JP2009005631A - Analysis element for analyzing base sequence of target nucleic acid, analysis apparatus and analysis method - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an analysis apparatus and an analysis method, with which the base sequence of a target nucleic acid has a long analyzable length, without reducing the immobilization density of a polymerase and causing mutual interference of polymerases or double stranded nucleic acids to be elongated through polymerases. <P>SOLUTION: The analysis apparatus analyzes the base sequence of a target nucleic acid. The analysis apparatus has an analysis element constituted of a substrate and a polymerase, a liquid feed means for pouring a liquid on the analysis element and a means for analyzing the base class of a nucleotide derivative elongated into a primer. The substrate has a sensor member region on the surface; the sensor member region has a plurality of polymerase immobilization regions; the width of the polymerase immobilization region is 10 nm or larger, and 50 nm or smaller; and the shortest distance between the plurality of the polymerase immobilization regions in the flow direction of the liquid generated by the liquid feed means is set larger than the length of target nucleic acid. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to an analysis element, an analysis apparatus, and an analysis method for analyzing a base sequence of a target nucleic acid having a polymerase immobilized on a support useful for analyzing the base sequence of the target nucleic acid by a sequencing by synthesis method.

  As a method for decoding the base sequence of the target nucleic acid at high speed, a method called Sequencing by synthesis method has been proposed. This includes the step of extending the reverse complementary strand of the target nucleic acid one base at a time to the 3 ′ end of the primer by the catalytic action of DNA polymerase and the step of identifying the type of the extended nucleotide one by one.

  As one embodiment of the Sequencing by synthesis method, a DNA base sequence analyzer in which a polymerase is immobilized on a support may be used.

Conventional DNA base sequence analyzers in which a polymerase is immobilized on a support include one in which a polymerase is supported on an optical waveguide (Patent Document 1).
JP-T-2002-543847

  However, the target nucleic acid base sequence analysis apparatus in which a polymerase is immobilized on a support has a problem that the length of the target nucleic acid base sequence that can be analyzed is short.

  In addition, as a means for preventing the polymerase immobilized on the support from interfering with each other even if the target nucleic acid is double-stranded, there is a method in which the polymerase immobilization density is reduced. However, this method has a problem that the signal intensity obtained from the DNA base sequence analyzer is weakened.

  Accordingly, an object of the present invention is to provide a configuration in which the polymerase or a double-stranded nucleic acid extended by the polymerase does not interfere with each other without reducing the signal intensity, that is, without reducing the immobilization density of the polymerase. Another object of the present invention is to provide a target nucleic acid analyzer having a long analyzable length of a base sequence of a target nucleic acid and a method for analyzing the target nucleic acid.

The present invention
An analysis device for analyzing the base sequence of a target nucleic acid,
The analysis device is
An analytical element comprising a substrate and a polymerase;
A liquid feeding means for flowing a liquid to the analysis element;
A means for analyzing the base type of the nucleotide derivative extended to the primer by the polymerase,
The base has a sensor member region;
The sensor member region has a plurality of polymerase-immobilized regions on its surface;
The polymerase is immobilized in the polymerase immobilization region;
The width of the polymerase immobilization region is 10 nm or more and 50 nm or less,
The analyzer is characterized in that the shortest distance between the plurality of polymerase immobilization regions in the flow direction of the liquid generated by the liquid feeding means is set to be longer than the length of the target nucleic acid.
Another aspect of the present invention is:
An analysis device for analyzing the base sequence of a target nucleic acid,
The analysis device is
An analytical element comprising a substrate and a polymerase;
A liquid feeding means for flowing a liquid to the analysis element;
A means for analyzing the base type of the nucleotide derivative extended to the primer by the polymerase,
The substrate is made of a porous body,
The base has a sensor member region and a plurality of polymerase immobilization regions on the surface of the sensor member region,
The polymerase is immobilized in the polymerase immobilization region;
The analysis apparatus characterized in that the liquid feeding means generates a liquid flow in a direction crossing the substrate.
Another aspect of the present invention is:
An analysis method for analyzing a base sequence of a target nucleic acid,
An analysis element comprising a polymerase, a substrate having a sensor member region on its surface, and a plurality of polymerase-immobilized regions to which the polymerase is immobilized in the sensor member region includes a complementary binding pair of a target nucleic acid and a primer. Adding a sample; and
Feeding the nucleotide derivative in a direction in which the shortest distance between the polymerase-immobilized regions is longer than the length of the target nucleic acid;
Determining the base type of the nucleotide derivative extended to the primer;
Have
The width of the polymerase immobilization region is 10 nm or more and 50 nm or less.
Another aspect of the present invention is:
An analysis element for analyzing a base sequence of a target nucleic acid,
The analytical element is
A substrate comprising a conductor region and an insulator region, and a polymerase;
The polymerase is immobilized on a polymerase immobilization region of the conductor region;
The base has a plurality of holes whose depth direction is the thickness direction of the base;
The conductor region forms part of a surface forming the hole;
The analysis element is characterized in that the diameter of the through hole is 10 nm or more and 50 nm or less.
Another aspect of the present invention is:
A target nucleic acid analyzer for analyzing a base sequence of a target nucleic acid,
The target nucleic acid analyzer is
An analysis element;
A liquid feeding means for flowing a liquid to the analysis element;
A means for analyzing the base type of the nucleotide derivative extended to the primer by the polymerase,
The analytical element is
A substrate comprising a conductor region and an insulator region, and a polymerase;
The polymerase is immobilized on a polymerase immobilization region of the conductor region;
The base has a plurality of holes whose depth direction is the thickness direction of the base;
The conductor region forms part of a surface forming the hole;
The target nucleic acid analyzer is characterized in that the diameter of the through hole is 10 nm or more and 50 nm or less.
Another aspect of the present invention is:
An analysis method for analyzing a base sequence of a target nucleic acid,
Adding a sample containing a complementary binding pair of a target nucleic acid and a primer to the analysis element;
A step of feeding a nucleotide derivative;
Determining the base type of the nucleotide derivative extended to the primer by the polymerase,
The analytical element is
A substrate comprising a conductor region and an insulator region, and a polymerase;
The polymerase is immobilized on a polymerase immobilization region of the conductor region;
The base has a plurality of holes whose depth direction is the thickness direction of the base;
The conductor region forms part of a surface forming the hole;
The diameter of the through hole is 10 nm or more and 50 nm or less.
Another aspect of the present invention is:
An analysis method for analyzing the base sequence of a target nucleic acid using an analysis element comprising a polymerase, a substrate having a sensor member region on its surface, and a plurality of polymerase-immobilized regions to which the polymerase is immobilized in the sensor member region There,
At least in the step of performing the extension reaction of the primer paired with the target nucleic acid by polymerase, an exonuclease specific for double-stranded DNA is allowed to coexist in the reaction solution for performing the extension reaction.

  According to the present invention, the double-stranded target nucleic acid extended by a plurality of polymerases held on the surface of the sensor member region does not interfere with each other. Synthesis is possible. That is, it is possible to provide an analysis element, a target nucleic acid analyzer, and a target nucleic acid analysis method that have a long analyzable length of a base sequence of a target nucleic acid.

