybridized nucleic acid or that is introduced into the nucleic acid after hybridization, a plurality of sets of the repetitive base sequences of the chromosomal DNA are mutually separated on the chromosomal DNA. And then
A position mapping method on chromosomal DNA, comprising determining a region or position on a chromosome of the set and the repetitive base sequence included in the set based on the measured distance feature;
(2) Expanded or extended chromosomal DNA is fragmented before expansion or extension, and by using the label, a plurality of sets of repetitive base sequences contained in the fragment Mapping the position of the fragment on the chromosomal DNA before being fragmented by measuring the distance and determining the position on the chromosome of the set based on the characteristic of the measured distance; (1) The method described in;
(3) The following steps:
In the expanded or elongated chromosomal DNA, nucleic acid is hybridized to multiple types of repetitive base sequences,
By using a label that can be specifically identified or cannot be identified for the type of repetitive base sequence introduced into the nucleic acid after hybridization or introduced into the nucleic acid after hybridization, the plurality of types of repetitive sequences are used. Measure the mutual distance for a plurality of sets of repetitive base sequences including the base sequence,
The position on the chromosomal DNA, including determining the region or position on the chromosome of the set and the repetitive base sequence contained in the set, based on the measured distance and, if possible, the characteristics of the identification content Mapping method;
(4) The expanded or extended chromosomal DNA is fragmented before expansion or extension, and by using the label, a repetitive base sequence comprising a plurality of types of repetitive base sequences contained in the fragment is obtained. For a plurality of sets, the mutual distance is measured, and based on the measured distance and, if it can be identified, the characteristics of the identification content, the set and the region on the chromosome of the repetitive base sequence included in the set Or mapping the position of the fragment on the chromosomal DNA before being fragmented by determining the position;
(5) The method according to (2) or (4), wherein the fragmentation is performed by restriction enzyme digestion;
(6) The method according to any one of (1) to (5), wherein the chromosomal DNA is expanded / expanded by dielectrophoresis to perform position mapping;
(7) The chromosomal DNA position mapping method according to any one of (1) to (6), wherein as the nucleic acid that hybridizes to the repetitive nucleotide sequence, 100 or less oligonucleic acids whose difference in annealing temperature is within a range of 5 ° C. are used. ;
(8) The chromosomal DNA position mapping method according to any one of (1) to (7), wherein the repetitive base sequence includes a human Alu sequence;
(9) the nucleotide sequence of residues 133 to 157, the nucleotide sequence of residues 231 to 245, the nucleotide sequence of residues 260 to 282 of the consensus Alu sequence in SEQ ID NO: 11, and these The chromosomal DNA position mapping method according to (8), wherein a nucleic acid having at least one base sequence selected from the group consisting of complementary strand sequences is used as a nucleic acid to hybridize to chromosomal DNA;
(10) The chromosomal DNA position mapping method according to any one of (1) to (9), wherein the repetitive base sequence includes a human LINE-1 sequence;
(11) The following steps:
In the expanded or elongated chromosomal DNA, a receptor having binding activity to methylated cytosine is added and bound,
Methylated cytosine position mapping on chromosomal DNA comprising identifying the position of methylated cytosine in chromosomal DNA by using a label that is introduced into the receptor or that is introduced into the receptor after binding Method;
(12) The method according to (11), wherein the expanded or extended chromosomal DNA is fragmented before expansion or extension;
(13)
The mapping method according to any one of (1) to (12), wherein the label contains a substance that becomes a ligand of a receptor having specific binding property thereto, and the receptor becomes the next label;
(14)
The mapping method according to any one of (1) to (13), wherein the label contains a fluorescent substance;
(15) A chromosomal DNA mapping apparatus system for use in the chromosomal DNA position mapping method according to any one of (1) to (14), wherein an observation apparatus for visualizing a label of a repetitive base sequence, It is essential to have three devices: a photographing device and a computing device that repeatedly extracts the base sequence position from the photographed image, measures the mutual distance of the set, and collates with the genomic base sequence database information or information extracted from the information. A chromosomal DNA mapping apparatus or system comprising as an element;
(16) The following steps:
Select from a mixture of nucleic acids consisting of multiple types of nucleic acids extracted from biological samples, a mixture of nucleic acids fragmented from them, a mixture of nucleic acids replicated using them as a template, and a mixture of nucleic acids subjected to both fragmentation and replication Prepare any one mixture that will be
The expanded or elongated chromosomal DNA is used as a nucleic acid for hybridization, the mixture of the prepared nucleic acids is used as a nucleic acid for hybridization, hybridization is performed, and then
Discrimination of the type of nucleic acid contained in the prepared mixture of nucleic acids and measurement of relative content by using a label introduced into the hybridized nucleic acid or introduced into the nucleic acid after hybridization A method for analyzing the composition of a nucleic acid mixture contained in a sample, comprising:
(17)
The composition analysis method according to (16), wherein the label contains a substance that becomes a ligand of a receptor having specific binding property thereto, and the receptor becomes the next label;
(18)
The composition analysis method according to (16) or (17), wherein the label contains a fluorescent substance.

The present invention further discloses the following:
(1) A chromosomal binding fibrous substrate having a surface modified with a receptor on its surface.
(2) The fibrous substrate according to (1), wherein the maximum cross-sectional width is 100 micrometers or less.
(3) The fibrous substrate according to (1), wherein the maximum cross-sectional width is 20 micrometers or less.
(4) The fibrous substrate according to any one of (1) to (3), wherein a plurality of the substrates are separated from each other by a region modified with a receptor and a region not modified with a receptor.
(5) The fibrous substrate according to (3), wherein receptor-modified regions having a width of 10 micrometers or less are arranged on the surface at intervals of 1 millimeter or less.
(6) The material is glass, synthetic resin, carbon, ceramics, silicon, silicon oxide, silicon nitride, metal, metal oxide, natural fiber, or a mixture or composite thereof (1) to (5) The fibrous substrate according to any one of the above.
(7) The receptor is an antibody, a lectin, a biotin specific receptor, biotin, a strep tag, a metal complex ligand, an antibody binding protein, glutathione, glutathione S-transferase, amylose, cellulose, galactose, amino group, amino group Any one of (1) to (6), including a reactive group having a binding property, a thiol group, a reactive group having a covalent binding property to a thiol group, a group having a nucleic acid binding property, and a nucleic acid A fibrous substrate as described in 1.
(8) The fibrous substrate according to any one of (1) to (6), wherein the receptor includes one selected from biotin, avidin, and streptavidin.
(9) The fibrous substrate according to any one of (1) to (6), wherein the receptor includes a metal complex ligand.
(10) The fibrous substrate according to any one of (1) to (6), wherein the receptor contains a nucleic acid.
(11) The fibrous substrate according to any one of (1) to (10), wherein the chromosome is a mitotic chromosome.
(12) The fibrous substrate according to any one of (1) to (10), to which chromosomes are bound.
(13) The fibrous substrate according to (12), wherein the chromosome is a mitotic chromosome.
(14) A chromosome is bound by hybridizing a nucleic acid to chromosomal DNA and binding a ligand introduced into the hybridized nucleic acid and a receptor modified on the fibrous substrate (12 Or a fibrous substrate according to (13).
(15) The fibrous substrate according to (14), wherein the chromosomal DNA has a repeated base sequence.
(16) The fibrous substrate according to (15), wherein the repetitive base sequence is a repetitive base sequence of a telomere region or a repetitive base sequence of a centromere region.
(17) A nucleic acid is hybridized to chromosomal DNA, synthesized using the hybridized nucleic acid as a primer, a nucleobase modified with a ligand as a synthetic substrate, and chromosomal DNA as a template in a hybridized state with chromosomal DNA. The fibrous substrate according to (12) or (13), wherein the chromosome is bound by binding of the ligand bound to the prepared nucleic acid and the receptor modified on the fibrous substrate.
(18) The fibrous substrate according to (17), wherein the chromosomal DNA has a terminal single-stranded portion.
(19) Ligand and receptor binding include antigen molecule and antibody molecule binding to the antigen molecule, antibody molecule and antibody binding protein binding, biotin or strepttag and biotin specific receptor binding, glutathione and glutathione S Binding of transferase, binding of sugar and lectin that binds to the sugar, binding of amino group and reactive group having covalent bond to amino group, binding of reactive group having covalent bond to thiol group and thiol group, metal The fibrous substrate according to any one of (14) to (18), which is selected from the group consisting of a bond via a complex, a bond via a nucleic acid, and a bond via a group having nucleic acid binding properties.
(20) The fibrous substrate according to any one of (14) to (18), wherein the binding between the ligand and the receptor is a binding between biotin and streptavidin or biotin and avidin.
(21) The fibrous substrate according to any one of (14) to (18), wherein the bond between the ligand and the receptor is a bond through a metal complex ligand.
(22) The fibrous substrate according to any one of (14) to (18), wherein the binding between the ligand and the receptor is binding via a nucleic acid.
(23) A solution tank for producing a fibrous substrate to which the chromosome according to any one of (12) to (22) is bound, wherein a part or the whole of the fibrous substrate according to (1) A solution tank having an element that is reversibly or irreversibly gripped or fixed.
(24) The following steps:
The fibrous substrate according to any one of (12) to (22) is immersed in a solution and supported so as not to flow or migrate,
A method for expanding or extending a chromosome, including flowing the entire solution or migrating a substance in the solution to expand or extend the chromosomal DNA.
(25) The following steps:
The fibrous substrate according to any one of (12) to (22) is immersed in a solution and supported so as not to flow or migrate,
A method for expanding or extending a chromosome, comprising expanding or extending a chromosome using one or a plurality of methods of liquid feeding, electroosmotic flow, and electrophoresis.
(26) A solution tank for expanding or extending chromosomal DNA in the method according to (24) or (25), wherein a part or the whole of the fibrous substrate is gripped or fixed reversibly or irreversibly. The solution tank.
(27) Chromosomal DNA expanded or elongated by the method according to (24) or (25), wherein a part or all of the chromosomal DNA in the expansion / elongation tank is fixed to a smooth surface.
(28) Chromosomal DNA expanded or elongated by the method described in (24) or (25), and fixed to a network structure, a fibrous structure, a rod structure, or a mixed structure in the expansion / elongation tank Chromosomal DNA.
(29) Development / development via a substance that is fixed to a positively charged surface or structure in the extension tank, or contains a substance selected from the group consisting of divalent metal ions, metal complexes, and polyamines. The fixed chromosomal DNA according to (27) or (28), which is fixed to a negatively charged surface or structure in an extension tank.
(30) The fixed chromosomal DNA according to (27) or (28), which is fixed through binding by a group having nucleic acid binding properties.
(31) Immobilization according to (27) or (28), wherein nucleic acid is hybridized to chromosomal DNA and immobilized through binding between a ligand introduced into the nucleic acid and a receptor that has been modified in advance on the substrate. Chromosomal DNA.
(32) A chromosomal DNA having a repetitive base sequence, wherein the nucleic acid hybridizes to the repetitive base sequence, and the fixed chromosomal DNA according to (31).
(33) Starting with a nick of chromosomal DNA, the ligand in the nucleic acid synthesized using a nucleobase modified with a ligand as a synthetic substrate, and the surface or structure in the expansion / elongation tank has been modified in advance. The fixed chromosomal DNA according to (27) or (28), which is fixed through receptor binding.
(34) The reaction according to any one of (31) to (33), wherein the binding between the ligand and the receptor has a binding between biotin and streptavidin, a binding between biotin and avidin, and a covalent bond with an amino group and an amino group. Chromosomes according to (27) or (28), comprising a group selected from the group consisting of a bond of a group, a bond of a reactive group having a covalent bond to a thiol group or a thiol group, a bond through a metal complex, and a bond through a nucleic acid DNA.
(35) A complex formed by combining a fibrous substrate and a droplet holding device satisfying the following conditions: • A fibrous substrate bound to a chromosome according to any one of claims 12 to 22; A droplet holding device having a plate-like structure, the droplet holding device holding a droplet on the surface of the plate-like structure, and immersing a part or all of the fibrous substrate with the droplet.
(36) A set consisting of two solution tanks, a solution tank in which the fibrous substrate bound with the chromosome according to any one of (12) to (22) is immersed and a solution tank in which the fibrous substrate is not immersed. The fibrous substrate to which the chromosome is bonded while being immersed in the solution is transferred from one solution tank to the other solution tank, and the solution is integrated and separated. A set of two solution tanks.
(37) The set of two solution tanks according to (36), wherein one or both of the solution tanks have a surface composed of a hydrophilic region surrounded by a hydrophobic region.
(38) The set of two solution tanks according to (36), wherein one or both of the solution tanks have a plate-like structure and the solution is held on the plate-like structure by surface tension.
(39) One solution tank is a solution tank for producing a fibrous substrate to which the chromosome according to any one of (12) to (22) is bound, and the fibrous tank according to claim 1 It is a solution tank which has an element which grasps or adheres in the state where a part or all can be removed, and the other solution tank is a solution tank for expanding or extending chromosomal DNA in the method of (24) or (25) The set of two solution tanks according to (36) or (37), which is a solution tank in which a part or the whole of the fibrous substrate is gripped or fixed in an attachable state.
(40) The following steps:
Embedding a fibrous substrate near the surface of a resin layer having a smooth surface,
A plurality of cuts are made in a direction intersecting the fibrous substrate along the resin surface, and the substrate surface is exposed at a plurality of locations of the fibrous substrate,
The substrate surface that is not exposed by cutting is protected from the receptor modification by the resin layer, the substrate surface exposed by cutting is modified, and then the receptor is modified.
Release the fibrous substrate from the resin layer;
The method for producing a fibrous substrate according to (4) or (5), comprising:

  ADVANTAGE OF THE INVENTION According to this invention, the method of position mapping on chromosomal DNA with high precision and efficient and composition analysis of a nucleic acid mixture is provided. In addition, according to the present invention, it is possible to analyze a chromosome with high resolution over a wide range including a gene that is expanded and extended without cutting the chromosome and is buried inside by the higher order structure of the chromosome. Also, even if the region that can be analyzed is discontinuous, such as when chromosomal DNA is cut, the location mapping technique itself described below is used to determine where the region originates from the original chromosomal DNA. It is also possible to identify. Therefore, the position mapping presented below can be used regardless of whether the expanded / extended chromosomal DNA is continuous or discontinuous.

