JP2008546775A - Modulation of negative immune regulators and application for immunotherapy - Google Patents

Abstract

  The present invention includes compositions and methods for enhancing immune capacity of immune cells using inhibition of negative immune modulators within the cells. The present invention provides vaccines and therapies in which antigen presentation is enhanced through inhibition of negative immune regulators. The present invention also provides a mechanism for breaking self-tolerance in tumor vaccination methods that rely on presentation of self-tumor antigens.

Description

  Inappropriate antigen presentation and activation in innate and adaptive immunity in humans results in damage to the human immune system that controls and eliminates many pathogenic infections and malignant cell growth. Effective therapeutic vaccines and immunotherapy for chronic infections and cancers will develop new approaches to efficient means of eliciting an active immune response with the ability to control and clear off aggressive antigens associated with its pathology It depends.

  The ability of a T cell to recognize an antigen depends on the association of the antigen with either the major histocompatibility complex (MHC) I or MHCII protein. For example, cytotoxic T cells respond to antigens that are presented in association with MHC-I protein. Thus, cytotoxic T cells that should kill virus-infected cells will not kill the cells if they do not express the appropriate MHC-I protein. Helper T cells recognize MHC-II. Helper T cell activity generally depends on both antigen recognition on antigen presenting cells and the presence of “self” MHC-II protein on these cells. The prerequisite for recognition of antigens associated with self MHC proteins is called MHC restriction. MHC-I protein is found on the surface of almost all nucleated cells. MHC-II protein is found on the surface of certain cells, including Langerhans cells of the skin and splenic dendritic cells, B cells and macrophages.

  A critical step in initiating an immune response in a mammal is the activation of CD4 + helper T cells that recognize MHC-II restricted exogenous antigens. These antigens are captured and processed in the cellular endosomal pathway within antigen-presenting cells such as dendritic cells (DC). Within endosomes and lysosomes, the antigen is processed into small antigen peptides that are complexed on MHC-II in the Golgi fraction to form antigen-MHC-II complexes. These complexes are expressed on the cell surface and this expression triggers activation of CD4 + T cells.

  Other critical events in the induction of an effective immune response in mammals involve CD8 + T cell and B cell activation. CD8 + cells are activated when the desired protein is delivered through the cell in such a way that it is presented on the cell surface as a processed protein complexed with the MHC-I antigen. B cells can interact with antigen via surface immunoglobulin (IgM and IgD) without the need for MHC proteins. However, activation of CD4 + T cells stimulates all arms of the immune system. At the time of activation, CD4 + T cells (helper T cells) produce interleukins. These interleukins help activate the other arms of the immune system. For example, helper T cells are interleukin-4 (IL-4) and interleukin-5 (IL-5) that help B cells produce antibodies; interleukin-2 (IL that activates CD4 + and CD8 + T cells. -2); and produces gamma interferon that activates macrophages. Helper T cells that recognize MHC-II restricted antigens respond to antigens because they play a central role in the activation and clonal expansion of cytotoxic T cells, macrophages, natural killer cells and B cells. The initial event of activating helper T cells is crucial for the induction of an effective immune response directed against the antigen. Attempts have been reported to stimulate helper T cell activity using sequences derived from lysosomal transmembrane proteins. However, these attempts did not result in the induction of an effective immune response for CD8 + T cells and B cells in the mammal being tested.

In addition to the critical role played by T cells in the immune response, DC is equally important. D
C is a specialized antigen-presenting cell that plays a major regulatory role in maintaining tolerance to self-antigens and activating innate and adaptive immunity (Non-patent Documents 1 and 2). When DC encounters a pro-inflammatory stimulus such as a microbial product, the cell maturation process is initiated by upregulating antigen peptide-loaded MHC molecules and costimulatory molecules expressed on the cell surface. After maturation and return to the local lymph node, the DC establishes contact with the T cell by forming an immunological synapse, where the T cell receptor (TCR) and costimulatory molecules are centrally surrounded by adhesion molecules. It gathers in the area (Non-Patent Document 3). Once activated, CD8 + T cells proliferate autonomously for several generations and acquire a cytotoxic function without further antigen stimulation (Non-patent Documents 4 and 5). Thus, the level and duration of peptide MHC complexes (signal 1) and costimulatory molecules (signal 2) provided by DCs are essential for determining the magnitude and fate of antigen-specific T cell responses (non- Patent Document 6, Non-Patent Document 7).

  Antigen presenting cells (APC) such as dendritic cells (DC) and macrophages play an important role in the activation of innate and adaptive immunity and in maintaining immunological tolerance. The mechanism by which APC detects pathogens and initiates an immune response has been well studied over the past few years. APC uses pattern recognition receptors such as Toll-like receptors (TLRs) to recognize conserved pathogen structures such as lipopolysaccharide (LPS), unmethylated bacterial DNA (CpG) and RNA. TLRs belong to the TIR (Toll / Interleukin-1 (IL-1) receptor) superfamily, which is subdivided into two major subgroups: the IL-1 receptor and the TLR. TLR consists of 11 members (TLR1 to TLR11). All members of this superfamily are members of a conserved cytosolic TIR domain that activates common signaling pathways, particularly signaling pathways that lead to activation of transcription factor nuclear factor-κB (NFκB) and stress-activated protein kinases. Signaling similarly due to presence. NF-κB activation is by secreting pro-inflammatory cytokines such as tumor necrosis factor (TNF), IFN, interleukin 1 (IL-1), IL-6, and IL-12 or CD80, CD86 and By expressing a costimulatory molecule such as CD40, it acts as a catalyst for the immune response. TNF family members such as TNFα and CD40L interact with their receptors or ligands and activate NF-κB as well.

  Great research efforts to develop tumor vaccines have been attempted with the aim of promoting DC maturation and costimulation as a means to enhance anti-tumor immunity. However, induction of immunity against self-tumor associated antigens (TAA) is limited by inherent inhibition mechanisms, and many of these mechanisms have not yet been defined. By cytotoxic T lymphocyte antigen 4 (CTLA4) and related molecules on T cells to control the magnitude of effector T cell activity via cell-cell contact with B7 family molecules on DCs or other cells Known inhibition mechanisms are utilized. DC maturation serves as a critical switch from maintaining self tolerance to immune induction. However, it remains unclear whether mature antigen-presenting DCs have a negative immune regulatory mechanism that allows the size and duration of adaptive immunity to be controlled beyond the maturity point.

Although much attention has been focused on pro-inflammatory signaling, little is known about the mechanisms that suppress and resolve inflammation. The magnitude and duration of the immune response initiated by the TLR is determined by the intensity and duration of pro-inflammatory signaling and modulation of signaling pathways. Since TLR-induced activation of the transcription factor NF-κB is essential for transcription of many pro-inflammatory genes, TLR signaling at multiple levels is protected to protect the host from excessive immune responses such as septic shock. A number of mechanisms have been utilized to negatively regulate and maintain immune homeostasis in conditions of chronic pathogen exposure such as the intestinal microenvironment. Negative immune regulators of the TLR signaling pathway include IRAK-M, MyD88s, PI3K, TOLLIP, A20, TRIAD3A, NOD2, and soluble TLR
Membrane-bound molecules containing TIR domains such as 2/4 and SIGRR and ST2 are included (Non-patent Document 8).

  Cytokines are critically involved in the regulation of many immune cell functions (Non-patent Documents 9 and 10). DCs promote Toll maturation by activating nuclear factor-κB (NF-κB) signaling pathways, and thus toll-like receptors (TLRs) that recognize conserved pathogenic structures such as lipopolysaccharide (LPS) Used (Non-patent Document 11). At this time, the NF-κB member mediates the expression of proinflammatory cytokines such as IL-12 (Non-Patent Document 11, Non-Patent Document 12, and Non-Patent Document 13). Following DC maturation, cytokine production and intracellular signaling pathways appear to be closely regulated to promote a beneficial immune response against foreign antigens while limiting excessive autoimmune activation. However, the importance of specific feedback inhibition mechanisms for these pathways and the resulting control of the autoantigen-specific immune response remains largely undefined.

  SOCS1 is a negative feedback regulator capable of inducing signaling by various cytokines including interferon (IFN) -g, interleukin (IL) -2, IL-6, IL-7, IL-12 and IL-15 (Non-Patent Document 14, Non-Patent Document 15). SOCS1 inhibits multiple signal transducers and activators of the transcriptional (STAT) signaling pathway by binding upstream activation loops of Janus kinase (JAK) as pseudosubstrate inhibitors and / or targeting JAK for proteasomal degradation ( Non-patent document 14, Non-patent document 15). SOCS1 similarly blocks NF-κB signaling by targeting the p65 protein for ubiquitin-mediated proteolysis through its SOCS box region (16). SOCS1-deficient (− / −) mice die as neonates with abnormal activation of T and NKT cells and significant systemic inflammation, mainly as a result of uncontrollable cytokine signaling (Non-patent Document 17, Patent Document 18, Non-Patent Document 19). Although little is known about the function of SOCS1 in DC, recent studies suggest a role for SOCS1 in controlling signaling in antigen-presenting cells (APC) (Non-Patent Document 14, Non-Patent Document 14, Patent Document 20). Expression of SOCS1 in macrophages is induced by LPS or CpG-DNA stimulation, and SOCS1-/-mice are more sensitive to LPS-induced shock than their wild-type littermates (Non-Patent Document 21, Non-patent document 22, Non-patent document 23, Non-patent document 24). In addition, SOCS1-/-DC derived from mice whose SOCS1 expression is restored in T and B cells on SOCS1-/-background are hyperreactive to IFNγ and LPS and show allogeneic cell expansion. Initiate and induce abnormal expansion of B cells and production of autoreactive antibodies (Non-patent Document 20).

  Little is known about the role of SOCS1 in DCs, but recent studies have demonstrated the role of SOCS1 in regulating cytokine signaling pathways. For example, it was observed that SOCS1-/-DC showed a more mature phenotype and was overreactive with lipopolysaccharide (LPS) interacting with Toll-like receptor (TLR) 4 for signaling It has been proven. Similar observations were that SOCS1-/-DC induced autoreactive antibody production. These observations suggested a possible role for SOCS1 in the negative regulation of DCs, possibly by controlling the JAK / STAT pathway and TLR / NF-κB pathway.

Banchereau et al., 1998, Nature 392: 245-52. Steinman et al., 2003, Annu. Rev. Immunol. No. 21: 685-711 Dustin et al., 2000, Nat. Immunol. Issue 1: Pages 23-9 Kaech et al., 2001, Nat. Immunol. Issue 2: Pages 415-22 Van Stipdonk et al., 2001, Nat. Immunol. Issue 2: Pages 423-9 Lanzavecchia et al., 2001, Nat. Immunol. No. 2: pages 487-92; Gett et al., 2003, Nat. Immunol. Issue 4: Pages 355-60 Nat Rev. Immunol. No. 5: 446, 2005 Kurtsinger et al., 2003, J. Am. Exp. Med. 197: 1141-51; Valenzuela et al., 2002, J. MoI. Immunol. No. 169: 6842-9 Akira et al., 2004, Nat. Rev. Immunol. Issue 4: Pages 499-511 Beutler et al., 2003, Nat. Rev. Immunol. Issue 3: Pages 169-76 Janeway et al., 2002, Annu. Rev. Immunol. No. 20: 197-216 Kubo et al., 2003, Nat. Immunol. Issue 4: 1169-76 Alexander et al., 2004, Annu. Rev. Immunol. No. 22: 503-29 Ryo et al., 2003, Mol. Cell. No. 12: 1413-26 Marine et al., 1999, Cell 98: 609-16. Alexander et al., 1999, Cell 98: 597-608. Naka et al., 2001, Immunity 14: 535-45. Hanada et al., 2003, Immunity 19: 437-50 Crespo et al., 2000, Biochem. J. et al. 349: 99-104 Dalpke et al., 2001, J. MoI. Immunol. No. 166: 7082-9 Nakagawa et al., 2002, Immunity 17: 677-87. Kinjoo et al., 2002, Immunity 17: 583-91.

Numerous attempts have been made to use DC in immunotherapy to stimulate an immune response in the mammalian body. In these research efforts, DCs have been engineered by loading it with antigen and allowing them to mature under ex vivo conditions, thus stimulating antitumor immunity in the body of cancer patients. Regarding the use of immunotherapy to eradicate human immunodeficiency virus (HIV), no effective human immunodeficiency virus (HIV) vaccine has yet emerged. Thus, the art has long recognized a need for an efficient and direct means of eliciting an immune response for the treatment of disease in mammals. The present invention satisfies this need.

  The present invention includes a composition for enhancing the immune capacity of immune cells. Preferably, the composition comprises an inhibitor of a negative immune modulator. In one aspect, the negative immunomodulator induces the expression of proteins and NFκB inhibitors involved in molecular stability by ubiquitination, deubiquitination and sumoylation or represses transcription of NFκB target genes Selected from the group consisting of transcription factors, or any combination thereof.

  In one aspect, the negative immune regulator involved in molecular stability by ubiquitination, deubiquitination and sumoylation is selected from the group consisting of A20 and SUMO (SUMO1, SUMO2, SUMO3, SUMO4). In another embodiment, the negative immune regulator that forms part of a family of transcription factors that repress transcription of NFκB target genes or induce expression of inhibitors of NFκB and repress transcription of NFκB target genes is Twist -1, Twist-2, Foxj1, Foxo3a, and variants thereof.

  The present invention is also a suppressor of cytokines in which negative immune regulators signal (SOCS), and SOCS is SOCS1, SOCS2, SOCS3, SOCS4, SOCS5, SOCS6, SOCS7 and cytokine-induced SH2-domain-containing proteins ( Also included are inhibitors of negative immune modulators selected from the group consisting of (CIS).

  In another aspect, the invention includes an inhibitor of SH2-containing phosphatase (SHP), wherein the SHP is selected from the group consisting of SHP-1 and SHP-2.

  In a further aspect, the present invention comprises a protein inhibitor of activated STAT (PIAS), wherein PIAS is selected from the group consisting of PIAS1, PIAS3, PIASx and PIASy.

  In one aspect, the negative immune modulator is A20, SUMO (SUMO1, SUMO2, SUMO3, and SUMO4), Foxj1, Foxo3a, TWIST (Twist1, Twist2), SOCS (SOCS1, SOCS2, SOCS3, SOCS4, SOCS5, SOCS5, SOCS5, SOCS5 , SOCS7, and CIS), PIAS (PIAS1, PIAS3, PIASx and PIASy), SHP (SHP-1 and SHP-2), and the like.

  In one particular embodiment, the inhibitor consists of small interfering RNA (siRNA), microRNA, antisense nucleic acid, ribozyme, expression vector encoding transdominant negative mutant, intracellular antibody, peptide and small molecule. Selected from the group. Preferably, the inhibitor is siRNA.

  In a further aspect, the siRNA is selected from the group consisting of a double stranded oligonucleotide, a single stranded oligonucleotide and a polynucleotide.

  In yet another embodiment, the siRNA is chemically synthesized.

  Another embodiment of the invention includes a composition comprising an inhibitor of a negative immune modulator, further comprising a physiologically acceptable carrier. Preferably, the physiologically acceptable carrier is a liposome.

  In another embodiment, the negative immune modulator inhibitor is encoded by an isolated polynucleotide cloned into an expression vector. The expression vector is selected from the group consisting of plasmid DNA, viral vector, bacterial vector and mammalian vector. In another embodiment, the expression vector further comprises an integration signal sequence that facilitates integration of the isolated polynucleotide into the genome of the host cell.

  The present invention also includes a composition for enhancing the immunity of immune cells, further comprising at least one epitope. Preferably, the epitope is capable of eliciting an immune response in the mammalian body. In another aspect, the epitope elicits a CD4 + T cell response in the mammalian body. In yet another aspect, the epitope elicits a CD8 + T cell response in the mammalian body. In a further aspect, the epitope elicits a B cell response in the mammalian body.

  In another embodiment, the antigen is expressed by an expression vector. In a further aspect, the antigen is an isolated polypeptide.

  In yet another embodiment, the antigen is associated with one disease. Preferably, the disease is selected from the group consisting of infectious diseases, cancer and autoimmune diseases.

  In one aspect, the infectious disease is caused by a pathogenic microorganism selected from the group consisting of viruses, bacteria, fungi and protozoa.

  In another embodiment, the antigen is encoded by a viral gene. Preferably, the viral gene is derived from a virus selected from the group consisting of hepatitis B virus, hepatitis C virus, human immunodeficiency virus, papilloma virus and herpes virus.

  In one aspect, the antigen is encoded by a viral gene selected from the group consisting of hepatitis B virus e antigen gene, hepatitis B virus surface antigen gene and hepatitis B virus core antigen gene.

  In another embodiment, the antigen is encoded by a viral gene selected from the group consisting of human immunodeficiency virus Env gp160 gene, Gag gene, Pol gene, Rev gene, Tat gene, Vif gene and Nef gene.

  In a further aspect, the antigen is encoded by a viral gene selected from the group consisting of papilloma virus E7 gene and papilloma virus E6.

  In yet another embodiment, the antigen is from type 1 herpes simplex virus, type 2 herpes simplex virus, Epstein-Barr virus, cytomegalovirus, human herpes virus type 6, human herpes virus type 7 and human herpes virus type 8. It is encoded by a viral gene derived from a herpesvirus selected from the group.

  In one embodiment, the antigen is associated with cancer, wherein the cancer is selected from the group consisting of breast cancer, cervical cancer, melanoma, kidney cancer and prostate cancer.

  In a further aspect, the tumor associated antigen is an overexpressed tumor associated antigen, testis-tumor antigen, mutant tumor associated antigen, differentiated tumor associated antigen tyrosinase, MART, trp, MAGE-1, MAGE-2, MAGE-3 , Gp100, HER-2, Ras and PSA.

  In yet another embodiment, the tumor associated antigen is BCR-ABL, CASP, CDK, Ras, p53, HER-2 / neu, CEA, MUC, TW1, PAP, survivin, telomerase, EGFR, PSMA, PSA, PSCA , Tyrosinase, MART, TRP, gp100, MART, MAGE, BAGE, GAGE, LAGE / NY-ESO, RAGE, SSX-2, CD19 and CD20.

