JP2009018999A - Anti-cancer agent-resistant inhibitor - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a new means inhibiting anti-cancer agent resistance of cancer cells. <P>SOLUTION: An anti-cancer agent-resistant inhibitor comprises a β1,3-N-acetylglucosaminyl transferase 6 governing biosynthesis of the core 3 structure of an O-glycan or a specific derivative etc., thereof as an active ingredient. Since the drug efflux activity of a P-glycoprotein which is one kind of a drug efflux transporter is inhibited with the anti-cancer agent-resistant inhibitor, the resistance to the anti-cancer agent conventionally causing problems in treatment using the anti-cancer agent can be inhibited, to maintain effects of the anti-cancer agent. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to an anticancer drug resistance inhibitor.

  In cancer chemotherapy, even if an anticancer drug is effective at first, it often becomes ineffective and becomes a problem. A typical multidrug resistance mechanism is a drug efflux transporter, and the acquisition of anticancer drug resistance is considered to be caused by an increase in drug efflux transporter activity.

  As a drug efflux transporter, a group of proteins having many ATP-binding cassettes (ATP-binding cassettes; ABC) is known (Non-Patent Documents 1 to 4). Currently, 48 types of ABC genes have been reported. Among them, P-glycoprotein (MDR1) (encoded by ABCB1 gene) and multidrug resistance protein are said to be important for drug resistance. 1 (multidrug resistance protein 1; MRP1) (coded by ABCC1 gene), MRP2 (coded by ABCC2), MRP3 (coded by ABCC3), MRP4 (coded by ABCC4), MRP5 (coded by ABCC5), breast cancer resistance protein (breast cancer resistance protein; BCRP) (ABCG2 is a code) (Non-patent Document 2). The most studied of these is a 170 kDa human P-glycoprotein consisting of 1280 amino acids, which has two ATP-binding domains, 12 transmembrane domains, and 3 N-glycans (Non-patent literature). 5, 6). This protein is highly expressed in the adrenal gland and kidney, and is also moderately observed in the lung, liver, lower jejunum, colon, and rectum (Non-patent Document 7), and also in the blood-brain barrier of the cerebrovascular endothelium. It is known to play an important role in preventing the entry of drugs into the nervous system (Non-patent Document 8).

  If the mechanism regulating drug efflux transporter activity is clarified, it is expected that cancer chemotherapy will make great progress in diagnosis and drug effect, but there are many unexplained parts. As for the relationship with sugar chains, it has been clarified that N-glycans have an important function for expressing the activity of P-glycoprotein (Non-patent Documents 9 and 10). In addition, cisplatin resistance in head and neck squamous cell carcinoma cells has been shown to be mainly due to a decrease in β1,6-N-acetylglucosamine branching in N-glycans bound to α5β1 integrin ( Non-patent document 11). On the other hand, the involvement of O-glycans in anticancer drug resistance has not been reported yet.

  O-glycans are those in which N-acetylgalactosamine residues are linked to serine or threonine on glycoproteins via O-glycosidic bonds, and are present in so-called mucin-like proteins on the cell surface. It is also called “type” (Non-Patent Documents 12 and 13). More than 10 types of ppGalNAcT, which transfer N-acetylgalactosamine residues onto a polypeptide, form a core structure consisting of 2-3 sugars, on which galactose, N-acetylglucosamine, fucose, N-acetylgalactosamine, sialic acid, sulfate group and the like are further bonded to 1 to several tens residues to form a side chain. Unlike N-glycans, these O-glycans often form clusters with strong charges and hydrophilicity, with several to several tens of them arranged in close proximity on the peptide, and determine the physicochemical properties of glycoproteins. There are many cases. In addition, sugar chain antigenic determinants such as Lewis X, Lewis A, and serial Lewis X, and ligands for cell-cell interaction bind to the side chain and are involved in various phenomena such as differentiation, immunity, adhesion, and canceration. Things are known. The core structure is core 1 (Galβ1-3GalNAcα-), core 2 [Galβ1-3 (GlcNAcβ1-6) GalNAcα-], core 3 (GlcNAcβ1-3GalNAcα-), core 4 [GlcNAcβ1-3 (GlcNAcβ1-6) GalNAcα- In addition, rare structures such as cores 5-8 have been reported. Many glycosyltransferases that form side chains recognize core structures (Non-Patent Document 14), and conversion of core structures is expected to involve changes in sugar chain structures including side chains. Thymic cortex cells express many core 2 sugar chains on their surface, but when they mature into T cells, these core 2 sugar chains disappear and become only core 1 sugar chains (Non-patent Document 15). T cells acquire core 2 sugar chains once activated by an immune response (Non-patent Document 16). In cancer cells, changes from core 3 to core 1 and core 2 have been reported (Non-patent Documents 17 and 18).

  As a report on the involvement of O-glycan and metastasis of cancer, UDP-GlcNAc: GalNAc-peptide β1,3-N-acetylglucose is an enzyme responsible for biosynthesis of the core 3 structure of O-glycan isolated by Iwai et al. It has been reported that saminyltransferase 6 (β3Gn-T6, core 3 synthase) (patent document 1, non-patent document 19) has an action of significantly reducing metastasis of cancer cells (patent document 2, non-patent document 1). Patent Document 20). However, as described above, no involvement of O-glycans in anticancer drug resistance has been reported.

  If the anticancer drug resistance of cancer cells can be effectively suppressed, it is extremely useful for cancer treatment. However, as described above, there are many unclear parts in the mechanism of anticancer drug resistance, and no useful means for suppressing anticancer drug resistance has yet been provided.