  Expanded and elongated chromosomal DNA is a versatile analysis target that can be analyzed by various methods, but the following method avoids labeling and identification problems (see “Summary of the Invention” below for details). Thus, it is possible to perform comprehensive mapping on the chromosomal DNA. Therefore, the present invention also includes such a mapping method.

One specific example of the mapping method of the present invention includes the following steps:
In the expanded or elongated chromosomal DNA, the nucleic acid is hybridized to one type of repeated base sequence,
By using a label that is introduced into the hybridized nucleic acid or that is introduced into the nucleic acid after hybridization, a plurality of sets of the repetitive base sequences of the chromosomal DNA are mutually separated on the chromosomal DNA. And then
A position mapping method on chromosomal DNA, comprising determining a region or a position on a chromosome of the set and the repetitive base sequences included in the set based on the characteristics of the measured distance.

  In this specification, “development / elongation”, “development / elongation” or “development / elongation” of chromosomal DNA is, as a preferable ideal state, there is no cleavage and other substances are not bound, The DNA itself is linear, or has a form that has a degree of bending that allows distance measurement on the DNA of each label in the position mapping. A substance that allows access to dissolved substances. As a state conforming to this, continuous chromosomal DNA having no breaks of 10 micrometers or more, no binding of other substances in a DNA region of 50% or more, preferably 80% or more, and linear or controlled bending In the case of taking a form having the above, it is intended to include those in a state that allows access to the dissolved substance in the solvent in that region.

  The repetitive nucleotide sequences in this method are uniformly distributed on each chromosome macroscopically, but microscopically, they have a distribution with a characteristic bias that differs from one chromosome region to another depending on the resolution of the observation method. It is preferable.

  In addition, when a repeated base sequence having a polymorphism is regarded as a set having a single type of repeated base sequence as an element, the set is divided into lower sets according to the classification of common parts of those polymorphs There is a case. The target repetitive base sequence in this method includes not only a repetitive set having polymorphism but also a case where an element or a subordinate set is meant.

When the Alu sequence (Jelinek WR, et al., Proc Natl Acad Sci USA 77: 1398-1402 (1980)) is used as the repetitive base sequence, a small number of polymorphisms were confirmed except for the underlined portion in the consensus sequence of the following Alu sequence. Only. For this reason, whether or not a nucleic acid having a sequence to hybridize other than the underlined portion actually hybridizes in each polymorphic subset of the Alu sequence depends on the base sequence of the subset. It becomes very complicated to determine the presence or absence. Furthermore, nucleic acids that cause hybridization mismatches at a small number of polymorphic sites are difficult to predict the success or failure of hybridization, making reliable chromosomal DNA position mapping difficult. On the other hand, polymorphism is confirmed very frequently in the underlined part except for the consensus sequence. Therefore, when using one or more nucleic acids having any of the nucleotide sequences including the underlined portion or their complementary strand sequences, hybridization to a nucleotide sequence belonging to a polymorphic subset other than the consensus sequence is highly efficient. Can be excluded. This makes it easy to determine the presence or absence of hybridization. Furthermore, the prediction of hybridization is facilitated, enabling reliable chromosomal DNA position mapping. The above relationship also holds for complementary strand sequences of consensus sequences.

  In addition, in order to fully demonstrate the resolution of the observation method, the label for the repetitive base sequence does not emit a signal having a wide range of the repetitive base sequence, but a sufficiently narrow signal depending on the detection sensitivity of the observation method. It is preferable that it emits. In human chromosomes, Alu sequences (Wang J., et al., Gene 365: 11-20 (2006)) or LINE-1 sequences (Szak ST, et al.,) Distributed at intervals of several to several tens of micrometers. Genome Biol 3: 1-18 (2002)) is exemplified as a preferable repetitive base sequence when an optical microscope is used as an observation method. As a preferable labeling method that emits a narrow signal, 4 to 20 minor types of oligo DNA (DNA strands having 20 to 50 residues) labeled with a fluorescent dye and having a uniform annealing temperature (Tm) are used. In this example, the labeling is based on an oligo DNA assembly consisting of the oligonucleotide. By unifying the annealing temperature, nonspecific hybridization can be suppressed by strictly controlling the temperature. Such a uniform annealing temperature has been difficult to produce for a set of many hybridization nucleic acids that perform labeling over a wide range of conventional base sequences. It is preferable to use a label that can be sufficiently significantly distinguished by such a small number of types of oligo DNAs because it enables more specific detection. Fortunately, the detection sensitivity of the observation method is improved because the target chromosomal DNA is isolated from the intracellular environment and extended in a state isolated from other intracellular substances. Such an assembly of a small number of oligo DNAs having a uniform annealing temperature (Tm) can be detected.

  The competing conditions of non-specific binding with chromosomal DNA other than the target sequence and sufficient detection sensitivity in the target sequence are summarized as follows. That is, as a nucleic acid that hybridizes to a repetitive nucleotide sequence, it is a collection of oligo DNAs whose difference in annealing temperature is in the range of about 10 ° C., preferably in the range of about 7 ° C., more preferably in the range of 5 ° C. When a set of 1, 2 fluorescently labeled oligo DNAs per oligo DNA is used for observation under a fluorescent microscope, about 100 types or less are preferable. This is because it is necessary to secure a length of 30 residues or more per one kind of oligo DNA in order to ensure the specificity of the oligo DNA on the chromosomal DNA. In order to make maximum use of the resolution of the optical microscope, the label is preferably observed as a bright spot on the expanded and elongated chromosomal DNA, and the upper length of the chromosomal DNA is preferably 500 nanometers or less. The number of oligo DNAs that can be hybridized so as to satisfy both conditions is 50 or less per DNA strand on one side, and 100 or less when both sides are combined. Accordingly, the number of types is 100 or less. More preferably, by using 20 or less types of oligo DNAs, the purpose of specific labeling can be achieved and the production of oligo DNA can be saved. In place of these oligo DNAs, other oligo nucleic acids generally having 20 to 50 residues for hybridization to DNA such as oligo PNA may be used.

  By using the above-mentioned preferable repetitive base sequence and labeling method, detection can be performed in a manner that sufficiently exhibits the resolution of the observation method over a wide range of each chromosome. By using such a mapping method, it is possible to detect a mutation occurring on a chromosome, for example, amplification or deletion of a base sequence, or a translocation corresponding to a partial exchange of a chromosome with a wide range and high resolution. Become.

  The expanded or expanded chromosomal DNA used for the mapping may be expanded or expanded by any method. Examples of chromosomal DNA expansion or extension methods include sweeping the solution surface by surface tension (see Wiegant J., et al., Hum Mol Genet 1: 587-591 (1992)), solution solutions by gravity and centrifugal force. Surface sweep / flow (see Japanese Patent Application No. 2006-157420 and “Example 7” described later), flow by liquid feeding, electrophoresis, dielectrophoresis (Washizu M. & Kurosawa O., IEEE Trans Ind Appl 26: 1165-1171 ( 1990) and later-described "Example 8"), and electroosmotic flow whose use is disclosed in detail in the present invention. The expanded or elongated chromosomal DNA used for the mapping is preferably one that has been expanded and elongated from the fibrous substrate of the present invention by the method of the present invention. More preferably, the expanded or elongated chromosomal DNA is expanded and elongated from the fibrous substrate of the present invention by a liquid feed flow, electroosmotic flow or electrophoresis.

  There may be only one type of repeated base sequence in the chromosome, but multiple types will increase the amount of information for mapping, reduce the erroneous determination of mapping, and the resolution of the base sequence to be mapped is also high. It is preferable from the point of improving. The type of label attached to the nucleic acid that hybridizes to the repetitive nucleotide sequence of the chromosome and the mode of binding to the nucleic acid are not particularly limited. Examples of the label include substances that emit fluorescence when an optical microscope is used, and heavy metal colloidal particles when an electron microscope or an atomic force microscope is used. Fluorescent substances include fluorescent molecules (eg, Fluorescein, Rhodamine, Texas Red, Cy3, Cy5) colloidal particles (eg, Quantum Dot, polystyrene fluorescent beads), fluorescent proteins (eg, GFP, DsRed), etc. Is useful, but is not limited thereto. When there are a plurality of repetitive base sequences in a chromosome, the label may be one that can identify a repetitive base sequence in a type-specific manner or one that cannot be distinguished.

In the case of using an indirect label, the ligand and the receptor may be bound in any form. Preferred binding includes an antigen molecule and an antibody molecule to the antigen molecule, and an antibody molecule and an antibody-binding protein. Binding, binding of biotin or a streptotag to a biotin-specific receptor, binding of glutathione and glutathione S transferase, binding of a sugar and a lectin that binds to the sugar, an amino group and a reactive group having a covalent bond to the amino group Bond (for example, a bond in which the ligand / acceptor is an amino group and N-hydroxysuccinimide, or a bond in which both are amino groups and both are cross-linked by glutaraldehyde), covalent bond to thiol group and thiol group Examples include, but are not limited to, reactive group bonds and bonds through metal complexes. Not to.

  By using a label, it is possible to measure the mutual distance on a chromosomal DNA for a set of a plurality of repetitive base sequences of chromosomal DNA, and based on the characteristics of the measured distance, the set and included in the set The region or position on the chromosome of the repetitive base sequence to be determined can be determined. Even when using a label that can be identified or cannot be identified specifically for the type of repetitive base sequence, the mutual distance can be measured and measured for multiple sets of repetitive base sequences containing multiple types of repetitive base sequences. The region or position on the chromosome of the set and the repetitive base sequence included in the set can be determined based on the distance and, if it can be identified, the characteristics of the identification content.

Accordingly, an example of a preferred embodiment of the above specific example includes the following steps:
In the expanded or elongated chromosomal DNA, nucleic acid is hybridized to multiple types of repetitive base sequences,
By using a label that is introduced into the hybridized nucleic acid or is introduced into the nucleic acid after hybridization and can be specifically identified or cannot be identified, the plurality of types of repeated base sequences Measure the mutual distance for multiple sets of repetitive base sequences containing
The position on the chromosomal DNA, including determining the region or position on the chromosome of the set and the repetitive base sequence contained in the set, based on the measured distance and, if possible, the characteristics of the identification content Mapping method.

In particular, when observation is limited to a part of the chromosomal DNA due to fragmentation of the chromosomal DNA, it is necessary that each limited stretch of chromosomal regions contain a plurality of repetitive base sequences sufficient for the above identification. is there. On the other hand, if it is possible to observe a sufficiently long stretch of chromosomal region, the above-mentioned position mapping technique itself is used, and it is limited by collating with genomic base sequence database information or information extracted from the information. By determining the contig using the overlapped portion of the observed regions, it is possible to identify where the original single chromosomal DNA originates. According to the present invention, even when the contig determination is made, since it can be performed in the region of a single chromosomal DNA molecule, insertion / purification into a vector for obtaining detection sensitivity as in the prior art -The complicated operation of amplification becomes unnecessary. Of course, position mapping is also possible within the continuous chromosomal region. In human chromosomes, when the Alu sequence or LINE-1 sequence distributed at intervals of several to several tens of micrometers is used as a labeling target, the length of the continuous chromosome region to be secured is several tens to several hundreds of micrometers. It is estimated to be.

Therefore, a preferred embodiment for fragmented chromosomal DNA is to first apply the position mapping method in the fragment.
That is, in the case of using a single type of repetitive base sequence, the mutual distance is measured for a plurality of sets of the repetitive base sequences contained in the fragment, and based on the measured distance characteristics, By determining the position of the set on the chromosome, the position of the fragment on the chromosomal DNA before being fragmented is mapped.
In addition, in the case of using a plurality of types of repetitive base sequences, the mutual distance is measured for a plurality of sets of repetitive base sequences including a plurality of types of repetitive base sequences contained in the fragment. Chromosomes before fragmentation by determining the region or position on the chromosome of the pair and the repetitive base sequence contained in the pair based on the distance and, if it can be identified, the characteristics of the identification content The position mapping of fragments on DNA is performed.

The above chromosomal DNA location mapping is not all that can be done with one device, but as an essential element in its work process,
(1) An observation apparatus for mounting an elongated chromosomal DNA and visualizing a label with respect to its repeated base sequence,
(2) Observation image capturing device,
(3) including a calculation device that extracts the position of the repeated base sequence from the captured image, measures the mutual distance of the set of repeated base sequence positions, and collates with the genomic base sequence database information or information extracted from the information ( It is preferable to operate as an apparatus system that is optically coupled between (2) and (3) optically between 1) and (2).

  In the present specification, the “repetitive base sequence” is not only a repetitive base sequence itself, but also a case where a plurality of repetitive base sequences are adjacent to each other, a base sequence straddling these repetitive base sequences, In the case of a partial base sequence of the sequence, the sequence is also included. In the present specification, “one type of base sequence to hybridize” or simply “base sequence to hybridize” is not limited to one consisting of a single type of base sequence, and is not strictly specific to the hybridization phenomenon. Due to the base sequence recognizing tendency, it includes a plurality of types of base sequences having a certain level of hybridization activity with respect to a single base sequence. It is assumed that 1% or less of a constituent element includes a base sequence having specificity for hybridization.