Hereinafter, first to fourth embodiments for carrying out the present invention will be described.
(First form)
The first embodiment of the present invention will be described below.
The present invention
An analysis device for analyzing the base sequence of a target nucleic acid,
The analysis device is
An analytical element comprising a substrate and a polymerase;
A liquid feeding means for flowing a liquid to the analysis element;
Means for analyzing the base type of the nucleotide derivative extended to the primer by the polymerase,
The base has a sensor member region;
The sensor member region has a plurality of polymerase-immobilized regions on its surface;
The width of the polymerase immobilization region is 10 nm or more and 50 nm or less,
The analyzer is set such that the shortest distance between the plurality of polymerase immobilization regions in the flow direction of the liquid generated by the liquid feeding means is longer than the length of the target nucleic acid.

  Hereinafter, each part which comprises the analyzer which analyzes the base sequence of the target nucleic acid of a 1st form is demonstrated.

(1) Analytical Element (1-1) Substrate The substrate is composed of a sensor member region for detecting the base sequence of the target nucleic acid and a non-sensor member region. Further, the surface of the sensor member region is composed of a plurality of polymerase immobilization regions.

  In order to analyze the base type of the nucleotide derivative extended to the primer, the sensor member region has a function of conducting electricity, guiding light, or having a magnetoresistive function. As such a sensor member region, a material capable of detecting an optical, electrical or magnetic signal can be used. For example, the sensor region material region can be formed using a conductive material such as glass, surface-modified glass, silicon, metal, semiconductor, high refractive index dielectric, crystal, gel, polymer, or an optical waveguide.

  The width of the polymerase immobilization region is preferably 10 nm or more and 50 nm or less. This is because when the width of the polymerase immobilization region is 10 nm or more and 50 nm or less, one molecule of polymerase is substantially immobilized within the width of the polymerase immobilization region. The length of the polymerase immobilization region is preferably about the width of the flow path of the liquid generated by the liquid feeding means. Furthermore, the polymerase immobilization region is arranged so that the shortest distance between the plurality of polymerase immobilization regions in the liquid feeding direction (liquid flow direction) of the liquid feeding means is longer than the length of the target nucleic acid.

  On the other hand, the non-sensor member region has an insulating and light-impermeable function. Examples of such a non-sensor member region include a member different from a member constituting the sensor member region with glass, silicon, metal, semiconductor, crystal, gel, polymer, or the like.

Further, the substrate may have a substrate shape (plate shape) or a cylindrical shape. The substrate may be a porous body. When the sensor member region exists on the surface of the base, it is preferable that the sensor member region 701 has a narrow rectangular shape or an elliptical shape as shown in the top view of FIG. Here, it is also preferable that a plurality of polymerase immobilization regions 204 to be immobilized on the sensor member region exist substantially in parallel. Here, the polymerase immobilization regions being parallel to each other means that the longest line segments among the line segments existing in each polymerase immobilization region are parallel to each other. Further, “substantially” parallel means that the line segments do not intersect in the width of the flow of the liquid generated by the liquid feeding means.
(1-2) Polymerase Polymerase has a function of extending a nucleoside triphosphate having a base complementary to the corresponding base of the target nucleic acid at the 3 ′ end of the primer complementary to the target nucleic acid using the target nucleic acid as a template. Have.

  The polymerase is only required to be present in a range where the sensor member region is fixed to the polymerase immobilization region on the surface and the sensor member region can be detected. Here, the sensor member region having the polymerase immobilization region on the surface means that the sensor member region has a polymerase immobilization region at the interface between the sensor member region and the outside. The width of the polymerase immobilization region is preferably 10 nm or more and 50 nm or less. Therefore, the polymerase may be directly fixed to the polymerase immobilization region, or may be fixed via a linker or the like. The polymerase is preferably held on the surface of the sensor member region at the highest possible density in the polymerase immobilization region, and the polymerases are preferably arranged adjacent to each other.

  Such a polymerase is classified into enzyme number EC 2.7.7.7, and the origin thereof is not limited as long as it is an enzyme that catalyzes the following reaction.

deoxynucleoside triphosphate + DNA (n) = diphosphate + DNA (n + 1)
A method for manufacturing the analysis element of the first embodiment will be described below.

  First, a sensor member is laminated on a substrate whose surface is at least a non-sensor member. The substrate that is a non-sensor member is not particularly limited as long as it is a member having a property different from that of the sensor member. However, when the sensor member is a conductive material, the substrate that is a non-sensor member includes silicon, oxide Aluminum, quartz, glass, ceramic, plastic and the like can be mentioned. When the sensor member is a material having an optical waveguide function, examples of the substrate that is a non-sensor member include silicon, aluminum oxide, and ceramic. When a conductor material is used as the sensor member, examples of the conductor material include metals, conductive polymers, metal oxides, and carbon materials. The metal oxide may be improved or imparted with conductivity by another conductor material. Examples of the film forming method include sputtering, CVD (chemical vapor deposition), dipping, MBE, and vapor deposition. When a material having an optical waveguide function is used as the sensor member, glass, a high refractive index dielectric, crystal, gel, polymer, or the like is used as the sensor member. Examples of the film forming method include sputtering, CVD (chemical vapor deposition), dipping, MBE, and vapor deposition.

  Subsequently, a polymerase or a synthetic complex composed of a polymerase, a target nucleic acid and a primer is immobilized on the laminated sensor member region. Examples of the method for immobilizing polymerase on the surface of the sensor member region include the methods (1) to (3) described below.

  Examples of a method for immobilizing a polymerase on the polymerase immobilization region or porous membrane include the methods (i) to (iii) described below.

(I) Covalent bond method A functional group is directly introduced on the surface of the sensor member region, and the functional group and the polymerase are covalently bonded to immobilize the polymerase. Alternatively, a functional group is introduced into a carrier disposed in contact with the sensor member region, and the functional group and a polymerase are covalently bonded to immobilize the enzyme.

  Examples of functional groups that can be used for such covalent bonds include hydroxyl groups, carboxyl groups, amino groups, aldehyde groups, hydrazino groups, thiocyanate groups, epoxy groups, vinyl groups, halogen groups, acid ester groups, phosphate groups, and thiol groups. , Disulfide groups, dithiocarbamate groups, dithiophosphate groups, dithiophosphonate groups, thioether groups, thiosulfate groups, and thiourea groups.

In addition, by utilizing the fact that the thiol group of alkylthiol acts on a metal such as gold and can easily bond to form a monomolecular film (self-assembled monomolecular film), a functional group previously introduced into the alkyl group of alkylthiol The enzyme is immobilized by covalently binding the enzyme to the metal.
The covalent bond between the functional group previously introduced into the alkyl group of the alkylthiol and the enzyme can be formed using, for example, a bifunctional reagent.