  In another embodiment, the antigen is associated with a disease selected from the group consisting of rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, psoriasis and Crohn's disease.

  The present invention also includes a composition comprising an antigen having at least one epitope capable of eliciting an immune response and an inhibitor of a negative immune modulator, and further comprising a cytokine. Preferably, the cytokine is an isolated polypeptide. In another aspect, the cytokine is from IL-12, TNFα, IFNα, IFNβ, IFNγ, IL-7, IL-1, IL-2, IL-6, IL-15, IL-21 and IL-23. Selected from the group consisting of

  The present invention also includes a composition comprising an antigen having at least one epitope capable of eliciting an immune response and an inhibitor of a negative immune modulator and further comprising a toll-like receptor (TLR) agonist. Including. In one aspect, the TLR agonist is expressed by an expression vector. Preferably, the TLR agonist is an isolated polypeptide.

  The invention also includes a composition comprising an inhibitor of a negative immunomodulator, wherein the inhibitor suppresses Janus kinase (JAK) signaling inhibition.

  In another embodiment, a composition comprising an inhibitor of a negative immune regulator suppresses inhibition of Toll-like receptor (TLR) signaling.

  In yet another embodiment, a composition comprising an inhibitor of a negative immune modulator inhibits inhibition of NF-κB signaling.

  The present invention relates to a composition for enhancing the immunity of a cell, the first polynucleotide encoding an inhibitor that inhibits a negative immune regulator in the cell, and an immune response in a mammalian body. And a composition comprising a second polynucleotide encoding an antigen having at least one epitope.

  The present invention also provides a composition for enhancing the immunity of a cell, comprising: a first polynucleotide encoding an inhibitor that inhibits negative IRM in the cell; and a second polynucleotide encoding a cytokine. Also included is a composition comprising a vector comprising. Preferably, the second polynucleotide encoding a cytokine is from IL-12, TNFα, IFNα, IFNβ, IFNγ, IL-7, IL-2, IL-6, IL-15, IL-21 and IL-23 Selected from the group consisting of

The invention also includes a cell comprising an inhibitor of a negative immune regulator. Preferably, the cell is an immune cell selected from the group consisting of APC, dendritic cells, monocytes / macrophages, T cells and B cells.

  In another embodiment, the cell further comprises an antigen having at least one epitope, wherein the at least one epitope is capable of eliciting an immune response in the mammalian body.

  In yet another embodiment, the cell further comprises an expression vector comprising a polynucleotide encoding a cytokine.

  The invention also includes a method of generating a silenced cell comprising contacting the cell with an inhibitor of a negative immune modulator.

  In another embodiment, the present invention provides a method of producing a cell that has been silenced and pulsed, wherein the step of contacting the cell with a negative immunomodulator and further comprising the cell in the body of a mammal. Contacting with an antigen having at least one epitope capable of eliciting an immune response.

  The present invention also includes a method of eliciting an immune response in a mammalian body, comprising the step of administering a composition comprising an inhibitor of a negative immune modulator to the body of the mammal in need thereof. Including the method.

  Another embodiment of the invention is a method of eliciting an immune response in a mammalian body, comprising administering a composition comprising silenced cells in the mammalian body in need thereof Also included is a method comprising a step, wherein the silenced cell comprises an inhibitor of a negative immune modulator. Preferably, the silenced cell is contacted with the antigen in vitro prior to administering the silenced cell into the body of a mammal in need thereof. In another embodiment, the silenced cells can be contacted with the antigen in vivo after administration of the silenced cells into the mammal in need thereof.

  For the purpose of illustrating the invention, there are shown in the drawings several embodiments of the invention. However, the invention is not limited to the precise arrangement and means of the embodiments depicted in the drawings.

Detailed description

  The present invention relates to enhancing the immune capacity of immune cells by modulating negative immune regulators in immune cells. The present invention provides compositions and methods for modulating antigen presentation in immune cells by modulating negative immune regulators. Negative immune regulators are involved in inhibitory homologues of proteins involved in signal transduction (eg soluble decoy TLR, inhibitory TIR homologues, inhibitory signaling molecule isoforms, inhibitory cytokine homologues, etc.), molecular stability Protein, inhibitory component of signaling molecule complex, protein involved in regulation of signaling molecule phosphorylation, transcription factor that suppresses transcription of NFκB target gene, protein involved in regulation of RNA translation and stability, cytokine signaling It can belong to different protein families, including but not limited to regulatory factors.

The present invention provides vaccines and therapies in which the immune capacity of immune cells is enhanced by modulation of negative immune regulators. Furthermore, the present invention also provides a mechanism for breaking self-tolerance in tumor vaccine contact. Thus, the present invention relates to negative immune regulators of proinflammatory signaling pathways such as TLR-, TNFR-mediated signaling and cytokine receptor-mediated JAK / STAT signaling within immune cells by enhancing the immune stimulatory capacity of the cells Provides the therapeutic benefits of interfering with

Definitions As used in this document, each of the following terms has its meaning associated with it in this section.

  The articles “a” and “an” are used herein to mean one or more (ie at least one) of the grammatical objects of the article. By way of example, “an element” means one element or more than one element.

  The term “about” is understood by one of ordinary skill in the art and will vary somewhat depending on the context in which it is used.

  The term “homologous” means grafts from different animals of the same species.

  An “alloantigen” is an antigen that is different from the antigen expressed by the recipient.

As used herein, the term “antigen” refers to an immunoglobulin molecule capable of specifically binding to a particular epitope on an antigen. The antibody can be an intact immunoglobulin derived from a natural source or a recombinant source, and can be an immunoactive portion of an intact immunoglobulin. An antibody is typically a tetramer of immunoglobulin molecules. The antibodies in the present invention may exist in various forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F (ab) ₂ and single chain antibodies and humanized antibodies (Harlow et al., 1988). Houston et al., 1988; Bird et al., 1988).

  The term “antigen” or “Ag” as used herein is defined as a molecule that provokes an immune response. This immune response involves antibody production and immunologically competent cells or both. One skilled in the art will understand that any macromolecule, including almost any protein or peptide, can serve as an antigen. Furthermore, the antigen can be derived from recombinant or genomic DNA. Those skilled in the art will understand that any DNA comprising a nucleotide sequence or partial nucleotide sequence encoding a protein that elicits an immune response thus encodes an “antigen” as used herein. right. Furthermore, those skilled in the art will also understand that the antigen need not be encoded solely by the full-length nucleotide sequence of the gene. The present invention includes, but is not limited to, the use of partial nucleotide sequences of two or more genes, and these nucleotide sequences are arranged in various combinations to elicit the desired immune response. It is immediately obvious. Moreover, those skilled in the art will appreciate that the antigen need not be encoded by a “gene” at all. It will be readily apparent that the antigen can be produced in synthetic form or otherwise derived from a biological sample. Such biological samples can include, but are not limited to, tissue samples, tumor samples, cells or body fluids.

  An “antigen-presenting cell” (APC) is a cell that has the ability to activate T cells and includes, but is not limited to, monocytes / macrophages, B cells and dendritic cells (DC).

The term “dendritic cell” or “DC” means any member of various populations of morphologically similar cell types found in lymphoid or non-lymphoid tissues. These cells are characterized by their unique morphology, high levels of surface MHC-class II expression. DC can be isolated from a number of tissue sources. DC has a high ability to sensitize MHC-restricted T cells and is very effective at presenting antigens to T cells in situ. Antigens can be self-antigens expressed during T cell development and tolerance and foreign antigens present during normal immune processes.

  As used herein, an “activated DC” is a DC that has the ability to activate immune cells in response to a pulse with an antigen.

  The term “mature DC” as used herein is defined as dendritic cells that express high levels of MHC class II, CD80 (B7.1) and CD86 (B7.2) molecules. In contrast, immature dendritic cells express low levels of MHC class II, CD80 (B7.1) and CD86 (B7.2) molecules, but have a great ability to take up antigens.

  “APC under antigen loading” or “APC under antigen pulse” includes APCs that have been exposed to and activated by an antigen. For example, APC can become Ag loaded in vitro, for example during culture in the presence of antigen. APC can also be loaded in vivo by exposure to an antigen.

  An “antigen-loaded APC” is conventionally prepared in one of two ways: (1) A small peptide fragment known as an antigenic peptide is “pulsed” directly outside the APC; or (2) APC is incubated with total protein or protein particles, and these proteins are then taken up by APC, which are digested by APC into small peptide fragments and possibly presented on the APC surface. An APC loaded with an antigen can also be produced by a polynucleotide encoding the antigen in a cell.

  As used herein, the term “silenced APC” or “silenced DC” refers to inhibitors of negative immune regulators (otherwise known as inhibiting negative immune regulators). It means APC or DC, respectively, that is exposed and thus negative immune modulators will be associated with modulation of the immune response. Inhibitors are TLR, RP105, SIGIRR, ST2, NOD2, MyD88s, IRAK (IRAKM, IRAK1, IRAK2), IRF-4, FLN29, TWEAK, TRIAD3A, CYLD, Cbl, A20, SUMO (SUMO1, SUMO4, SUMO3, SUMO3, SUMO3, SUMO3, SUMO3, SUMO3, SUMO3 , IkB protein, MKPs, Foxj1, Foxo3a, TWIST (Twist1, Twist2), Roquin, Dok (Dok-1, Dok-2), PI3K, prostaglandin, TRAIL-R, arrestin, TOLLIP, SOCS (SOCS1, SOCS2, SOCS1, SOCS1) SOCS3, SOCS4, SOCS5, SOCS6, SOCS7 and CIS), PIAS (PIAS1, PIAS3, PIASx and PIASy), SHP (SHP -1 and SHP-2) and the like, and has the ability to inhibit any negative immunomodulator disclosed herein. Silenced APCs have enhanced immune capacity compared to otherwise identical APCs that have not been treated with inhibitors of negative immune regulators.

  “Antisense” specifically refers to the nucleic acid sequence of the non-coding strand of a double-stranded DNA molecule encoding a polypeptide, or a sequence that is substantially homologous to the non-coding strand. As defined herein, an antisense sequence is complementary to the sequence of a double-stranded DNA molecule that encodes a polypeptide. The antisense sequence need not be complementary only to the coding portion of the coding strand of the DNA molecule. The antisense sequence is complementary to the regulatory sequences identified on the coding strand of the DNA molecule encoding the polypeptide that control the expression of the coding sequence.

  The term “autoimmune disease” as used herein is defined as a disorder resulting from an autoimmune response. Autoimmune diseases are the result of inappropriate and excessive responses to self antigens. Examples of autoimmune diseases include Addison's disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune parotitis, Crohn's disease, diabetes (type I), dystrophic epidermolysis bullosa, testis Epidermitis, glomerulonephritis, Graves' disease, Guillain-Barre syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, Examples include, but are not limited to, sarcoidosis, scleroderma, Sjogren's syndrome, spondyloarthritis, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia, and ulcerative colitis.

  As used herein, the term “autologous” is intended to mean any material derived from the same individual that is to be subsequently reintroduced into the individual.

  The term “cancer” is defined herein as a disease characterized by rapid and uncontrolled growth of abnormal cells. Cancer cells can spread to other parts of the body locally or through the bloodstream and lymphatic system. Examples of various cancers include breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain tumor, lymphoma, leukemia, lung cancer, etc. It is not limited.

  The term “cytokine signaling regulator” or “regulator of cytokine signaling” or “regulator of cytokine signaling” means a protein that has the ability to negatively regulate the cytokine signaling pathway in one cell. Modulators of cytokine signaling include suppressors of cytokine signaling (SOCS1-SOCS7, cytokine-inducible SH2-domain containing protein (CIS)), SHS-containing phosphatase (SHP), and activated STAT protein inhibitors (PIAS) Including, but not limited to.

  The term “DNA” as used herein is defined as deoxyribonucleic acid.

  By “donor antigen” is meant an antigen expressed by donor tissue to be transplanted into a recipient.

  The term “recipient antigen” means a target for an immune response against a donor antigen.

  As used herein, “effector cell” refers to a cell that mediates an immune response against an antigen. Examples of effector cells include, but are not limited to, T cells and B cells.

The term “encode” refers to either a defined nucleotide sequence (ie, rRNA, tRNA and mRNA) or a defined amino acid sequence possessed by a particular sequence of nucleotides within a polynucleotide, such as a gene, cDNA or mRNA. It refers to the unique properties of serving as a template for the synthesis of other polymers and macromolecules in the biological process and the resulting biological properties. Thus, a gene encodes a protein when transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand having the nucleotide sequence identical to the mRNA sequence and usually provided in the list of sequences and the non-coding strand used as a template for transcription of the gene or cDNA are proteins of that gene or cDNA Or it may be mentioned as encoding other products.

  As used herein, “endogenous” refers to any material derived from or produced within a living organism, cell, tissue or system.

  As used herein, the term “exogenous” refers to any material that is introduced from or produced outside a living organism, cell, tissue, or system.

  The term “epitope” as used herein is defined as a small chemical molecule on an antigen that can elicit an immune response and elicit a B and / or T cell response. An antigen can have one or more epitopes. Most antigens have many epitopes. That is, it is multivalent. In general, an epitope is approximately 5 amino acids and / or sugars in size. One skilled in the art understands that generally an overall three-dimensional structure, rather than a specific linear array of molecules, is the primary measure of antigen specificity and thus distinguishes epitopes.

  The term “expression” as used herein is defined as the transcription and / or translation of a particular nucleotide sequence driven by its promoter.

  As used herein, the term “expression vector” refers to a vector that contains a nucleic acid sequence that encodes at least a portion of a transcribable gene product. In some cases, the RNA molecule is then translated into a protein, polypeptide or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules, siRNA, ribozymes and the like. An expression vector may contain various control sequences that refer to the nucleic acid sequences necessary for transcription and optionally translation of the operably linked coding sequence in a particular host organism. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well.

  The term “helper T cells” as used herein is defined as effector T cells whose primary function is to promote the activation and function of other B and T lymphocytes and / or macrophages. Most helper T cells are CD4 T cells.

  The term “heterologous” as used herein is defined as a DNA or RNA sequence or protein derived from a different species.

  As used herein, the term “homologous” refers to subunit sequence similarity between two polymer molecules, eg, two nucleic acid molecules, eg, between two DNA molecules or two RNA molecules or between two polypeptide molecules. means. If the subunit position is occupied by the same monomer subunit in both two molecules, for example if one position in each of the two DNA molecules is occupied by adenine, they are homologous at that position. is there. Homology between two sequences is directly proportional to the number of matching or homologous positions, eg, half of the positions in the two compound sequences (eg, 5 positions in a 10 subunit long polymer) are homologous In some cases, two sequences are 50% homologous, and if 90% of the positions, eg, 9 out of 10, are matched or homologous, the two sequences share 90% homology. As an example, the DNA sequences 3'ATTGCC5 'and 3'TATGGC share 50% homology.

  As used herein, “homology” is used interchangeably with “identity”.

  As used herein, “immunogen” means a substance capable of stimulating or inducing a humoral antibody and / or a cell-mediated immune response in a mammalian body.

  As used herein, the term “immunoglobulin” or “Ig” is defined as a type of protein that functions as an antibody. The five members included in this protein class are IgA, IgG, IgM, IgD and IgE. IgA is the primary antibody present in bodily secretions such as saliva, tears, breast milk, gastrointestinal secretions, and mucous secretions of the respiratory tract and urogenital tract. IgG is the most common circulating antibody. IgM is the major immunoglobulin produced in the primary immune response in most mammalian bodies. It is the most efficient immunoglobulin in agglutination, complement fixation and other antibody responses and is important in defense against bacteria and viruses. IgD is an immunoglobulin that has no known antibody function but can serve as an antigen receptor. IgE is an immunoglobulin that mediates immediate hypersensitivity by releasing mediators from mast cells and basophils upon exposure to allergens.

  As used herein, “negative immune regulator” or “negative regulator” or “negative regulator of immune response” has the ability to negatively regulate immune signaling transduction pathways in cells It means protein. Preferably, the negative immune regulator negatively regulates the proinflammatory signaling pathway. Negative immunomodulators disclosed herein include sTLR, RP105, SIGIRR, ST2, NOD2, MyD88s, IRAK (IRAKM, IRAK1, IRAK2), IRF-4, FLN29, TWEAK, TRIAD3A, CYLD, Cbl, A20. , SUMO (SUMO1, SUMO2, SUMO3 and SUMO4), IkB protein, MKPs, Foxj1, Foxo3a, TWIST (Twist1, Twist2), Roquin, Dok (Dok-1, Dok-2), PI3K, Prostagland R, Arrestin, TOLLIP, SOCS (SOCS1, SOCS2, SOCS3, SOCS4, SOCS5, SOCS6, SOCS7 and CIS), PIAS (PIAS1, PIAS3, PIASx and PIASy), SHP (SHP-1 and SHP-2), and the like, but are not limited thereto. Negative immune regulators are involved in inhibitory homologues of proteins involved in signal transduction (eg soluble decoy TLR, inhibitory TIR homologues, inhibitory signaling molecule isoforms, inhibitory cytokine homologues, etc.), molecular stability Protein, inhibitory component of signaling molecule complex, protein involved in regulation of phosphorylation of signaling molecule, transcription factor that suppresses transcription of NFκB target gene, protein involved in regulation of RNA translation and stability, cytokine It may belong to different protein families including but not limited to signaling regulators and the like. In one aspect, inhibiting one or more negative immune modulators in immune cells serves to enhance the immune capacity of the cell.

  An "isolated nucleic acid" is a nucleic acid segment or fragment that is separated from the sequence that it flanks in a naturally occurring state, i.e. a sequence that is usually adjacent to that fragment, i.e., in the genome in which it occurs naturally. Means a DNA fragment removed from the sequence adjacent to the fragment. The term also applies to nucleic acids that have been substantially purified from other components that naturally accompany the nucleic acid, ie, RNA or DNA or proteins that naturally accompany it in the cell. Thus, the term is used as a separate molecule independent of, for example, recombinant DNA or other sequences incorporated into vectors, self-replicating plasmids or viruses, or prokaryotic or eukaryotic genomic DNA. Including recombinant DNA present (ie, as cDNA or genomic or cDNA fragments produced by PCR or restriction enzyme digestion). This also includes recombinant DNA that is part of a hybrid gene encoding additional polypeptide sequences.