International Publication No. 03/033710 Pamphlet JP 2006-22027 A Leslie EM et al. Toxicol Appl Pharmacol 2005; 204: 216-37. Takano M et al. Pharmacol Ther 2006; 109: 137-61. Borst P et al. J Natl Cancer Inst 2000; 92: 1295-302. Loo TW et al. J Membr Biol 2005; 206: 173-85. Chen CJ et al. Cell 1986; 47: 381-9. Schinkel AH et al. J Biol Chem 1993; 268: 7474-81. Fojo AT et al. Proc Natl Acad Sci U S 1987; 84: 265-9. Bauer B et al. Exp Biol Med (Maywood) 2005; 230: 118-27. Kramer R et al. Br J Cancer 1995; 71: 670-5. Gribar JJ et al. J Membr Biol 2000; 173: 203-14. Nakahara S et al. Mol Cancer Ther 2003; 2: 1207-14. Fukuda M. Biochim Biophys Acta 2002; 1573: 394-405. Wopereis S et al. Clin Chem 2006; 52: 574-600 Holgersson J et al. Glycobiology 2006; 16: 584-93 Baum LG et al. J Exp Med 1995; 181: 877-87 Priatel JJ et al. Immunity 2000; 12: 273-83 Vavasseur F et al. Eur J Biochem 1994; 222: 415-24 Vavasseur F et al. Glycobiology 1995; 5: 351-7 Iwai T et al. J Biol Chem 2002; 277: 12802-9 Iwai T et al. Proc Natl Acad Sci U S A 2005; 102: 4572-7

  Accordingly, an object of the present invention is to provide a novel means capable of suppressing the resistance of an anticancer drug to cancer cells.

  As a result of intensive studies, the inventors of the present application expressed β1,3-N-acetylglucosaminyltransferase 6 (β3Gn-T6, SEQ ID NO: 2), which controls the biosynthesis of the core 3 structure of O-glycan, in cancer cells. When this is done, the drug excretion activity of P-glycoprotein, which is one of the drug excretion transporters, is suppressed, the extracellular excretion of the anticancer agent in cancer cells is remarkably reduced, and the sensitivity of the anticancer agent is increased. completed.

  That is, the present invention relates to a polypeptide having 80% or more homology with the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing or a polypeptide containing the polypeptide as a partial sequence, wherein the N-acetylgalactosaminyl group An anticancer agent-resistant inhibitor containing, as an active ingredient, a polypeptide having an activity of transferring N-acetylglucosamine to the non-reducing end of β-1 or 3 by a β-1,3 bond.

  According to the present invention, a novel drug capable of suppressing the resistance of an anticancer drug to cancer cells has been provided. According to the anticancer drug resistance inhibitor of the present invention, it is possible to suppress resistance to an anticancer agent, which has been a problem in the conventional treatment using an anticancer agent, and to maintain the effect of the anticancer agent. Moreover, if the inhibitor of this invention is used together with an anticancer agent from the beginning of treatment, the effect of the anticancer agent can be enhanced from the beginning. Further, the combined use of the inhibitor of the present invention and an anticancer agent is expected to increase the effectiveness of the anticancer agent and make it applicable to a combination of a cancer and an anticancer agent that has not been applied because of its low therapeutic effect. The As described above, the present invention greatly contributes to cancer chemotherapy.

Examples of the polypeptide contained as an active ingredient in the anticancer drug resistance inhibitor of the present invention include the following. In the present invention, “polypeptide” refers to a molecule formed by peptide bonding of a plurality of (two or more) amino acids, and includes not only high molecular weight molecules having a large number of amino acids but also the number of amino acids. Low molecular weight molecules (oligopeptides) and proteins are also included. In the present invention, a protein consisting of the full length of SEQ ID NO: 2 is also included.
(a) N-acetylglucosamine is transferred to the non-reducing end of N-acetylgalactosaminyl group by β-1,3 bond, having 80% or more homology with the amino acid sequence shown in SEQ ID NO: 2 A polypeptide having the activity of
(b) A polypeptide comprising (a) as a partial sequence and having an activity of transferring N-acetylglucosamine to a non-reducing end of an N-acetylgalactosaminyl group through a β-1,3 bond.

  In the present invention, “having an amino acid sequence” and “having a base sequence” mean that amino acid residues and bases are arranged in such an order, respectively. Therefore, for example, “a polynucleotide having the base sequence represented by SEQ ID NO: 3” means a 52-base size polynucleotide having the base sequence of ggggacaagtttgtacaaaaaagcaggcttcatggcttttccctgccgcagg represented by SEQ ID NO: 3. In addition, for example, “polypeptide having the amino acid sequence represented by SEQ ID NO: 2” may be abbreviated as “polypeptide of SEQ ID NO: 2”.

The amino acid sequence shown in SEQ ID NO: 2 is β1,3-N-acetylglucosaminyltransferase 6 (also referred to as β3Gn-T6, β3GlcNAcT6, core 3 synthase) isolated by the present inventors (Iwai T, Inaba N, Naundorf A, et al. J Biol Chem (2002) 277: 12802-9; International Publication No. WO03 / 033710). β3Gn-T6 is an enzyme responsible for biosynthesis of O-glycan core 3 structure (N-acetylglucosaminyl β1-3N-acetylgalactosaminyl α1-R), and non-reducing N-acetylgalactosaminyl group The core 3 structure is synthesized by the activity of transferring N-acetylglucosamine at the terminal by a β-1,3 bond. The reaction catalyzed by the activity is represented by the following reaction formula (R represents a residue in an ether bond with a hydroxyl group of a side chain such as serine or threonine in a protein or a hydroxyl group such as p-nitrophenol. ).
UDP-N-acetyl-D-glucosamine + N-acetyl-D-galactosaminyl-R → UDP + N-acetyl-β-D-glucosaminyl-1,3-N-acetyl-D-galactosaminyl-R
(GalNAc-R + UDP-GlcNAc → GlcNAcβ1-3GalNAc-R + UDP)