Typical bifunctional reagents include glutaraldehyde, periodic acid, N, N′-o-phenylene dimaleimide, N-succinimidyl-4- (N-maleimidomethyl) cyclohexane-1-carboxylate, N-succinate. Sinimidylmaleimidoacetic acid, N-succinimidyl-4-maleimidobutyric acid, N-succinimidyl-6-maleimidohexanoic acid, N-sulfosuccinimidyl-4-maleimidomethylcyclohexane-1-carboxylic acid, N-sulfosuccinimi Dil-3-maleimidobenzoic acid, N- (4-maleimidobutyryloxy) sulfosuccinimide sodium salt, N- (6-maleimidocaproyloxy) sulfosuccinimide sodium salt, N- (8-maleimidocapryloxy) sulfosuccinimide Sodium salt, N- (11-maleimide Undecanoyloxy) sulfosuccinimide / sodium salt, N [2- (1-piperazinyl) ethyl] maleimide / dihydrochloride, disulfone compounds (for example, divinylsulfone compounds) and the like.
Examples of the carrier arranged in contact with the conductor region include agarose, agarose degradation product, κ-carrageenan, agar, alginic acid, polyacrylamide, polyisopropylacrylamide, polyvinyl alcohol, and copolymers thereof.

(Ii) Adsorption method (part 1)
The polymerase is immobilized by a physical adsorption method using hydrophobic interaction or electrostatic interaction between the sensor member region and the polymerase. When physical adsorption of the polymerase to the sensor member region is impossible or insufficient, the polymerase can be immobilized via a carrier that causes physical adsorption of the polymerase. As such a carrier, a carrier made of polyanion or polycation such as polyallylamine, polylysine, polyvinylpyridine, dextran modified with an amino group (for example, DEAE-dextran), chitosan, polyglutamate, polystyrene sulfonic acid, dextran sulfate is used. be able to. The polymerase is fixed to the carrier by an ion binding method using electrostatic interaction between the carrier and the polymerase, and this polymerase-immobilized carrier is placed in contact with the sensor member region.

(Iii) Adsorption method (part 2)
Immobilization is performed using various affinity tags used to facilitate purification of the recombinant protein. For example, the polymerase is immobilized using epitope tags such as HA (hemagglutinin), FLAG, Myc, etc., GST, maltose-binding protein, biotinylated peptide, oligohistidine tag.

(2) Analysis apparatus The analysis apparatus of the present invention has the following configuration in addition to the analysis element.
(2-1) Liquid-feeding means The liquid-feeding means has a function of flowing a liquid such as a specimen to the analysis element, and between the polymerase immobilization regions in the direction of the liquid flow (liquid-feeding) generated by the liquid-feeding means. This is a liquid feeding means for feeding in a direction in which the shortest distance is longer than the length of the target nucleic acid. By feeding the solution in such a direction, it is possible to prevent the double-stranded nucleic acids from contacting each other and not interfering with each other in the step of extending the target nucleic acid by the polymerase. In addition, as long as the distance between the polymerase-immobilized regions of the analysis element is larger than the length of the target nucleic acid, the target nucleic acid can be produced in any direction as long as the direction of the liquid flow generated by the liquid feeding means is constant. The distance between the polymerase immobilization regions in the direction of the liquid flow generated by the liquid feeding means is longer than the length.

  Such a liquid feeding means refers to a pump or the like for feeding a solution containing a nucleotide derivative or a cleaning liquid to the analysis element.

The liquid feeding speed generated by the liquid feeding means is preferably such that the synthesized double-stranded DNA overcomes the affinity between the synthesized double-stranded DNA and the substrate and flows in the liquid feeding direction. In addition, it is desirable that it is below the mechanical limit strength of the flow path at such a rate that the synthetic complex of the polymerase immobilized on the support and the synthesized double-stranded DNA does not desorb. From such a point, the liquid feeding speed is preferably 10 to 3000 cm / h, more preferably 150 to 1000 cm / h.
(2-2) Analyzing means The means for analyzing the base type of the nucleotide derivative extended to the primer is an optical evaluation means, electrochemical evaluation means selected according to the structure of the modifying group introduced into the nucleotide derivative, Or it is a magnetic evaluation means.

  Examples of the optical evaluation means include those having a light projecting system-light receiving system such as a spectrophotometer and a fluorometer. When a part of a light transmissive waveguide is used as the sensor member region in the analysis apparatus, the waveguide can be used as a light projecting system.

  Examples of the electrochemical evaluation means include those having both a means for applying a voltage such as a potentiostat and a means for detecting a current. In the analysis apparatus, a counter electrode and a reference electrode are required to apply a voltage and detect a current in the conductor region. The counter electrode and the reference electrode can be prepared in advance in the analysis element, or may be provided on the analysis device side.

  Examples of the magnetic detection means include a Hall element and a magnetoresistive effect element.

(Second form)
In the analysis apparatus of the second form, the base is a porous body, and the shortest distance between the plurality of polymerase immobilization regions in the flow direction of the liquid generated by the liquid feeding means is longer than the length of the target nucleic acid. Instead of being set to be long, the liquid flow generated by the liquid feeding means is the same as in the first embodiment except that the liquid flow is generated in a certain direction across the substrate.

  The sensor member region of the substrate may be present on the surface of the substrate or may be present inside the substrate. Even when the sensor member region is present inside the substrate, the expression that the sensor member region has a polymerase-immobilized region on the surface is used.

  FIG. 9 shows an example of an analysis element when the base has a sensor member region inside.

  The base body 401 is a porous body, and a sensor member region 701 exists inside the base body 401. Such a sensor member region 401 preferably has a narrow rectangular shape or an elliptical shape. Further, the entire porous body that is the substrate may be the sensor member region.

  In addition, when the polymerase is immobilized on the surface of the porous substrate, the pore diameter of the substrate is small for allowing the polymerase or the target nucleic acid to pass through, but allows the nucleoside 5'-triphosphate derivative to pass through. Is preferably large. On the other hand, when the polymerase is fixed inside the substrate, the pores of the substrate are preferably sufficiently large. For example, the average diameter of the holes is preferably 100 nm or more. Examples of such a base material include metals, conductive polymers, metal oxides, carbon materials, and mixtures thereof. Examples of the porous body formed of metal include foam metal, electrodeposited metal, electrolytic metal, sintered metal, and fibrous metal.

  Further, the liquid feeding means included in the analyzing device generates a liquid flow in a certain direction in which the liquid flow generated by the liquid feeding means crosses the substrate. In other words, the analysis element is arranged so that a liquid flow in a certain direction generated by the liquid feeding means crosses the base of the analysis element.

  Since the liquid feeding means generates a liquid flow in a certain direction across the substrate, the double-stranded nucleic acids do not come into contact with each other in the target nucleic acid extension step using the polymerase, as in the first embodiment. , You can avoid interference.

(Third form)
As a third form, the base body has a columnar hole, and the polymerase is fixed to a conductor region that is a part of the wall surface forming the hole.

  Hereinafter, each part which comprises the analyzer which analyzes the base sequence of the target nucleic acid of a 3rd form is demonstrated.

(1) Analysis element Regarding the analysis element used in the target nucleic acid analysis apparatus of the third embodiment, the constituent elements other than the substrate are the same as those of the first embodiment, and therefore only the substrate will be described.
(1-1) Base As shown in the top view of FIG. 4, the base has a through hole. The through holes are not in contact with each other and are spaced from each other.