  In connection with the present invention, the following abbreviations are used for commonly occurring nucleobases. That is, “A” means adenosine, “C” means cytosine, “G” means guanosine, “T” means thymidine and “U” means uridine.

  As used herein, the term “major histocompatibility complex” or “MHC” refers to evolutionarily relevant cells, many of which are involved in antigen presentation that falls among the most important determinants of histocompatibility. It is defined as a specific gene cluster that encodes a surface protein. Class IMHC, or MHC-I, functions primarily in antigen presentation to CD8 T lymphocytes. Class II MHC, or MHC-II functions primarily in antigen presentation to CD4 T lymphocytes.

  As used herein, the term “modulate” is intended to mean any change in biological state, ie, increase, decrease, etc. For example, the term “modulate” refers to transcription of the desired negative immune regulator mRNA, stability of the desired negative immune regulator mRNA, translation of the desired negative immune regulator mRNA, desired negative immune regulator. Positive or negative expression or activity of negative immune modulators including, but not limited to, stability of the factor polypeptide, post-translational modification of the desired negative immune regulator or any combination thereof Means ability to adjust to. In addition, the term “modulate” includes, but is not limited to, the activity of a desired negative immune modulator associated with the immune capacity of a dendritic cell, increasing, decreasing, masking. Can be used to mean altering, overriding or restoring. The term “modulate” is sTLR, RP105, SIGIRR, ST2, NOD2, MyD88s, IRAK (IRAKM, IRAK1, IRAK2), IRF-4, FLN29, TWEAK, TRIAD3A, CYLD, Cbl, A20, SUMO (SUMO1, SUMO2 , SUMO3 and SUMO4), IkB protein, MKPs, Foxj1, Foxo3a, TWIST (Twist1, Twist2), Roquin, Dok (Dok-1, Dok-2), PI3K, prostaglandin, TRAIL-R, SOLIP, COLIP (SOCS1, SOCS2, SOCS3, SOCS4, SOCS5, SOCS6, SOCS7 and CIS), PIAS (PIAS1, PIAS3, PIASx and PIASy), S This applies to any negative immune regulator disclosed herein, including but not limited to HP (SHP-1 and SHP-2) and the like. Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence encoding a protein or RNA can also include introns, as long as the protein can contain introns in some versions.

The term “polynucleotide” as used herein is defined as a chain of nucleotides. In addition, nucleic acids are nucleotide polymers. Thus, the nucleic acids and polynucleotides used herein are interchangeable. One skilled in the art has the general knowledge that nucleic acids are polynucleotides that can be hydrolyzed into monomeric “nucleotides”. Monomeric nucleotides can be hydrolyzed into nucleosides. Polynucleotides used in this document include, without limitation, recombinant means, ie cloning of nucleic acid sequences from recombinant libraries or cell genomes using conventional cloning techniques and PCR ^™ , and synthetic means, without limitation. All nucleic acid sequences obtained by any means available in the art are included, but are not limited to such.

  The term “polypeptide” as used herein is usually defined as a chain of amino acid residues having a defined sequence. As used herein, the term polypeptide is mutually inclusive of the terms “peptide” and “protein”.

“Proliferation” as used herein means the replication or propagation of a similar form of entity, eg, amplification of cells. That is, proliferation includes the production of more cells, which can be measured, among other things, by simply counting the number of cells, measuring ³ H-thymidine incorporation into the cells, and the like.

  As used herein, the term “promoter” refers to the DNA sequence required to initiate specific transcription of a polynucleotide sequence that is recognized by or introduced by a synthetic machinery of a cell. Defined.

  As used herein, “promoter / regulatory sequence” refers to a nucleic acid sequence required for expression of a gene product operably linked to a promoter / regulator sequence. In some cases, this sequence may be a core promoter sequence; in other cases, this sequence may also include enhancer sequences and other regulatory elements required for expression of the gene product. A promoter / regulatory sequence can be, for example, one that expresses a gene product in a tissue-specific manner.

  A “constitutive” promoter, when operably linked to a polynucleotide that encodes or identifies a gene product, causes the gene product to be produced in the cell under most or all physiological conditions of the cell. Nucleotide sequence.

  An “inducible” promoter is a gene that is substantially intracellularly only when an inducer corresponding to the promoter is present inside the cell when operably linked to a polynucleotide that encodes or identifies the gene product. A nucleotide sequence that produces a product.

  A “tissue specific” promoter is substantially only when the cell is a cell of a tissue type of the type corresponding to the promoter when operably linked to a polynucleotide encoding or identifying the gene product. A nucleotide sequence that produces a gene product in a cell.

  As used herein, the term “RNA” is defined as ribonucleic acid.

  As used herein, the term “recombinant DNA” is defined as DNA that is produced by joining pieces of DNA from different sources.

  A “recombinant polypeptide” as used herein is defined as a polypeptide produced by using recombinant DNA methods.

  The term “self antigen” as used herein is defined as an antigen expressed by a host cell or tissue. The autoantigen is a tumor antigen, but in some embodiments it is expressed on both normal and tumor cells. One skilled in the art will readily appreciate that self-antigens can be overexpressed in cells.

  As used herein, a “substantially purified” cell is a cell that is essentially free of other cell types. Substantially purified cells also mean cells that are separated from other cell types with which they are normally associated in their naturally occurring state. In some cases, a substantially purified population of cells means a homogenous population of cells. In other cases, the term simply refers to a cell that has been separated from a cell with which it is naturally associated in its natural state. In some embodiments, the cell is an in vitro culture. In other embodiments, the cells are not cultured in vitro.

  The term “T cell” as used herein is defined as a thymus-derived cell that participates in various cell-mediated immune responses.

The term “B cell” as used herein is defined as a cell derived from the bone marrow and / or spleen. B cells can develop into plasma cells that produce antibodies.

  As used herein, a “therapeutically effective amount” is an amount of a therapeutic composition sufficient to provide a beneficial effect to the mammal to which the composition is administered.

  As used herein, the term “transfected” or “transformed” or “transduced” refers to the process of transferring or introducing exogenous nucleic acid into a host cell. A “transfected” or “transformed” or “transduced” cell is a cell that has been transfected, transformed or transduced with an exogenous nucleic acid. Cells include primary target cells and their progeny.

  As used herein, the phrase “under transcriptional control” or “operably linked” means that the promoter is the right place in relation to the polynucleotide to control transcription by RNA polymerase and initiation of expression of the polynucleotide. And in an orientation.

  The term “vaccine” as used herein is defined as a material used to raise an immune response after the material has been administered to a mammal.

  As used herein, the term “variant” is a nucleic acid or peptide sequence that retains the basic properties of a reference molecule, although the sequence differs from the reference nucleic acid sequence or peptide sequence, respectively. Changes in the sequence of the nucleic acid variant may not alter the amino acid sequence of the peptide encoded by the reference nucleic acid, or may otherwise result in amino acid substitutions, additions, deletions, fusions and truncations. is there. Peptide variant sequence changes are typically limited or conservative, thus the reference peptide and variant sequences are generally similar and identical in many regions. . A variant and reference peptide may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. Nucleic acid or peptide variants can be naturally occurring, such as allelic variants, and can otherwise be variants not known to occur naturally. Non-naturally occurring variants of nucleic acids and peptides can be made by mutagenesis techniques or direct synthesis.

  A “vector” is a composition of matter that contains an isolated nucleic acid and can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides associated with ions or amphiphiles, plasmids and viruses. Thus, the term “vector” includes self-replicating plasmids or viruses. The term should also be taken to include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells such as, for example, polylysine compounds, liposomes. Examples of viral vectors include adenoviral vectors, adeno-associated viral vectors, retroviral vectors and the like.

  The term “virus” as used herein is defined as a particle consisting of nucleic acid (RNA or DNA) encapsulated in a protein membrane with or without an external lipid envelope that has the ability to replicate in whole cells. The

  By “heterologous” is meant a graft derived from a different species of animal.

DESCRIPTION Uncontrolled signaling in response to an immune response in a mammalian body can have biologically devastating consequences. Therefore, the signaling path is closely controlled at different levels. There are various types of immune response modulators. One way to modulate the immune response is through negative immune regulators. Accordingly, the present invention relates to inhibiting negative immune regulators in immune cells to enhance the immune capacity of the cells.

  Negative immune regulators are involved in inhibitory homologues of proteins involved in signal transduction (eg soluble decoy TLR, inhibitory TIR homologues, inhibitory signaling molecule isoforms, inhibitory cytokine homologues, etc.), molecular stability Protein, inhibitory component of signaling molecule complex, protein involved in regulation of phosphorylation of signaling molecule, transcription factor suppressing transcription of NFκB target gene, protein involved in regulation of RNA translation and stability, cytokine It can belong to different protein families including but not limited to signaling regulators and the like. Examples of negative immune regulators include sTLR, RP105, SIGIRR, ST2, NOD2, MyD88s, IRAK (IRAKM, IRAK1, IRAK2), IRF-4, FLN29, TWEAK, TRIAD3A, CYLD, Cbl, A20, SUMO (SUMO1, SUMO2, SUMO3, and SUMO4), IkB protein, MKPs, Foxj1, Foxo3a, TWIST (Twist1, Twist2), Roquin, Dok (Dok-1, Dok-2), PI3K, prostaglandin, TRAIL-TOL, Lestin L , SOCS (SOCS1, SOCS2, SOCS3, SOCS4, SOCS5, SOCS6, SOCS7 and CIS), PIAS (PIAS1, PIAS3, PIASx and PIASy) Although the like SHP (SHP-1 and SHP-2), but is not limited thereto.

  In one aspect, the negative immune regulator is a regulator of cytokine signaling comprising a suppressor of cytokine signaling (SOCS), an SH2-containing phosphatase (SHP) and an activated STAT protein inhibitor (PIAS), (But not limited to).

  Inducible inhibitors of cytokine signaling are suppressors of cytokine signaling (SOCS) proteins, among which there are eight family members: SOCS1-SOCS7 and cytokine-induced SH2 domain-containing protein (CIS). SOCS proteins recognize cytokine receptors or associated JAKs and attenuate signal transduction both by direct interference in signaling and targeting the receptor complex for ubiquitin-mediated proteasome degradation.

  SHP proteins including (but not limited to) (SHP-1 and SHP-2) are constitutively expressed and cytokines by dephosphorylated signaling intermediates such as Janus kinase (JAK) and its receptors Signal transduction can be attenuated. Members of the activated STAT protein inhibitor (PIAS) family, including but not limited to PIAS1, PIAS3, PIASx and PIASy, are also constitutively expressed and signaling by inhibiting STAT activity. Is attenuated. The sumoylation process has been implicated in PIAS-mediated suppression of STAT activity.

  The present invention relates to the discovery that inhibition of negative immune modulators provides a therapeutic benefit to mammals. That is, inhibition of negative immune regulators in immune cells serves to enhance signaling pathways associated with intracellular immune capacity. In one aspect, inhibitory homologues of proteins involved in signal transduction (eg, soluble decoy TLR, inhibitory TIR homologues, inhibitory signaling molecule isoforms, inhibitory cytokine homologues, etc.), proteins involved in molecular stability , Inhibitory components of signaling molecule complexes, proteins involved in regulation of phosphorylation of signaling molecules, transcription factors that suppress transcription of NFκB target genes, proteins involved in regulation of RNA translation and stability, cytokine signaling regulation Inhibition of the factors or any combination thereof provides a therapeutic benefit to the mammal.

  Thus, the present invention comprises compositions and methods for inhibiting negative immune regulators in immune cells to enhance immune capacity of immune cells. Preferably, A20, SUMO (SUMO1, SUMO2, SUMO3 and SUMO4), Foxj1, Foxo3a, TWIST (Twist1, Twist2), SOCS (SOCS1, SOCS2, SOCS3, SOCS4, SOCS6, SOCS6, SOCS3 and PISI, SIS7, CIS, PISC3, PISI, SPI, PI , PIASx and PIASy), SHP (SHP-1 and SHP-2), etc., to inhibit one or more negative immune modulators selected from the group consisting of therapeutic benefits.

  In a further aspect, inhibition of any one or more members from a cytokine signal modulator provides a therapeutic benefit. Thus, the present invention comprises compositions and methods for modulating cytokine signaling regulators within immune cells to enhance immune capacity within immune cells.

  Regardless of the desired negative immune modulator to be inhibited, the compositions of the present invention that enhance the immunity of a cell can be an inhibitor of a negative immune modulator (eg, the inhibitor corresponds to the desired negative immune modulator). Any of at least one or more of: an antigen, a silenced immune cell, a pulsed cell, a silenced cell pulsed with an antigen, a cytokine, etc. Including a combination of The composition can be a vaccine for in vivo immunization and / or ex vivo therapy.

  The present invention provides silenced APC as a comprehensive means to enhance vaccine efficacy by overriding critical control points within APC. Vaccination with the silenced APCs or inhibitors of negative immune regulators of the present invention can result in antigen-presenting immunogenic APCs persistently antigen-specific T cells in vivo by silencing negative immune regulators Can enhance antigen-specific immunity. In one embodiment of the invention, the silenced APC has the ability to switch off regulatory T cells by enhancing the production of proinflammatory cytokines that inhibit regulatory T cell suppression and APC maturation. .

  In addition to generating silenced APCs, the present invention also includes silenced cytotoxic T lymphocytes (CTLs). The present disclosure demonstrates that CTLs silenced using the methods of the invention exhibit enhanced cytolytic activity. Enhanced cytolytic activity provides a therapeutic benefit in cell therapy and / or vaccination.

Inhibition of negative immune regulators:
Based on the disclosure presented herein, the present invention encompasses the generic concept that negative immune regulators are thus inhibited and thus negative immune regulators are associated with modulation of the immune response. Negative immune modulators can belong to different protein families. Each family of negative immune regulators has a different strategy for modulating the immune response. Different families include inhibitory homologues of proteins involved in signal transduction (eg soluble decoy TLR, inhibitory TIR homologues, inhibitory signaling molecule isoforms, inhibitory cytokine homologues, etc.), proteins involved in molecular stability , Inhibitory components of signaling molecule complexes, proteins involved in regulation of phosphorylation of signaling molecules, transcription factors that suppress transcription of NFκB target genes, proteins involved in regulation of RNA translation and stability, cytokine signaling regulation Including, but not limited to, factors. Based on the disclosure presented herein, the immune capacity in the cell is enhanced by inhibiting negative immune regulators in the immune cell.

  In some embodiments, inhibition of negative immune regulators in immune cells enhances intracellular Toll-like receptor (TLR) and tumor necrosis factor receptor (TNFR). As a result of enhancing intracellular TLR and TNFR, the immune capacity of the cell increases.

Inhibitory homologues of proteins involved in signal transduction Effective immune responses result from activation of DCs in response to pathogenic infections. This activation includes signaling through a pathogen recognition receptor such as TLR. Members of TLRs are present in a conserved cytosolitol / interleukin-1 receptor (TIR) domain that activates common signaling pathways, particularly those that lead to activation of NF-κB and stress-activated protein kinases. Signaling in the same way. NF-κB activation is secreted by secreting proinflammatory cytokines such as TNF, IFN, interleukin 1 (IL-1), IL-6, and IL-12, and co-stimulation such as CD80, CD86 and CD40 By expressing the molecule, it acts as a catalyst for the immune response.

  A frequently used strategy for modulating the immune response based on intracellular TLR signaling is to identify the major signaling molecule by its non-functional homologue or isoform that has no stimulatory activity in the extracellular portion of the TLR. Competitive inhibition. Proteins within this family of negative immune regulators include, but are not limited to, soluble decoy TLR (sTLR). sTLR suppresses the interaction between a pathogenic product (eg, a pathogen product) and TLR. For example, soluble decoy TLR2 competes with TLR2 for interaction with the corresponding pathogen ligand. In another case, soluble decoy TLR4 interacts with MD2 and inhibits the formation of the MD2-TLR4 complex, thus blocking LPS-mediated signaling by TLR4.

  Based on the present disclosure, those skilled in the art will understand that the present invention is a composition and method for inhibiting negative immune regulators, wherein the negative immune regulator is a non-functional homologue of a signaling molecule. And would include a method. Preferably, the non-functional homologue of the signaling molecule is a soluble decoy TLR. Inhibiting a non-functional homologue of a signaling molecule (or otherwise inhibiting sTLR) serves to inhibit the inhibitory effect of the non-functional homologue on the signaling molecule.

  In addition to inhibiting soluble decoy TLRs, another strategy to enhance TLR signaling is to inhibit proteins containing non-functional TIR homologues or isoforms in the cytoplasmic region of TLRs. These proteins are members of a family of proteins that share membrane-bound non-functional TIR homologs (otherwise known as non-functional receptors) that contain TIR domains without any stimulating activity. Such proteins include, but are not limited to, STGIRR (single immunoglobulin IL-IR-related molecule), ST2 and RP105.

  While not wishing to be bound by any particular theory, these proteins suppress TLR signaling by inhibiting or blocking the TLR from binding to its corresponding signaling molecule. For example, SIGIRR attenuates TLR4 signaling by competing with TLR4 to interact with signaling molecules. Thus, the present invention provides compositions and methods for inhibiting negative immune regulators, wherein the negative immune regulator is a membrane bound non-functional TIR homologue for enhancing TLR signaling in immune cells. Products and methods. This strategy provides support for the general concept of inhibiting negative immune regulators to enhance the immune capacity of immune cells.

TLR signaling can be regulated by NOD2 as well. NOD2 is a member of a family of nucleotide-binding oligomerization domains that can recognize the bacterial product muramyl dipeptide (MDP). NOD2 is a negative regulator of TLR2 signaling. Based on the present disclosure presented herein, inhibiting NOD2 in immune cells suppresses the inhibitory effect of NOD2 on intracellular TLR signaling. Therefore, when NOD2 is inhibited in the body of an immunizer, the immunity of the cell is enhanced.