Hereinafter, in this specification, “the activity of transferring N-acetylglucosamine to the non-reducing end of the N-acetylgalactosaminyl group by β-1,3 bond” is referred to as “β3Gn-T6 enzyme activity”. The β3Gn-T6 enzyme activity is not particularly limited, but can be confirmed, for example, by the method described in Example 1 of WO03 / 033710. That is, for example, the polypeptide solution whose enzyme activity should be confirmed is pNp-α-GalNAc and UDP-GlcNAc in an appropriate buffer (for example, 50 mM HEPES buffer, 10 mM MnCl ₂ , 0.1% Triton-CF54, etc.) The mixture is reacted at 37 ° C. for about 16 hours, and whether or not the core 3 structure is formed can be easily confirmed by HPLC or the like. For example, as described in International Publication No. WO03 / 033710, HPLC uses Mightysil RP-18, 250 × 4 mm as a column and acetonitrile: H ₂ O = 10: 90 as a solvent, and detection is performed at an absorption of 210 nm. Can be implemented. Since GlcNAcβ1-3GalNAc-α-pNp (core3 structure) and GlcNAcβ1-6GalNAc-α-pNp (core6 structure) that can be used as preparations are commercially available, they can be easily obtained.

  β3Gn-T6 is highly expressed in the digestive system from the esophagus to the large intestine and low in muscles, lungs, and brains, but decreased in digestive system cancers such as colorectal cancer and stomach cancer (Iwai T, Inaba N, Naundorf A, et al. J Biol Chem (2002) 277: 12802-9; International Publication No. WO03 / 033710). FIG. 1 shows a biosynthetic reaction pathway of the core 1-4 structure of O-glycan. As shown here, when β3Gn-T6 is expressed, it competes with core1GalT, which controls the biosynthesis of the core1 structure, and core1 and core2 made from it decrease, and core3 and it become the substrate. It is predicted that the number of core 4 made will increase.

  As described in the following examples, among the clones expressing β3Gn-T6 in HCT-15 cells derived from human colon adenocarcinoma, the enzyme activity of β3Gn-T6 was actually exhibited and β3Gn-T6 and core1GalT In the clones in which the core 1 sugar chain is decreased due to the competition, the drug excretion activity of P-glycoprotein is decreased, and a marked increase in paclitaxel sensitivity is observed. Therefore, if β3Gn-T6 or a polypeptide having the same enzyme activity is allowed to act on cancer cells, the anticancer drug resistance caused by the increased drug excretion activity of P-glycoprotein can be suppressed. Moreover, according to the inhibitory effect of the P-glycoprotein brought about by the β3Gn-T6 enzyme activity, an effect of increasing the anticancer drug sensitivity of cancer cells and the anticancer action of the anticancer drug can be expected. For example, paclitaxel used in the following examples is known not to be effective for the same type of colorectal cancer as HCT-15 cells, and clinically paclitaxel anticancer agents are used for treatment of such colorectal cancer. Not applied. However, as described in the Examples below, β3Gn-T6 increases the sensitivity of HCT-15 to paclitaxel. Therefore, when β3Gn-T6 is used in combination with a paclitaxel anticancer agent, the paclitaxel anticancer agent can be applied to the treatment of the same type of colorectal cancer as HCT-15. Thus, if the β3Gn-T6 enzyme activity is used, the application range of anticancer agents that have been limited in clinical application can be expanded.

  In general, in a protein having physiological activity such as an enzyme, even when one or a few amino acids in the amino acid sequence are substituted, deleted and / or inserted, the physiological activity is maintained. It is well known that there are cases. Therefore, a polypeptide having an amino acid sequence in which one or a few amino acids are substituted, deleted and / or inserted in the amino acid sequence shown in SEQ ID NO: 2 and having β3Gn-T6 enzyme activity (hereinafter, for convenience) (Also referred to as “modified polypeptide”) is also useful as an active ingredient of an anticancer drug resistance inhibitor and is included within the scope of the present invention. The amino acid sequence of such a modified polypeptide has a homology of 80% or more, preferably 90% or more, more preferably 95% or more, and even more preferably 98% or more with the amino acid sequence shown in SEQ ID NO: 2. preferable. Further, as the modified polypeptide, one having an amino acid sequence in which one or several amino acids are substituted, deleted and / or inserted in the amino acid sequence shown in SEQ ID NO: 2 is particularly preferable.

  Here, the “homology” of amino acid sequences means that both amino acid sequences are aligned so that the amino acid residues of the two amino acid sequences to be compared match as much as possible, and the number of matched amino acid residues is the total number of amino acid residues. The percentage divided by is expressed as a percentage. In the above alignment, a gap is appropriately inserted in one or both of the two sequences to be compared as necessary. Such sequence alignment can be performed using a known program such as BLAST, FASTA, CLUSTAL W, and the like. When gaps are inserted, the total number of amino acid residues is the number of residues obtained by counting one gap as one amino acid residue. When the total number of amino acid residues counted in this way is different between the two sequences to be compared, the homology (%) is the total number of amino acid residues in the longer sequence, and the number of amino acid residues matched. Is calculated by dividing. The 20 amino acids constituting the natural protein are neutral amino acids having low side chains (Gly, Ile, Val, Leu, Ala, Met, Pro), and neutral amino acids having hydrophilic side chains (Asn , Gln, Thr, Ser, Tyr Cys), acidic amino acids (Asp, Glu), basic amino acids (Arg, Lys, His), and aromatic amino acids (Phe, Tyr, Trp) It is known that the properties of a polypeptide often do not change as long as it can be grouped and the substitution between them. Therefore, when substituting amino acid residues in the amino acid sequence of SEQ ID NO: 2, there is a possibility that the β3Gn-T6 enzyme activity of the polypeptide used as an active ingredient can be maintained by substitution between these groups. Get higher.