  The repeated base sequence in the chromosome may be any sequence, but can be classified into a preferred sequence according to the purpose of use. That is, in the case of fixing a chromosome to a fibrous substrate using the binding between a ligand and a receptor, it is preferable that the repetitive base sequences are distributed unevenly in a partial region of each chromosome, and there is a partial bias. It is preferable that the chromosomal DNA is fixed to the fibrous substrate by a biased part by binding the ligand and the receptor in the repetitive base sequence. As a result, when the chromosomal DNA is expanded and elongated from the fibrous substrate, the DNA to be expanded and elongated covers a wide range. Examples of such a repetitive base sequence that can be fixed in a biased part include a telomeric sequence in the chromosome end region, or a centromeric sequence in the centromeric region where the centromere of the mitotic chromosome is formed (also referred to as an alpha satellite sequence). Illustrated. On the other hand, when the chromosomal DNA is immobilized using the binding between the ligand and the receptor in the expanded / expanded state in the expansion / extension tank, or the position mapping on the chromosomal DNA is performed using the characteristics of the repeated base sequence. In some cases, it is preferable that the repetitive base sequences are uniformly distributed in each chromosome, and the chromosomal DNA is uniformly expanded / extensioned by binding the ligand and the receptor in the uniformly distributed repetitive base sequences. It has the favorable effect that it can be fixed to the inner surface or structure, or chromosomal DNA can be mapped over a wide range. Examples of such a repetitive base sequence having a uniform distribution include an Alu sequence and a LINE-1 sequence, which are preferable when the chromosome is derived from human.

In another specific example of the above chromosomal DNA position mapping method, the target to be labeled is methylated cytosine, methylated cytosine binding protein (MBP), anti-methylated cytosine antibody, or methylated cytosine-binding metal complex. The exemplified methylated cytosine-coupled receptor can be used to analyze chromosomal DNA modifications. That is, the present invention includes the following steps:
In the expanded or elongated chromosomal DNA, a receptor having binding activity to methylated cytosine is added and bound,
There is also provided a method for mapping methylated cytosine positions on chromosomal DNA, including identifying the position of methylated cytosine on chromosomal DNA by using a label introduced into the receptor.

  A preferred label used in the above mapping method is a fluorescent substance. As such substances, fluorescent molecules (eg, Fluorescein, Rhodamine, Texas Red, Cy3, Cy5) colloidal particles (eg, Quantum Dot, polystyrene fluorescent beads), fluorescent proteins (eg, GFP, DsRed), etc. are useful. However, it is not limited to these.

In the case of using an indirect label, the ligand and the receptor may be bound in any form, as in the case of nucleic acid hybridization to the repetitive base sequence.

In addition, the chromosome whose position on the chromosomal DNA is mapped by the above method or by another method is used as a comparison target / reference target, and the sample nucleic acid derived from this chromosomal DNA is hybridized. Information about the composition can be obtained. Specific examples of the composition analysis method include the following methods. That is, the present invention includes the following steps:
A mixture of nucleic acids composed of multiple types of nucleic acids extracted from a biological sample, a mixture of nucleic acids obtained by fragmenting them, a mixture of nucleic acids whose amounts are amplified using them as a template, and a mixture of nucleic acids that are both fragmented and amplified Prepare a mixture of any one of the nucleic acids,
The expanded or elongated chromosomal DNA is used as a nucleic acid for hybridization, the mixture of the prepared nucleic acids is used as a nucleic acid for hybridization, hybridization is performed, and then
By using a labeling substance introduced into the hybridized nucleic acid, it is possible to determine the type of nucleic acid contained in the prepared nucleic acid mixture and to measure the relative content of the nucleic acid mixture contained in the sample. A composition analysis method is provided.

  In the type discrimination, a mixture derived from a plurality of types of nucleic acids extracted from the biological sample from the position of the chromosomal DNA to be hybridized determined by mapping by the above-described position mapping method that can be performed before, after, or simultaneously with this composition analysis operation Each type can be discriminated. In the measurement of relative content, the composition has already been revealed or reproducibility has been confirmed separately from the mixture of nucleic acids extracted from the biological sample to be measured in order to obtain the relative value of the content. The relative content is measured in comparison with the same measurement using a mixture of reference nucleic acids. Preferably, a mixture derived from a plurality of types of nucleic acids extracted from the biological sample to be measured and the mixture of the reference nucleic acids are simultaneously hybridized, the two mixtures are identified by different labels, and the relative amounts of the two are compared. To do things.

  The expanded or extended chromosomal DNA used in the composition analysis method of the nucleic acid mixture may be developed or extended by any method. As a method for developing / extending the position mapping method on the chromosomal DNA, sweep of the solution liquid surface by surface tension, sweep / flow of the solution liquid surface by gravity or centrifugal force, flow by liquid feeding, electrophoresis, dielectrophoresis, and An electroosmotic flow disclosed in detail below may be used in the present invention. These means and methods are publicly known and can be appropriately selected according to the properties of the chromosomal DNA, the purpose of analysis, and the like. Further, the chromosomal DNA to be expanded / extended may be a region composed of a continuous base sequence of one chromosome or a partial region obtained by fragmentation.

  Methods for fragmenting chromosomal DNA are known and can typically be performed using restriction enzymes. The type of restriction enzyme and reaction conditions can be selected according to the situation such as the size of chromosomal DNA and nucleotide sequence.

  A preferred label used in the composition analysis method of the nucleic acid mixture is a substance that emits fluorescence. For the substance emitting fluorescence, the explanation of the mapping method is applicable.

In the case of using an indirect label, the ligand and the receptor may be bound in any form, as in the case of nucleic acid hybridization to the repetitive base sequence.

Furthermore, the present invention is a chromosomal DNA mapping apparatus system used in the chromosomal DNA position mapping method of the present invention,
-An observation device that visualizes the label of a repeated base sequence,
・ Observation image photographing device, and ・ 3 of a computing device that repeatedly extracts the position of the base sequence from the photographed image, measures the mutual distance of the set, and collates with the genomic base sequence database information or information extracted from the information Provided is a chromosomal DNA mapping apparatus system including the apparatus as an essential element.

  The observation apparatus can be appropriately selected and used according to the properties of the labeling object. For example, an observation apparatus using an optical means is generally used, but is not limited thereto. The above-described photographing apparatus can also be appropriately selected and used according to the visualization means or the like. For example, a camera with a magnifying lens is generally used, but is not limited thereto. An ordinary computer can be used as the calculation device, and a program for calculation is also known to those skilled in the art or can be easily assembled by those skilled in the art.

Furthermore, the present invention discloses a fibrous substrate for chromosomal binding having on its surface a region modified with a receptor. The following advantages arise from the fibrous base.
(1) A chromosome fixing environment and a chromosomal DNA extension environment can be separated, thereby preventing inappropriate chromosome contamination in the extension environment.
(2) The surface area of the substrate is small and the amount of chromosome fixation can be reduced.
(3) Since it is fibrous, the chromosome fixing region can be supported from the outside.
(4) The starting point of chromosomal DNA extension can be matched with respect to the extension direction.
(5) When chromosomal DNA is fixed at intervals, it can be expanded and extended in parallel with respect to the direction of expansion and extension.

  In the present invention, the term “fibrous” means that the shape is linear or can be bent, but satisfies the state of being linearly formed in the chromosome expansion / extension operation. In addition, each of the chromosome expansion / extension operations satisfies a state in which each one can be made independent as an operation target. A non-fibrous state that is in a bent state and difficult to return to a straight line again, or a state that has a large number of pieces and that is difficult to separate and operate independently In other words, it can be said that the present invention cannot be easily carried out with a non-fibrous substrate unless otherwise disclosed. The length to width ratio of the fibrous substrate is preferably 10: 1 or more, more preferably 1000: 1 or more.

  The shape of the fibrous substrate in the fiber direction may be various. For example, the fibrous substrate may be linear or bent. Preferably, the shape is appropriately adapted to conditions such as the properties and characteristics of the chromosome, the conditions for expanding and extending the chromosome, and the shape of the apparatus therefor. The cross-sectional shape of the fibrous substrate is a circle, an ellipse, a triangle, a quadrangle, a polygon, a U shape, a V shape, one of the above shapes, and a porous shape or a hollow shape, the shape Of these, one or a plurality of shapes may be bundled, but it is not limited to these shapes. Preferably, the shape is appropriately adapted to conditions such as the properties and characteristics of the chromosome, the conditions for expanding and extending the chromosome, and the shape of the apparatus therefor. The maximum cross-sectional width of the substrate is 100 micrometers or less, preferably 20 micrometers or less. The reason for this is that the size of the chromosome is 20 μm or less in the long side direction and 10 μm or less in the short side direction when targeting the mitotic chromosome, and the length is long when targeting the interphase chromosome. Undefined, takes a string-like shape with a width of 1 micrometer or less. Since the chromosome has such a size, if the cross section of the fibrous substrate is large, a large number of chromosomes are arranged in multiple directions in the cross section direction. This is because by limiting the maximum cross-sectional width of the fibrous substrate, multiple fixation in the cross-sectional direction is suppressed, and chromosome fixation aligned in the lateral direction of the fibrous substrate is realized.

  The substrate material may be glass, plastic, carbon, silicon, silicon oxide, silicon nitride, metal, metal oxide, natural fiber, etc., or a mixture or composite thereof, but is not limited to these materials. . A preferred substrate material is glass. The substrate surface may be a smooth surface, a rough surface, or uneven. Chromosome binding can be increased by rough surfaces or irregularities.

  The surface of the fibrous substrate is preferably modified with a receptor. Here, the “receptor” includes a substance (for example, an antibody, a lectin, streptavidin, etc.) that can bind to a ligand bound to a chromosome or a functional group of the chromosome, or a part thereof, or a functional group, Is preferably specific. The “ligand” includes a substance that binds to the receptor, a part thereof, or a functional group. In this specification, instead of “modification”, it may be called “binding”. Modification of the substrate with a ligand specific receptor can be done by any mode of binding. For example, the substrate can be modified by covalent bond, ionic bond, hydrogen bond, hydrophobic bond, van der Waals force, physical adsorption, and the like. As a method for binding a ligand-specific receptor to a substrate, a known method can be appropriately selected and used. Modification of the substrate with a ligand-specific receptor can be performed by means and methods known to those skilled in the art. Considering the type of substrate material, the shape of the substrate, the type of ligand specific receptor, the characteristics, the size and shape of the chromosome to be bound, etc., the type of ligand specific receptor is selected and applied to the substrate. A coupling method can be selected.

  You may use the base | substrate which has the functional group which can be couple | bonded directly with a chromosome or the ligand couple | bonded with the chromosome on the surface. In the present specification, the functional group on the surface of the substrate is also included in the “receptor”.

  As used herein, the term “nucleic acid hybridizing to chromosomal DNA” refers to a chromosomal DNA in which complementary hydrogen bonds are successively formed with respect to four nucleobases of adenine, cytosine, thymine, and guanine on chromosomal DNA. It refers to a molecule having the property of having a specific binding property to a region, and includes, but is not limited to, DNA, RNA, and PNA. Examples of the “group having nucleic acid binding property” include an intercalation molecule, a nucleic acid binding molecule that specifically binds to the double helical groove, and a group capable of forming a metal complex using a nucleobase as a ligand. You can, but you are not limited to this.

  A ligand is bound to a chromosome to be developed and elongated, and the ligand is bound to a receptor on the substrate surface. The combination of a ligand and a receptor is well-known, and any combination may be sufficient. Ligand and receptor combinations include biotin-specific receptors (eg streptavidin) and biotin or strepttab, lectins and sugars, antibodies and antigens or epitopes (including fragments thereof), nucleic acids that hybridize to each other, coordination And a metal ion-containing ligand or vice versa, glutathione and glutathione S transferase, amino group and reactive group having covalent bond with amino group, reactive group having covalent bond with thiol group and thiol group, intercalation and Examples include double helical groove bonds and nucleic acid binding reagents and nucleic acids by other binding mechanisms. These combinations can be appropriately selected in consideration of the type of substrate material, the shape of the substrate, the type of ligand specific receptor, the characteristics, the size and shape of the chromosome to be bound, and the like. Preferably, the receptor modified on the substrate is one or more selected from the group consisting of antibodies, lectins, biotin specific receptors and nucleic acids.

  In the above, a ligand and a receptor are a pair of substances that have a specific binding relationship with each other, and the type and binding mode of the substance do not distinguish between the ligand and the receptor. Of such a pair of substances having specificity, one existing on the substrate side is called a receptor, and one existing on the chromosome side which is a moving body with respect to the substrate is called a ligand. In this respect, DNA or protein inherent in the chromosome may be a ligand. Furthermore, there are inclusions in the binding of the ligand and the receptor, and the specificity of the inclusion and the ligand, and the inclusion and the receptor, as a result, the specificity of the direct and indirect binding between the ligand and the receptor is maintained. In this case, it is called a ligand and a receptor in that it is a pair of substances having a specific binding relationship directly or indirectly.

  Either of the members constituting the ligand / receptor combination may be bound to the substrate (or to the chromosome). For example, streptavidin may be bound to the substrate and biotin may be bound to the chromosome, or biotin may be bound to the substrate and streptavidin may be bound to the chromosome. Alternatively, the chromosome may be directly bound to the substrate without using a ligand. In such a case, the chromosome itself can be said to be a “ligand”.

  The binding between the chromosome and the ligand can also be performed by a known method. In consideration of the type of substrate material, the shape of the substrate, the type of ligand-specific receptor, the characteristics, the size and shape of the chromosome to be bound, etc., the method for binding the chromosome to the ligand can be selected.

  There may be one or more types of receptors for modifying the substrate surface. For example, only streptavidin may be bound to the substrate surface, or streptavidin and an antibody may be bound to the substrate surface.

  The method for binding the chromosome to the fibrous substrate may be a method known to those skilled in the art. In particular, for imparting specific binding to a substrate only to a specific sequence of a chromosome, for example, by an in situ hybridization method (see Example 2) or a primer extension method (see Example 3) for the specific sequence, Groups or ligands having specific binding properties to the surface treatment reagent of the fibrous substrate can be introduced.

  The site of the chromosome to be bound to the substrate of the present invention or the site for introducing the ligand into the chromosome may be any site, but is preferably at or near the end of the chromosome. By binding to the substrate near the end of the chromosome, it is possible to suppress the bending and overlapping of the chromosomes during expansion and extension.