  The size of the through hole is preferably larger than the larger one of the diameters of one polymerase molecule or double-stranded DNA to be used, and does not exceed twice that. This is because a DNA synthesis complex of two or more molecules of polymerase is not immobilized in each through hole. Specifically, it is preferably 10 nm or more and 50 nm or less.

  The depth of the through hole is not particularly defined, but in the case of a hole that does not penetrate, it is preferable that the length between the polymerase immobilization region and the bottom of the hole is longer than the length of the target nucleic acid. This is because in the case of a non-penetrating hole, if the depth of the hole is shallower than the target nucleic acid, the synthesized double-stranded DNA comes into contact with the bottom surface of the hole.

  A part of the wall surface forming the through hole of the base is constituted by a conductor region. The size of such a conductor region in the depth direction is preferably larger than the diameter of one polymerase molecule and does not exceed twice that.

  Moreover, the analysis element of the third embodiment can be manufactured by the following method, for example.

  First, a conductor material is stacked on a substrate having at least a surface insulating. The insulating substrate is not particularly limited as long as it is insulating, and examples thereof include silicon, aluminum oxide, quartz, glass, ceramic, and plastic. Examples of the conductor material include metals, conductive polymers, metal oxides, and carbon materials. The metal oxide may be improved or imparted with conductivity by another conductor material. Examples of the film forming method include sputtering, CVD (chemical vapor deposition), dipping, MBE, and vapor deposition.

  Subsequently, an insulating member is laminated on the laminated conductor material. The insulating member is not particularly limited as long as it is insulating, and examples thereof include silicon, aluminum oxide, quartz, glass, ceramic, and plastic. Examples of the film forming method include the methods described above.

  Next, the through hole is patterned by, for example, an electron beam drawing apparatus or a focused ion beam processing apparatus. In particular, a structure in which aluminum is used as a substrate and anodized alumina nanoholes are through holes can be produced as follows. That is, by removing the outermost insulating film and the underlying conductor material layer by the patterning step, anodization is performed in an acidic or alkaline electrolyte so that the surface of the aluminum exposed by patterning is changed from the exposed surface to the film surface. On the other hand, fine pores oriented vertically are formed. Next, the back surface of the substrate is mechanically polished to produce a through hole.

  Finally, a polymerase or a synthetic complex composed of a polymerase, a target nucleic acid, and a primer is immobilized on the surface of the exposed conductor region on the side surface of the through hole. Thereby, a base and an analysis element are formed. Examples of the method for immobilizing polymerase on the surface of the conductor region include the methods (1) to (3) described below.

(1) Covalent bonding method A functional group is directly introduced on the surface of the conductor region, and the functional group and the polymerase are covalently bonded to immobilize the polymerase. Alternatively, a functional group is introduced into a carrier immobilized on the conductor region, and the functional group and a polymerase are covalently bonded to immobilize the enzyme.

  Examples of functional groups that can be used for such covalent bonds include hydroxyl groups, carboxyl groups, amino groups, aldehyde groups, hydrazino groups, thiocyanate groups, epoxy groups, vinyl groups, halogen groups, acid ester groups, phosphate groups, and thiol groups. , Disulfide groups, dithiocarbamate groups, dithiophosphate groups, dithiophosphonate groups, thioether groups, thiosulfate groups, and thiourea groups.

  In addition, by utilizing the fact that the thiol group of alkylthiol acts on a metal such as gold and can easily bond to form a monomolecular film (self-assembled monomolecular film), a functional group previously introduced into the alkyl group of alkylthiol The enzyme is immobilized by covalently binding the enzyme to the metal. The covalent bond between the functional group previously introduced into the alkyl group of the alkylthiol and the enzyme can be formed using, for example, a bifunctional reagent.

Typical bifunctional reagents include glutaraldehyde, periodic acid, N, N′-o-phenylene dimaleimide, N-succinimidyl-4- (N-maleimidomethyl) cyclohexane-1-carboxylate, N-succinate. Sinimidylmaleimidoacetic acid, N-succinimidyl-4-maleimidobutyric acid, N-succinimidyl-6-maleimidohexanoic acid, N-sulfosuccinimidyl-4-maleimidomethylcyclohexane-1-carboxylic acid, N-sulfosuccinimi Dil-3-maleimidobenzoic acid, N- (4-maleimidobutyryloxy) sulfosuccinimide sodium salt, N- (6-maleimidocaproyloxy) sulfosuccinimide sodium salt, N- (8-maleimidocapryloxy) sulfosuccinimide Sodium salt, N- (11-maleimide Undecanoyloxy) sulfosuccinimide / sodium salt, N [2- (1-piperazinyl) ethyl] maleimide / dihydrochloride, disulfone compounds (for example, divinylsulfone compounds) and the like.
Examples of the carrier arranged in contact with the conductor region include agarose, agarose degradation product, κ-carrageenan, agar, alginic acid, polyacrylamide, polyisopropylacrylamide, polyvinyl alcohol, and copolymers thereof.

(2) Adsorption method (1)
The polymerase is immobilized by a physical adsorption method using hydrophobic interaction or electrostatic interaction between the conductor region and the polymerase. If physical adsorption of the polymerase to the conductor region is impossible or insufficient, the polymerase can be immobilized via a carrier that causes physical adsorption of the polymerase. As such a carrier, a carrier made of polyanion or polycation such as polyallylamine, polylysine, polyvinylpyridine, dextran modified with an amino group (for example, DEAE-dextran), chitosan, polyglutamate, polystyrene sulfonic acid, dextran sulfate is used. be able to. The polymerase is fixed to the carrier by an ion binding method using electrostatic interaction between the carrier and the polymerase, and this polymerase-immobilized carrier is placed in contact with the conductor region.

(3) Adsorption method (2)
Immobilization is performed using various affinity tags used to facilitate purification of the recombinant protein. For example, the polymerase is immobilized using epitope tags such as HA (hemagglutinin), FLAG, Myc, etc., GST, maltose-binding protein, biotinylated peptide, oligohistidine tag.

  Through the above steps, an analysis element characterized in that the conductor region is arranged on the side surface of the through hole in the substrate having the through hole can be manufactured.

  By providing means for flowing a flow in a certain direction and base type analysis means in such an analysis element, an analysis device of the third form can be obtained.