  Further, the β3Gn-T6 protein or modified polypeptide described above is included as a partial sequence (that is, β3Gn-T6 protein or modified polypeptide having one or both ends added with other amino acids or polypeptides), and the β3Gn-T6 enzyme A polypeptide having activity (hereinafter sometimes referred to as “addition polypeptide” for convenience) can also be used for the preparation of an anticancer drug-resistant inhibitor in the same manner as β3Gn-T6 and the modified polypeptide described above. Specific examples of such added polypeptides include, but are not limited to, fusion proteins to which various tags such as His tag, FLAG tag, and GFP are added.

  In general, in a pharmaceutical comprising a polypeptide, a sugar chain or a polyethylene glycol (PEG) chain is added to the polypeptide or at least a part of the amino acids constituting the polypeptide in order to increase the stability of the polypeptide in vivo. A technique using a D-form amino acid is widely known and used. By adding sugar chains or PEG chains, or by using D-form amino acids as at least part of the amino acids that make up the polypeptide, it is less susceptible to degradation by peptidases in vivo, reducing the polypeptide in vivo by half. The period becomes longer. As long as it has β3Gn-T6 activity, the polypeptide used in the present invention may be those subjected to these known modifications for in vivo stabilization. The term “peptide” is used in the sense of including those that have been modified for in vivo stabilization, unless the context clearly indicates otherwise.

  Glycosylation to polypeptides is well known, for example, Sato M, Furuike T, Sadamoto R, Fujitani N, Nakahara T, Niikura K, Monde K, Kondo H, Nishimura S., "Glycoinsulins: dendritic sialyloligosaccharide-displaying insulins showing a prolonged blood-sugar-lowering activity. ", J Am Chem Soc. 2004 Nov 3; 126 (43): 14013-22 and Sato M, Sadamoto R, Niikura K, Monde K, Kondo H, Nishimura S," Site- specific introduction of sialic acid into insulin. ", Angew Chem Int Ed Engl. 2004 Mar 12; 43 (12): 1516-20. The sugar chain can be bound to the N-terminus, C-terminus, or an amino acid therebetween, but is preferably bound to the N-terminus or C-terminus so as not to inhibit the activity of the polypeptide. The number of sugar chains to be added is preferably 1 or 2, and preferably 1. The sugar chain is preferably monosaccharide to tetrasaccharide, more preferably disaccharide or trisaccharide. The sugar chain can be bound to a free amino group or carboxyl group of the polypeptide directly or via a spacer structure such as a methylene chain having about 1 to 10 carbon atoms.

  Addition of PEG chains to polypeptides is also well known, e.g. Ulbricht K, Bucha E, Poschel KA, Stein G, Wolf G, Nowak G., "The use of PEG-Hirudin in chronic hemodialysis monitored by the Ecarin Clotting Time: influence on clotting of the extracorporeal system and hemostatic parameters. ", Clin Nephrol. 2006 Mar; 65 (3): 180-90. and Dharap SS, Wang Y, Chandna P, Khandare JJ, Qiu B, Gunaseelan S, Sinko PJ, Stein S, Farmanfarmaian A, Minko T., "Tumor-specific targeting of an anticancer drug delivery system by LHRH peptide.", Proc Natl Acad Sci USA. 2005 Sep 6; 102 (36): 12962-7. The PEG chain can be attached to the N-terminus, C-terminus, or the amino acid between them, and usually one or two PEG chains are attached to a free amino group or carboxyl group on the polypeptide. The molecular weight of the PEG chain is not particularly limited, but is usually about 3000 to 7000, preferably about 5000.

  A method in which at least a part of amino acids constituting a polypeptide is in D form is also well known. For example, Brenneman DE, Spong CY, Hauser JM, Abebe D, Pinhasov A, Golian T, Gozes I., “Protective peptides that are orally active and mechanistically nonchiral. ", J Pharmacol Exp Ther. 2004 Jun; 309 (3): 1190-7, Wilkemeyer MF, Chen SY, Menkari CE, Sulik KK, Charness ME.,“ Ethanol antagonist peptides: structural specificity without stereospecificity ", J Pharmacol Exp Ther. 2004 Jun; 309 (3): 1183-9. A part of the amino acids constituting the polypeptide may be D-form, but since the activity of the polypeptide is not inhibited as much as possible, all of the amino acids constituting the polypeptide are D-form amino acids rather than only part of the amino acids It is preferable that

  The above polypeptide used as an active ingredient in the present invention can be easily prepared by a conventional method using, for example, a commercially available peptide synthesizer. Moreover, it can be easily prepared using a known genetic engineering technique. For example, from the RNA extracted from the tissue expressing the β3Gn-T6 gene, cDNA of β3Gn-T6 gene is prepared by RT-PCR, the full length of the cDNA is incorporated into an expression vector, and introduced into a host cell, The target polypeptide can be obtained. Extraction of RNA, RT-PCR, integration of cDNA into a vector, and introduction of a vector into a host cell can be performed by known methods. Further, vectors and host cells to be used are well known, and various types are commercially available. The stabilization modification can also be easily performed by a known method as described in each of the above documents.

  The inhibitor of the present invention containing a polypeptide having β3Gn-T6 enzyme activity as an active ingredient may be composed of only a polypeptide, a pharmacologically acceptable carrier suitable for each dosage form, and / or Or it can formulate using a diluent. Formulation methods and various carriers therefor are well known in the field of pharmaceutical formulation. The pharmacologically acceptable carrier or diluent may be, for example, a buffer solution such as a physiological buffer solution or an excipient (sugar, lactose, corn starch, calcium phosphate, sorbitol, glycine, etc.), and a binder ( Syrup, gelatin, gum arabic, sorbitol, polyvinyl chloride, tragacanth, etc.), lubricant (magnesium stearate, polyethylene glycol, talc, silica, etc.) and the like may be appropriately mixed. Examples of the dosage form include oral preparations such as tablets, capsules, granules, powders, and syrups, and parenteral preparations such as inhalants, injections, suppositories, and liquids. These preparations can be made by generally known production methods.