  The entire surface of the substrate may be modified with a receptor, but it is preferable that individual chromosomes are arranged and arranged on the substrate at an appropriate density before expansion / extension so as not to cause chromosomal confusion during expansion / extension. . In accordance with this purpose, it is preferable to arrange the receptors to which chromosomes are bound on the substrate at an appropriate density. Furthermore, it is preferable to develop and extend the chromosome DNA in a form in which the relative position of the chromosomal DNA is clear starting from the aligned position.

  As a specific example for realizing the above, a plurality of regions modified with the receptor are arranged on the surface of the substrate in a state of being separated by regions not modified with the receptor. Preferably, regions modified with receptors having a width of 10 micrometers or less are arranged on the surface of a fibrous substrate having a maximum cross-sectional width of 100 micrometers or less at intervals of 1 millimeter or less, preferably around 50 micrometers. In this way, a plurality of regions modified with the receptor are arranged in a state isolated by a region not modified with the receptor, and the chromosomes are bound to the substrate at an appropriate interval compared to the size of the chromosome. Thus, a plurality of chromosomes can be analyzed simultaneously. Furthermore, it is possible to prevent the expanded and elongated chromosomes from being complicated, overlapped, or torn, and can be expanded and elongated in a form with a clear relative position of the chromosomal DNA, starting from the aligned position. Etc. are produced.

  A method known to those skilled in the art may be used for arranging a plurality of regions modified with a receptor on the surface of the substrate in a state where they are separated by a region not modified with a receptor. The above method can be appropriately selected according to conditions such as the material of the substrate, the arrangement interval of the regions modified with the receptor, and the type of ligand. For example, a blocking protein such as bovine serum albumin or GFP, which is a fluorescent protein that can be easily removed, is used as a substrate to prevent nonspecific binding of chromosomes to regions other than those modified with receptors on the substrate surface. After coating, the chromosome may be bound, and then the blocking protein may be removed.

  The fibrous substrate of the present invention, particularly the fibrous substrate in which regions modified with receptors are arranged on the surface at intervals, is a means / method using an electric field or a fluid field, for example, liquid flow, electroosmosis. When combined with means and methods for chromosome expansion / elongation such as flow and electrophoresis, it has the above-described advantages, and is thus very useful as a tool for analyzing chromosomes over a wide range with high resolution.

  The chromosome to be analyzed by being bound to the fibrous substrate of the present invention may be a chromosome at any stage on any cell cycle, but a mitotic chromosome is preferred. The reason is that, when a mitotic chromosome is expanded and elongated, it is separated into chromosomes one by one, so that analysis is easy. In the case of mitotic chromosomes, all chromosomes extracted from cells can be used for binding to fibrous substrates, but certain types of chromosomes separated and purified by using a chromosome separation method such as Flow Cytometry It is also preferred to bind to the substrate and analyze only for that type of chromosome.

  With the fibrous substrate of the present invention, chromosomes can be arranged in an elongated spatial region, and the chromosomes can be successfully expanded and elongated as described below.

  Fibrous substrates of the present invention that have chromosomes attached thereto are also encompassed by the present invention.

  In a preferred embodiment, the present invention is a method in which a nucleic acid is hybridized to chromosomal DNA, and a ligand is bound to a ligand introduced into the hybridized nucleic acid and a receptor modified on a fibrous substrate. The present invention relates to a fibrous substrate. In this embodiment, it is preferable that the chromosomal DNA further has a repeated base sequence. Since the hybridization target is a repetitive base sequence, a ligand can be introduced into many hybridization targets simply by preparing one or a small number of nucleic acids. This enhances the binding activity to the receptor-modified fibrous substrate. Examples of such a repetitive base sequence include a repetitive base sequence of a telomere region or a repetitive base sequence of a centromere region.

  In another preferred embodiment, the present invention is a method in which a nucleic acid is hybridized to chromosomal DNA, the hybridized nucleic acid is used as a primer, a nucleobase modified with a ligand is used as a synthetic substrate, and chromosomal DNA is used as a template. The present invention relates to a fibrous substrate in which a chromosome is bound by binding of the ligand bound to a nucleic acid synthesized in a hybridized state with chromosomal DNA and a receptor modified on the fibrous substrate. . More preferred hybridization in this embodiment is exemplified for the chromosomal DNA terminal single-stranded portion. Here, the terminal single-stranded portion is a sticky end that does not require an operation to dissociate the double helix prior to hybridization.

  The binding between the ligand and the receptor may be in any form, but preferred binding includes antigen molecule and antibody molecule binding to the antigen molecule, antibody molecule and antibody binding protein binding, biotin or strepttag Binding of biotin specific receptor, binding of glutathione and glutathione S transferase, binding of sugar and lectin that binds to the sugar, binding of amino group and reactive group having covalent bond to amino group (for example, ligand / reception A bond in which the body is an amino group and N-hydroxysuccinimide, or a combination in which both are amino groups and both are cross-linked by glutaraldehyde), a thiol group and a reactive group having a covalent bond with the thiol group, Bonds via metal complexes, bonds via nucleic acids, bonds via nucleic acid binding groups And the like. Among these, preferred bonds include biotin and streptavidin, biotin and avidin, metal complex ligand bonds, or nucleic acid bond (for example, hybridization or covalent cross-linking). Hybridization with a nucleic acid having an agent and subsequent cross-linking).

  Since the thing which couple | bonded the chromosome with the fibrous base | substrate of this invention can analyze a some chromosome at once, it is useful also as what is called a chromosome chip | tip. Detecting a specific site on a chromosome by hybridizing a chromosome or a gene or polynucleotide or oligonucleotide serving as a marker to a plurality of chromosomes linked to the fibrous substrate of the present invention and expanding and extending these chromosomes You can also. Further, those obtained by binding chromosomes to the fibrous substrate of the present invention are useful for chromosome sorting, chromosomal protein modification analysis and the like.

  Furthermore, the present invention provides a method for expanding and extending a chromosome, characterized in that the fibrous substrate of the present invention to which a chromosome is bound is placed in a medium, and an electric field or fluid field is applied thereto to expand and expand the chromosome. It is to provide. A preferable method for expanding and extending a chromosome by applying an electric field or a fluid field includes a method using an electroosmotic flow or an electrophoresis method, and a method using an electroosmotic flow is more preferable. Electroosmotic flow (EOF) is attracted to the surface of the charged solution tank, electrophoresed by applying an electric field to the counter-ion in the solution whose concentration has increased near the surface, and this generates a liquid flow on the surface of the solution tank. It is to do. When this method is used, there is an advantage that the chromosomal DNA itself is adsorbed on the surface of the solution tank and can be transported by a liquid feed flow while controlling the development / elongation state. Thereby, a preferable arrangement of chromosomal DNA can be realized in fixation after extension or observation.

  After the chromosome is bound to the substrate of the present invention, it is preferable to deproteinize the chromosome in an aggregated state to release the DNA of the unbound sequence, and then expand and extend the chromosome. As such a deproteinization method, a known method such as a surfactant, a proteolytic enzyme, a high salt concentration aqueous solution, or a polyanion can be used.

A specific embodiment of the method for expanding and extending the chromosome of the present invention includes the following steps:
Immerse the fibrous substrate of the present invention having the chromosome fixed therein in a solution and support it so that it does not flow or migrate,
It includes flowing the entire solution or migrating a substance in the solution to develop or extend chromosomal DNA.

  Chromosome expansion / extension is carried out in a development / extension tank containing a solution. For fixation or observation after expansion / extension, the chromosomal DNA is placed in the vicinity of a smooth surface in the expansion / extension tank. It is preferable that it is expanded and stretched.

  In particular, in the case where a plurality of regions modified with receptors in a fibrous substrate are arranged in a state where they are separated by regions not modified with receptors, the same as when the receptors are modified A deployment / elongation vessel that is spaced apart by a septum is preferred. By being separated by the partition wall in this way, it can be expanded and expanded in the expansion / extension tank surrounded by one partition wall for each chromosome bound to the arranged receptor, and can bind to other receptors, There is no crossing with chromosomal DNA expanded and extended from other locations.

  When the spacing of the receptors on the fibrous substrate is equal, and when the spacing is equal to or less than 1 millimeter, preferably about 50 micrometers, it is preferable that the partition walls be spaced at the same equal spacing. .

  When using liquid feeding, for example, when a unidirectional steady flow parallel to a smooth surface is formed, the fluid velocity field is slow near the surface and fast away from the surface due to the viscosity of the fluid. Under such circumstances, if a fibrous substrate to which chromosomes are bound is placed near a smooth surface, the chromosomal DNA expanded and elongated away from the smooth surface will move faster and generate tension. As described above, it has the effect of staying in the vicinity of a smooth surface after expansion and extension. Furthermore, as one preferred specific example, the space in which the chromosomal DNA is expanded and elongated is limited between two parallel and smooth surfaces having a narrow interval (see FIG. 10 (c) as an example). By using a development / extension tank that restricts diffusion in the vertical direction, it is possible to realize development / extension in the vicinity of the smooth surface of the chromosomal DNA. Two parallel and smooth surfaces are also advantageous to limit the turbulent flow. The distance between the two smooth surfaces can be appropriately determined in consideration of the development / elongation method, conditions, characteristics of the chromosome to be developed / elongated, etc., but it will usually be 10 to 200 micrometers.

  When electroosmotic flow (EOF) is used, for example, the smooth surface in the expansion / elongation tank is a glass substrate, which is negatively charged by cleaning it, and the fibrous substrate bound to the chromosome is in the vicinity of the smooth surface. The electric field is applied (5 to 100 V / cm) in a state where the electrolyte concentration of the solution is reduced (monovalent ions / micromol or less). At this time, a positive counter ion is concentrated near the negatively charged surface, and this forms a laminar flow of the solution by the applied electric field. On the other hand, the negatively charged chromosomal DNA is attracted by the positive charge concentrated in the vicinity of the surface, and moves together with the positive charge while maintaining the state of being adsorbed on the surface. Such electrophoresis that maintains the surface adsorption state has a favorable effect for fixation after development / elongation or observation.

  When electrophoresis is used, the chromosomal DNA migrates toward the applied electric field anode. At this time, similarly to the expansion / elongation by the liquid feeding, the expansion / elongation can be performed in the vicinity of the smooth surface by installing the fibrous substrate combined with the chromosome in the vicinity of the smooth surface. Further, this smooth surface can be positively charged by using, for example, a glass substrate subjected to aminosilane treatment or the like, and electrophoresis can be performed with chromosomal DNA adsorbed on the surface. Furthermore, by restricting the space where the chromosomal DNA is expanded and extended between two parallel and smooth surfaces having a narrow interval, the expansion and extension of the chromosomal DNA in the vicinity of the smooth surface can be realized. (See above). Furthermore, by encapsulating a material having a network structure such as acrylamide, agarose, dextran, etc. between two parallel and smooth surfaces, it can be expanded and stretched while being supported by the network structure.

  The present invention also includes expanded and elongated chromosomes. Preferably, the chromosome is expanded and elongated by the above method. When the chromosomal DNA, which is a linear ultrapolymer developed and elongated by the above method, loses its development and elongation force, it is deformed depending on the environment, or transitions to a stable form, and in that state, such as a solution tank By adsorbing to the structure, the effect of the present invention due to the expansion / elongation is lost. Therefore, it is necessary to maintain the expanded / elongated state even after losing the expanded / elongated force. In order to answer this need, the chromosome is fixed in the expanded / elongated tank in a state where the expanded / elongated state is maintained. Therefore, the present invention encompasses a chromosome fixed in a deployment / extension tank while maintaining the stretched / deployed state.

  Such fixation may be performed either during deployment / extension or after deployment / extension. The site of the chromosome used for fixation may be any site, but the site of fixation can be appropriately determined according to the size, structure, type of the chromosome, structure / size / material of the expansion / elongation tank, etc. . The fixing mode and method can also be appropriately selected by those skilled in the art in consideration of various conditions.

  In one embodiment, the chromosomal DNA expanded or elongated by the method of the present invention is fixed to the surface of a partially expanded / smooth expansion / extension tank. "Smooth part or all of the surface in the expansion / elongation tank" means a surface in the expansion / elongation tank in which a smooth area preferable for optical microscope or other microscopic observation is a partial area or the entire surface. / Surface that prevents the signal interference from the chromosomal DNA from being interfered by eliminating the interference of the signal from the surface in the expansion / elongation tank itself, because part or all of the surface in the extension tank is smooth. Say. In addition, such a surface is preferably the entire surface on which the chromosomal DNA in the expansion / elongation tank is expanded or extended, but may be a part of the surface.

  In a further embodiment, the expanded or elongated chromosomal DNA is fixed to a network structure, a fibrous structure, a rod structure, or a mixed structure thereof in the expansion / elongation tank. Chromosomal DNA is fixed not in the entire length but in a part of the development / extension tank by fixing the chromosome in the development / extension tank having a network structure, a fibrous structure, a rod structure, or a mixed structure thereof. It is a positive guide to what is done. As a result, even when the fixing method used is to denature chromosomal DNA as a test target, it is possible to test in the chromosomal DNA region that is not fixed. Among these structures, a network structure exemplified by polyacrylamide gel, agarose gel, dextran, etc., a fibrous structure exemplified by linear acrylamide, etc., or a smooth surface in a development / elongation tank by microfabrication technology, etc. There are rod structures exemplified by a model made of glass or resin prepared above, and these structures have been modified to fix chromosomal DNA, which will be clarified below.

  In a further embodiment, the expanded or elongated chromosomal DNA is immobilized on a positively charged surface or structure in the expansion / elongation chamber, or selected from the group consisting of divalent metal ions, metal complexes, and polyamines. It is fixed to a negatively charged surface or structure in a development / elongation vessel that is negatively charged via a material containing material.

  In a further embodiment, the expanded or extended chromosomal DNA is immobilized on the surface or structure in the expansion / elongation chamber via binding by a group having a nucleic acid binding property on the surface or structure in the expansion / elongation chamber. . A person skilled in the art can appropriately select and use such a group and a method for arranging the group on the surface or structure in the expansion / elongation tank.