Examples of the DNA base sequence analysis method using the analysis element include the following steps.
Step 1: A sample containing a complementary binding pair of a target nucleic acid and a primer is added to the analysis element. Thereby, the complementary binding pair of the target nucleic acid and the primer is captured by the polymerase of the analysis element.
Step 2: A nucleotide derivative is allowed to coexist with the polymerase. In this nucleotide derivative, the base moiety is adenine (A), cytosine (C), guanine (G), or thymine (T) (or uracil (U)). The deoxyribose site is modified with a different structure. The structure of this modifying group can be distinguished by optical evaluation means, electrochemical evaluation means, or magnetic evaluation means. In addition, the nucleotide derivative is modified by a different type from the modifying group or the modifying group so that when the base is extended to the 3 ′ end of the primer by the catalytic action of the polymerase, further extension reaction is inhibited. It shall be modified with a group. By this step, a nucleotide derivative having a base complementary to the target nucleic acid at the 3 ′ end of the primer in the complementary binding pair of the target nucleic acid and the primer is extended by one base.
Step 3: If necessary, excess nucleotide derivatives that have not been incorporated into the extension reaction are removed.
Step 4: Based on the structure of the modifying group introduced into the nucleotide derivative, the base type of the extended nucleotide derivative is determined by electrochemical evaluation means or magnetic evaluation means.
Step 5: Remove the modifying group or another modifying group different from the modifying group. After removal, the 3 ′ end of the primer can again undergo an extension reaction catalyzed by polymerase.
By repeating the above steps 2 to 5, the DNA base sequence of the target nucleic acid can be analyzed one by one.

Examples of the DNA base sequence analysis method using the above-described analysis apparatus include a method having the following steps.
Step 1: A sample containing a complementary binding pair of a target nucleic acid and a primer is added to the analyzer. Thereby, the complementary binding pair of the target nucleic acid and the primer is captured by the polymerase of the analyzer. Note that this step can be omitted when the analyzing apparatus includes a complementary binding pair of a target nucleic acid and a primer in advance.
Step 2: A nucleotide derivative is allowed to coexist with the polymerase. In this nucleotide derivative, the base moiety is adenine (A), cytosine (C), guanine (G), or thymine (T) (or uracil (U)). The deoxyribose site is modified with a different structure. The structure of this modifying group can be discriminated by an electrochemical evaluation means or a magnetic evaluation means. In addition, the nucleotide derivative is modified by a different type from the modifying group or the modifying group so that when the base is extended to the 3 ′ end of the primer by the catalytic action of the polymerase, further extension reaction is inhibited. It shall be modified with a group. By this step, a nucleotide derivative having a base complementary to the target nucleic acid at the 3 ′ end of the primer in the complementary binding pair of the target nucleic acid and the primer is extended by one base.
Step 3: If necessary, excess nucleotide derivatives that have not been incorporated into the extension reaction are removed.
Step 4: Based on the structure of the modifying group introduced into the nucleotide derivative, the base type of the extended nucleotide derivative is determined by electrochemical evaluation means or magnetic evaluation means.
Process 5: The process of removing the modification group different from the said modification group or the said modification group. After this step, the 3 ′ end of the primer should again be able to undergo an extension reaction catalyzed by polymerase.
By repeating the above steps 2 to 5, the DNA base sequence of the target nucleic acid can be analyzed one by one.

(4th form)
The fourth embodiment of the present invention will be described below.

The present invention analyzes a base sequence of a target nucleic acid using an analysis element comprising a polymerase, a substrate having a sensor member region on the surface, and a plurality of polymerase-immobilized regions to which the polymerase is immobilized in the sensor member region. An analysis method for
At least in the step of performing the extension reaction of the primer paired with the target nucleic acid by polymerase, an exonuclease specific for double-stranded DNA is allowed to coexist in the reaction solution for performing the extension reaction.

  By using such a method, the synthesized double-stranded DNA coexists in a situation in which the target nucleic acid has been double-stranded by the catalytic action of the polymerase without reducing the immobilization density of the polymerase. Degraded by exonuclease. For this reason, the synthesized double-stranded DNA is prevented from coming into contact with other polymerases or DNA molecules, so that the base sequence of the target nucleic acid can be analyzed.

Specifically, the means for decomposing the synthesized double-stranded DNA can be achieved by the coexistence of a double-stranded DNA-specific exonuclease such as lambda exonuclease or exonuclease III. Lambda exonuclease (EC 3.1.11.3) is an enzyme that acts only on double-stranded DNA and excises nucleoside 5'-phosphate by hydrolysis one base at a time from the 5 'end toward the 3' end. As long as it has such a catalytic action, its origin is not limited. Exonuclease III (EC 3.1.11.2) is an enzyme that acts only on double-stranded DNA and cleaves nucleoside 5'-phosphate by hydrolysis from the 3 'end toward the 5' end one by one. As long as it has such a catalytic action, its origin is not limited.
Since the strand cleaved by lambda exonuclease is a primer strand, the 5 ′ end of the primer needs to be phosphorylated.

The analysis method can be performed, for example, by the following steps.
Step 1: A sample containing a complementary binding pair of a target nucleic acid and a primer is added to the analyzer. Thereby, the complementary binding pair of the target nucleic acid and the primer is captured by the polymerase of the analyzer.
Step 2: A nucleotide derivative is allowed to coexist with the polymerase. In this nucleotide derivative, the base moiety is adenine (A), cytosine (C), guanine (G), or thymine (T) (or uracil (U)). The deoxyribose site is modified with a different structure. The structure of this modifying group can be distinguished by optical evaluation means, electrochemical evaluation means, or magnetic evaluation means. In addition, the nucleotide derivative is modified by a different type from the modifying group or the modifying group so that when the base is extended to the 3 ′ end of the primer by the catalytic action of the polymerase, further extension reaction is inhibited. It shall be modified with a group. By this step, a nucleotide derivative having a base complementary to the target nucleic acid at the 3 ′ end of the primer in the complementary binding pair of the target nucleic acid and the primer is extended by one base.
Step 3: If necessary, excess nucleotide derivatives that have not been incorporated into the extension reaction are removed.
Step 4: The base type of the extended nucleotide derivative is determined by optical evaluation means, electrochemical evaluation means, or magnetic evaluation means, depending on the structure of the modifying group introduced into the nucleotide derivative.
Step 5: Remove the modifying group or another modifying group different from the modifying group. After removal, the 3 ′ end of the primer can again undergo an extension reaction catalyzed by polymerase.
By repeating steps 2 to 5, the DNA base sequence of the target nucleic acid can be analyzed one by one. In the present invention, in particular, in the above step 2, exonuclease coexists in the reaction solution for performing the extension reaction. It is characterized by making it.

  As a matter common to all the examples, a method for quantifying the polymerase immobilized on the sensor member region and a method for measuring the average length (number of bases) of double-stranded DNA synthesized by the polymerase will be described.

A single-stranded target nucleic acid and a primer are added in an appropriate buffer solution to an analysis element in which a polymerase is immobilized on the sensor member region. Primers are designed to hybridize to the target nucleic acid so that the first and second bases adjacent to the 3 ′ extension end are different.
Subsequently, the nucleoside 5′-triphosphate corresponding to the first base to be extended is added.
The nucleoside 5′-triphosphate added in this step is added to the 3 ′ end of the primer, and pyrophosphate is released. After a suitable time has elapsed, the reaction solution is recovered. By adding ATP sulfurylase (EC 2. 7. 7. 4) and Adenylylsulfate to the collected reaction solution, the following reaction:
Pyrophosphate + Adenylylsulfate = ATP + Sulfate
To synthesize ATP.
Furthermore, by adding luciferase (EC 1. 13. 12. 7) and luciferin to this reaction solution, the following reaction is performed:
luciferin + O2 + ATP = oxidized luciferin + CO2 + AMP + diphosphate + hn
To provoke. Using a luminometer, measure the luminescence (L1) associated with this reaction.