  The administration route to the living body of the inhibitor of the present invention comprising the above polypeptide as an active ingredient may be oral administration or parenteral administration, but parenteral administration such as intramuscular administration, subcutaneous administration, intravenous administration, intraarterial administration, etc. Is preferred. In particular, local administration to cancer tissue or its surrounding tissues is preferable to systemic administration. According to local administration, exposure of healthy tissue to the inhibitor can be avoided, and cancer cells can be efficiently acted in a smaller amount. The dose may be an amount effective for reducing the drug excretion activity of P-glycoprotein in vivo (preferably in cancer cells). The dosage is appropriately selected according to symptoms, age, body weight, administration method, etc., and is not particularly limited, but is usually about 1 μg to 1 g, particularly about 1 mg to 100 mg per day as an active ingredient amount for adults. Yes, divided into 1 to several doses.

  The subject of administration of the inhibitor of the present invention is a mammal, and examples thereof include humans, dogs, cats, rabbits, hamsters and the like. Although it does not specifically limit, Preferably it is a human.

  Moreover, anticancer drug resistance can also be suppressed by expressing a polynucleotide encoding the above-mentioned polypeptide having β3Gn-T6 enzyme activity in cancer cells of the subject animal. In this case, the polynucleotide encoding the polypeptide is administered to the subject animal in the form of a recombinant vector incorporated into a vector that can be expressed in the cells of the subject organism. Administering such a recombinant vector to a target animal to produce the above polypeptide as an active ingredient in the target animal cell is also considered as one form of administering the above polypeptide to the target animal. Are included in the range of inhibitors.

  The polynucleotide to be inserted into the vector may be a polynucleotide having the base sequence shown in SEQ ID NO: 1, and its conservatively substituted base sequence (the encoded amino acid sequence is the same and the base sequence is different). Can be used. In addition, since the codons encoding each amino acid are known, the base sequence of a polynucleotide encoding a specific amino acid sequence can be easily specified. Therefore, the base sequence of the polynucleotide encoding any of the above-described polypeptides can be easily specified. These polynucleotides can be synthesized by a conventional method using a commercially available nucleic acid synthesizer. The polynucleotide having the base sequence shown in SEQ ID NO: 1 can be easily prepared using a well-known genetic engineering technique. For example, β3Gn− is extracted from RNA extracted from cells expressing β3Gn-T6. It can be easily obtained by preparing cDNA of T6 gene by RT-PCR. The polynucleotide may be DNA or RNA.

  The expression vector may be any vector that can be expressed in a living cell, preferably a mammalian cell, and may be a plasmid vector or a viral vector. Vectors that can be expressed in mammalian cells are well known, and various vectors are commercially available. For example, the recombinant vector can be easily obtained by inserting the above-described polynucleotide into a multicloning site of a commercially available vector.

The administration route of the recombinant vector may be any administration route commonly used for administration methods such as gene vaccines and gene medicines, and is not particularly limited, but intramuscular administration, subcutaneous administration, intravenous administration, intraarterial administration. A parenteral route of administration such as administration is preferred. Local administration is preferred because local administration to cancer tissues or surrounding tissues can efficiently produce the polypeptide in cancer tissues and avoid exposure of healthy tissues to the polypeptide. The recombinant vector can be prepared into a preferable dosage form according to the administration route, and is usually administered in the form of an injection or the like. If necessary, a conventional carrier may be added. The dose can be appropriately selected according to the administration route and the like. Usually, the amount of the recombinant vector is about 1 × 10 ⁸ to 1 × 10 ¹⁴ vector particles / kg, particularly 1 × ^{10 10 to} 1 × ¹⁰ per treatment for an adult. ^{About 13} vector particles / kg.

  The anticancer agent whose resistance is changed by the inhibitor of the present invention is a substrate of P-glycoprotein, and is an anticancer agent that is excreted out of the cell by the action of P-glycoprotein. The substrate of P-glycoprotein is known as described in Non-Patent Document 2 (Takano M et al. Pharmacol Ther (2006) 109: 137-61). Specific examples of anticancer agents that are substrates for P-glycoprotein include, but are not limited to, paclitaxel, actinomycin D, daunorubicin, docetaxel, doxorubicin, methotrexate, vincristine, and the like. Among the P-glycoprotein substrates, there are drugs that also serve as substrates for other drug transporters. However, anticancer drugs with higher specificity for P-glycoproteins cause resistance changes due to the inhibitors of the present invention. It is considered easy.

  The anticancer drug resistance targeted by the inhibitor of the present invention is anticancer drug resistance caused mainly by an increase in drug excretion activity of P-glycoprotein. Although other drug transporters may be involved, it is considered that the effect of the inhibitor of the present invention is higher as the resistance of the anti-cancer agent with higher contribution of P-glycoprotein. When an anticancer drug that is susceptible to the drug excretion activity of P-glycoprotein ceases to work during medication, the resistance to the anticancer drug may be mainly due to an increase in the drug excretion activity of P-glycoprotein High nature. Therefore, the inhibitor of the present invention can preferably exert an inhibitory effect when resistance to an anticancer agent occurs in the course of treatment using an anticancer agent that is a P-glycoprotein substrate.