  Another strategy to regulate TLR signaling is to regulate cytoplasmic signaling proteins such as MyD88 and IRAK. Negative immunomodulators that inhibit cytoplasmic signaling molecules are considered to be non-functional isoforms of the major signaling molecules in TLR signaling (or alternatively known as signaling molecule isoforms). An example of a negative immune regulator that is considered to be a non-functional isoform is a short alternatively spliced variant of MyD88 that lacks an intermediate domain. This splice variant of MyD88, designated MyD88, has been found to suppress TLR signaling. For example, MyD88 inhibits LPS-induced NF-κB activity. MyD88 is thought to inhibit LPS-induced NF-κB activity because it does not have the ability to bind to IRAK4 and promote IRAK1 phosphorylation. Based on the disclosure presented herein, inhibiting a negative immunomodulator that is a non-functional isoform in one cell (eg, MyD88) enhances intracellular TLR signaling, thus Means are provided for enhancing immune capacity.

  Another example of a protein belonging to a family of inhibitory homologues of proteins involved in signal transduction is IRAK. The IRAK family of kinases comprises four members: IRAK1, IRAK2, IRAK4 and IRAKM. Furthermore, IRAKM lacks kinase activity, which functions as a global negative immune regulator of intracellular TLR signaling. Thus, supporting the general concept of inhibiting negative immune regulators that are non-functional isoforms, such as IRAKM, by inhibiting negative immune regulators in immune cells to enhance the immune capacity of the cells. Provided.

  Other negative immune regulators of TLR signaling include, but are not limited to, members of the IFN regulator (IRF) family of transcription factors, FLN29 (a novel interferon and LPS-inducible gene) and TWEAK. . Thus, inhibiting one or more of these negative immune regulators can prevent the inhibitory effect of each negative immune regulator on the immune response. Thus, inhibiting any one or more of these negative immunomodulators provides a means to enhance TLR signaling and thus enhance the cell's immune capacity within the cell. .

Molecular stability:
One family of negative immune regulators utilizes strategies that modulate the stability of signaling molecules. This strategy is coupled with regulating the stability of the major signaling molecules by ubiquitination / deubiquitination and increasing the stability of the inhibitory component of the signaling molecule complex by sumoylation and other mechanisms. Yes. Many of these negative immune regulators such as TRIAD3A, Cyld, Cbl, A20 and SUMO are 2-biquitin modifying enzymes that modify target TLRs and signaling molecules and promote their degradation to attenuate TLR signaling. In some cases, these negative immune regulators can attenuate TNFR signaling as well. Thus, based on the disclosure presented herein, one of ordinary skill in the art will recognize the intracellular TLR and the intracellular TLR by inhibiting one or more of these negative immune modulators in the immune cell. It will be appreciated that / or TNFR signaling is enhanced. The result of enhancement of intracellular TLR and / or TNFR signaling is an increase in the immune capacity of the cell.

  Other negative immune regulators involved in regulating molecular stability include the arrestin family. Based on this disclosure, one skilled in the art will recognize that inhibiting the arrestin family member in immune cells suppresses the inhibitory effect of the arrestin family member on NF-κB activation. . Thus, inhibition of arrestin family members increases the immune capacity of the cell.

Inhibitory components that signal molecular complexes Negative immunomodulators that are members of the family of inhibitory components of signaling molecule complexes include the IκB protein. IκB proteins, including IκBα, IκBβ and IκBε, sequester NF-κB proteins in the cytoplasm and inhibit NF-κB from its normal function. The IκB protein retains NF-κB in the cytoplasm by masking the nuclear localization sequence (NLS) on the NF-κB subunit.

  An important event in the activation of NF-κB is the phosphorylation of IκB by the IκB kinase (IKK) complex. The IKK complex is a confluence for the activation of NF-κB by various stimuli including TLR, ligand and TNF. The IKK complex contains two catalytic subunits, IKKα and IKKβ, and controls the activation of the NF-κB transcription factor. IKKβ mediates NF-κB activation in response to proinflammatory cytokines and pathogenic products. The role of negative regulation for IKKα in controlling the activation of NF-κB has been observed. IKKα contributes to the suppression of NF-κB activity by accelerating both the degradation of the NF-κB subunits RelA and cRel and the removal of RelA and c-Rel from the pro-inflammatory gene promoter.

  Based on the disclosure presented herein, proteins that negatively regulate NF-κB or otherwise prevent activation of NF-κB are disclosed herein to enhance cellular immunity. Are candidates for targeted inhibition using the method. One skilled in the art will recognize that inhibiting the IκB proteins IKKα, IKKβ, or any combination can suppress the inhibitory effect of these proteins on NF-κB activation.

Regulation of signaling molecule phosphorylation The MAPK signaling pathway is linked to the activation of immune responses. The MAPK pathway is subject to feedback inhibition by MAPK phosphatase (MKP) because phosphatase is induced after activation of the MAPK pathway. Based on the disclosure presented herein, inhibiting MKP (eg, MKP5 and MKP6) helps to suppress the inhibitory effect of MKP on its corresponding MAPK pathway. MKP5 and MKP6 have been shown to negatively regulate T cell activation by inhibiting the activity of their respective MAPK targets.

  Based on the disclosure presented herein, one of ordinary skill in the art will recognize that inhibiting MKP (eg, MKP5 and MKP6) can suppress the inhibitory effect of phosphatases on the MAPK signaling pathway. By inhibiting MKP in immune cells, the immune capacity of the cells can be enhanced.

Regulation of target gene transcription Another strategy for regulating immune responses is to repress transcription of NFκB target genes or enhance transcription of negative components in signaling molecule complexes. Such strategies include the suppression of negative immune modulators including but not limited to Twist-1, Twist-2, Foxj1, and Foxo3a. The disclosure presented herein demonstrates that suppression of the level of at least one of these proteins can enhance the immune capacity of the cell.

  Foxo3a and Foxj1 are members of the forkhead transcription factor family that are actively involved in the negative regulation of NF-κB. Twist is another negative immune regulator of NF-κB. Twist binds to the E box in the cytokine promoter and inhibits the activity of NF-κB bound to the adjacent κB site.

Methods of Inhibiting Negative Immunomodulators Based on the disclosure herein, the present invention includes a generic concept for inhibiting negative immune regulators in a cell to enhance the immune capacity of the cell. Preferably, the present invention includes A20, SUMO (SUMO1, SUMO2, SUMO3, and SUMO4), Foxj1, Foxo3a, TWIST (Twist1, Twist2), SOCS (SOCS1, SOCS2, SOCS3, SOCS4, SOCS5, SOCS6, SOCS7, and SOCS7, SOCS7, and SOCS7). Inhibiting one or more negative immune regulators selected from the group consisting of PIAS (PIAS1, PIAS3, PIASx and PIASy), SHP (SHP-1 and SHP-2) and the like.

  In one embodiment, the present invention comprises a composition for enhancing the immune capacity of immune cells. Preferably, the composition comprises A20, SUMO (SUMO1, SUMO2, SUMO3 and SUMO4), Foxj1, Foxo3a, TWIST (Twist1, Twist2), SOCS (SOCS1, SOCS2, SOCS3, SOCS4, SOCS5, SOCS6, SOCS7, SOCS7, SOCS7, An inhibitor that inhibits one or more negative immune modulators selected from the group consisting of PIAS (PIAS1, PIAS3, PIASx and PIASy), SHP (SHP-1 and SHP-2), and the like.

  A composition comprising an inhibitor of a negative immune regulator comprises a group consisting of small interfering RNA (siRNA), microRNA, antisense nucleic acid, ribozyme, transdominant gene negative mutant, intracellular antibody, peptide and small molecule Selected from.

  One skilled in the art, based on the disclosure provided herein, is one method for reducing mRNA and / or protein levels of negative immune regulators such as cytokine signaling regulators in one cell. It will be appreciated that this is due to reducing or inhibiting the expression of the nucleic acid encoding the factor. Thus, the protein levels of negative immune regulators in cells can also be reduced using molecules or compounds that inhibit or reduce gene expression, such as antisense molecules or ribozymes.

  In a preferred embodiment, the modulation sequence is an antisense nucleic acid sequence expressed by a plasmid vector. Antisense expression vectors are used to transfect mammalian cells or the mammal itself, thus causing reduced endogenous expression of the desired negative immune regulator. However, the present invention should not be construed as being limited to inhibiting the expression of negative immune regulators by transfection of cells with antisense molecules. Rather, the present invention includes the use of ribozymes, the expression of non-functional negative immune regulators (ie trans dominant negative mutants) and the use of intracellular antibodies (but not limited to) Other methods known in the art for inhibiting protein expression or activity are included.

Antisense molecules and their use to inhibit gene expression are well known in the art (see, for example, Cohen, 1989, “Oligodeoxyribonucleotides, Antisense Inhibitors of
See “Gene Expression”, in CRC Press). An antisense nucleic acid is a DNA or RNA molecule that is complementary to at least a portion of a specific mRNA molecule, as that term is defined elsewhere in this document (Weintraub, 1990, Scientific American No. 262: 40). Within the cell, antisense nucleic acids hybridize to the corresponding mRNA, forming double-stranded molecules and inhibiting gene translation.

  The use of antisense methods to inhibit gene translation is known in the art, for example in Marcus-Sakura (1988, Anal. Biochem. 172: 289). is described. Such antisense molecules can be transferred to cells via gene expression using DNA encoding the antisense molecule as taught by Inoue (1993, US Pat. No. 5,190,931). Can be provided.

  Alternatively, antisense molecules of the invention can be made synthetically and then provided to cells. Antisense oligomers of about 10 to about 30, more preferably about 15 nucleotides are preferred because they are readily synthesized and introduced into target cells. Synthetic antisense molecules contemplated by the present invention include oligonucleotide derivatives known in the art that have improved biological activity compared to unmodified oligonucleotides (US Pat. No. 5,023,243). See the description).

  Ribozymes and their use to inhibit gene expression are also well known in the art (eg, Chech et al., 1992, J. Biol. Chem. 267: 17479-17482; Hampel (Hampel et al., 1989, Biochemistry 28: 4929-4933; Eckstein et al., WO 92/07005; Altman et al., US Pat. No. 5,168,053). See the book). Ribozymes are RNA molecules that have the ability to specifically split other single-stranded RNAs, similar to DNA restriction endonucleases. Through modification of the nucleotide sequences encoding these RNAs, the molecules can be engineered to recognize and split specific nucleotide sequences within the RNA molecule (Chef, 1988, J. Amer. Med. Assn. 260: 3030). The main advantage of this approach lies in the fact that the ribozyme is sequence specific.

  There are two basic types of ribozymes, the Tetrahymena type (Hasselhoff, 1988, Nature 334: 585) and the hammerhead type. Tetrahymena ribozymes recognize sequences with a length of 4 bases, while hammerhead ribozymes recognize base sequences with a length of 11-18 bases. The longer the sequence, the greater the probability that the sequence will occur exclusively within the target mRNA species. As a result, hammerhead ribozymes are preferred over tetrahymena ribozymes to inactivate specific mRNA species and are relatively short recognitions that can occur randomly within various unrelated mRNA molecules. An 18-base recognition sequence is preferred over the sequence.

  Ribozymes useful for inhibiting the expression of negative immune regulators can be designed by incorporating the target sequence into a basic ribozyme structure that is complementary to the mRNA sequence of the desired negative immune regulator. . Ribozymes targeting the desired negative immunomodulator can be synthesized using commercially available reagents (Applied Biosystems, Inc., Foster City, CA), and so on. Otherwise, it can be genetically expressed from the DNA that encodes them.

  In another aspect of the invention, negative immunomodulators can be inhibited by inactivating and / or sequestering the desired negative immune regulator. Thus, by using a transdominant negative mutant, inhibition of the effects of negative immune modulators can be achieved. Alternatively, intracellular antibodies specific for the desired negative immune modulator, otherwise known as antagonists to the negative immune regulator, can be used. In one embodiment, the antagonist is a protein and / or compound that has the desired property of interacting with the binding partner of the negative immune regulator and thus competing with the corresponding wild-type negative immune regulator. In another embodiment, the antagonist is a protein and / or compound that has the desired property of interacting with a negative immune regulator and thus sequestering the negative immune regulator.

Small interfering RNA (siRNA)
Small interfering RNA (siRNA) is an RNA molecule that comprises a set of nucleotides that are targeted to a gene or polynucleotide of interest. As used herein, the term “siRNA” refers to (i) a double stranded RNA polynucleotide, (ii) a single stranded polynucleotide and (iii) 1, 2, 3, 4 or more nucleotide modifications or substitutions. All forms including (but not limited to) the polynucleotide of either (i) or (ii) are included.

  SiRNAs in the form of double-stranded polynucleotides are about 18 base pairs, about 19 base pairs, about 20 base pairs, about 21 base pairs, about 22 base pairs, about 23 base pairs, about 24 base pairs, about 25 base pairs, about 26 base pairs, about 27 base pairs, about 28 base pairs, about 29 base pairs or about 30 bases. Double-stranded siRNA has the ability to interfere with the expression and / or activity of negative immune regulators.

  Single-stranded siRNA comprises a portion of an RNA polynucleotide sequence that is targeted to a gene or polynucleotide of interest. A single-stranded siRNA is about 18 nucleotides in length, about 19 nucleotides, about 20 nucleotides, about 21 nucleotides, about 22 nucleotides, about 23 nucleotides, about 24 nucleotides, about 25 nucleotides, about 25 nucleotides A polynucleotide comprising 26, about 27 nucleotides, about 28 nucleotides, about 29 nucleotides or about 30 nucleotides. Single-stranded siRNAs are A20, SUMO (SUMO1, SUMO2, SUMO3, and SUMO4), Foxj1, Foxo3a, TWIST (Twist1, Twist2), SOCS (SOCS1, SOCS2, SOCS3, SOCS4, SOCS6, SOCS6, It has the ability to interfere with the expression and / or activity of target polynucleotides such as PIAS (PIAS1, PIAS3, PIASx and PIASy), SHP (SHP-1 and SHP-2). Single-stranded siRNAs also have the ability to anneal to complementary sequences to yield dsRNAs that have the ability to interfere with the expression and / or activity of negative immune regulators.

  In yet another embodiment, the siRNA comprises a polynucleotide comprising a polynucleotide that is either double-stranded or single-stranded, wherein the siRNA has 1, 2, 3, 4 or more therein. Of nucleotide modifications or substitutions.

siRNA polynucleotides are RNA nucleic acid molecules that interfere with RNA activity that is generally thought to occur through post-transcriptional gene silencing mechanisms. The siRNA polynucleotide preferably comprises double stranded RNA (dsRNA), but is not intended to be so limited and may comprise single stranded RNA (eg, multiness ( Martinez) et al., 2002, Cell 110: 563-74). SiRNA polynucleotides included in the present invention may comprise nucleotides (ribonucleotides or deoxyribonucleotides or a combination of both) and / or nucleotide analogs (eg, typically in 5 ′ to 3 ′) as provided herein. Other naturally occurring, recombinant or synthetic single or double stranded polymers (such as oligonucleotides or polynucleotides in phosphodiester linkages) may also be included. Thus, several example sequences disclosed herein, such as DNA sequences capable of directing transcription of siRNA polynucleotides, are similarly addressed in view of the well-proven principle of complementary nucleotide base pairing. It will be appreciated that it is also intended to describe the RNA sequence to be complemented and its complement.

  SiRNA can be transcribed using DNA (genome, cDNA, or synthesis) containing a promoter for the RNA polymerase promoter as a template. For example, the promoter can be a U6 promoter or a HIRNA polymerase III promoter. Alternatively, the siRNA can be a synthetically derived RNA molecule. In some embodiments, siRNA polynucleotides can have blunt ends. In some other embodiments, at least one strand of the siRNA polynucleotide “overhangs” at the 3 ′ end of either strand of the siRNA polynucleotide (ie, with a complementary base in the opposite strand). It has at least one, preferably two nucleotides (not base-paired). In a preferred embodiment of the invention, each strand of the siRNA polynucleotide duplex has a 2 nucleotide overhang at the 3 'end. The 2-nucleotide overhang is preferably a thymidine dinucleotide (TT), but may similarly comprise other bases such as TC dinucleotides or TG dinucleotides or any other dinucleotide. The overhanging dinucleotide may also be complementary to the two nucleotides at the 5 'end of the polynucleotide sequence targeted for interference. For a discussion of the 3 'end of siRNA polynucleotides, see eg WO 01/75164.

  Preferred siRNA polynucleotides are two of about 18-30 nucleotide base pairs, preferably about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26 or about 27 base pairs. In other preferred embodiments comprising about 19, about 20, about 21, about 22 or about 23 base pairs, or about 27 base pairs, thus the term "about" In some embodiments and under certain conditions, an absolute sequential cleavage step that can generate a functional siRNA polynucleotide capable of interfering with the expression of a selected polypeptide is absolutely necessary. Indicates that it may not be effective. Thus, siRNA polynucleotides can vary in length by 1, 2, 3, 4 base pairs or more (eg, due to nucleotide insertions or deletions) as a consequence of variability in siRNA processing, biosynthesis or artificial synthesis, or Further siRNA polynucleotide molecules may be included. The siRNA polynucleotides of the present invention are also polynucleotides that exhibit variability by differing in 1, 2, 3, or 4 nucleotides from a particular sequence (eg, by nucleotide substitutions including translocations or transversions) It can also comprise an array. These differences can occur at any of the nucleotide positions of a particular siRNA polynucleotide sequence, depending on the length of the molecule, whether in the sense or antisense strand of the double-stranded polynucleotide. is there. Nucleotide differences can be found on one strand of a double-stranded polynucleotide, where complementary nucleotides that would normally form hydrogen-bonded base pairings with alternative nucleotides are not necessarily replaced in a corresponding manner. I don't get it. In preferred embodiments, siRNA polynucleotides are homologous in relation to a specific nucleotide sequence.