  The amount of luminescence (L1) is proportional to the amount of ATP in the reaction solution, which is proportional to the amount of pyrophosphate in the previous reaction solution. Since the amount of pyrophosphate corresponds to the number of nucleotides extended to the 3 ′ end of the primer, the amount of luminescence (L1) is proportional to the amount of immobilized polymerase.

  Subsequently, a mixed solution of four kinds of nucleoside 5′-triphosphates is added to the analysis element to start an extension reaction. After a lapse of an appropriate time, the reaction solution is recovered, and the aforementioned enzyme and substrate are added to lead to a luciferin luminescence reaction, and the luminescence (L2) is measured with a luminometer.

The amount of luminescence (L2) is proportional to the total amount of nucleotides extended up to the point of recovery of the reaction solution.
The following values calculated using the two measured light emission quantities:
(L2 + L1) / L1
Is used as an evaluation method in the following Examples as the average length (base conversion) of double-stranded DNA synthesized by polymerase.

Next, as a matter common to all Examples, a method for preparing a DNA polymerase will be described.
Genomic DNA is obtained from Thermus aquaticus [ATCC 25104] by a conventional method. Using this genomic DNA as a template, PCR is performed using the following synthetic oligo DNA as a primer to obtain a DNA amplification product of 2487 bp.
5'-aataatACCGGTctgcccctctttgagcccaagggccgggtc-3 '(AgeI) [SEQ ID NO: 1], and
5'-aataatGTCGACtcactccttggcggagagccagtcctcccc-3 '(SalI) [SEQ ID NO: 2]
This DNA amplification product is digested and cleaved with restriction enzymes AgeI and SalI, and inserted into the same restriction enzyme site of pET-45b (+) (manufactured by Novagen) to produce the expression vector pET45-TaqDP.
The expression vector pET45-TaqDP is transformed into E. coli BL21 (DE3) according to a conventional method. The transformant can be selected as a resistant strain against the antibiotic ampicillin.

  Transformants are pre-cultured overnight in 10 mL of LB medium supplemented with ampicillin as an antibiotic. Thereafter, 0.2 mL of the resultant is added to 100 mL of LB-Amp medium, and cultured with shaking at 30 ° C. and 170 rpm for 4 hours. Thereafter, IPTG is added (final concentration 1 mM), and the culture is continued at 37 ° C. for 4 to 12 hours. Collect the IPTG-induced transformant (8000 × g, 2 min, 4 ° C) and resuspend in 1/10 volume of 4 ° C PBS. Crush the cells by freeze-thawing and sonication, and centrifuge (8000 xg, 10 min, 4 ° C) to remove solid contaminants. After confirming that the target expressed protein is present in the supernatant by SDS-PAGE, the inducibly expressed His-tag fusion protein is purified using a nickel chelate column.

As a target nucleic acid model to be used in the above measurement method, E. coli-derived genomic DNA (Escherichia coli K-12, ATCC 10798D-5) is used, and the following synthetic oligo DNA is used as a primer.
5'- aaattgaagagtttgatcatggctc -3 '[SEQ ID NO: 3]
Was used. The primer represented by SEQ ID NO: 3 is a sequence complementary to a gene encoding 16S ribosomal RNA, and the base that is first extended to the 3 ′ end is adenine (A).

Example 1
This example is characterized in that a flow barrier is formed between double-stranded target nucleic acids by providing a flow in a certain direction as a means of preventing the extended double-stranded target nucleic acids from interfering with each other. An example will be described. The target nucleic acid used was a fragment obtained by digesting E. coli-derived genomic DNA (Escherichia coli K-12, ATCC 10798D-5) with the restriction enzyme Nru I, and the following synthetic oligo DNA 5'-aaattgaagagtttgatcatggctc-3 '[ SEQ ID NO: 3] is used. The length of the target nucleic acid analyzed by this primer is 1,439 base pairs and about 480 nm.

  FIG. 1 is a schematic view showing a part of the detection element of this embodiment. A channel 102 is formed on the substrate 101, and a waveguide 103 is provided so as to intersect the channel 102. A part of the waveguide 103 is exposed at the bottom surface of the flow path, and is used as a support surface (sensor member region) 104 on which the polymerase is immobilized.

  FIG. 2 is an enlarged schematic view of the support surface 104 portion in FIG. In FIG. 2, on the support surface 104, a polymerase immobilization region 204 and a polymerase non-immobilization region 205 are alternately formed sequentially in the liquid feeding direction. The width of the polymerase immobilization region is 10 to 50 nm, and the polymerase 201 is immobilized thereon. The width of the polymerase non-immobilized region is about 500 nm, and is kept at a distance that does not collide with the downstream polymerase even when the target nucleic acid 202 is double-stranded.

FIG. 3 is a schematic view showing an example of a method for sequentially forming the polymerase immobilization region 204 and the polymerase non-immobilization region 205 on the support surface 104. A resist 301 is applied on the support surface 104, and the polymerase immobilization region 204 is patterned by an electron beam drawing process. Here, 3-mercaptopropyltrimethoxysilane (manufactured by Shin-Etsu Chemical Co., Ltd.) is reacted, and a thiol group is modified on the polymerase immobilization region 204 by silane coupling. Next, Maleimido-C3-NTA (trade name, manufactured by Dojin Chemical Laboratory, chemical name:
N- [5- (3′-Maleimidopropylamido) -1-carboxypentyl] iminodiacetic acid, disodium salt, monohydrate) is reacted to modify the nitrilotriacetic acid group on the polymerase immobilization region 204.
Next, the resist 301 is stripped, and 3-mercaptopropyltrimethoxysilane (manufactured by Shin-Etsu Chemical Co., Ltd.) is reacted therewith to modify a thiol group on the polymerase non-immobilized region 205 by silane coupling. Next, 4-Maleimidobutyric acid (manufactured by Sigma-Aldrich) is reacted to modify the carboxyl group on the polymerase non-immobilized region 205.

  Next, nickel ions are added to modify the nitrilotriacetic acid nickel complex (Ni-NTA) on the polymerase immobilization region 204.

  Finally, a polymerase or a complex consisting of a polymerase, a target nucleic acid and a primer is added, and these are immobilized on the polymerase immobilization region 204 using a histidine tag added to the polymerase.

  In the analysis apparatus of the present embodiment, the polymerase immobilized on the waveguide can be used for the purpose of analyzing the base sequence of the target nucleic acid by the sequencing by synthesis method. An example of the analysis procedure will be described.

  By adding a complementary binding pair of the target nucleic acid and the primer to the polymerase immobilized on the polymerase immobilization region 204, a complex of the polymerase and the complementary binding pair is formed. Next, a nucleoside 5′-triphosphate labeled with a fluorescent substance is added. The nucleoside 5′-triphosphate labeled with a fluorescent substance is selected according to the base type of the target nucleic acid, and has a base complementary thereto and added to the 3 ′ end of the primer. The labeling site of the fluorescent substance is, for example, the 3 ′ hydroxyl group of ribose. When the base is extended by one base, further extension reaction thereafter is stopped.