  Moreover, the inhibitor of this invention can be used also for uses other than suppression of anticancer agent resistance. For example, by using in combination with an anticancer agent that is a P-glycoprotein substrate, extracellular discharge of the anticancer agent in cancer cells can be suppressed, and the effect of the anticancer agent can be enhanced. For example, if a paclitaxel anticancer agent does not have a desirable effect and is administered in combination with a paclitaxel anticancer agent and the inhibitor of the present invention for a colon adenocarcinoma that has not been clinically applied conventionally, the paclitaxel anticancer agent from the cancer cells of the paclitaxel anticancer agent Is suppressed, and treatment with the anticancer agent becomes possible (see Examples below). Therefore, according to the inhibitor of the present invention, the application range of the anticancer agent can be expanded.

  Hereinafter, the present invention will be described more specifically based on examples.

Materials and Methods material
[ ³ H] paclitaxel (740 GBq / mmol) and [ ³ H] glucosamine hydrochloride (1480 GBq / mmol) were purchased from American Radiolabeled Chemicals (St. Louis, MO, USA). Verapamil, paclitaxel (Taxol), and rhodamine 123 were purchased from Sigma (St. Louis, MO, USA). Arthrobacter-derived sialidase was obtained from Nacalai Tesque (Kyoto, Japan). PNA-biotin was obtained from Vector Laboratories (Burlingame, California, USA). MTS assay reagents were obtained from Promega (Madison, Wis., USA). Lipofectamine 2000 reagent and geneticin were obtained from Invitrogen (Carlsbad, Calif., USA). Human P-glycoprotein-specific monoclonal antibody UIC2 was purchased from Beckman Coulter (Marseilles, France).

2. Cell culture HCT-15 cells derived from human colon adenocarcinoma were obtained from the American Type Cell Collection in RPMI-1640 medium supplemented with 10% fetal bovine serum at 37 ° C in a wet incubator with 5% CO ₂ environment. Cultured. Four pure cell lines stably expressing β3GlcNAcT6 and one pure mock-transfected (mock) control cell line were cultured in the same medium as described above in the presence of geneticin (1.0 mg / ml).

3. Expression construct and transfection The ORF fragment encoding β3GlcNAcT6 was amplified by PCR using Marathon-Ready cDNA (Clontech) of human gastric tissue as a template. The forward primer (SEQ ID NO: 3: 5'-ggggacaagtttgtacaaaaaagcaggcttcatggcttttccctgccgcagg-3 ') and reverse primer (SEQ ID NO: 5'-ggggaccactttgtacaagaaagctgggtctggcctcaggagacccggtg-3') were added to the recombination sites respectively. Using the GATEWAY system (Invitrogen), the amplified fragment was inserted between the attP1 and attP2 sites of the pDONR 201 entry vector, and then the inserted fragment was transferred into the pDEST12.2 mammalian expression vector. This plasmid was named pDEST12.2-β3GlcNAcT6.

  HCT-15 cells were transfected with pDEST12.2-β3GlcNAcT6 expression plasmid DNA using Lipofectamine 2000 reagent. Transfected cells were selected for 3 weeks in the presence of geneticin (1.0 mg / ml). Cells were isolated by trypsinization and cloned by limiting dilution while continuing selection with geneticin in 96 well plates. Four pure cell lines (# 30, # 36, # 40, # 46) stably expressing β3GlcNAcT6 and one pure mock-transfected (mock) control cell line were established. The mock cell line was obtained by transfection with pDEST12.2 not containing β3GlcNAcT6.

4). Drug accumulation assay For paclitaxel accumulation assay, HCT on 12-well tissue culture plates using RPMI-1640 medium supplemented with 10% fetal calf serum for 1 day at 37 ° C in a wet incubator with 5% CO ₂ environment -15 cells were cultured (1 x 10 ⁵ cells / well). [ ³ H] paclitaxel (74 GBq / mmol) was added to a final concentration of 26.7 μM and incubated at 37 ° C. Cells collected at each time point were washed four times with ice-cold phosphate buffered saline (PBS) and mixed with a liquid scintillator OptiPhase HiSafe 3 (Wallac Perkin Elmer Life Sciences). Radioactivity was counted with a liquid scintillation counter (ALOKA, LSC-6101).

5). Drug Sensitivity Assay For paclitaxel sensitivity assay, HCT-15 cells (1 x 10 ⁴ cells / well) are cultured for 1 day in 96-well culture plate, then various concentrations of paclitaxel are added to the medium The culture was further continued for 72 hours. 96 AQueous One Solution with 3- (4,5-dimethylthiazol-2-yl) -5- (3-carboxymethoxyphenyl) -2- (4-sulfophenyl) 2H-tetrazolium inner salt (MTS) Cell viability was measured by Cell Proliferation Assay (Promega, Madison, Wis., USA).

6). P-glycoprotein activity inhibition assay
HCT-15 cells (mock and # 30 transfectant clonal cells) were cultured on a 12-well tissue culture plate (1 × 10 ⁵ cells / well). Incubate for 1 hour in the absence of 0.3 μM cyclosporin A and functional P-glycoprotein specific neutralizing antibody UIC2 (10 μg / ml), and then add [ ³ H] paclitaxel (74 GBq / mmol). The drug accumulation assay for 2 hours was performed as described above.

7). Rhodamine 123 excretion assay by flow cytometry
HCT-15 cells were incubated at 37 ° C. for 1 hour in RPMI-1640 medium supplemented with 10% fetal calf serum in the presence of 1 μg / ml rhodamine 123 (Rho-123). The cells were washed with PBS and incubated in fresh medium without Rho-123 for 4 hours at 37 ° C. to drain Rho-123. After incubation, the cells were washed with PBS and immediately analyzed for Rho-123 accumulation. Analysis was performed using a FACSAria flow cytometer (Becton, Dickinson and Campany, Franklin Lakes, NJ, USA) at an excitation wavelength of 488 nm (using a 575/26 nm bandpass filter).