  In addition, a nucleic acid is hybridized to the chromosomal DNA, and the expanded / extended chromosome is bonded to the surface of the expansion / elongation tank through a bond between the ligand introduced into the nucleic acid and a receptor that has been modified in advance on the substrate. Alternatively, it can be fixed to the structure. A person skilled in the art appropriately determines which nucleic acid is to be hybridized at which position of the chromosomal DNA and which ligand is to be introduced into the nucleic acid in consideration of the properties of the chromosomal DNA. It can be.

  The “ligand” in the above embodiment is different from the ligand described for the fibrous substrate (binding to the receptor on the fibrous substrate), and binds to a surface or structural receptor in the deployment / elongation tank. Is. Other than the above, the description of “ligand” and “receptor” at the fibrous substrate also applies here.

  Furthermore, in the above specific example, it is also preferred that the chromosomal DNA has a repetitive base sequence, and the nucleic acid is hybridized to the repetitive base sequence.

  In the above specific example, the hybridization of the nucleic acid to the chromosome may be performed before the expansion / extension, or may be performed after the expansion / extension.

  In addition, starting from the nick of chromosomal DNA, a ligand in a nucleic acid synthesized using a nucleobase modified with a ligand as a synthetic substrate, and a receptor that has been previously modified on the surface or structure in the expansion / elongation tank You may fix through the coupling | bonding. In this case, the synthesis of the nucleic acid and the modification of the nucleic acid with the ligand may be performed before the expansion / extension, or may be performed after the expansion / extension.

  In the above-described embodiment, the ligand and the receptor are bound to biotin and streptavidin, biotin and avidin, amino groups and reactive groups having a covalent bond to amino groups, thiol groups or covalent bonds to thiol groups. The reaction can be carried out by bonding of reactive groups, bonding through a metal complex, bonding through a nucleic acid, or the like.

  Finally, a related technique for facilitating deployment / extension is disclosed. When a chromosome is bound to a fibrous substrate in a solution tank, non-specific adsorption of the chromosome also generally occurs in the solution tank. If the chromosomal DNA is expanded and elongated in this state, the chromosomal DNA expands, expands, or floats not only from the fibrous substrate but also from the wall surface of the solution tank. As a result, the chromosomal DNA is expanded and expanded into a form suitable for analysis. Can not be.

  In the present invention, in order to avoid this, it is divided into two solution tanks, a solution tank for binding the chromosome to the fibrous substrate and a solution tank for expanding and extending the chromosome, and a solution tank for binding the chromosome to the fibrous substrate. After linking chromosomes in Fig. 2, the fibrous substrate bonded with the chromosomes was transferred to the expansion / elongation tank, and the chromosomes were expanded and expanded. However, if the fibrous substrate is taken out from the solution during this transfer, the chromosomes are damaged by drying and surface tension. In order to avoid this, the solution can be integrated and separated between the two solution tanks, the chromosomes can be combined and the chromosomes expanded and elongated in the separated state, and the fibrous substrate can be transferred in the integrated state. I decided to do so.

  In order to realize this, in the present invention, two solution tanks are used in combination. That is, the present invention is a set consisting of two solution tanks, a solution tank in which a fibrous substrate to which chromosomes are bound is immersed, and a solution tank in which the fibrous substrate is not immersed. The fibrous substrate to which the chromosome is bound is transferred from one solution tank to the other solution tank, and a method for integrating and separating the solutions is provided. Here, the solution tank is a structure having a function of holding a solution, and is not necessarily limited to a structure in which a concave depression is formed and stored as disclosed below.

  As a preferable example in the set of two solution tanks, first, a solution tank having a partition wall capable of integrating and separating the chromosome binding tank and the expansion / extension tank as shown in FIG. With this partition, the treatment for binding the chromosome to the fibrous substrate and the treatment for expanding / extending the chromosome from the fibrous substrate can be performed in separate solution tanks. The bonded fibrous substrate is not dried.

  Another preferred example of avoiding damage to the chromosomes bound to the fibrous substrate during the transfer between the two solution tanks is the surface tension of the fibrous substrate and a droplet immersed in a part of the fibrous substrate. One or a plurality of plate-like structures held by the above are integrated to move between the two solution tanks without drying the fibrous substrate. FIG. 8 (b) shows a process of performing this operation with two plate-like structures in the form of droplet holding tweezers.

  As a more preferred example in the set of two solution tanks of the present invention, one or both of the solution tanks may have a surface including a hydrophilic region surrounded by a hydrophobic region. See Figure 9-a. In this case, the solution tank can be formed as a smooth surface, and can be held in a form in which the solution protrudes into a hydrophilic region surrounded by a hydrophobic region on the smooth surface. Thereby, the liquid held on the smooth surface can be integrated with and separated from the solution in the other solution tank without contacting the wall surface of the other solution tank. In addition, a part of the fibrous substrate can be immersed in the solution in the hydrophilic region without bending, and the other part can be exposed outside the solution in the hydrophobic region. Therefore, this exposed portion can be used as a handle for moving / manipulating the fibrous substrate without contaminating a portion immersed in the solution. Particularly preferred is a case where both end regions of the fibrous substrate are exposed outside the solution and can be used as a handle for movement / operation.

  In the set of two solution tanks of the present invention described above, one solution tank is a solution tank for producing a fibrous substrate to which the chromosome of the present invention is bound, A part or the whole is a solution tank having an element that is reversibly or irreversibly gripped or fixed, and the other solution tank is a solution tank for carrying out the method for developing or extending the chromosomal DNA of the present invention. In addition, the solution tank is preferably one in which a part or the whole of the fibrous substrate is gripped or fixed in a state where it can be attached or detached. As a particularly preferable example, it is a case where it is gripped by the solution tank structure in a state where it can be attached or detached at both end regions of the fibrous substrate, or one surface of the fibrous substrate can be attached or detached over the entire length. This is a case where it is fixed to the bottom surface of the solution tank in a simple state.

  The expansion / elongation tank is for expanding / extending the chromosome using electroosmotic flow or electrophoresis. More preferably, the electrophoresis tank is for expanding and extending chromosomes using electroosmotic flow. The electrophoresis tank is generally in the form of an electrophoresis tank. The substrate of the apparatus, particularly the bottom surface of the “electrophoresis tank” to which an electric field is applied, is preferably made of a negatively charged material. An example of such a material is glass, and a microscope slide glass or the like may be used as a substrate.

  A specific example of such a set of two solution tanks will be described. Refer to FIG. A liquid 802 containing a chromosome (in FIG. 8 (b), the chromosome is shown as an X-shaped structure) is added to the fibrous substrate 804 held between the plate-like structures 813 having two plates, Chromosomes are bound to the fibrous substrate in the chromosomal fluid 802 held between the plate-like structures 813 having plates. At this time, the chromosome is also adsorbed to the plate-like structure 813 having two plates. In order to remove unbound chromosomes from the solution, a washing solution is poured into the chromosome solution 802 held between the plate-like structures 813 having two plates to replace them. The glass fiber 804 combined with the chromosome is immersed in the expansion / elongation tank while being sandwiched between the plate-like structures 813 having two plates. In this state, the plate-like structure 813 having two plates is removed, and the gripping of the fibrous substrate is transferred to the expansion / elongation tank, or the fibrous substrate is fixed to the bottom surface of the expansion / elongation tank. In this state, the chromosome remains attached only to the substrate 808. Chromosome deproteinization is performed to release the chromosomal DNA from the aggregated state. During this deproteinization treatment, a sealing lid may be placed to prevent evaporation of the replacement solution 802 due to high temperature. If there is a sealing lid, it is removed, positive and negative electrodes 812 are connected to the replacement solution 802 on both sides of the substrate 808, connected to a power source 810, and the deproteinized chromosomal DNA is expanded and extended by electroosmotic flow.

  A further specific example of such a set of two solution vessels will be described. See FIG. A liquid 902 containing chromosomes (in FIG. 9, the chromosomes are shown in an X-like structure) is added to the fibrous substrate 904 to bind the chromosomes. The glass substrate 905 is preferably preliminarily subjected to a hydrophobic surface treatment in the peripheral region so that the chromosomal fluid does not spread outside the central region. As a result of adding the chromosomal solution 902 to the base 904, the chromosome is also adsorbed to the central region of the glass substrate 905. After completion of the binding reaction with the substrate 904, the chromosomes remaining in a suspended state in the chromosome solution 902 are washed away with the replacement solution 902. Even after washing, the central region of the glass substrate 905 is filled with the replacement solution 902. The glass substrate 905 and the glass substrate 901 are opposed to each other with the replacement solution 902 and the base 904 sandwiched by an interval generated by the frame 903. As with the glass substrate 905, the glass substrate 901 is preferably subjected to a hydrophobic surface treatment in the peripheral region so that the chromosomal fluid does not spread outside the central region. After facing, the glass substrate 905 is removed by transferring the base 904 and the replacement solution 902 onto the glass substrate 901. In this state, the chromosome remains attached only to the substrate 904. Chromosome deproteinization is performed to release the chromosomal DNA from the aggregated state. During the deproteinization treatment, a sealing lid 906 may be covered to prevent evaporation of the replacement solution 902 due to high temperature. The sealing lid 906 is removed, the positive and negative electrodes 908 are connected to the replacement solution 902 on both sides of the base 904, connected to the power source 907, and the deproteinized chromosomal DNA is developed and extended by electroosmotic flow.

As for the modification of the fibrous substrate, the fibrous substrate of the present invention in which a plurality of regions modified with the receptor are separated from each other by a region not modified with the receptor is preferable. The invention also provides a method for producing such a fibrous substrate. The method comprises the following steps:
Embedding a fibrous substrate near the surface of a resin layer having a smooth surface,
A plurality of cuts are made in a direction intersecting the fibrous substrate along the resin surface, and the substrate surface is exposed at a plurality of locations of the fibrous substrate,
The substrate surface that is not exposed by cutting is protected from the receptor modification by the resin layer, the substrate surface exposed by cutting is modified, and then the receptor is modified.
Release the fibrous substrate from the resin layer;
It is a method including. See FIG.

  Chromosomes expanded and extended using the above method, apparatus or kit of the present invention may be used as a chromosome sample. Such specimens can be used as a standard indicating the relationship between disease and genetic abnormality to diagnose disease. For example, by extending in parallel a chromosomal DNA obtained from a specimen having a disease and a chromosomal DNA obtained from a specimen of a healthy person, it is possible to more clearly discover mutations in both genes and tag sequence positions. In addition, a sample obtained by elongating chromosomal DNA obtained from a healthy subject sample is derived from chromosomal DNA obtained from a sample having a fragmented disease, and this fragmented and labeled DNA is hybridized to the sample. The same chromosomal DNA amount assay as CGH can be performed.

  Furthermore, the present invention provides a chromosome analysis kit containing either or both of the fibrous substrate and the electrophoresis tank as essential. Usually, an instruction manual is attached to the kit.

  The present invention will be described in more detail and specifically with reference to the following examples, but the examples are not intended to limit the present invention.

Fibrous substrate having chromosome-specific binding activity As a preferred specific example of the fibrous substrate for binding chromosomes, a method for producing a glass fiber having a labeled chromosome site-specific binding activity will be described.

  As glass fibers having chromosome binding activity, glass fibers having uniform binding activity on the fiber surface and glass fibers having binding activity at equal intervals in a narrow region separated from the fiber surface were prepared. The binding activity on the glass fiber is carried by streptavidin, to which biotin labeled on the chromosome binds.

Glass fiber with uniform binding activity Glass fiber (diameter: about 6 micrometers: DE150G 1 / 0-0.7Z manufactured by Unitika) treated with dichlorodimethylsilane (manufactured by WAKO) in advance to inhibit aminosilane binding Both ends were fastened with an adhesive on the top and placed parallel to the glass substrate. 1% (v / v) aminosilane aqueous solution (Silaace S330: manufactured by Chisso) on glass substrate, 100 μg / ml amino group biotinylating agent (Biotin-AC5-Sulfo-OSu: manufactured by DOJINDO) dissolved in phosphate buffer, phosphoric acid 10 μg / ml streptavidin (manufactured by Sigma) dissolved in a buffer solution was sequentially added. Each reagent was allowed to stand for 30 minutes, and then the unreacted reagent was removed by washing with a solvent in which the reagent was dissolved, and the next reagent was added. After the last washing, it was washed with distilled water and dried.

Glass fiber having binding activity at equal intervals in the separated narrow region Each process for producing the glass fiber is shown in FIG. A plurality of glass fibers 101 are arranged on a glass substrate 103 so that both ends thereof are fastened with an adhesive 102 and are parallel to each other. A glass substrate 103 was spin-coated with 7.5% (v / v) PVB (polyvinyl butyral) resin dissolved in 2-butanol at 500 rpm for 30 seconds, and the glass fiber 101 was embedded in an embedding layer 104 of PVB resin. . The PVB resin 104 was cut with a sharp cutting blade 105 to which a weight of 15 to 30 g was applied. Cutting was performed so that the cutting lines were parallel to each other at intervals of 50 microns and perpendicular to the embedded glass fiber 101. As a result, an exposed surface of the glass fiber having a width of 1 to 10 microns appeared in the glass fiber portion of the cutting groove 106 formed. Thereafter, the same aminosilane treatment, biotinylation treatment, and streptavidin modification as in the case of glass fibers having uniform binding activity were sequentially performed (107 in FIG. 1 represents these receptor treatment solutions). The glass fiber that had been washed after the treatment with streptavidin was washed with ethanol, the PVB resin was dissolved and removed, and the glass fiber 108 modified with the streptavidin receptor was cut out from the glass substrate. FIG. 2 is a fluorescence microscope observation image that confirms that streptavidin receptors are present at equal intervals in a narrow region separated from the glass fiber 201 produced by the above process. Streptavidin labeled with FITC (manufactured by Sigma) was used so that the streptavidin modification position could be confirmed. The bright spot-like fluorescence of FITC was confirmed on the glass fiber at intervals of 50 microns. As a result, the streptavidin receptor was surely arranged on the glass fiber at an equal interval in a separated narrow region. FIG. 3 confirms the biotin binding activity of the streptavidin receptor. 1 μg / ml FITC-labeled biotin (manufactured by Sigma) dissolved in a phosphate buffer was added to glass fiber 301 modified with streptavidin not fluorescently labeled, and the binding activity was confirmed. FIG. 3 shows an observation after washing unbound FITC-labeled biotin with a phosphate buffer. Again, bright spot-like fluorescence of FITC was confirmed on the glass fiber at intervals of 50 microns. This confirmed that the streptavidin receptor has biotin activity on the glass fiber. In FIGS. 2 and 3, the bright field image is superimposed on the fluorescence image to show the position of the glass fiber.