In some embodiments, a polynucleotide comprising a siRNA polynucleotide of the invention is a single stranded oligonucleotide fragment (eg, of about 18-30 nucleotides) and vice versa, typically separated by a spacer sequence. It can be derived from a single stranded polynucleotide comprising complement. According to certain such embodiments, spacer splitting provides single stranded oligonucleotide fragments and their reverse complements, thus they anneal and optionally 3 of either or both strands. Forming a double-stranded siRNA polynucleotide of the present invention with further processing steps resulting in the addition or removal of 1, 2, 3 or 4 or more nucleotides from the 'end and / or 5' end. it can. In some embodiments, the spacer is one, two, three, four or more nucleotides from the 3 ′ end and / or 5 ′ end of either or both strands prior to and optionally in the splitting. Has a length that allows the fragment and its reverse complement to anneal to form a double stranded structure (such as a hairpin polynucleotide) prior to subsequent processing steps that may result in addition or removal. ing. Thus, a spacer sequence is any polynucleotide sequence as provided herein that is between two complementary polynucleotide sequence regions that result in an siRNA polynucleotide when annealed into a double stranded nucleic acid. obtain. Preferably, the spacer sequence comprises at least 4 nucleotides. In some embodiments, the spacer is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21-25, 26-30, It can comprise 31-40, 41-50, 51-70, 71-90, 91-110, 111-150, 151-200 or more nucleotides. Examples of siRNA polynucleotides derived from a single nucleotide strand comprising two complementary nucleotide sequences separated by one spacer have been described (e.g., Brunmelkamp et al., 2002, Science 296: 550; Paddison et al., 2002, Genes Develop. 16: 948; Paul et al., 2002, Nat. Biotechnol. 20: 505-508; (Grabarek) et al., 2003, BioTechniques 34: 734-44).

  A polynucleotide variant may contain one or more substitutions, additions, deletions and / or insertions such that the activity of the siRNA polynucleotide is not substantially reduced. The effect of any such modification of nucleotide content on the activity of siRNA polynucleotides can generally be assessed as described elsewhere in this document. The variants are preferably native A20, SUMO (SUMO1, SUMO2, SUMO3 and SUMO4), Foxj1, Foxo3a, TWIST (Twist1, Twist2), SOCS (SOCS1, SOCS2, SOCS3, SOCS4, SOCS6, and SOCS6, SOCS6, CS7). , Preferably at least about 75%, 78%, 80%, 85% to a portion of the polynucleotide sequence encoding PIAS (PIAS1, PIAS3, PIASx and PIASy), SHP (SHP-1 and SHP-2), etc. It exhibits 87%, 88% or 89% identity, and more preferably at least about 90%, 92%, 95%, 96% or 97% identity. The percent identity can be readily determined by comparing the sequence of the polynucleotide with the corresponding portion of the target polynucleotide using any method, including using computer algorithms well known to those skilled in the art. These algorithms include the Align or BLAST algorithm (Altschul, 1991, J. Mol. Biol. 219: 555-565; Henikoff and Henikov, 1992, Proc. Natl. Acad. Sci. USA 89: 10915-10919).

Some siRNA polynucleotide variants can be substantially homologous to a portion of the polynucleotide encoding the target polynucleotide. Single stranded polynucleotides derived from these polynucleotide variants have the ability to hybridize to naturally occurring DNA or RNA sequences encoding the target polypeptide under moderately stringent conditions. At least 10 consecutive siRNA polynucleotides that hybridize in a detectable manner to a polynucleotide sequence encoding a target polypeptide under moderately stringent conditions are complementary to a particular target polynucleotide Nucleotide sequence, more preferably 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides Can have. In some preferred embodiments, such siRNA sequences (or their complements) can be unique to a single specific polynucleotide that encodes a target polypeptide for which interference with expression is desired. . In some other embodiments, the sequence (or its complement) may be shared by two or more related polynucleotides that encode target polypeptides that are desired to interfere with polypeptide expression.

  Suitable moderately stringent conditions include, for example, pre-washing the polynucleotide in a solution of 5 × SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0); Hybridize polynucleotides at 5 × SSC for 1-16 hours (eg overnight); and then 2 ×, 0.5 × and 0 each containing 0.05-0.1% SDS Washing the polynucleotide once or twice with one or more of the 2X SSCs for 20-40 minutes at 22-65 ° C. For further stringency, hybridization conditions include additional washing in 0.1 × SSC and 0.1% SDS at 50-60 ° C. for 15-40 minutes. Those skilled in the art will appreciate that variations in the stringency of hybridization conditions can be achieved by modifying the concentration and / or temperature and time of the solution used for the prehybridization, hybridization and washing steps. That would be true. Appropriate conditions may also depend in part on the probe used and the specific nucleic acid sequence of the blotted proband nucleic acid sample. Thus, the desired selectivity of the polynucleotide is based on its ability to hybridize to one or more certain proband sequences while not hybridizing to certain other proband sequences. Once identified, it will be appreciated that appropriately stringent conditions can be readily selected without undue experimentation.

The sequence-specific siRNA polynucleotides of the present invention can be designed using one or more of a plurality of criteria. For example, to design a siRNA polynucleotide having about 21 contiguous nucleotides identical to a sequence encoding the polypeptide of interest, about 21 having one or more of the following characteristics: The reading frame of the polynucleotide sequence can be scanned over the length of the base sequence: (1) A + T / G + C ratio of about 1: 1, but not more than 2: 1 or 1: 2; (2) at the 5 ′ end An AA dinucleotide or CA dinucleotide; (3) an internal hairpin loop melting temperature below 55 ° C .; (4) a homodimer melting temperature below 37 ° C. (the melting temperature described in (3) and (4) Calculations can be determined by those skilled in the art using known computer software); (5) exist within some other known polynucleotide sequence. A sequence of at least 16 contiguous nucleotides not identified as present. Alternatively, siRNA polynucleotide sequences can be obtained from, for example, OligoEngine ^™ (Seattle, Wash.); Dharmacon, Inc. (Lafayette, Colo.); Ambion Commercially available from a variety of suppliers, such as Ambion Inc. (Austin, Tex.); And QIAGEN, Inc. (Valencia, Calif.). It can be designed and selected using software. See also Elbashir et al., 2000, Genes & Development 15: 188-200; Elbashir et al., 2001, Nature 411: 494-98. The siRNA polynucleotide can then be tested for the ability to interfere with expression of the target polypeptide according to methods known in the art and described elsewhere herein. Determining the effectiveness of a siRNA polynucleotide includes not only considering its ability to interfere with expression of the target polypeptide, but also whether the siRNA polynucleotide is toxic to the host cell. For example, the desired siRNA appears to exhibit RNA interference activity while not exhibiting undesirable biological consequences. An example of an undesirable biological consequence is apoptosis of a cell whose death as a result of introduction of siRNA into the host cell is not desired.

  Based on this disclosure, it should be understood that the siRNAs of the invention can result in silencing of target polypeptide expression to different degrees. Thus, siRNA must first be tested for its effectiveness. An siRNA is selected therefrom based on its ability to interfere with or modulate the expression of a target polypeptide possessed by a given siRNA. Accordingly, the production and testing of each siRNA is necessary to identify specific siRNA polynucleotide sequences that have the ability to interfere with the expression of the desired target polypeptide. Selection of appropriate siRNA for use in the present invention and methods for testing each siRNA are fully described in the examples herein. The present disclosure is also clinically relevant to the level of interference with target protein expression using the siRNA of the invention, since not all siRNAs that interfere with protein expression will have a physiologically significant effect. It also describes various physiologically relevant tests for determining whether they are significant.

  One skilled in the art will readily recognize that as a result of the degeneracy of the genetic code, many different nucleotide sequences can encode the same polypeptide. That is, an amino acid can be encoded by one of a plurality of different codons, and those skilled in the art will encode a polypeptide that actually has the same amino acid sequence, although one specific nucleotide sequence may differ from each other. Can be easily determined. Accordingly, the present invention specifically considers polynucleotides that vary due to different codon usage.

  siRNA polynucleotides can be prepared using any of a variety of techniques that are useful for the preparation of specifically desired siRNA polynucleotides. For example, a polynucleotide can be amplified from cDNA prepared from an appropriate cell or tissue type. Such polynucleotides can be amplified via the polymerase chain reaction (PCR). Using this approach, sequence-specific primers are designed based on the sequences provided herein, which can be purchased or synthesized directly. The amplified portion of the primer can be used to isolate the full length gene or a desired portion thereof from an appropriate DNA library using well known techniques. The library (cDNA or genome) is screened using one or more polynucleotide probes or primers suitable for amplification. Preferably, the library is sized to include larger polynucleotide sequences. Randomly primed libraries may also be preferred to identify 5 'and other upstream regions of genes. Genomic libraries are preferred for obtaining introns and extending 5 'sequences. The siRNA polynucleotides contemplated by the present invention can also be selected from a library of siRNA polynucleotide sequences.

For hybridization techniques, partial polynucleotide sequences can be labeled (eg, by nick translation or end labeling with ³² P) using well-known techniques. At this time, bacteria or bacteriophage libraries can be screened (eg, Sambrook et al.) By hybridization to a filter containing denatured bacterial colonies with labeled probes (or a lawn containing phage plaques). , “Molecular Cloning: A Laboratory
Manual ", Cold Spring Harbor Laboratories, Cold Spring Harbor, NY (see 2001), Cold Spring Harbor Laboratories, Cold Spring Harbor Laboratories, NY. Hybridizing colonies or plaques are selected and expanded, and the DNA is isolated for further analysis.

  Alternatively, a number of amplification techniques are known in the art for obtaining a full-length coding sequence from a partial cDNA sequence. Within the scope of such techniques, amplification is generally performed via PCR. One such technique is known as “fast amplification of cDNA ends” or RACE (eg, Sunbrook et al., “Molecular Cloning: A Laboratory Manual”, Cold Spring Harbor Laboratories, Cold, NY). (See Spring Harbor, 2001).

  A number of specific siRNA polynucleotide sequences useful for interfering with target polypeptide expression are presented in the examples, drawings and sequence listings herein. siRNA polynucleotides can generally be prepared by any method known in the art, including, for example, solid phase chemical synthesis. Modifications in the polynucleotide sequence can also be introduced using standard mutagenesis techniques such as oligonucleotide-directed site-directed mutagenesis. In addition, siRNA can be chemically modified or conjugated with other molecules to improve its stability and / or delivery properties. Included as an aspect of the present invention is an siRNA from which one or more ribose sugars have been removed, as described herein.

  Alternatively, the appropriate DNA sequence (eg, T7, U6, H1 or SP6, although other promoters may be equally useful), as long as the DNA is incorporated into the vector (eg, SiRNA polynucleotide molecules can be generated by in vitro or in vivo transcription of a polynucleotide sequence encoding a target polypeptide or a desired portion thereof. In addition, there are DNA sequences (eg, recombinant nucleic acid constructs as provided herein) that support transcription (and possibly applicable processing steps) in such a way that the desired siRNA is generated in vivo. As obtained, siRNA polynucleotides can be administered to a mammal.

  In one embodiment, siRNA polynucleotides capable of interfering with target polypeptide expression can be used to generate silenced cells. Any siRNA polynucleotide that results in a significant decrease in expression of the target polypeptide when contacted with a biological source for a period of time is included in the invention. Preferably, the decrease is greater than about 10%, more preferably greater than about 20%, more preferably greater than about 30%, more preferably about 40% relative to the expression level of the target polypeptide detected in the absence of siRNA. %, About 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or more than about 98%. Preferably, the presence of siRNA polynucleotides in the cell results in or causes some undesirable toxic effect, such as death of one cell or apoptosis where internal apoptosis is not the desired effect of RNA interference. It will never be.

In another embodiment, the siRNA polynucleotide results in a significant decrease in expression of the target polypeptide when contacted with the biological source for a period of time. Preferably, the decrease is about 10% to 20%, more preferably about 20% to 30%, more preferably about 30% to 40% in relation to the expression level of the target polypeptide detected in the absence of siRNA. , More preferably about 40% to 50%, more preferably about 50% to 60%.
%, More preferably about 60% to 70%, more preferably about 70% to 80%, more preferably about 80% to 90%, more preferably about 90% to 95%, more preferably about 95% to 98%. %. Preferably, the presence of intracellular siRNA polynucleotides does not result in or cause any undesirable toxic effects.

  In yet another embodiment, the siRNA polynucleotide results in a significant decrease in the expression of the target polypeptide when contacted with the biological source for a period of time. Preferably, the decrease is about 10% or more, more preferably about 20% or more, more preferably about 30% or more, more preferably about 40% relative to the expression level of the target polypeptide detected in the absence of siRNA. % Or more, more preferably about 50% or more, more preferably about 60% or more, more preferably about 70% or more, more preferably about 80% or more, more preferably about 90% or more, more preferably about 95% or more. More preferably, it is about 98% or more. Preferably, the presence of intracellular siRNA polynucleotides does not result in or cause any undesirable toxic effects.

  Accordingly, the present invention includes siRNA polynucleotides such as siRNA as exemplified in SEQ ID NOs: 1-3, 21-23 and 28-57. SEQ ID NOs: 1-3 and 21-23 are sequences of mouse and human siRNA candidate sequences for SOCS1, respectively. SEQ ID NOs: 28-33, 34-39, 40-45, 46-51 and 52-57 are the sequences of human siRNA candidate sequences for PIAS1, PIAS3, PIASx, PIASy and SHP-1, respectively. The sequence of siRNA is depicted in FIG.

  Other siRNA sequences encompassed by the present invention include mouse A20 siRNA: 5′-CAAAGCACUUAUUGAGAGA-3 ′, SEQ ID NO: 58; mouse SUMO-1 siRNA: 5′-GAUGUGAUGAGAGUUUAUC-3 ′, SEQ ID NO: 59; mouse Foxj1 siRNA: 5′-AGAUCACUCUGUCGGCCAU-3 ′, SEQ ID NO: 60; and mouse Twist-2 siRNA: 5′-GCGACGGAGAUGGACAAUAA-3 ′, SEQ ID NO: 61 (Twist-2 siRNA1) and 5′-CAAGAAAUCGAGCGAAGAU-3 ′ Twist-2 siRNA 2) is included.

  In another aspect, the invention comprises siRNA polynucleotides targeted to a desired negative immune regulator. Preferably, the siRNA is targeted to a negative immune modulator selected from the group consisting of A20, SUMO (SUMO1, SUMO2, SUMO3, SUMO4), Twist-1, Twist-2, Foxj1, Foxo3a and variants thereof. . Examples of target sequences for A20, SUMO1, SUMO2, SUMO3, SUMO4, Twist-1, Twist-2, Foxj1 and Foxo3a are SEQ ID NOS: 63-84, 85-92, 93-105, 106-112, 113-, respectively. 128, 129-136, 137-149, 150-161 and 162-185. The sequences of these siRNA target sequences are depicted in FIG.

Polynucleotide and polypeptide sequences for various negative immune regulators can be found in computerized databases known to those skilled in the art. One such database is the Genbank and GenPept databases of the National Center for Biotechnology Information. Nucleic acid sequences for these known genes are amplified, combined (eg, ligated) with sequences disclosed herein, and / or using techniques disclosed herein or known to those of skill in the art. It can be expressed by any technique that appears to be present (eg, Sunbrook et al., 2001). Although the nucleic acid can be expressed in an in vitro expression system, in preferred embodiments, the nucleic acid comprises a vector for in vivo replication and / or expression.

Modification of siRNA After production of the siRNA polynucleotides of the present invention, one of ordinary skill in the art will have certain characteristics that siRNA polynucleotides can be modified to improve siRNA as therapeutic compositions. Will understand. Thus, the siRNA polynucleotide may be further modified to include phosphorothioate or other linkages, methylphosphonates, sulfones, sulfates, ketyls, phosphorodithioates, phosphoramidates, phosphate esters, and the like. (Eg, Agrwal et al., 1987, Tetrahedron Lett. 28: 3539-3542; Stec et al., 1985, Tetrahedron Lett. 26: 2191). Moody et al., 1989, Nucleic Acids Res. 12: 4769-4782; Xtine, 1989, Trends Biol. Sci. 14: 97-100; Tine (Stein), "Oligodeoxynucleotides: Antisense Inhibitors of Gene Expression" in, Cohen eds., Macmillan Press, London, pp. 97-117 (1989) see).

  Any polynucleotide of the invention can be further modified to increase its stability in vivo. Possible modifications include the addition of flanking sequences at the 5 ′ and / or 3 ′ ends; the use of phosphorothioates or 2′O-methyl rather than phosphodiester in the main chain; and / or inosine, Non-traditional bases such as queuosine and wybutosine and acetyl-, methyl-, thio- and other modified forms of adenine, cytidine, guanine, thymine and uridine are included but are not limited thereto.

Vectors In other related aspects, the invention provides a nucleic acid comprising a promoter / regulatory sequence in an isolated nucleic acid encoding an inhibitor, preferably in such a way that the nucleic acid has the ability to direct expression of the protein encoded by the nucleic acid. An isolated nucleic acid that inhibits a negative immunomodulator operably linked to an inhibitor, preferably an siRNA. Thus, the present invention is disclosed in Sunbrook et al. (2001, “Molecular Cloning: A Laboratory Manual”, Cold Spring Harbor Laboratory, New York) and Ausubel et al. (1997, “Current Protocols in Molecular. Biology ", introduction of exogenous DNA into cells with co-expression of exogenous DNA in cells such as those described in John Wiley & Sons, New York) Expression vectors and methods for

  In another aspect, the invention includes a vector comprising an siRNA polynucleotide. Preferably, the siRNA polynucleotide has the ability to inhibit the expression of the target polypeptide, wherein the target polypeptide is A20, SUMO (SUMO1, SUMO2, SUMO3 and SUMO4), Foxj1, Foxo3a, TWIST (Twist1, Twist2), From the group consisting of SOCS (SOCS1, SOCS2, SOCS3, SOCS4, SOCS5, SOCS6, SOCS7 and CIS), PIAS (PIAS1, PIAS3, PIASx and PIASy), SHP (SHP-1 and SHP-2) or any combination thereof Selected. Incorporation of the desired polynucleotide into the vector and selection of the vector is well known in the art, as described, for example, in Sunbrook et al. (Supra) and Ausvel et al. (Supra).

  siRNA polynucleotides can be cloned into many types of vectors. However, the present invention should not be regarded as limited to any particular vector. Rather, the present invention should be construed to include a number of vectors that are readily available and / or well known in the art. For example, the siRNA polynucleotides of the present invention can be cloned into vectors, including but not limited to plasmids, phagemids, phage derivatives, animal viruses and cosmids. Particularly advantageous vectors include expression vectors, replication vectors, probe generation vectors and sequencing vectors.