9. Analysis of O-glycans
HCT-15 cells (1 x 10 ⁶ cells) were prepared using RPMI1640 medium with a glucose concentration of 1/5, 5% CO2 in the presence of [ ³ H] glucosamine (1 Mbq / ml) and 5% dialyzed FBS. Incubated in ₂ environments for 20 hours. After the cells were collected, the cell homogenate was dialyzed against PBS and subjected to β-elimination reaction with 0.05N KOH / 1M NaBH ₄ at 45 ° C. for 15 hours. The released oligosaccharides were digested with Arthrobacter-derived sialidase and subjected to Bio-Gel P-4 column chromatography (<45 μm, 1.5) according to the method described in Yamashita K et al., Methods Enzymol 1982; 83: 105-26. Neutral sialidase digested oligosaccharides were analyzed using cm id x 50 cm long, Bio-Rad Laboratory. The standard oligosaccharides Galβ1-3GalNAc _OT and GlcNAcβ1-3GalNAc _OT are described in previous reports (Guo JM et al., FEBS Lett (2002) 524: 211-8; Tachibana K et al., Glycobiology (2006) 16: 46-53). according to the method, prepared from enzymatically synthesized core 1 and the core 3-MUC5AC peptide was subjected to β elimination / labeling (1MBq NaB ³ H ₄ containing 0.05N KOH / 1M NaBH _4). Galβ1-3 (Galβ1-4GlcNAcβ1-6) GalNAc _OT and Galβ1-4GlcNAcβ1-3GalNAc _OT were prepared from core 2- and core 3-Muc5AC peptides by the same method, and then β4-galactosylated using recombinant β4GalT1. Obtained. Galβ1-4GlcNAcβ1-3 (Galβ1-4GlcNAcβ1-6) GalNAc _OT was prepared from core 3 oligosaccharides using recombinant cores 2GlcNAcT1 and β4GalT1.

Result 1. Creation of β3GlcNAcT6 expression clone
HCT-15 strain was transfected with β3GlcNAcT6 gene, and four clones with different β3GlcNAcT6 expression levels were isolated. When β3GlcNAcT6 is expressed, as shown in Fig. 1, it competes with core1GalT in the cell, core 1 (Galβ1-3GalNAcα-) and core 2 made using it as a substrate decrease, and core 3 increases. is expected. Therefore, the expression level of β3GlcNAcT6 protein in each clone was analyzed as a decrease in the amount of core 1 binding on the cells using PNA recognizing core 1 (FIG. 2A). However, on the cells, core 1 is often sialyl core 1 (Siaα2-3Galβ1-3GalNAcα-), and since this structure is not recognized by PNA lectin, it was analyzed after digestion with neuraminidase.

The amount of core 1 binding was the highest in the mock of the control and decreased to # 40, # 46, # 36, # 30, and it was revealed that the actual amount of β3GlcNAcT6 activity expressed was # 30. It was. Therefore, mock, # 30 cells were metabolically labeled with ³ H-glucosamine, and O-glycans were excised from these membrane fractions by β-elimination reaction to analyze how the structure was changed. O-glycans were converted to neutral oligosaccharides by sialidase digestion and separated using Bio-Gel P-4 gel filtration chromatography (FIG. 2B). In mock cells, the peak was at the same elution position as core 1 (Galβ1-3GalNAc _OT ) and core 2-derived Galβ1-3 (Galβ1-4GlcNAcβ1-6) GalNAc _OT. Most of the peak components at the same elution position as Galβ1-4GlcNAcβ1-3GalNAc _OT having the core 3 structure disappeared.

2. Measurement of multidrug transporter activity The multidrug transporter activity of each clone was measured by the following two methods.
(1) Each clone was incubated in the presence of [ ³ H] paclitaxel (taxol) and collected after a certain time. The cells were washed with PBS, and the radioactivity from intracellular [ ³ H] paclitaxel was measured to examine the amount of paclitaxel accumulated in the cell. The results are shown in FIG. 3A.
(2) After loading rhodamine 123 into each clone, the medium was replaced with a medium not containing rhodamine, and each clone was further incubated for 4 hours, and the residual amount of rhodamine in the cells was measured by flow cytometry. The results are shown in FIG. 3B.

The results of the two were completely in agreement, indicating that [ ³ H] paclitaxel and rhodamine extracellular excretion activities were remarkably reduced in clones # 30 and # 36, which have high β3GlcNAcT6 expression. # 40 and # 46 clones with low β3GlcNAcT6 expression showed transporter activity almost the same as mock. Since there is no difference between mock and wild type cell line (Wt) in FIG. 3A, it is considered that there is no influence of the transfection and cloning process. These results indicate that the conversion of O-linked glycoprotein sugar chain from core 1 + core 2 to core 3 structure caused by β3GlcNAcT6 expression significantly changed the action of multidrug transporter protein in HCT-15 cells. Probably caused.

3. Measurement of paclitaxel sensitivity
Mock and clone # 30 were tested for sensitivity to paclitaxel. Each cell is cultured at a density of 1 x 10 ⁴ cells / well, further cultured for 72 hours in the presence of paclitaxel at a concentration of 1 x 10 ^{-5-10 -10} M, and the viability is measured using an MTS assay did. The results are shown in FIG. The mock had an IC50 (50% inhibitory concentration) of 3 x 10 ^-7 M, while the # 30 clone had a 3 times 10 ^-9 M increase in sensitivity and was caused by the expression of β3GlcNAcT6 It was shown that conversion of O-linked glycoprotein sugar chains markedly changed the drug resistance of HCT-15 cells.