  Excess nucleoside 5′-triphosphate that was not used for the extension reaction was removed by washing, and then the fluorescence corresponding to the extended base type was obtained by irradiating the excitation light of the fluorescent substance through the waveguide 103. Get as.

  Next, the fluorescent label is removed by acid, alkali, or light irradiation, and the 3 ′ extension terminal is changed to a state capable of extension.

  By repeating the above steps, the base sequence information of the target nucleic acid is obtained. In the extension step of the 3 ′ end of the primer, the average length of the double-stranded DNA to be synthesized is determined depending on whether or not a flow with a linear flow rate of 200 cm / h is generated in the channel 102 using a peristaltic pump. Evaluation is performed using the luminescence reaction of luciferin.

  It is confirmed that the average length (base number conversion) of the double-stranded DNA synthesized by the polymerase is longer than when no flow is performed.

(Example 2)
As in Example 1, this example provides a flow in a certain direction as a means of preventing the extended double-stranded target nucleic acids from interfering with each other, thereby providing a flow barrier between the double-stranded target nucleic acids. It is an example characterized by forming.

  FIG. 6 is a schematic diagram showing the configuration of the analysis element of this example. Polymerase 201 is immobilized on one surface of porous body 401 having conductivity. There is a flow from one side of the porous body 401 to the side on which the polymerase is immobilized, so that the synthesized double-stranded DNA does not collide with other polymerases.

A method for producing an analysis element having the configuration of this example is as follows.
Stainless steel foam metal (Mitsubishi Materials, SUS316L, thickness 0.5mm, gold plating thickness 0.5μm, hole diameter 50μm) cut to 3mm square, washed and dried, then UV ozone treated To make it hydrophilic. Dithiobis (C2-NTA) (trade name, manufactured by Dojin Chemical Laboratory, chemical name:
3,3'-Dithiobis [N- (5-amino-5-carboxypentyl) propionamide-N ', N'-diacetic acid] dihydrochloride)
To modify the surface of the porous body 401 with nitrilotriacetic acid groups. Next, nickel ions are added to modify the surface of the porous body 401 with a nickel complex of nitrilotriacetic acid (Ni-NTA).
Finally, a polymerase or a complex composed of a polymerase, a target nucleic acid, and a primer is added, and these are immobilized on the surface of the porous body 401 using a histidine tag added to the polymerase.

  The analysis element of this example can be used for the purpose of analyzing the base sequence of a target nucleic acid by a sequencing by synthesis method using a polymerase immobilized on a conductor region. An example of the analysis procedure will be described.

By adding a complementary binding pair of the target nucleic acid and the primer to the polymerase immobilized on the conductor region, a complex of the polymerase and the complementary binding pair is formed. Next, a nucleoside 5'-triphosphate labeled with an electrochemically active group is added. The nucleoside 5′-triphosphate labeled with the electrochemically active group is selected depending on the base type of the target nucleic acid, and the one having a complementary base is added to the 3 ′ end of the primer. The electrochemically active group is, for example, a hydrogen atom substituent in the 3 ′ hydroxyl group of ribose. When the base is extended by one base, further extension reaction thereafter is stopped.
After the excess nucleoside 5′-triphosphate that was not used for the extension reaction was removed by washing, the electrochemically active group was electrochemically oxidized or reduced through the conductor region, thereby removing the redox potential from the redox potential. The extended base type is determined.

  Here, with the electrochemical conversion of the electrochemically active group, a reaction for detaching the electrochemically active group is induced, and the 3 ′ extension end may be changed to an extendable state. desirable. By doing so, since the extension reaction is restarted, the base sequence information of the target nucleic acid can be obtained sequentially by repeating the above steps.

  In the step of extending the 3 ′ end of the primer, a flow with a linear flow rate of 200 cm / h is generated from one side of the porous body 401 to the side where the polymerase is immobilized using a peristaltic pump. The average length of the double-stranded DNA synthesized in the case where the flow is generated and the case where the flow is not generated is evaluated using the luminescence reaction of luciferin.

  It is confirmed that the average length (base number conversion) of the double-stranded DNA synthesized by the polymerase is longer than when no flow is performed.

(Example 3)
In this example, an analysis element having a substrate having the following structure will be described as an example of means for preventing the elongated double-stranded target nucleic acids from interfering with each other. That is, the substrate of the analysis element of this example is disposed on the side surface of the through hole in the substrate having the through hole in the conductive region, and the diameter of the through hole is 10 to 50 nm. The thickness in the through-hole depth direction is 10 to 50 nm.

  4 and 5 are schematic views showing the configuration of the detection element of this example. 4 shows a top view of the analysis element, and FIG. 5 shows a cross-sectional view of the element between A and A ′ in FIG. 4. A conductor region 601 is laminated with a thickness of 10 to 50 nm on an insulating substrate 101, and an insulating film 501 is further laminated thereon. A hole is provided through the substrate 101, the conductor region 601, and the insulator region 501, and the complex of the polymerase 201 and the target nucleic acid 202 is immobilized on the exposed side surface of the conductor region 601.

  The structure having this structure is manufactured by patterning a through-hole in a stacked structure of the insulating substrate 101, the conductor region 601, and the insulator region 501 using, for example, an electron beam drawing apparatus or a focused ion beam processing apparatus. be able to.

The procedure for immobilizing the complex of the polymerase 201 and the target nucleic acid 202 on the exposed side surface of the conductor region 601 was as in Example 2 as Dithiobis (C2-NTA) (trade name, manufactured by Dojindo Laboratories, chemical name: 3,3'-Dithiobis [N- (5-amino-5-carboxypentyl) propionamide-N ', N'-diacetic acid] dihydrochloride)
The nitrilotriacetic acid group is modified on the exposed side surface of the conductor region 601. Next, nickel ions are added, and a nickel complex of nitrilotriacetic acid (Ni-NTA) is modified on the exposed side surface of the conductor region 601.

  Finally, a polymerase or a complex consisting of a polymerase, a target nucleic acid, and a primer is added, and these are immobilized on the exposed side surface of the conductor region 601 using a histidine tag added to the polymerase.

  FIG. 7 is a schematic diagram showing the configuration of the analysis apparatus of this embodiment. In this DNA base sequence analyzer, a triode cell is constituted by an analysis element (working electrode), a counter electrode, and a reference electrode, and these are connected to a potentiostat. A function generator for setting the electrode potential and a computer for measurement and data processing are further connected to the potentiostat. The voltage applied to the working electrode is programmed by a function generator and is applied via a potentiostat. The applied voltage and the current value observed at this time are sent to a computer and collected. The computer identifies the type of nucleotide derivative bound to the extended chain, that is, the type of extended base, from the voltage and current values applied to the analysis element.

Example 4
This example is an example of a DNA base sequence analysis method in which an exonuclease specific to double-stranded DNA is allowed to coexist in a reaction solution for performing an extension reaction as a means for preventing the extended double-stranded target nucleic acids from interfering with each other. It is.