  In certain embodiments, the expression vector is selected from the group consisting of a viral vector, a bacterial vector, and a mammalian cell vector. There are numerous expression vector systems that include at least a portion or all of the compositions described above. Prokaryotic and / or eukaryotic vector based systems may be utilized for use with the present invention to produce polynucleotides or their cognate polypeptides. Many such systems are commercially available and widely available.

  Furthermore, expression vectors can be provided to cells in the form of viral vectors. Viral vector technology is well known in the art and is described, for example, in Sunbrook et al. (2001), and in Außbel et al. (1997) and in other virology and molecular biology manuals. Viruses that are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. In general, suitable vectors contain an origin of replication that functions in at least one organism, a promoter sequence, a convenient restriction endonuclease site, and one or more selectable markers (eg, WO01 / 96584 pamphlet; WO 01/29058 pamphlet; and US Pat. No. 6,326,193).

  For siRNA expression, at least one module within each promoter functions to position the start site for RNA synthesis. The best known example of this is the TATA box, but within some promoters lacking the TATA box, such as the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 gene, The discrete elements above the start site itself serve to define the start location.

  Additional promoter elements or enhancers regulate the frequency of transcription initiation. Typically these are located in the region 30-110 bp upstream of the start site, but it has recently been shown that many promoters also contain functional elements downstream of the start site. The spacing between the promoter elements is often flexible so that the promoter function is maintained when the elements are reversed or moved in relation to each other. In the thymidine kinase (tk) promoter, the spacing between the promoter elements can be increased until they are separated by 50 bp before activity begins to decline. Depending on the promoter, it appears that individual elements can function cooperatively or independently to activate transcription.

A promoter can be one that is naturally associated with a gene or polynucleotide sequence, such as can be obtained by isolating a coding segment and / or a 5 ′ non-coding sequence upstream of an exon. Such promoters can be referred to as “endogenous” promoters. Similarly, an enhancer can be one that is naturally associated with a polynucleotide sequence located either downstream or upstream of the sequence. Alternatively, some advantage may be gained by positioning the coding polynucleotide segment under the control of a recombinant or heterologous promoter that usually means a promoter not associated with the polynucleotide sequence in its natural environment. become. A recombinant or heterologous enhancer also refers to an enhancer that is not normally associated with a polynucleotide sequence in its natural environment. Such promoters or enhancers include promoters and enhancers of other genes, and promoters or enhancers isolated from any other prokaryotic, viral or eukaryotic cell, and are not “naturally occurring”, ie different Promoters or enhancers containing mutations that alter different elements of the transcriptional regulatory region and / or expression may be included. In addition to synthetically producing promoter and enhancer nucleic acid sequences, the sequences are produced using recombinant cloning and / or nucleic acid amplification techniques, including PCR ^™ , in conjunction with the compositions disclosed herein. (US Pat. No. 4,683,202, US Pat. No. 5,928,906). In addition, it is believed that regulatory sequences leading to transcription and / or expression of sequences within non-nuclear organelles such as mitochondria and chloroplasts can be used as well.

  Of course, it will be important to utilize a promoter and / or enhancer that effectively directs the expression of the DNA segment in the cell type, organelle and organism chosen for expression. Those skilled in molecular biology generally know how to use a combination of promoters, enhancers and cell types for the expression of proteins. See, for example, Sunbrook et al. (2001). The promoter utilized is useful and / or configured under appropriate conditions to direct high level expression of the introduced DNA segment, which is advantageous in large scale production of recombinant proteins and / or peptides. It can be sex, tissue specific, or induced. Promoters can be heterologous or endogenous.

  The promoter sequence illustrated in the experimental examples presented herein is the early early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence with the ability to drive high level expression of any operably linked polynucleotide sequence. However, Simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, Moloney virus promoter, avian leukemia virus promoter, Epstein-Barr virus early promoter, Other constitutive properties including (but not limited to) the rous sarcoma virus promoter and the human gene promoter including but not limited to the actin promoter, myosin promoter, hemoglobin promoter and muscle creatine promoter. Promoter sequences can be used as well. Furthermore, the present invention should not be limited to the use of constitutive promoters. Inducible promoters are considered as part of the present invention. The use of an inducible promoter in the present invention provides a molecular switch that can turn on expression of a polynucleotide sequence that is operably linked when expression is desired, and turn off expression when expression is not desired. To do. Examples of inducible promoters include, but are not limited to, metallothionine promoter, glucocorticoid promoter, progesterone promoter and tetracycline promoter. Furthermore, the present invention includes the use of tissue specific promoters that are active only in the desired tissue. Tissue specific promoters are well known in the art and include, but are not limited to, the HER-2 promoter and PSA-related promoter sequences.

To assess siRNA expression, the expression vector to be introduced into one cell also contains either a selectable marker gene or reporter gene or both to facilitate identification and selection of viral vectors. can do. In other embodiments, the selectable marker can be carried on a separate piece of DNA and used in a co-transfection procedure. Both the selectable marker and the reporter gene can be flanked with appropriate regulatory sequences to allow expression in the host cell. Useful selectable markers are known in the art and include antibiotic resistance genes such as neo.

  Reporter genes are used to identify potentially transfected cells and to evaluate the functionality of regulatory sequences. Reporter genes encoding for readily assayable proteins are well known in the art. In general, a reporter gene is a gene that encodes a protein that is not present in or expressed by the recipient organism or tissue, and whose expression is revealed by some readily detectable property, such as enzymatic activity, for example. It is. Reporter gene expression is assayed an appropriate time after the DNA is introduced into the recipient cell.

  Suitable reporter genes may include luciferase, beta-galactosidase, chloramphenicol acetyltransferase, a gene encoding secreted alkaline phosphatase or a green fluorescent protein gene (eg, Ui-Tei et al. 2000, FEBS Lett. No. 479: 79-82). Suitable expression systems are well known and are prepared using well known techniques or are commercially available. Internal deletion constructs can be generated using unique internal restriction sites or by partial digestion of non-unique restriction sites. The construct can then be transfected into cells that display high levels of siRNA polynucleotide and / or polypeptide expression. In general, a construct with a minimal 5 'flanking region that exhibits the highest level of expression of a reporter gene is identified as a promoter. Such a promoter region is linked to a reporter gene and can be used to evaluate an agent for its ability to modulate promoter-driven transcription.

Generating Silenced Immune Cells In one embodiment, the present invention provides a cell-based system for expressing inhibitors of negative immune modulators in cells. A cell-based system means a “silenced cell” and comprises an expression vector for expressing the cell and the inhibitor. However, the present invention is not limited to cells comprising an expression vector; rather, the silenced cells of the present invention include any type of inhibitor of the present invention, ie cells modified with chemically synthesized siRNA. Should be construed as including. In any case, a silenced cell comprising an inhibitor has a higher immunity compared to a cell that is otherwise identical but not yet silenced with an inhibitor. . The silenced cells are suitable for administration to a mammalian recipient, either alone or in combination with other therapies.

  The present invention includes cells comprising inhibitors of negative immune modulators. In one embodiment, the inhibitor is A20, SUMO (SUMO1, SUMO2, SUMO3 and SUMO4), Foxj1, Foxo3a, TWIST (Twist1, Twist2), SOCS (SOCS1, SOCS2, SOCS3, SOCS4, SOCS5, SOCS6, SOCS7, SOCS7). , Have the ability to inhibit at least one of PIAS (PIAS1, PIAS3, PIASx and PIASy), SHP (SHP-1 and SHP-2), and the like. In one aspect, the cells can be transfected with a vector comprising a polynucleotide encoding the inhibitor. The polynucleotide need not be incorporated into the cell. In another embodiment, the cell need not have been transfected with the vector, but rather, the cell is exposed to an inhibitor that is not expressed from the vector. An example of such an inhibitor is a chemically synthesized siRNA.

In the context of an expression vector, the vector can be easily introduced into a host cell, such as a mammalian, bacterial, yeast or insect cell, by any method in the art. For example, an expression vector can be transferred into a host cell by physical, chemical or biological means. It can be readily appreciated that the introduction of an expression vector comprising a polynucleotide of the present invention produces a cell that is silenced in the context of a negative immune regulator.

  Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells comprising vectors and / or exogenous nucleic acids are well known in the art. For example, Sunbrook et al. (2001, “Molecular Cloning: A Laboratory Manual”, Cold Spring Harbor Laboratory, New York) and Ausbell et al. (1997, “Current Protocols in Molecular Biology”, John Willy and. (Sands, New York).

  Biological methods for introducing advantageous polynucleotides into host cells include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors, have become the most widely used method for inserting genes into mammalian cells such as humans. Other viral vectors can be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses. See, for example, US Pat. Nos. 5,350,674 and 5,585,362.

  Chemical means for introducing polynucleotides into host cells include macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles and liposomes. Colloidal dispersions are included. A preferred colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (ie, an artificial membrane vesicle). The preparation and use of such systems is well known in the art.

  Regardless of the method used to introduce exogenous nucleic acid into the host cell or otherwise expose the cell to the inhibitors of the present invention to confirm the presence of the recombinant DNA sequence in the host cell. Various tests can be performed. Such assays include, for example, “molecular biology” assays well known to those skilled in the art, such as Southern and Northern blots, RT-PCR and PCR; described herein for identifying agents that fall within the scope of the invention Included are “biochemical” assays such as detecting the presence or absence of a particular peptide by an assay performed or by immunological means (ELISA and Western blot).

  To generate a silenced cell, any DNA vector or delivery vehicle can be utilized to transfer the desired siRNA polynucleotide to the immune cell in vitro or in vivo. When non-viral delivery systems are utilized, the preferred delivery vehicle is a liposome. Thus, the delivery systems and protocols described above are described in “Gene Targeting Protocols”, 2nd edition, pages 1-35 (2002) and “Gene Transfer and Expression Protocols”, Vol. 7, edited by Murray, 81-89. Can be found in the page (1991).

The use of lipid formulations is contemplated to introduce inhibitors of the negative immunomodulators of the present invention into host cells (in vitro, ex vivo or in vivo). In certain embodiments of the invention, the inhibitor can be associated with a lipid. Inhibitors associated with lipids are either encapsulated within the aqueous interior of the liposome, dispersed within the lipid bilayer of the liposome, or via a linking molecule associated with both the liposome and the oligonucleotide. Attached to, incorporated into liposomes, complexed with liposomes, dispersed in a solution containing lipids, mixed with lipids, combined with lipids, suspended in lipids It can be contained as a product, contained with micelles, complexed, complexed or otherwise associated with lipids. The lipid, lipid / siRNA or lipid / expression vector association composition of the present invention is not limited to any particular structure in solution. For example, within a bilayer structure, it may exist as micelles or with a “collapsed” structure. They can also be simply scattered in the solution and in some cases form aggregates that are not uniform in size or shape.

  Lipids are fatty substances that can be naturally occurring or synthetic lipids. For example, lipids include naturally occurring fatty droplets in the cytoplasm, as well as types of compounds well known to those skilled in the art, including long chain aliphatic hydrocarbons and derivatives thereof, such as fatty acids, alcohols, amines, amino alcohols. And aldehyde.

  Phospholipids can be used to prepare the liposomes according to the present invention, which can carry a net positive charge, a negative charge or a neutral charge. Diacetyl phosphate can be used to impart a negative charge on the liposome, and stearylamine can be used to impart a positive charge on the liposome. Liposomes can be made of one or more phospholipids.

  Neutral charged lipids can comprise uncharged lipids, substantially uncharged lipids or lipid mixtures having the same number of positive and negative charges. Suitable phospholipids include phosphatidylcholine and others well known to those skilled in the art.

  Lipids suitable for use according to the present invention are available from commercial sources. For example, dimyristylphosphatidylcholine (“DMPC”) is available from Sigma Chemical Co. (St. Louis, Mo.) and dicetyl phosphate (“DCP”) is available from K And K Laboratories (Plainview, NY); cholesterol (“Chol”) is obtained from Calbiochem-Behring; dimyristyl phosphatidylglycerol (“DMPG”) )) And other lipids are available from Avanti Polar Lipids, Inc. (Birmi, Alabama). Gham, may be obtained from the AL)). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at about -20 ° C. Preferably, chloroform is used as the only solvent because it evaporates more easily than methanol.

  Phospholipids from natural sources such as egg or soy phosphatidylcholine, brain phosphatidic acid, brain or plant phosphatidylinositol, heart cardiolipin and plant or bacterial phosphatidylethanolamine can result in unstable and prone to leakage of the resulting liposomes It is preferably not used as the primary phosphatide, ie the phosphatide constituting more than 50% of the total phosphatide composition.

“Liposome” is a generic term encompassing various single and multilamellar lipid vehicles formed by the formation of encapsulated lipid bilayers or aggregates. Liposomes can be characterized as having a vesicular structure with a phospholipid bilayer membrane and an internal aqueous medium. Multilamellar liposomes have multiple lipid layers separated by an aqueous medium. These form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid component undergoes self-rearrangement prior to the formation of a closed structure, encapsulating water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). However, the present invention also includes a composition having a dissolved structure different from a normal vesicular structure. For example, lipids can have a micellar structure or can simply exist as heterogeneous aggregates of lipid molecules. Also considered are lipofectamine-nucleic acid complexes.

  Phospholipids can form various structures other than liposomes when dispersed in water, depending on the molar ratio of lipid to water. At low ratios, liposomes are the preferred structure. The physical characteristics of liposomes depend on pH, ionic strength and / or the presence of divalent cations. Liposomes may exhibit low permeability to ions and / or polar substances, but at high temperatures undergo a phase transition that significantly modifies their permeability. Phase transitions involve from tightly packed ordered structures known as gel states to loosely packed and less ordered structures known as fluid states. This occurs at a characteristic phase transition temperature and / or results in increased permeability to ions, sugars and / or drugs.

  Liposomes have four different mechanisms: endocytosis by phagocytic cells of the reticuloendothelial system such as macrophages and / or neutrophils; nonspecific weakly hydrophobic and / or electrostatic forces, and / or cell-surface components. Adsorption to the cell surface by either specific interaction with the plasma; fusion with the plasma cell membrane by insertion of a lipid bilayer of the liposome into the plasma membrane with simultaneous release of the contents of the liposome into the cytoplasm; and It interacts with cells via mechanisms such as by transfer of liposomal lipids to cells and / or intracellular membranes and / or vice versa, without association of liposome contents. Varying the liposome formulation can alter which mechanism is in operation, but two or more can also operate simultaneously.

  In vitro expression of exogenous DNA and liposome-mediated oligonucleotide delivery have been very successful. Wong et al. (1980) demonstrated the feasibility of exogenous DNA expression and liposome-mediated delivery in cultured chicken embryos, HeLa and hepatoma cells. Nicolau et al. (1987) have had successful liposome-mediated gene transfer in rats after intravenous injection.

  In some embodiments of the invention, the lipid may be associated with Sendai virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al., 1989). In other embodiments, the lipid can be complexed or combined with nuclear non-histone chromosomal protein (HMG-1) (Kato et al., 1991). In yet another embodiment, the lipid can be complexed or combined with both HVJ and HMG-1. Since such expression vectors have been successfully used in oligonucleotide transfer and expression in vitro and in vivo, they can now be applied for the present invention. If a bacterial promoter is utilized in the DNA construct, it may also be desirable to include an appropriate bacterial polymerase inside the liposome.

  Liposomes used according to the present invention can be made in different ways. The size of the liposome varies depending on the synthesis method. Liposomes suspended in an aqueous solution are generally in the form of spherical vesicles having one or more concentric layers of lipid bilayer molecules. Each layer consists of parallel rows of molecules represented by structural formula XY where X is a hydrophilic moiety and Y is a hydrophobic moiety. In aqueous suspension, the concentric layers are arranged so that the hydrophilic portion tends to stay in contact with the aqueous phase and the hydrophobic regions tend to self-associate. For example, when an aqueous phase is present both inside and outside the liposome, lipid molecules can form a bilayer known as a lamella with the configuration XY-YX. Lipid aggregates can form when the hydrophilic and hydrophobic portions of two or more lipid molecules become associated with each other. The size and shape of these aggregates will depend on many different variables such as the nature of the solvent and the presence of other compounds in the solution.

  Liposomes falling within the scope of the invention can be prepared according to known laboratory techniques. In one preferred embodiment, liposomes are prepared by mixing liposomal lipids in a solvent in a container such as a glass, pear flask. The container should have a volume that is 10 times greater than the expected volume of the liposome suspension. The solvent is removed at about 40 ° C. under negative pressure using a rotary evaporator. The solvent is usually removed within about 5 minutes to 2 hours, depending on the desired volume of the liposomes. The composition can be further dried in a desiccator under vacuum. Dried lipids are generally disposed after about a week because they tend to degrade over time.

  The dried lipid can be hydrated with about 25-50 mM phospholipid in sterile, pyrogen-free water by shaking until all lipid film is resuspended. At this time, the liposomal water can be separated into aliquots, each placed in a vial, lyophilized, and sealed under vacuum.

  Alternatively, liposomes may be used in other known laboratory procedures, ie, the method of Bangham et al. (1965), the contents of which are hereby incorporated by reference; the contents of which are incorporated herein by reference. "Drug Carriers in Biology and Medicine", G. Gregoriadis, Ed. (1979) Gregoriadis method as described on pages 287-341; “the method of Deamer and Uster”, 1983, the contents of which are incorporated by reference in the present invention. And the reverse phase evaporation method as described by Szoka and Papahadjopoulos, 1978. The methods described above differ with respect to their respective ability to encapsulate aqueous materials and their respective water space to lipid ratios.

  Lyophilized liposomes or dried lipids prepared as described above can be dehydrated and reconstituted in a solution of inhibitory peptides and diluted to a suitable concentration with a suitable solvent, such as DPBS. The mixture is then vigorously shaken in a vortex mixer. Unencapsulated nucleic acid is removed by centrifugation at 29,000 × g and the liposome pellet is washed. The washed liposomes are resuspended at an appropriate total phospholipid concentration, eg, about 50-200 mM. The amount of nucleic acid encapsulated can be determined according to standard methods. After determining the amount of nucleic acid encapsulated in the liposome preparation, the liposomes can be diluted to an appropriate concentration and stored at 4 ° C. until use.