A glass fiber that has binding activity at equal intervals in a separated narrow area and that inhibits nonspecific adsorption in other areas is treated with dichlorodimethylsilane in advance, and both ends of the glass fiber on the glass substrate that has inhibited aminosilane binding. Was fastened with an adhesive and placed parallel to the glass substrate. 1% (v / v) aminosilane aqueous solution on glass substrate, 100 μg / ml divalent amino group cross-linking agent DPSSP (Pierce) dissolved in phosphate buffer, 1 mM disulfide dissolved in phosphate buffer A binding reducing agent DTT and 100 μg / ml of a metal complex ligand Maleimide-C (3) -NTA (manufactured by DOJINDO) dissolved in a phosphate buffer and having a thiol group-modifying activity were sequentially added. Each reagent was allowed to stand for 30 minutes, and then the unreacted reagent was removed by washing with a solvent in which the reagent was dissolved, and the next reagent was added. After the last washing, it was washed with distilled water and dried. By the above, the glass fiber which the metal complex ligand NTA couple | bonded uniformly was produced. After this, PVB resin embedding similar to the case of “glass fibers having binding activity at equal intervals in a separated narrow region”, cutting at equal intervals is performed, and the resin and the metal complex ligand subjected to the modification are peeled off. A fresh glass surface was exposed. Next, aminosilane treatment, biotinylation treatment, and streptavidin modification were sequentially performed. The glass fiber that had been washed after the treatment with streptavidin was washed with ethanol, and the PVB resin was dissolved and removed. Through the above steps, streptavidin was arranged at equal intervals in a narrow region separated on the glass fiber. To modify the metal complex ligand on the glass fiber exposed again by dissolution of PVB resin, 100 μM nickel (II) chloride dissolved in phosphate buffer was added, and then 100 μg / dissolved in phosphate buffer. ml of fluorescent protein GFP with 6 histidine tags was added. By this step, glass fibers to which GFP binding non-specific adsorption was inhibited in a region not modified with streptavidin were produced. Glass fiber binds a chromosome having biotin as a ligand in its streptavidin region, and then non-specifically adsorbed chromosomes to other GFP regions are added with 100 μg / ml imidazole solution dissolved in phosphate buffer and fixed with a histidine tag. Both GFPs were dissociated by dissociating them.

Chromosome binding to glass fiber (hybridization)
Chromosomes were extracted from HeLa cells, which are cultured cells of cervical-derived epithelial cells synchronized with the mid-phase in a culture solution containing 200 ng / ml colcemid, and stored in acetic acid / methanol fixative. The chromosome was labeled with biotin by complementary strand hybridization under denaturing conditions. The biotin-labeled chromosome was then bound to the streptavidin-modified glass fiber and the biotin-streptavidin bond using the biotin-streptavidin bond.

Chromosome biotin labeling is performed by hybridization of complementary strands to telomeric sequences in the end region of the chromosome. A synthetic oligonucleotide having the following biotin group at the 3 ′ end and a psoralen double-strand crosslinker at the 5 ′ end was prepared.
Psoraren-5′TAACCTCTAACCCTACACCTATACCCTA3 ′ (SEQ ID NO: 1) -Biotin
Psoraren-5′TAGGGTTTAGGGTAGGGGTTAGGGTTA 3 ′ (SEQ ID NO: 2) -Biotin

  Formamide and aqueous STE solution (300 mM NaCl, 30 mM Tris-HCl (pH 8.0), 3 mM EDTA (pH 8.0)) are mixed at 7: 3, and this is a mitotic chromosome extracted from about 1 million HeLa cells. A small volume of 2 kinds of synthetic oligonucleotides (5 pmol) was added and stirred to make a 100 microliter solution. After heating at 70 ° C. for 2 minutes, 40 microliters of the cooled STE aqueous solution was immediately added to 0 ° C., and the temperature was raised again to 37 ° C. over 30 minutes. By this operation, a biotin-labeled synthetic oligonucleotide was incorporated into the chromosome end region. A STE aqueous solution containing 1% (w / v) BSA was added at 37 ° C., and centrifugal precipitation was performed three times to wash away unbound biotin-labeled synthetic oligonucleotides. The final centrifugal precipitate was suspended in 100 microliter of aqueous STE solution. FIG. 4 shows that the oligonucleotide was hybridized to the telomeric sequence of the chromosome using a synthetic oligonucleotide labeled with a fluorescent group FITC at the 5 'end instead of psoralen. Although it is a FISH image in solution, the outline of the chromosome 401 is not clear, but a bright spot-like FITC label at the end of the chromosome region (shown by a black dot on the right in FIG. 3), that is, a hybridization nucleic acid to the telomere 402 The binding of was confirmed. FIG. 5 shows this chromosome with the addition of streptavidin-modified glass fibers. On the glass fiber 501, the biotin label 503, which is indicated by the bright fluorescent image of FITC, is present in the DAPI-stained chromosome 502, which is indicated by a medium intensity fluorescence image. Can be confirmed. Chromosomes not subjected to the binding treatment of the hybridization nucleic acid did not show such binding to glass fibers. When psoralen was used instead of FITC, a cross-linking reaction to chromosomal DNA was performed with a transilluminator after hybridization.

Fixation of chromosome ends to glass fibers (enzymatic reaction)
Chromosomes extracted from HeLa cells synchronously cultured in the middle metaphase were used. It is known that the 3 ′ end of the telomere sequence in the chromosomal DNA terminal region 601 is a short protruding single strand (several hundred bp) (Makarov VL, Cell 88: 657-666 (1997)). Non-denaturing hybridization is performed on this, and terminal modification is performed. Non-denaturing hybridization is performed in order to ameliorate irreversible chromosomal degeneration in degenerative hybridization, which suppresses chromosomal DNA elongation. However, this short telomere single-stranded sequence is not sufficient for chromosome end-binding labeling by hybridization. Therefore, it was decided to perform terminal modification by biosynthesis as shown in FIG. Non-denaturing oligonucleotides are used as primers 604, partially biotin group-modified nucleobases 605 are used as substrates, polymerization elongation reaction using DNA replication enzyme 607 is performed, and biotin group-introduced DNA chromosome It was decided to amplify the end label 606 by extending on DNA.

The chromosome is a mitotic chromosome extracted from HeLa cells as in Example 2, but the chromosome has the same base sequence as the single strand in order to selectively remove proteins bound to the telomere single strand upon extraction. Oligonucleotide 603 having the following nucleotide sequence was used.
5 'TTAGGGTTTAGGG 3' (SEQ ID NO: 3)

Since the telomere single-stranded binding protein POT1602 has a substitution half-life of 128 seconds in the nuclear equilibrium state (Mattern KA, Mol Cell Biol 24: 5587-5594 (2004)), the oligonucleotide 603 is excessive (about 100 cells). In addition to 100 pmol per mitotic chromosome extracted from 10,000), the chromosome treatment was carried out at 37 ° C. for 30 minutes to competitively bind the telomeric single-stranded binding protein and remove it from the chromosome. Next, the following oligonucleotide 604 was prepared for non-denaturing hybridization to the telomere single-stranded sequence.
5′CCCTAACCCTACACCTAA3 ′ (SEQ ID NO: 4)

A non-denaturing buffer (150 mM NaCl, 50 mM Tris-HCl (pH 7.4), 1 mM EDTA, 90 μg / ml RNase A) was added with a small volume of mitotic chromosome extracted from about 1 million cells and 5 pmol of the above synthetic oligonucleotide and stirred. 50 microliter solution. After performing a hybridization reaction at 40 ° C. for 12 hours, the mixture was returned to ice-cooling, 0.5 microliters of 1M MgCl ₂ , 0.5 microliters of 1M DTT, 0.5 microliters of 1 mM biotin-16-dUTP, 0.5 microliter of 1 mM dATP / dGTP / dCTP mix, 1 microliter of 5 U / μl E. coli DNA polymerase I was added and a primer extension reaction was performed at 14 ° C. for 1 hour. The reaction was stopped again by cooling to ice and adding 2 microliters of 0.5M EDTA (pH 8.0). In order to remove unreacted substances, 200 microliters of ethanol was added and stirred, and then centrifugal precipitation was performed. The supernatant was discarded, and the same centrifugal precipitation was further performed three times with 70% ethanol. The final precipitate was suspended in 100 microliters of the aqueous STE solution. FIG. 7 shows that a nucleobase labeled with FITC, which is a fluorescent group instead of biotin, is introduced as a reaction substrate by a replication reaction by an enzymatic reaction starting from a telomeric sequence 702 in the chromosome 701. This was observed with a fluorescence microscope. Although the fluorescence intensity varies depending on the length of the replication reaction at the time of chromosome introduction, it is incorporated into the chromosomal region.

  When the chromosome is bound to the fibrous substrate, the chromosome is non-specifically adsorbed to the container containing the fibrous substrate. If the chromosome is expanded and elongated in the state where the chromosome remains, DNA is expanded and elongated not only from the fibrous substrate but also from the chromosome adsorbed on the container, which is a problem. In order to cope with this, it is necessary to transfer the chromosome to another container after binding the chromosome to the fibrous substrate. However, if the fibrous substrate is dried or agitated in the solution at the time of this transfer, the fibrous substrate and the connected chromosome are damaged or denatured.

Therefore, it was decided to use the solution tank shown in FIG. This solution tank is divided by a partition wall 805 into a chromosome binding tank 801 that performs a process of binding chromosomes to glass fibers and a development / extension tank 806 that performs a process of expanding and extending chromosomes bonded to glass fibers. First, the chromosome solution 802 was added to the chromosome binding tank 801, and the chromosome was bound to the glass fiber 804 supported by the support bow 803 in the chromosome binding tank. Thereafter, chromosomes remaining in the solution were washed out, the partition wall 805 was pulled out, and the solutions in the chromosome binding tank 801 and the expansion / extension tank 806 were integrated. Thereby, the glass fiber which couple | bonded the chromosome can be moved to an expansion | deployment / extension tank, without taking out from a solution. The septum 805 was returned to its original position, the two solutions were separated, and a chromosome 809 that had been subjected to deproteinization treatment in a development / extension tank was prepared. Next, an electrode 812 connected to a power source 810 was placed in the expansion / elongation tank, and a chromosome 811 expanded / extended by electroosmotic flow was obtained. At this time, since the chromosome is bound only on the glass fiber in the expansion / elongation tank, DNA is not expanded / elongated from the chromosome adsorbed in the expansion / elongation tank.

Droplet holding device By removing and separating the partition walls in the above two-fiber glass cell tank, it was possible to prevent the chromosomes on the fibrous substrate from being dried. As another preferable drying prevention method, a method using a droplet holding device can be taken up. That is, the fibrous substrate and one or a plurality of plate-like structures each holding a droplet in which a part of the fibrous substrate is immersed by surface tension are integrated, without drying the fibrous substrate, It moves between the two solution tanks. FIG. 8B shows a process of performing this operation with two plate-like structures 813 in the form of droplet holding tweezers. A more preferred example is a method in which the chromosome is bound to the fibrous substrate on the plate-like structure and immersed in the expansion / elongation tank as it is. That is, the fibrous substrate is held between the droplet holding tweezers, the chromosomal fluid is filled between the droplet holding tweezers, and the fibrous substrate is immersed in the chromosomal fluid. After washing off the unlinked chromosomes between the droplet holding tweezers, the fibrous substrate was immersed in the expansion / elongation tank together with the droplet holding tweezers, and the fibrous substrate was kept immersed. The droplet holding tweezers are removed.

Glass fiber facing transfer cell Further, the following glass fiber transfer cell capable of smoothly moving the glass fiber from the chromosome binding tank to the expansion / elongation tank was prepared.
FIG. 9 schematically shows a glass fiber transfer cell. The glass fiber facing transfer cell is composed of two glass substrates having a hydrophilic region surrounded by a hydrophobic region, and a glass fiber disposed between the glass substrates.

The glass substrate was first hydrophobized once by dichlorodimethylsilane treatment (immersion in 2% (v / v) dichlorodimethylsilane dissolved in chlorobenzene for 30 minutes). Next, a mask having a rectangular window frame is placed on the glass substrate, and the silane layer of the glass substrate on the window surface is decomposed by UV irradiation (irradiation with a mercury lamp with an intensity of 28 mW / cm ^{2 at} a wavelength of 254 nm for 30 minutes) to form a square hydrophilic The sex surface was regenerated.

  The glass fiber 904 is fixed on the glass substrate 905 for chromosomal binding having the first square hydrophilic region so as to straddle the hydrophilic region, and the chromosomal fluid 902 is added to the hydrophilic region, and the chromosome is added to the glass fiber in the hydrophilic region. Combined. At this time, the chromosomal fluid was gently shaken to promote the binding of the chromosome to the glass fiber. The unbonded chromosomes are washed away, and in the state where the washing solution remains in the hydrophilic region of the first glass substrate, the second development / elongation glass substrate 901 is overlapped so that the rectangular hydrophilic regions face each other, The solution was also attached to the hydrophilic region of the glass substrate 901 that was stacked later. At this time, the two glass substrates prevent the glass fiber from being directly touched by separating the spacer 903. In this state, when glass fiber fixation is transferred from the first glass substrate 905 to the second glass substrate 901, and the first glass substrate 905 is pulled away, the glass substrate 901 crosses the hydrophilic region of the second glass substrate 901. The washing solution remained in the hydrophilic region with the fibers fixed.