FIG. 1 is a schematic diagram showing the overall configuration of the analysis element of this example. A channel 102 is formed on the substrate 101, and a waveguide 103 is provided so as to intersect the channel 102. A part of the waveguide 103 is exposed at the bottom surface of the channel, and is used as the support surface 104 on which the polymerase is immobilized. Unlike Example 1, polymerases are immobilized on the support surface 104 at random. The density of the polymerase immobilized on the support surface 104 is 2.2 × 10 ⁸ molecules / mm ² . E. coli-derived genomic DNA (Escherichia coli K-12, ATCC 10798D-5) as a target nucleic acid model, and the following synthetic oligo DNA as a primer
5'- aaattgaagagtttgatcatggctc -3 '[SEQ ID NO: 3]
Is used.

  The mixture of genomic DNA and primers is sent to the analysis element and captured by the polymerase on the analysis element. The mixture of genomic DNA that was not captured and the primer was removed by sending a buffer solution, and then a buffer solution containing 2 ′ deoxyadenosine-5′-triphosphate was sent to the first 1 Only bases cause an extension reaction. The pyrophosphoric acid liberated by the extension reaction is recovered, and led to the above-mentioned luminescence reaction and quantified to obtain the amount of target nucleic acid / primer complex (L1) captured by the polymerase.

Next, an extension reaction is induced by feeding a mixture of 2 ′ deoxynucleoside-5′-triphosphates composed of four types of bases, adenine, cytosine, guanine and thymine. After a certain period of time, the reaction solution is recovered, and the amount of pyrophosphate released in the light emission reaction is quantified to estimate the amount of target nucleic acid (L2) extended by the polymerase at that time.
Next value calculated using two quantities (L2 + L1) / L1
Is the average length (base conversion) of double-stranded DNA synthesized by polymerase.
When feeding a mixture of 2 ′ deoxynucleoside-5′-triphosphates composed of the above four bases,
The average length of double-stranded DNA to be synthesized is compared depending on whether or not lambda exonuclease (EC 3.1.11.3) coexists.

  In the absence of lambda exonuclease, the average length of the double-stranded DNA synthesized is 150 bases at the polymerase immobilization density. On the other hand, when lambda exonuclease coexists, the average length of double-stranded DNA synthesized is greatly improved to 4500 bases, confirming the effect of coexisting exonuclease during the extension reaction.

It is the schematic which shows the whole structure of the analysis element of a present Example. It is the schematic diagram which expanded the support body surface 104 part in FIG. It is the schematic which showed an example of the method of forming sequentially a polymerase fixed area | region and a polymerase non-immobilized area | region on a support surface. It is the schematic which shows the structure of the analysis element of a present Example. It is the schematic which shows the structure of the analysis element of a present Example. It is the schematic which shows the structure of the analysis element of a present Example. It is the schematic which shows the structure of the analyzer of a present Example. It is a figure which shows the example of the analysis element which the analyzer of a 1st form has. It is a figure which shows the example of the analysis element which the analyzer of a 2nd form has.

Explanation of symbols

101 Substrate 102 Channel 103 Waveguide 104 Support surface 105 Upper cover 201 Polymerase 202 Target nucleic acid 203 Double-stranded DNA
204 Polymerase immobilization region 205 Polymerase non-immobilization region 301 Resist 401 Porous body 501 Insulator region 601 Conductor region 701 Sensor member region

Claims (9)

An analysis device for analyzing the base sequence of a target nucleic acid,
The analysis device is
An analytical element comprising a substrate and a polymerase;
A liquid feeding means for flowing a liquid to the analysis element;
A means for analyzing the base type of the nucleotide derivative extended to the primer by the polymerase,
The base has a sensor member region;
The sensor member region has a plurality of polymerase-immobilized regions on its surface;
The polymerase is immobilized in the polymerase immobilization region;
The width of the polymerase immobilization region is 10 nm or more and 50 nm or less,
The analysis apparatus, wherein the shortest distance between the plurality of polymerase immobilization regions in the flow direction of the liquid generated by the liquid feeding means is set to be longer than the length of the target nucleic acid. An analysis device for analyzing the base sequence of a target nucleic acid,
The analysis device is
An analytical element comprising a substrate and a polymerase;
A liquid feeding means for flowing a liquid to the analysis element;
A means for analyzing the base type of the nucleotide derivative extended to the primer by the polymerase,
The substrate is made of a porous body,
The base has a sensor member region and a plurality of polymerase immobilization regions on the surface of the sensor member region,
The polymerase is immobilized in the polymerase immobilization region;
The analysis apparatus characterized in that the liquid feeding means generates a liquid flow in a certain direction across the substrate. An analysis method for analyzing a base sequence of a target nucleic acid,
An analysis element comprising a polymerase, a substrate having a sensor member region on its surface, and a plurality of polymerase-immobilized regions to which the polymerase is immobilized in the sensor member region includes a complementary binding pair of a target nucleic acid and a primer. Adding a sample; and
Feeding the nucleotide derivative in a direction in which the shortest distance between the polymerase-immobilized regions is longer than the length of the target nucleic acid;
Determining the base type of the nucleotide derivative extended to the primer by the polymerase;
Have
The analysis method, wherein a width of the polymerase immobilization region is 10 nm or more and 50 nm or less. An analysis element for analyzing a base sequence of a target nucleic acid,
The analytical element is
A substrate comprising a conductor region and an insulator region, and a polymerase;
The polymerase is immobilized on a polymerase immobilization region of the conductor region;
The base has a plurality of holes whose depth direction is the thickness direction of the base;
The conductor region forms part of a surface forming the hole;
An analysis element, wherein the diameter of the through hole is 10 nm or more and 50 nm or less.   The analysis element according to claim 4, wherein the hole is a through hole.   The analysis element according to claim 4, wherein the hole is a hole that does not penetrate, and the length of the polymerase-immobilized region and the bottom of the hole is longer than the length of the target nucleic acid. A target nucleic acid analyzer for analyzing a base sequence of a target nucleic acid,
The target nucleic acid analyzer is
The analytical element according to any one of claims 4 to 6,
A liquid feeding means for flowing a liquid to the analysis element;
Means for analyzing the base type of the nucleotide derivative extended to the primer by the polymerase;
A target nucleic acid analyzer characterized by comprising: An analysis method for analyzing a base sequence of a target nucleic acid,
The analysis element according to any one of claims 4 to 6,
Adding a sample comprising a complementary binding pair of a target nucleic acid and a primer;
A step of feeding a nucleotide derivative;
Determining the base type of the nucleotide derivative extended to the primer by the polymerase;
The analysis method characterized by having. An analysis method for analyzing the base sequence of a target nucleic acid using an analysis element comprising a polymerase, a substrate having a sensor member region on its surface, and a plurality of polymerase-immobilized regions to which the polymerase is immobilized in the sensor member region There,
An analysis method characterized in that, in at least a step of performing an extension reaction of a primer paired with the target nucleic acid by a polymerase, an exonuclease specific for double-stranded DNA is allowed to coexist in a reaction solution for performing the extension reaction.

Images