Generation of activated (pulsed) immune cells The invention includes cells that have been exposed or otherwise “pulsed” with an antigen and activated by the antigen. For example, APC can be Ag-loaded in vitro by ex vivo culture in the presence of the antigen or in vivo by exposure to the antigen.

  It is also easy for those skilled in the art to “pulse” APC in such a way that APC is exposed to the antigen for a time sufficient to promote presentation of that antigen on the surface of the APC. Seems to understand. For example, APC can be exposed to an antigen such that a small peptide fragment known as an antigenic peptide is “pulsed” directly outside the APC (Mehta-Damani et al., 1994); Otherwise, APC can be incubated with whole protein or protein particles that will later be ingested by APC. All these proteins are digested into small peptide fragments by APC and are sometimes transported to and presented on the APC surface (Cohen et al., 1994). Peptide forms of antigen can be exposed to cells by the standard “pulse” technique described herein.

  While not wishing to be bound by any particular theory, foreign antigens or antigens in the form of autoantigens are processed by the APCs of the present invention in order to retain the immunogenic form of the antigen. An immunogenic form of an antigen implies the processing of the antigen through fragmentation in order to produce a form of the antigen that can be recognized by and stimulates immune cells such as T cells. Preferably, such foreign or autoantigen is a protein that is processed into a peptide by APC. Relevant peptides produced by APC can be extracted and purified for use as an immunogenic composition. Peptides processed by APC can also be used to induce tolerance to proteins processed by APC.

  Autoimmune diseases are the result of an immune response directed against a “self-protein” otherwise known as an autoantigen, ie, an autoantigen present in or endogenous to one individual. It is thought to be brought about. In an autoimmune response, these “self proteins” are presented to T cells, thus conferring “self-reactivity”. According to the method of the invention, APCs are pulsed with an antigen to produce the relevant “self-peptide”. Relevant self-peptides are different for each individual because the MHC product is highly polymorphic and each individual MHC molecule can bind to a different peptide fragment. “Self peptides” and agonists of inhibitors of cytokine signaling can then be used to design competing peptides or induce tolerance to self proteins in individuals in need of treatment.

  Antigen activated APC, otherwise known as “pulsed APC” of the present invention, is produced by exposing APC to an antigen either in vitro or in vivo. When APC is pulsed in vitro, it is plated on a culture dish and exposed to the antigen for a sufficient amount of time for the antigen to bind to the APC. The amount and time required to achieve antigen binding to APC can be determined by using methods known in the art or otherwise disclosed herein. Other methods known to those skilled in the art can be used to detect the presence of the antigen on the APC after exposure to the antigen, such as an immunoassay or binding assay.

  In a further embodiment of the invention, APC can be transfected with a vector that allows expression by a specific protein by APC. At this time, the protein expressed by APC can be processed and presented on the cell surface on the MHC receptor. The transfected APC can then be used as an immunogenic composition to generate an immune response against the protein encoded by the vector.

  As discussed elsewhere in this document, vectors can be prepared to contain specific polynucleotides that encode and express proteins for which an immunogenic response is desired. Preferably, retroviral vectors are used to infect cells. More preferably, an adenoviral vector is used to infect cells.

  In another embodiment of the invention, the vector can be targeted to APC by modifying the viral vector to encode a protein or portion thereof recognized by a receptor on the APC, thus the vector-based APC receptor. Occupancy will allow the processing and presentation of the antigen encoded by the viral vector nucleic acid. The nucleic acids delivered by the virus are natural to the virus when encoded on the APC, which encodes the viral proteins and these viral proteins are then processed and presented on the APC MHC receptor. It is.

  As discussed elsewhere in this document, various methods can be used to transfect a polynucleotide into a host cell. The method includes calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, colloidal dispersion (ie, macromolecular complexes, nanocapsules, microspheres, beads and oil-in-water emulsions, micelles, mixed micelles and liposomes. Including, but not limited to, lipid-based systems).

In another embodiment, the polynucleotide encoding the antigen can be cloned into an expression vector, and the vector can be introduced into APC to otherwise produce activated APC. Various types of vectors and methods for introducing nucleic acids into cells are discussed elsewhere in this document. For example, a vector encoding an antigen can be introduced into a host cell by any method in the art. For example, the expression vector can be transferred into the host cell by physical, chemical or biological means. For example, Sanbrook et al. (2001, “Molecular Cloning: A Laboratory Manual”, Cold Spring Harbor Laboratory, New York), and Ausbell et al. (1997, “Current Protocols in
See "Molecular Biology", John Willy and Sons, New York). It will be readily appreciated that the introduction of an expression vector comprising a polynucleotide encoding an antigen produces a pulsed cell.

  The present invention includes various methods for pulsing APC, including (but not limited to) loading APC with a whole antigen in the form of a protein, cDNA or cRNA. However, the present invention should not be construed as limited to the particular form of antigen used to pulse APC. Rather, the present invention also encompasses other methods known in the art for generating antigen-loaded APCs. Preferably, the APC undergoes transfection with mRNA encoding a defined antigen. MRNA corresponding to a gene product whose sequence is known can be rapidly generated in vitro using reverse transcriptase-polymerase chain reaction (RT-PCR) combined with appropriate primers and transcription reactions. Transfection of APC with mRNA offers one advantage over other antigen loading techniques for generating pulsed APC. For example, the ability to amplify RNA from minute amounts of tissue, ie tumor tissue, expands the use of APC for vaccination against a large number of patients.

  Antigens can be derived from viruses, fungi or bacteria. The antigen may be an antigen or autoantigen associated with a disease selected from the group consisting of infectious diseases, cancer, autoimmune diseases.

In order for one antigen composition to be useful as a vaccine, the antigen composition must elicit an immune response against the antigen in a cell, tissue or mammal (eg, a human). An “immunological composition” as used herein comprises an antigen (eg, a peptide or polypeptide), a nucleic acid encoding the antigen (eg, an antigen expression vector), a cell that expresses or presents the antigen or cell composition. . In certain embodiments, the antigen composition comprises or encodes all or a portion of any antigen described herein or an immunological functional equivalent thereof. In other embodiments, the antigen composition is in a mixture comprising additional immunostimulatory agents or nucleic acids encoding such agents. Immunostimulatory agents include, but are not limited to, additional antigens, immunomodulators, antigen presenting cells or adjuvants. In other embodiments, one or more of the additional agents are covalently bound to the antigen or immunostimulatory agent in any combination. In some embodiments, the antigen composition is conjugated to or comprises an HLA anchor motif amino acid.

  The vaccine of the present invention may vary in the composition of its nucleic acid and / or cell composition. In a non-limiting example, the nucleic acid encoding the antigen can be formulated with an adjuvant. Of course, it will also be understood that the various compositions described herein may include additional compositions. For example, one or more vaccine compositions can be included in a lipid or liposome. In another non-limiting example, the vaccine may comprise one or more adjuvants. The vaccine of the invention and its various components can be prepared and / or administered by any method disclosed herein or as would be known to one of ordinary skill in the art in light of this disclosure.

  The antigen composition of the present invention is a peptide or polypeptide comprising the antigen of the present invention in a chemical synthesis by solid phase synthesis and purification from other products of chemical reaction by HPLC, or in an in vitro translation system or in a living cell. It has been found that can be made by methods well known in the art, including but not limited to production by expression of a nucleic acid sequence encoding (eg, a DNA sequence). Further, the antigen composition can comprise a cell composition isolated from a biological sample. Preferably, the antigen composition is isolated and lyophilized to be extensively dialyzed and / or more easily formulated into the desired vehicle to remove one or more undesirable low molecular weight molecules. . Furthermore, it is also understood that if there are additional amino acids, mutations, chemical modifications, etc. made (performed) in the vaccine composition, these preferably do not substantially interfere with antibody recognition of the epitope sequence. Yes.

  Peptides or polypeptides corresponding to one or more antigenic determinants of the invention generally must be at least 5 or 6 amino acids in length, up to about 10, about 15, about 20, about It may contain 25, about 30, about 35, about 40, about 45, or about 50 residues. Peptide sequences can be synthesized by methods known to those skilled in the art, such as peptide synthesis using an automated peptide synthesizer such as those available from Applied Biosystems (Foster City, Calif.).

  Longer peptides or polypeptides can also be prepared, such as by recombinant means. In some embodiments, the antigen compositions and / or components described herein are used, for example, for the purpose of producing the antigen compositions in vitro or in vivo for the various compositions and methods of the invention. It is possible to use encoding nucleic acids. For example, in some embodiments, the nucleic acid encoding the antigen is contained within a vector, eg, in a recombinant cell. Nucleic acids can be expressed to produce peptides or polypeptides that comprise an antigen sequence. The peptide or polypeptide can be secreted from the cell or can be contained as part of or within the cell.

  In some embodiments, an immune response can be promoted by transfecting or inoculating a mammal with a nucleic acid encoding an antigen. At this time, one or more cells contained within the target mammal express a sequence encoded by the nucleic acid after administration of the nucleic acid to the mammal. A vaccine may also be in the form of a nucleic acid (eg, cDNA or RNA) encoding, for example, all or part of a peptide or polypeptide sequence of one antigen. In vivo expression by a nucleic acid can be, for example, by a plasmid-type vector, a viral vector, or a virus / plasmid construct vector.

In a preferred embodiment, the nucleic acid comprises a coding region that encodes all or a portion of the sequence encoding the appropriate antigen, or an immunologically functional equivalent thereof. It will be appreciated that the nucleic acid comprises additional sequences, including but not limited to those comprising one or more immunomodulatory agents or adjuvants, and / or Can be coded.

Tumor-associated antigen The term “tumor antigen” or “hyperproliferative disorder antigen” or “antigen associated with a hyperproliferative disorder” in the context of the present invention means an antigen common to a particular hyperproliferative disorder. In some aspects, the hyperproliferative disorder antigen of the invention comprises primary or metastatic malignant melanoma, thymoma, lymphoma, sarcoma, lung cancer, liver cancer, non-Hodgkin lymphoma, Hodgkin lymphoma, leukemia, uterine cancer, Derived from cancers including, but not limited to, cervical cancer, bladder cancer, kidney cancer and adenocarcinoma such as breast cancer, prostate cancer, ovarian cancer, pancreatic cancer and the like.

  In one embodiment, the tumor antigens of the invention comprise one or more antigenic cancer epitopes that are immunologically recognized by tumor infiltrating lymphocytes (TILs) derived from mammalian cancer tumors. .

  Malignant tumors express a certain number of proteins that can serve as target antigens for immune attack. These molecules include, but are not limited to, tissue specific antigens such as MART-1, tyrosinase and GP-100 in melanoma and prostate acid phosphatase (PAP) and prostate specific antigen (PSA) in prostate cancer. Do not mean. Other target molecules belong to the group of transformation-related molecules such as the oncogene HER-2 / Neu / ErbB-2. Yet another target antigen group is oncofetal antigens such as carcinoembryonic antigen (CEA). In B-cell lymphoma, tumor-specific idiotype immunoglobulins constitute truly tumor-specific immunoglobulin antigens that are unique to individual tumors. B cell differentiation antigens such as CD19, CD20 and CD37 are other candidates for target antigens in B cell lymphomas. Some of these antigens (CEA, HER-2, CD19, CD20, idiotype) have been used with some success as targets for passive immunotherapy with monoclonal antibodies.

Tumor antigens and their antigenic cancer epitopes can be purified and isolated from natural sources such as primary clinical isolates, cell lines, and the like. Cancer peptides and their antigenic epitopes can also be obtained by chemical synthesis or recombinant DNA techniques known in the art. Techniques for chemical synthesis are: Steward et al. (1969); Bodansky et al. (1976); Meienhofer (1983); and Schroder et al. (1965). ). In addition, a number of antigens are known in the art, as described in Renkvist et al. (2001). The table below describes the epitopes identified in T cells encoded by tumor antigens, listing only those tumor antigens (either cytotoxic CD8 + or helper CD4 +) that are recognized by T cells. . Although analogs or artificially modified epitopes are not listed, those skilled in the art will recognize how to obtain or generate them by standard means in the art. Other antigens identified by antibodies and detected by the Serex method (see Sahin et al., (1997) and Chen et al., (2000)) include the Ludouing Institute for Cancer. Research (Ludwig)
Identified in the Institute for Cancer Research database.

Pathogen antigens Pathogen antigens can be derived from viruses, bacteria or fungi. Examples of infectious viruses include retroviridae (eg, human immunodeficiency virus such as HIV-1 (HTLV-III
, LAV or HTLV-III / LAV, or HIV-III): and other isolates such as HIV-LP; Picoraviridae (eg, polioviruses, hepatitis A virus) enteroviruses; human coxsackie viruses, rhinoviruses, echoviruses; calciviridae (for example, gastroenteritis) Togaviridae (eg equine encephalitis virus, rubella virus) (Rubella virus)); Flaviviridae (eg, dengue virus, encephalitis virus, yellow fever virus) or coronaviridae For example, coronaviruses); Rhabdoviridae (eg, vesicular stomatitis viruses, rabies viruses (Firoviridae), for example, Firoviridae (Firoviridae) ebolavirus)); Paramyxoviridae idae) (eg parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus (RS) virus) Viridae (for example, influenza virus (influenza virus) class); Nairoviruses); Arenaviridae (Arena) viridae (hemorrhagic fever viruses); Reoviridae (eg, reoviruses, orbiviruses and rotaviruses); (Birnaviridae); Hepadnaviridae (Hepatitis B virus); Parvoviridae (Parvoviridae); ), Polyomavirus (Polyomavirus)); Adenoviridae Adenoviridae (most adenoviruses); Herpesviridae (Herpes simplex virus (HSV) 1 and 2, varicella zoster virus (Varicella zoster virus) cytomegalovirus (CMV)), herpes viruses); Poxviridae (variola viruses), vaccinia viruses, poxvirus (pox)
viruses)); and Iridoviridae (eg, African swinever virus); Unclassified viruses (eg, Spongiform encephalopathy pathogens, hepatitis B What is considered an incomplete incidental virus), non-A, non-B hepatitis pathogens (class 1 = oral infection, class 2 = parenteral infection (ie, hepatitis C)); Norwalk And related viruses, and astroviruses).

Examples of infectious bacteria include Helicobacter pylori
oris), Borrelia burgdorferi Borelia burgdorferi, Legionella pneumophilia, Mycobacterium species (for example, M. tuberculosis, M. tuberculum (M. M. intracellulare, M. kansai, M. gordonae, Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis
meningitidis), Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Streptococcus agalactiae) (Streptococcus staphylococcus p Group (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus species, Streptococcus spp., Streptococcus spp. , Enterocytes Enterococcus spp., Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium spp. Clostridium
tetani), Enterobacter aerogenes (Enterobacter aerogenes), Klebsiella pneumoniae (Klebsiella pneumoniae), Pasteurella Murutochida (Pasturella multocida), Bacteroides (Bacteroides) species, Fusobacterium Nutareatsumu (Fusobacterium nucleatum), Streptomyces Bacillus Las Moniriforumisu (Streptobacillus moniliformis), Treponema, Tremone pertenue, Leptospira and Actinomyces israelli are included.

  Examples of infectious fungi include Cryptococcus neoformans, Histoplasma capsultatum, Coccidioides imtis, Blastomyces dermatoid B. Chlamydia trachomatis), Candida albicans. Other infectious organisms (ie, protists) include tropical Plasmodium falciparum and Toxoplasma gondii.

Silenced and pulsed immune cells In another embodiment, cells can be isolated from cultures, tissues, organs or organisms and administered to a mammal as a cellular vaccine. Thus, the present invention contemplates “cellular vaccines”. Of course, the cells can also express one or more additional vaccine components, such as immunomodulators or adjuvants. The vaccine may comprise all or part of the cells. In a preferred embodiment, the cellular vaccine of the present invention comprises human APC, and in a more preferred embodiment, the APC is DC.

  A cellular vaccine may comprise APC that has been silenced according to the present invention to enhance its immune capacity. The silenced APC can then be transfected with the nucleic acid encoding the antigen to produce antigen-loaded cells. In another embodiment, the silenced APC can be pulsed with an immunostimulatory protein containing the antigen to generate antigen-loaded cells. Based on the present disclosure, the silenced APC can be pulsed in any way utilizing any type of antigen to load the antigen. Furthermore, APC can be pulsed by any method prior to, simultaneously with, or after silencing of APC with the inhibitors of the present invention.

  As disclosed elsewhere herein, a variety of methods can be used to pulse cells with antigen. The antigen of the present invention contains at least one epitope, wherein said epitope is capable of eliciting an immune response in a mammal. In one embodiment, the antigen is expressed by an expression vector. In another embodiment, the antigen is an isolated polypeptide. Preferably, the antigen is associated with one disease selected from the group consisting of infectious diseases, cancer and autoimmune diseases. A number of preferred antigens useful in pulsing the cells of the invention are disclosed elsewhere in this document. The antigen can take the form of at least one or more of tumor lysates, proteins, peptides, mRNA, DNA expressed from vectors, liposomes, and the like.

  Silenced APCs with inhibitors of negative immune regulators have an increased immune capacity, thus eliciting an enhanced immune response, ie an enhanced ability to present and activate an immune response thereto To do. APCs that have been silenced and pulsed in accordance with the present invention stimulate effector T cells and have improved immunity against antigens compared to otherwise identical APCs that have not been silenced. Invoke a response.

Therapeutic Applications The present invention includes compositions useful for enhancing the immune capacity of immune cells such as APC. The response to an antigen presented by APC can be measured by monitoring the induction of a cytolytic T cell response, a helper T cell response and / or an antibody response to the antigen using methods well known in the art.

  The present invention relates to a method for enhancing an immune response in a mammalian body comprising the step of contacting an antigen composition with one or more lymphocytes, wherein the antigen is presented by immune cells such as APC. Including. Based on the present disclosure, APC can be silenced by exposure to inhibitors of negative immune modulators, thus exposure to inhibitors enhances the immune capacity of APC. The APC can be silenced using the methods disclosed herein prior to, simultaneously with, or after exposing the APC to the antigen composition to otherwise pulse the APC.