  The glass fibers to which the chromosomes were bound by the above series of operations were transferred to a glass substrate for development / elongation without non-specific adsorption of chromosomes. In this state, protein removal treatment was performed. Since the amount of the solution on the development / elongation glass substrate is small, it may be covered with a sealing lid 906 in order to prevent drying during the deproteinization process. After deproteinization, the electroosmotic flow was induced by the electric field from the electrode 908 connected to the power source 907 to expand and extend the chromosome. At this time, the development / elongation glass substrate 901 does not adsorb chromosomes and does not interfere with the development / elongation from the glass fibers.

Extension Chromosome Channel The development / extension tank channel, which is the location where the chromosomal DNA extends, can have various forms as shown in FIG. 10, but is not limited thereto. In the first example of FIG. 10 (FIG. 10 (a)), the chromosome bonded to the glass fiber 1005 by the electrode 1001 placed on both ends of the expansion / elongation tank 1003 on the flat surface and the power source 1002 connected thereto. DNA1004 can be migrated along it, and the extension state can be observed on a flat surface. In the second example (FIG. 10 (b)), a parallel flow path in which wall surfaces 1006 are arranged in parallel along the extending direction is formed on this flat surface, and other flows separated by this wall surface. It prevents the extended chromosomal DNA from entering and getting entangled in the road. In the third example (FIG. 10C), the channel is covered with a lid 1007, and a function for preventing the chromosomal DNA in the extension process from escaping to the upper side of the channel is added. The fourth example (FIG. 10 (d)) is a fifth example (FIG. 10 (e)) parallel flow path, which is an example covered with a lid 1008 when the flow path is a parallel flow path. Is a meandering parallel wall surface 1009, which is designed to disperse the tension acting on the chromosomal DNA and to suppress chromosomal DNA breakage by contacting and supporting the chromosomal DNA in the elongation process. . The effect of dispersing the extension force is that a flow path having a plurality of columnar structures 1010 (FIG. 10 (f)) that do not separate the flow paths from each other by a wall surface or the like, or a flow path having a three-dimensional network structure 1011 (FIG. 10 (g) )). In any of the examples of FIG. 10, an electric field is applied to elongate the chromosome to induce electrophoresis / electroosmotic flow, but it is also possible to change to a configuration in which a constant liquid is fed to the flow path.

Chromosome expansion / extension First, deproteinization is performed to release DNA from the chromosome. This is a glass fiber on the glass substrate in the development and extension glass substrate in the glass fiber-to-surface transfer cell in Example 4, 750 mM NaCl, 75 mM TrisHCl (pH 8.0), 7.5 mM EDTA (pH 8.0), 0.0. Treatment was performed at 45 ° C. for 2 hours with a deproteinized solution composed of 5% (w / v) N-lauroyl sarcosine, 0.2 mg / ml heparin, 20 mM dithiothreitol, 0.7 mg / ml proteinase K. For this deproteinization treatment, the binding between streptavidin and biotin for chromosome fixation is not impaired, and the chromosome is not released from the glass fiber. After deproteinization, DNA fluorescent staining solution YO-PRO-1 was added to a final concentration of 250 nM, and electrophoresis was performed by applying a DC electric field of 1 to 5 V / cm. Alternatively, in electroosmotic flow, after deproteinization, the protein removal solution is gently removed, and Milli-Q water is added 5 times to demineralize the electrophoretic solution, and DNA fluorescent staining solution YO-PRO-1 is present. A direct electric field of 1-5 V / cm was applied below. FIG. 11 shows a chromosome 1102 that has been subjected to deproteinization treatment that is bound to the glass fiber 1101 prepared in “Example 2”. FIG. 12 applies an electric field to this to induce electroosmotic flow. 1203 is where the DNA is extended. A lump 1202 that does not extend partially can be confirmed. Chromosomal DNA to which the bright part on the right hand side of the screen is attached and glass fiber that emits light by autofluorescence, and chromosomal DNA in which fibers that emit fine fluorescence extending to the right are elongated. FIG. 13 shows an example of tracking chromosomal DNA extended over a long distance.

  FIG. 14 shows a chromosome 1402 that has been subjected to deproteinization treatment that is bound to the glass fiber 1401 prepared in “Example 3”, and FIG. 15 applies an electric field to the chromosome 1402 to induce electroosmotic flow. It is 1502 where DNA is extended. Compared with FIG. 12, no lump was confirmed. All of the above examples show that the chromosomal DNA has been successfully developed and elongated from the glass fiber.

FISH method using a repetitive nucleotide sequence for chromosomal DNA extended by the rotational extension method Chromosomes extracted from HeLa cells synchronously cultured in the mid-phase were used. Chromosome elongation was performed by the following rotational elongation method (see Japanese Patent Application No. 2006-157420). First, 2 microliters (containing about 20,000 cells) of HeLa cells suspended in a 70% ethanol aqueous solution was dropped on a glass substrate, and 10 microliters of the protein removal solution was immediately added. After leaving for 2 minutes, 500 microliters of Milli-Q water is added to swell the chromosomal DNA that has been deproteinized and released, and then the glass substrate is rotated horizontally at 5000 rpm for 30 seconds and centrifuged. Chromosomal DNA was elongated by the flow of the additive solution flowing away by force. This rotation also has the effect of removing the additive solution and drying and fixing the chromosomal DNA on the glass substrate. The deproteinized component remaining on the surface was washed away with a 70% aqueous ethanol solution, and then the chromosomal DNA was dried on a glass substrate at 60 ° C. for 30 minutes. As the glass substrate onto which the chromosomes were dropped, a glass substrate treated in advance with an aminosilane solution (Silaace S330: manufactured by Chisso) diluted 100,000 times for 30 minutes was used. The glass substrate surface having dried chromosomal DNA contains 50 nM each of oligo DNA probes for 6 types of Alu sequences having the following base sequences and having fluorescent groups Cy3 at the 5 ′ end and 3 ′ end respectively. 200 microliters of hybridization solution containing 50% (v / v) formamide, 300 mM NaCl, 3 mM Tris-HCl (pH 8.0), 3 mM EDTA (pH 8.0) was added per square centimeter.

Cy3-5′AGCCGGGGCGTGGGGGCGCGCGCTGTTAATCCCA3 ′ (SEQ ID NO: 5) -Cy3
Cy3-5′GATTACAGGCCGCGGCCCACCACGCCCGCTAAT3 ′ (SEQ ID NO: 6) -Cy3
Cy3-5′GTTGCAGATGGAGCGAGATCCGCGCCACTGCACTC3 ′ (SEQ ID NO: 7) -Cy3
Cy3-5′TGCAGGTGCGCGGATCTCGGCTCACTGCAACCTC3 ′ (SEQ ID NO: 8) -Cy3
Cy3-5′GCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA3 ′ (SEQ ID NO: 9) -Cy3
Cy3-5′TGAGACGGAGTCCTCGCTCTGTCGCCAGGCTG3 ′ (SEQ ID NO: 10) -Cy3

  The glass substrate was sealed with a silicone rubber cover so that the solution was not evaporated and the glass substrate was not dried, and then the temperature of the glass substrate was changed at 80 ° C. for 2 minutes, 4 ° C. for 10 minutes, and 37 ° C. for 10 minutes. In particular, the temperature was increased at a constant rate for 30 minutes between 4 ° C. for 10 minutes and 37 ° C. for 10 minutes. After temperature control, the glass substrate was washed with an aqueous solution containing 50% (v / v) formamide at 37 ° C., 300 mM NaCl, 3 mM Tris-HCl (pH 8.0), 3 mM EDTA (pH 8.0). Washing was performed with an aqueous STE solution, and an aqueous STE solution containing 50 nM YO-PRO-1 was added. FIG. 16 is a fluorescence observation image of the extended chromosomal DNA 1601 subjected to the above processing. The chromosome extends from the adhesion base at the upper right point to the lower left on the substrate. The labeled nucleic acid probe 1602 hybridized to a repetitive base sequence shown by a bright fluorescent image scattered on a fibrous chromosomal DNA 1601 shown by a weak fluorescent image stained with YO-Pro-1 Can be observed. These repetitive base sequences have an inherent dispersion state depending on the chromosomal region. Based on this feature, it is possible to identify the chromosomal region being observed.

FISH method using a repetitive base sequence for chromosomal DNA first fragmented and then extended by dielectrophoresis. 100 microliters of 20 mM NaCl, 10 mM TrisHCl (pH 8.0) were extracted from about 1 million HeLa cells. ) And an aqueous solution containing 100 mM EDTA (pH 8.0). A 1% (w / v) low-melting point agarose solution using 20 mM NaCl, 10 mM TrisHCl (pH 8.0), and 100 mM EDTA (pH 8.0) as a solvent was prepared. The mixture was rapidly mixed with the previous chromosomal suspension, transferred to ice-cooling and gelled. The agarose gel gelled in a plug shape was taken out and 20 mM NaCl, 10 mM TrisHCl (pH 8.0), 100 mM EDTA (pH 8.0), 1% (w / v) N-lauroyl sarcosine, 0.1 mg / ml proteinase K was added. It was immersed in a deproteinized solution having a composition and treated at 50 ° C. for 12 hours. The plug was washed with a 10 mM TrisHCl (pH 8.0) and 1 mM EDTA (pH 8.0) aqueous solution containing a serine protease inhibitor, and the deproteinized solution was removed. Next, the chromosomal DNA is fragmented to about 100 micrometers with a restriction enzyme. First, the plug was immersed in 500 microliters of an aqueous solution and equilibrated with 100 mM NaCl, 50 mM TrisHCl (pH 7.5), 10 mM MgCl, and 1 mM DTT. Thereafter, 2 microliters of restriction enzyme NotI (10 units / microliter) was added, and chromosomal DNA was fragmented at 37 ° C. for 6 hours. An additional 2 microliters of NotI was added and the treatment was repeated. After the cleavage, the restriction enzyme solution was removed by washing with 10 mM TrisHCl (pH 8.0) and 1 mM EDTA (pH 8.0) aqueous solution. Further, the solvent in which the plug was immersed was replaced with Milli-Q water and heated to 68 ° C. to dissolve the plug. The solution was added to a glass substrate having deposited aluminum electrodes at 100 micron intervals on its surface. Prior to the addition of the solution, the glass substrate was treated with aminosilane as in Example 7. Dielectric migration was performed by applying an AC voltage of 100 V and 1 MHz between the aluminum electrodes for 5 minutes, and then allowed to stand for 30 minutes. The chromosomal DNA is extended by electrophoresis with one end fixed to the electrode, and adsorbed to the glass substrate in the extended state. After adsorption, water was removed and the glass substrate was dried at 60 ° C. for 30 minutes. Thereafter, as in “Example 7”, hybridization reaction was carried out on the adsorbed chromosomal DNA using 6 types of oligo DNA probes for the Alu sequence having a fluorescent group. FIG. 17 is a fluorescence observation image of the chromosomal DNA 1701 that has been subjected to the above processing and has been fragmented and extended. Chromosomal DNA extends from the boundary of the electrodes on the bottom 1702 to the upper side of the substrate. The oligo DNA probe 1703 having the fluorescent group Cy3 bound by hybridization is dispersed as a strong luminescent spot on the fragmented chromosomal DNA 1701 indicated by a weak fluorescent image stained with YO-Pro-1. These repetitive base sequences 1703 have an inherent dispersion state depending on the chromosomal region, and based on this feature, the observed chromosomal region can be identified. Unlike “Example 7”, since chromosomal DNA is fragmented, there is an advantage of avoiding DNA fibers from becoming complex and bundled.

Summary of the Present Invention The expanded / elongated chromosome realizes high-resolution observation even in, for example, FISH staining, and promises general-purpose observation combined with conventional techniques. However, in normal FISH staining, it can be said that the characteristics of the chromosomal DNA developed and extended cannot be fully utilized due to the limitation of the number of distinguishable staining dyes. In order to enable observation at a high resolution over a wide range of chromosomal DNA at once, it is conceivable to prepare a specific labeling method for each part of the chromosomal DNA. However, in this method, for example, when mapping the position information of each part of a human genome having a total base number of 3 Gb with a resolution of 100 kb, it is necessary to label and identify 30,000 locations. At present, there is no labeling / discriminating method having high discrimination ability for such many kinds of labeling targets.

  One solution is to take advantage of the unique features of chromosomal DNA. That is, a large number of common or similar base sequences scattered on the chromosomal DNA are produced by repeating amplification, transfer, and mutation in the course of evolution. In humans, if it is possible to label these repetitive base sequences, it is possible to label many parts. Further, the distribution of the repetitive base sequences is not uniform, and the diversity of the distribution has the characteristic positional relationship unique to the repetitive base sequences of each part. If attention is paid to the characteristic of the unique positional relationship of this repetitive base sequence as an identification target, a high discrimination ability for each part of the chromosomal DNA is provided, and a position mapping method on the chromosomal DNA as a whole is provided.

  A wide range of chromosomal abnormalities and polymorphisms can be observed at high resolution over a wide range of chromosomal DNA as described above. Comprehensive and heuristic testing is possible at the species level, individual level, and body tissue level.

This large-scale diagnosis has an effect worth noting in the following points when compared with a chip technology in which test drugs are densely integrated on a substrate. That is,
(1) Since it is not necessary to accumulate the test drug, it is cheaper than that.
(2) Accumulation of test drugs subdivides the specifications, and it is necessary to prepare a plurality of chips for a plurality of purposes.

  In addition, according to this method, information other than the base sequence on the chromosome in which the position of each part of the chromosomal DNA is mapped by another method can be obtained. For example, by adding a labeled methylated cytosine-binding receptor to the methylation site nucleotide sequence of chromosomal DNA, it is possible to detect a wide range of methylation on chromosomal DNA with high resolution. Methylation of chromosomal DNA is an important chromosomal modification phenomenon that is known to be involved in ontogeny, cancer, and aging, but there have been no examples of detection over a wide range of chromosomal DNA. Therefore, it is considered very effective.