4). Effect of inhibition of P-glycoprotein activity on paclitaxel excretion activity Paclitaxel and rhodamine 123 are known to be very good substrates for P-glycoprotein, but may also be substrates for other transporters. (Takano M et al., Pharmacol Ther (2006) 109: 137-61; Deeley RG et al., FEBS Lett (2006) 580: 1103-11; Lagas JS et al., Clin Cancer Res ( 2006) 12: 6125-32; Hopper-Borge E et al., Cancer Res (2004) 64: 4927-30; Wang Y et al., Biochim Biophys Acta (2006) 1758: 1671-6). It cannot be determined that the transporter affected by the conversion of the O-glycan structure is a P-glycoprotein. Thus, we confirmed the inhibitory effect on [ ³ H] paclitaxel excretion activity using verapamil, a P-glycoprotein-specific inhibitor, and antibody UIC2, which inhibits the transporter activity of P-glycoprotein.

The result of the inhibition experiment with verapamil is shown in FIG. 5A. In the condition without verapamil, the accumulation of [ ³ H] paclitaxel in the # 30 clone was almost 3 times higher than that of mock cells. However, when verapamil concentration was increased, there was a difference in the [ ³ H] paclitaxel excretion activity of both. It became clear that it was lost.

On the other hand, anti-P-glycoprotein antibody UIC2 is known to specifically bind to the structure bound to the drug and inhibit its transporter activity (Mechetner EB et al., Proc Natl Acad Sci USA (1992 89: 5824-8; Ghosh P et al., Arch Biochem Biophys (2006) 450: 100-12; Hochman JH et al., J Pharmacol Exp Ther (2001) 298: 323-330). Therefore, in mock cells, UIC2 (10 μg / ml) was added in the presence of a low concentration of cyclosporin A (0.3 μM) that does not significantly inhibit [ ³ H] paclitaxel excretion activity, and the effect on paclitaxel excretion activity was examined. As a result, as shown in FIG. 5B, it was shown that the intracellular [ ³ H] paclitaxel concentration of mock and # 30 increased to almost the same level, and the excretion activity was inhibited by the P-glycoprotein antibody. From these results, it was revealed that the multidrug transporter protein of HCT-15 cells whose activity was reduced by β3GlcNAcT6 introduction was P-glycoprotein.

The biosynthetic reaction pathway of the core 1-4 structure of O-glycan is shown. The expression of β3GlcNAcT6 in HCT-15 cell clone is shown. (A) For each clone, cell surface glycoproteins were digested with neuraminidase and analyzed for PNA binding by flow cytometry. (B) ³ H-labeled O-glycans derived from HCT-15 mock cells (upper) and # 30 clone cells (lower) were separated by Bio-Gel P-4 column chromatography. I to VI indicate the elution position of the sample (I; GlcNAc _OT + GalNAc _OT , II; Gal-GalNAc _OT , III; GlcNAc-GalNAc _OT , IV; Gal-GlcNAc-GalNAc _OT , V; Gal- (Gal- GlcNAc) GalNAc _OT , VI; Gal-GlcNAc (Gal-GlcNAc) GalNAc _OT ). The upper arrow indicates the elution position of the glucose oligomer (the number represents the number of glucose units). The result of the drug excretion assay in HCT-15 cell clone is shown. (A) shows the results of measuring the amount of [ ³ H] paclitaxel accumulated in wild type cells (Wt), mock cells, and clone 4 lines. (B) shows the results of measuring rhodamine 123 excretion for mock cells and clone 4 lines. Results of paclitaxel sensitivity assay in mock cells and clone # 30 are shown. Each cell was cultured for 72 hours under various paclitaxel concentration conditions, and cell viability was measured by MTS assay. Data represent the average of 4 replicates. The result of inhibiting the activity of P-glycoprotein in the HCT-15 cell line using verapamil or a monoclonal antibody is shown. The amount of [ ³ H] paclitaxel accumulated in mock cells and # 30 clones was measured by (A) under various verapamil concentration conditions. (B) shows P-glycoprotein-specific monoclonal antibody UIC2 (10 μg / ml) And the results of measurement in the presence or absence of cyclosporin A (CsA, 0.3 μM) are shown. Data represent the average of 3 replicate experiments. The bar is +/- SD. * Significantly different (p <0.05).

Claims (8)

  A polypeptide having 80% or more homology with the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing or a polypeptide containing the polypeptide as a partial sequence, wherein N is present at the non-reducing end of the N-acetylgalactosaminyl group -Anticancer drug resistance inhibitor comprising, as an active ingredient, a polypeptide having an activity of transferring acetylglucosamine by β-1,3 bond.   The inhibitor according to claim 1, wherein the polypeptide is a polypeptide having 90% or more homology with the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing or a polypeptide containing the polypeptide as a partial sequence.   The polypeptide is an amino acid sequence represented by SEQ ID NO: 1, or an amino acid in which one or several amino acids are substituted or deleted in the sequence, or one or several amino acids are inserted or added to the amino sequence The inhibitor according to claim 1, which is a polypeptide having a sequence or a polypeptide comprising the polypeptide as a partial sequence.   The inhibitor according to claim 3, wherein the polypeptide is a polypeptide having the amino acid sequence represented by SEQ ID NO: 1, or a polypeptide containing the polypeptide as a partial sequence.   The inhibitor according to claim 4, wherein the polypeptide is a polypeptide having the amino acid sequence represented by SEQ ID NO: 1.   The inhibitor according to any one of claims 1 to 5, wherein the active ingredient is produced in vivo by a vector containing a polynucleotide encoding the polypeptide and capable of expressing the polypeptide in vivo.   The inhibitor according to any one of claims 1 to 6, wherein the anticancer agent is a substrate of P-glycoprotein.   The inhibitor according to claim 7, wherein the anticancer agent is at least one selected from the group consisting of paclitaxel, actinomycin D, daunorubicin, docetaxel, doxorubicin, methotrexate and vincristine.

Images