  The method for detecting methylation is equally useful for binding a receptor that has binding activity to other characteristic portions on chromosomal DNA and detecting that characteristic. Examples thereof include detection of nick sites, depurination sites, chromosomal damage sites such as thymidine dimers, and replication / repair failure sites such as mismatch sites.

  The chromosomal DNA developed and extended according to the present invention, in which the position of each part of the chromosomal DNA is mapped by the above method or by other methods, is derived from this chromosomal DNA, using this as a comparison target / reference target. Information on the composition can be obtained by hybridizing different sample nucleic acids.

  For example, by adding a chromosomal DNA fragment derived from a chromosomal DNA that is different from the chromosomal DNA that has been developed and extended as a comparison target or reference target as a sample nucleic acid, hybridization can be performed to increase the resolution of the above-described Comparative Genome Hybridization method. Can be realized.

  Furthermore, chromatin whose histone protein contained in the chromosome has been modified by methylation acetylation etc. is recovered by immunoprecipitation, and the chromosomal DNA fragment bound to this chromatin is extracted, and its label is prepared for comparison. It can be hybridized to the expanded / elongated chromosome as the target / reference target. This is an application of a method for mapping the location of modified histones on the genome, called the ChIP method, to chromosomal DNA that has been developed and extended, but also enables observation at a high resolution over a wide range at once.

  The present invention is also useful in the case where expansion / decompression is not performed. Usually, a cell contains a plurality of types of chromosomes, and the chromosomes are a mixture of these when purified from the cells. It is useful for selecting chromosomes to bind to a specific type of chromosome using the fibrous substrate having type-specific binding properties. In addition, as described above, when the chromosomes bound to the fibrous substrate are used as a comparison target / reference target to obtain information on the composition of the sample DNA, not as a sample, the comparison target / reference of these chromosomes is used. In order to maintain reproducibility and model as a target, it is necessary to manage a large amount of chromosomes of the same type derived from the same cell. In such a case, it is useful to prepare and manage a large amount of a fibrous substrate derived from the same cell and bound to the same type of chromosome.

  The present invention provides means / methods for expanding and extending chromosomes while suppressing damage, and analyzing the chromosomes with high resolution over a wide range including genes buried inside the chromosomes. Therefore, the present invention enables large-scale analysis of chromosomes and large-scale diagnosis of diseases. Furthermore, the present invention is also useful for preparing expanded and elongated chromosome specimens. Such specimens can be used as a standard indicating the relationship between disease and genetic abnormalities. Therefore, the present invention provides basic research fields such as bioresource survey, bioresource conservation record, epigenetics research, gene function research, population genetics research, etc .; cancer diagnosis, congenital genetic disease diagnosis, lifestyle-related disease diagnosis, tailor-made prescription It can be used in the medical field such as diagnosis; and in the food and agricultural field such as breed improvement and breed management.

FIG. 1 schematically shows each step of producing glass fibers modified at equal intervals in a narrow region where a receptor having binding activity is separated. FIG. 2 shows the glass fiber obtained by fluorescently labeling streptavidin in “Example 1” as observed with a fluorescence microscope. The distribution of streptavidin corresponding to the cutting interval can be confirmed on the glass fiber. A bright field image is superimposed on the fluorescence image to show the position of the glass fibers. FIG. 3 shows a glass fiber having streptavidin which is not fluorescently labeled in “Example 1”, which is obtained by observing a fluorescently labeled biotin with a fluorescent microscope. Distribution of streptavidin having biotin binding activity corresponding to the cutting interval can be confirmed on the glass fiber. A bright field image is superimposed on the fluorescence image to show the position of the glass fibers. FIG. 4 shows that in Example 2, a synthetic oligonucleotide in which the fluorescent group FITC is labeled 5 ′ instead of biotin is used, and it is confirmed that the oligonucleotide has hybridized to the telomeric sequence of the chromosome. FIG. 5 is a fluorescence microscopic observation of the telomere-labeled chromosome of FIG. 4 bound to glass fibers uniformly modified with streptavidin. It can be confirmed that the biotin label indicated by the bright fluorescence of FITC is bound on the glass fiber indicated by the weak autofluorescence image. FIG. 6 schematically shows a process in which a biotin group is introduced into a chromosome telomere sequence together with a reaction substrate by an enzymatic reaction in “Example 3”. FIG. 7 shows that the fluorescent group FITC is introduced into the chromosome telomere sequence together with the reaction substrate by fluorescent microscope observation in the same manner as in FIG. 6 instead of biotin. FIG. 8 shows an operation process for preventing non-specific binding using a glass fiber-crossing two-tank cell and a droplet holding device for preventing non-specific binding of chromosomes to the expansion / elongation tank in “Example 4”. It is a thing. FIG. 9 shows an operation process for preventing non-specific binding using a glass fiber facing transfer cell for preventing non-specific binding of chromosomes to the expansion / elongation tank in “Example 4”. FIG. 10 shows various flow paths as a development / extension tank used in the chromosomal DNA extension process using the fibrous substrate of “Example 5”. FIG. 11 shows the result of deproteinization of the chromosome bound to the glass fiber prepared in “Example 2” (hybridization) based on the operation of “Example 6” and observation of the fluorescence image of the entire chromosomal DNA. . FIG. 12 shows that the chromosome DNA bound to the glass fiber prepared in “Example 2” (hybridization) is elongated from the glass fiber by deproteinization and electroosmotic flow based on the operation of “Example 6”. This process was observed as a fluorescent image of DNA. FIG. 13 is a fluorescence observation image following extension over a long distance for chromosomal DNA subjected to the same processing as in FIG. FIG. 14 shows the result of deproteinization of the chromosome bound to the glass fiber prepared in “Example 3” (enzymatic reaction) based on the operation of “Example 6” and observation of the fluorescence image of the entire chromosomal DNA. . FIG. 15 shows chromosomal DNA from the glass fiber by deproteinization and electroosmotic flow based on the operation of “Example 6” for the chromosome bound to the glass fiber prepared by the operation of “Example 6” (enzymatic reaction). This is a process of observing as a fluorescence image of DNA. FIG. 16 shows an extension of chromosomal DNA extracted from cells derived from human strains based on the operation of “Example 7”, and hybridization of a fluorescently labeled probe to the repetitive base sequence (Alu sequence) of this extended DNA. This was observed with a fluorescence microscope. On the fibrous chromosomal DNA indicated by the weak fluorescence image, the probe indicated by the bright fluorescence image can be confirmed. FIG. 17 shows an extension of chromosomal DNA extracted from cells derived from human strains based on the operation of “Example 8”, and hybridization of a fluorescently labeled probe to the repetitive base sequence (Alu sequence) of this extended DNA. This was observed with a fluorescence microscope. Unlike “Example 7”, the chromosomal DNA is fragmented before extension, thus preventing the DNA fibers from becoming complex and bundled. On the fibrous chromosomal DNA indicated by the weak fluorescence image, the probe indicated by the bright fluorescence image can be confirmed.

Explanation of symbols

DESCRIPTION OF SYMBOLS 101 Glass fiber 102 Adhesive 103 Glass substrate 104 Embedding agent layer 105 Cutting blade 106 Cutting groove 107 Receptor modification liquid 108 Glass fiber with receptor 201 Glass fiber 301 Glass fiber 401 Chromosome 402 Labeled telomere 501 Glass fiber 502 Chromosome 503 Labeled telomere 601 Chromosomal DNA end labeling 602 PotI
603 Oligonucleotide having competitive binding 604 Primer 605 Labeled nucleobase 606 Label incorporated by biosynthesis 607 DNA replication enzyme 701 Chromosome 702 Labeled telomere 801 Chromosome binding tank 802 Chromosome fluid 803 Supporting bow 804 Glass fiber 805 Bulkhead 806 Expansion / extension tank 807 Chromosome adsorbed to chromosome binding tank 808 Chromosome bound to fibrous substrate 809 Deproteinized chromosome 810 Power supply 811 Expanded / expanded chromosome 812 Electrode 813 Plate structure 901 For expansion / extension Glass substrate 902 Chromosome solution 903 Spacer 904 Fibrous substrate 905 Chromosome binding glass substrate 906 Sealed lid 907 Power supply 908 Electrode 1001 Electrode 1002 Power supply 1003 Expansion / extension tank 1004 Chromosomal DNA
1005 Glass fiber 1006 Parallel partition wall 1007 Lid 1008 Cover on parallel partition wall 1009 Meandering parallel partition wall 1010 Columnar structure 1011 Three-dimensional network structure 1101 Glass fiber 1102 Chromosome before stretching 1201 Glass fiber 1202 Not stretched Chromosome 1203 Elongated chromosome 1401 Glass fiber 1402 Chromosome before extension 1501 Glass fiber 1502 Elongated chromosome 1601 Chromosome 1602 Repeated nucleotide sequence Nucleic acid probe 1701 Chromosomal DNA
1702 Electrode 1703 Repeated nucleotide sequence nucleic acid probe

Claims (18)

The following process:
In the expanded or elongated chromosomal DNA, the nucleic acid is hybridized to one type of repeated base sequence,
By using a label that is introduced into the hybridized nucleic acid or that is introduced into the nucleic acid after hybridization, a plurality of sets of the repetitive base sequences of the chromosomal DNA are mutually separated on the chromosomal DNA. And then
A position mapping method on chromosomal DNA, comprising: determining a region or position on a chromosome of the set and the repetitive base sequence included in the set based on the measured distance feature.   Expanded or extended chromosomal DNA is fragmented before expansion or extension, and by using the label, the distance between multiple sets of repetitive base sequences contained in the fragment is measured. And mapping the position of the fragment on the chromosomal DNA before fragmentation by determining the position of the set on the chromosome based on the measured distance feature. The method described. The following process:
In the expanded or elongated chromosomal DNA, nucleic acid is hybridized to multiple types of repetitive base sequences,
By using a label that can be specifically identified or cannot be identified for the type of repetitive base sequence introduced into the nucleic acid after hybridization or introduced into the nucleic acid after hybridization, the plurality of types of repetitive sequences are used. Measure the mutual distance for a plurality of sets of repetitive base sequences including the base sequence,
The position on the chromosomal DNA, including determining the region or position on the chromosome of the set and the repetitive base sequence contained in the set, based on the measured distance and, if possible, the characteristics of the identification content Mapping method.   Expanded or extended chromosomal DNA is fragmented before expansion or extension, and by using the label, a plurality of repetitive base sequences including a plurality of repetitive base sequences contained in the fragment are used. The distance between each pair is measured, and the region or position on the chromosome of the pair and the repetitive base sequence included in the pair is determined based on the measured distance and, if it can be identified, the characteristics of the identification contents. 4. The method according to claim 3, wherein the position of the fragment on the chromosomal DNA before being fragmented is mapped by determining.   The method according to claim 2 or 4, wherein the fragmentation is performed by restriction enzyme digestion.   The method according to any one of claims 1 to 5, wherein position mapping is performed by expanding and extending chromosomal DNA by dielectrophoresis.   The chromosomal DNA position mapping method according to any one of claims 1 to 6, wherein 100 or less oligonucleic acids whose difference in annealing temperature is within a range of 5 ° C are used as the nucleic acid that hybridizes to the repetitive base sequence.   The chromosomal DNA position mapping method according to any one of claims 1 to 7, wherein the repetitive base sequence comprises a human Alu sequence.   The base sequence of the 133rd to 157th residues, the base sequence of the 231st to 245th residues, the base sequence of the 260th to 282nd residues of the consensus Alu sequence in SEQ ID NO: 11, and their complementary strand sequences The chromosomal DNA position mapping method according to claim 8, wherein a nucleic acid having at least one base sequence selected from the group consisting of:   The chromosomal DNA position mapping method according to any one of claims 1 to 9, wherein the repetitive base sequence comprises a human LINE-1 sequence. The following process:
In the expanded or elongated chromosomal DNA, a receptor having binding activity to methylated cytosine is added and bound,
Methylated cytosine position mapping on chromosomal DNA comprising identifying the position of methylated cytosine in chromosomal DNA by using a label that is introduced into the receptor or that is introduced into the receptor after binding Method.   The method according to claim 11, wherein the expanded or elongated chromosomal DNA is fragmented before expansion or elongation. The mapping method according to any one of claims 1 to 12, wherein the label contains a substance that becomes a ligand of a receptor having specific binding property thereto, and the receptor becomes the next label. The mapping method according to claim 1, wherein the label contains a substance that emits fluorescence.   A chromosomal DNA mapping apparatus system used in the chromosomal DNA position mapping method according to any one of claims 1 to 14, wherein an observation apparatus for visualizing a label of a repeated base sequence, an observation image photographing apparatus, and In addition, as a required element, the position of the base sequence is repeatedly extracted from the photographed image, the mutual distance of the set is measured, and the genome base sequence database information or the information extracted from the information is collated with three devices. Chromosomal DNA mapping apparatus or system. The following process:
Select from a mixture of nucleic acids consisting of multiple types of nucleic acids extracted from biological samples, a mixture of nucleic acids fragmented from them, a mixture of nucleic acids replicated using them as a template, and a mixture of nucleic acids subjected to both fragmentation and replication Prepare any one mixture that will be
The expanded or elongated chromosomal DNA is used as a nucleic acid for hybridization, the mixture of the prepared nucleic acids is used as a nucleic acid for hybridization, hybridization is performed, and then
Discrimination of the type of nucleic acid contained in the prepared mixture of nucleic acids and measurement of relative content by using a label introduced into the hybridized nucleic acid or introduced into the nucleic acid after hybridization Performing a composition analysis of the nucleic acid mixture contained in the sample. The composition analysis method according to claim 16, wherein the label contains a substance that becomes a ligand of a receptor having specific binding property thereto, and the receptor becomes the next label.   The composition analysis method according to claim 16 or 17, wherein the label contains a substance that emits fluorescence.

Images