  The enhanced immune response can be an active or passive immune response. The response is that APCs such as dendritic cells, B cells or monocytes / macrophages are obtained from mammals (eg patients) and then (against negative immunomodulator inhibitors to silence immune cells in other ways). It may be part of an adoptive immunotherapy approach in which APC is administered to a mammal in need thereof, pulsed with a composition comprising an antigen composition (before, simultaneously with, or after cell exposure).

The composition comprises at least one or more of a negative immune modulator, an antigen, a silenced immune cell, a pulsed cell, and a silenced immune cell that is also pulsed with an antigen. Includes any combination of the above. The composition can be a vaccine for ex vivo immunization and / or in vivo therapy in a mammal. Preferably the mammal is a human.

  In connection with ex vivo immunization, at least one of the following occurs in vitro prior to administering the cells into the mammal. I) cell silencing, ii) cell pulse or iii) cell silencing and pulse. The immune cells of the present invention can be treated using the methods disclosed elsewhere herein before, simultaneously with, or after treatment of the APC with an antigen to pulse the immune cells. It should be fully understood that it can be silenced.

  In another embodiment, the silenced APC can be administered to a patient in need without prior in vitro exposure to the antigen. That is, the present invention encompasses the administration of a silenced APC to a patient in which a pulse of cells occurs in vivo within the patient's body.

  In yet another embodiment, pulsed APCs can be administered to patients in need thereof without prior in vitro exposure of cells to inhibitors of negative immune modulators. That is, the present invention encompasses the administration of pulsed APCs to a patient, where cell silencing occurs in vivo in the patient's body.

  Ex vivo procedures are well known in the art and are described in further detail below. Briefly, a cell is isolated from a mammal (preferably a human) and a vector expressing an inhibitor of a negative immune regulator or any other form of negative immune regulator disclosed herein (ie, Chemically synthesized siRNA) is silenced (ie transduced or transfected in vitro). The silenced cells can be administered to a mammalian recipient to provide a therapeutic benefit. The mammalian recipient can be a human and the cells thus silenced can be autograft in the context of the recipient. Alternatively, the cells can be allogeneic, syngeneic or xenogeneic in relation to the recipient.

  The procedure for ex vivo expansion of hematopoietic stem and progenitor cells described in US Pat. No. 5,199,942, incorporated herein by reference, can be applied to the cells of the invention. Other suitable methods are also known in the art, and thus the present invention is not limited to any particular method of ex vivo expansion of cells. Briefly, ex vivo culture and DC expansion include (1) collecting mammalian derived CD34 + hematopoietic stem and progenitor cells from a peripheral blood harvest or bone marrow explant and (2) ex vivo such cells. The process of expanding by is included. In addition to the cell growth factors described in U.S. Pat. No. 5,199,942, other factors such as flt3-L, TL-1, IL-3 and C-kit ligand can be added to cell culture and Can be used for expansion.

  Various cell selection techniques are known for identifying and separating CD34 + hematopoietic stem or progenitor cells from a cell population. For example, monoclonal antibodies (or other specific cell binding proteins) can be used to bind to marker proteins or surface antigen proteins found on stem and progenitor cells. Several such markers or cell surface antigens (ie flt-3, CD34, My-10 and Thy-1) for hematopoietic stem cells are known in the art.

Collected CD34 + cells are cultured with appropriate cytokines. CD34 + cells can then differentiate to accommodate dendritic lineage cells. These cells are then further purified by flow cytometry or similar means using markers characteristic of dendritic cells such as CD1a, HLA DR, CD80 and / or CD86. After isolation of the DC culture, the cells can be modified according to the methods of the invention. Alternatively, progenitor cells can be modified before being differentiated into DC-like cells.

  In addition to using cell-based vaccines for ex vivo immunization, the present invention also provides compositions and methods for in vivo immunization to elicit an immune response directed against antigens in a patient's body is doing.

  With respect to in vivo immunization, the present invention provides the use of inhibitors of negative immune modulators as a comprehensive means to enhance vaccine efficacy by overriding critical control points within APC. Thus, a vaccine useful for in vivo immunization comprises an inhibitor component capable of inhibiting at least negative immune modulators. In another aspect, the vaccine comprises both an inhibitor component and an antigen component, the antigen component having the ability to elicit an immune response in the mammalian body.

  For in vivo immunization, cells obtained from a patient are transfected or transduced in vivo to generate silenced cells in other ways. Cells are silenced in vivo with vectors that express inhibitors of cytokine regulators. Alternatively, the cells are silenced using any other form of inhibitor of the negative immunomodulator disclosed herein that is not expressed by the vector (which is a chemically synthesized siRNA). Methods for generating silencing cells in vivo are discussed elsewhere in this document.

  Another aspect of the vaccine includes an antigen component useful for pulsing cells in vivo. Any antigen can be administered in combination with the negative immunomodulator inhibitors of the present invention. Cells can be pulsed using any method as discussed elsewhere herein prior to, simultaneously with, or after silencing of cells with a vaccine comprising an inhibitor. It can easily be seen that if cells are to be pulsed and silenced simultaneously, a mammal can be immunized with a single vaccine comprising both inhibitor and antigen. Alternatively, it is possible to immunize a mammal with two separate vaccines, one comprising an inhibitor and a second vaccine comprising an antigen.

  The present invention includes in vivo immunization for cancer and infectious diseases. In one embodiment, a disorder or disease can be treated by administering siRNA in vivo in combination with an antigen or alone to generate an immune response against the antigen in the patient's body. Based on this disclosure, inhibitors of negative immune modulators (eg A20, SUMO (SUMO1, SUMO2, SUMO3 and SUMO4), Foxj1, Foxo3a, TWIST (Twist1, Twist2), SOCS (SOCS1, SOCS2, SOCS3, SOCS4, SOCS5) , SOCS6, SOCS7 and CIS), PIAS (PIAS1, PIAS3, PIASx and PIASy), SHP (siRNA for SHP-1 and SHP-2 or any combination thereof) in combination with the antigen formulation This enhances the efficacy of vaccination protocols that are otherwise identical without the use of inhibitors of negative immune regulators, although not wishing to be bound by any particular theory, The immune response to the antigen is: (1) the administered siRNA composition, (2) the duration, dose and frequency of administration, (3) the general condition of the patient, and (4) the administered antigen composition, if applicable. It is thought to be influenced by things.

In one embodiment, the mammal has a type of cancer that expresses a tumor-specific antigen. According to the present invention, an immunostimulatory protein can be made comprising a tumor specific antigen sequence component. In such cases, the inhibitor of the negative immune modulator is administered to a patient in need thereof in combination with an immunostimulatory protein, resulting in, for example, a solid tumor or cancer that expresses a tumor-specific antigen Improvement in therapeutic outcome for the patient is evidenced by slowing or reducing cell growth or reducing the total number of cancer cells or total systemic tumor tissue volume.

  In related embodiments, the patient has been diagnosed as having a virus, bacterial, fungal or other type of infection that is associated with the expression of a particular antigen, eg, a viral antigen. In accordance with the present invention, an immunostimulatory protein can be made comprising a sequence component consisting of an antigen, for example an HIV specific antigen. In such cases, an inhibitor of a negative immune modulator is administered to a patient in need thereof in combination with an immunostimulatory protein, resulting in a slowing of the growth of the causative infectious agent in the patient's body. And / or results in improved therapeutic outcomes for patients as evidenced by the reduction or elimination of detectable syndromes typically associated with certain infectious diseases.

  Under any circumstances, a disorder or disease can be treated by administration of an inhibitor of a negative immune modulator in combination with an antigen to a patient in need thereof. The present invention provides a means for generating a protective DC-induced immune response to an antigen in a patient. Based on this disclosure, one of ordinary skill in the art would recognize inflammatory cytokines (ie, IL-12, TNFa, IFNa, etc.) against the treatment regimes disclosed herein to enhance the efficacy of inhibitors of negative immunomodulator vaccines. It will be appreciated that IFNb, IFNg, etc.) can be added.

Dosage and formulation (pharmaceutical composition)
The present invention envisages treating diseases such as HIV infection and cancer in the body of mammals by administration of therapeutic agents such as siRNA. Administration of the therapeutic agent according to the present invention may be continuous or intermittent, depending on, for example, the patient's physiological body condition, whether the purpose of the treatment is treatment or prevention, and other factors known to the specialist physician. Good. Administration of the agents of the present invention can be essentially continuous over a preselected period of time, otherwise it can take the form of a series of spaced doses. Both local and systemic administration is considered. The amount administered includes (but is not limited to) the selected composition, the particular disease, the mammal's weight, physical condition and age, and whether to prevent or treat. ) It will vary depending on various factors. Such factors can be readily determined by clinicians utilizing animal models or other test systems that are well known in the art.

  Administration of siRNA can be accomplished through administration of a nucleic acid molecule encoding siRNA (eg, Felgner et al., US Pat. No. 5,580,859, Pardoll et al., 1995; Stevenson). ) Et al. 1995; Molling 1997; Donnelly et al. 1995; Yang et al. II; Abdallah et al. 1995). For example, in Fergner et al. (Supra), nucleic acid pharmaceutical formulations, dosages and routes of administration are generally disclosed.

May be optionally formulated for sustained release as discussed below (e.g., using microencapsulation, WO 94/07529, the disclosure of which is incorporated herein by reference) and (See US Pat. No. 4,962,091) One or more suitable unit dosage forms having the therapeutic agents of the invention can be administered into parenteral routes, including intravenous and intramuscular routes, and into affected tissues. It can be administered by a variety of routes including direct injection. For example, the therapeutic agent can be injected directly into the tumor. Formulations may take any convenient form in individual unit dosage forms, where applicable, and may be prepared by any of the methods well known in pharmacy. Such methods can include the step of associating the therapeutic agent with a liquid carrier, solid matrix, semi-solid carrier, finely divided solid carrier, or combinations thereof, and then introducing or shaping the product into the desired delivery system, if necessary. .

  When the therapeutic agents of the present invention are prepared for administration, these are preferably combined with a pharmaceutically acceptable carrier, diluent or excipient to form a pharmaceutical formulation or unit dosage form. The total active ingredient in such a formulation comprises 0.1 to 99.9% by weight of the formulation. “Pharmaceutically acceptable” is a carrier, diluent, excipient and / or salt that is compatible with the other ingredients of the formulation and not deleterious to the recipient thereof. The active ingredient for administration may be present as a powder or granule, as a solution, suspension or emulsion.

  Pharmaceutical formulations containing the therapeutic agents of the invention can be prepared by procedures known in the art using well-known and readily available ingredients. The therapeutic agents of the invention can also be formulated as solutions suitable for parenteral administration, eg, by intramuscular, subcutaneous or intravenous routes.

  The pharmaceutical formulation of the therapeutic agent of the present invention can also take the form of an aqueous solution or no solution or dispersion, or an emulsion or suspension.

  Thus, the therapeutic agent can be formulated for parenteral administration (eg, infusion, eg, by bolus injection or continuous infusion), ampoules, drug-filled syringes, small dose infusions or multi-dose containers with preservatives added. Can take the form of a single dosage form. The active ingredient may take the form of a suspension, solution or emulsion in an oily or aqueous vehicle and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents. Alternatively, the active ingredient may be in powder form, obtained by lyophilization from solution or by aseptic isolation of sterile solids, such that it is composed of a suitable vehicle, such as sterile, pyrogen-free water prior to use. .

  The unit content of the active ingredient contained in the individual aerosol dose of each dosage form is itself capable of achieving the required effective amount by administration of multiple dosage forms and as such is a specific indication. Alternatively, it will be appreciated that it is not necessary to constitute one effective amount for treating a disease. Moreover, effective amounts can be achieved by using less than the dose in the dosage form individually or in a series of administrations.

  The pharmaceutical formulations of the present invention can include, as optional ingredients, pharmaceutically acceptable carriers, diluents, solubilizers or emulsifiers, and salts of the type well known in the art. Specific, non-limiting examples of carriers and / or diluents useful in the pharmaceutical formulations of the present invention include water and physiologically acceptable buffered saline solutions, such as pH 7.0-8.0. A phosphate buffered saline solution.

  The expression vectors, transduced cells, polynucleotides and polypeptides (active ingredients) of the present invention treat a variety of disease states by any means that create contact of the active ingredient with the active site in the body. Can be formulated and administered. They can be administered by any conventional means available in combination with pharmaceutical agents, either as individual therapeutic active ingredients or in a combination of therapeutic active ingredients. They can be administered alone, but are generally administered with a pharmaceutical carrier based on standard pharmaceutical practice and the chosen route of administration.

In general, for parenteral solutions, water, suitable oils, saline, aqueous dextrose (glucose), and related sugar solutions and glycols such as propylene glycol or polyethylene glycol are suitable carriers. Solutions for parenteral administration contain the active ingredient, suitable solubilizers and, if necessary, buffer substances. Antioxidants such as sodium bisulfate, sodium sulfite or ascorbic acid are suitable stabilizers, either alone or in combination. Also used are citric acid and its salts, and ethylenediaminetetraacetic acid (EDTA). In addition, parenteral solutions can contain preservatives, such as benzalkonium chloride, methyl or propylparaben, and chlorobutanol. Suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences”, a standard reference book in the field.

  The active ingredients of the present invention can be formulated to be suspended in a pharmaceutically acceptable composition suitable for use in mammals, particularly humans. Such formulations are described in U.S. Pat. Nos. 4,082,735; 4,082,736; 4,101,536; 4,185,089. No. 4,235,771; and 4,406,890, including the use of adjuvants such as the muramyl dipeptide derivatives (MDP) or analogs described therein. Other useful adjuvants include alum (Pierce Chemical Co.), lipid A, trehalose dimycolate and dimethyldioctadecylammonium bromide (DDA), Freundajuband and IL-12. It is. Other components include polyoxypropylene-polyoxylene block copolymers (Pluronic®), nonionic surfactants and metabolic oils such as squalene (US Pat. No. 4,606,918). Letter).

  Furthermore, the duration of action can be controlled using standard pharmaceutical methods. These methods are well known in the art and include controlled release preparations such as polymers, polyesters, polyamino acids, polyvinyls, pyrrolidone, ethylene vinyl acetate, methylcellulose, carboxymethylcellulose or protamine sulfate. It can contain molecules. The concentration of macromolecules as well as the uptake method can be adjusted to control the release. In addition, agents such as polyesters, polyamino acids, hydrogels, poly (lactic acid) or ethylene vinyl acetate copolymers can be incorporated into the particles of polymer material. In addition to being incorporated, these agents can also be used to entrap compounds within the microcapsules.

  Accordingly, the pharmaceutical compositions of the invention can be delivered via a variety of routes to various sites within a mammal to achieve a particular effect (eg, Rosenfeld et al., 1991; Rosenfeld et al., 1991a; Jaffe et al., Supra; see Berkner, supra). Although one of skill in the art can use more than one route for administration, a particular route may provide a more immediate and more effective response than the other route. You will recognize that. By topical administration by infusion or application of the formulation into body cavities, inhalation or insufflation of aerosols or parenteral introduction comprising intramuscular, intravenous, intraperitoneal, subcutaneous, intradermal as well as topical administration Alternatively, systemic delivery can be achieved.

  The active ingredient of the present invention comprises a predetermined amount of a composition in which each dosage unit, for example, a teaspoon, a tablet, a solution or a suppository, alone or in appropriate combination with other active agents. It can be provided in a unit dosage form containing. As used herein, the term “unit dosage form” is appropriate as a single dosage for human and mammalian subjects, and is associated with a pharmaceutically acceptable diluent, carrier or vehicle, as applicable. A standard amount containing the composition of the present invention alone or in combination with other active agents, in an amount sufficient to produce the desired effect. Means an individual unit. The specifications for the unit dosage form of the present invention depend on the particular effects to be achieved and the particular pharmacodynamics associated with the pharmaceutical composition within the particular host.

  These methods described in this document are in no way comprehensive, and those skilled in the art will find additional methods suitable for a particular field of application. Moreover, the effective amount of the composition can be further approximated through analogy to compounds known to have the desired effect.

Gene Therapy Administration The skilled artisan will recognize that different delivery methods are available for administering the vector into the cell. Examples include (1) methods using physical means such as electroporation (electro), genetics (physical force) or application of large amounts of liquid (pressure), and (2) liposomes, aggregated proteins or transporters A method of conjugating the vector to another entity, such as a molecule.

  Furthermore, actual dosages and regimens can vary depending on whether the composition is being administered in combination with other pharmaceutical compositions or on individual differences in pharmacokinetics, drug behavior and metabolism. Similarly, the amount depends on the particular cell line utilized in the in vitro field (eg, the number of vector receptors present on the cell surface, or the particular vector utilized for gene transfer that replicates within that cell line. Based on the ability of Furthermore, the amount of vector to be added per cell is likely to vary depending on the length and stability of the therapeutic gene inserted into the vector and the nature of the sequence, and is determined especially empirically. It is a necessary parameter and can be modified due to factors inherent in the method of the invention (eg, costs associated with synthesis). A person skilled in the art can easily make any necessary adjustments according to the requirements of the particular situation.

  Cells containing therapeutic agents can also contain genes that code for suicide genes, ie products that can be used to destroy the cells. In many gene therapy situations, it is desirable not only to be able to express a gene for therapeutic purposes in a host cell, but also to have the ability to destroy host cells at will. The therapeutic agent can be linked to a suicide gene whose expression is not activated in the absence of the activator compound. If it is desired to kill a cell into which both the agent and the suicide gene have been introduced, the activator compound is administered to the cell, thus activating the expression of the suicide gene and killing the cell. Examples of suicide gene / prodrug combinations that can be used include herpes simplex virus-thymidine kinase (HSV-tk) and ganciclovir, acyclovir; oxidoreductase, and cycloheximide; cytosine deaminase and 5-fluorocytosine; thymidine kinase thymidylate kinase (Tdk :: Tmk) and AZT; and deoxycytidine kinase and cytosine arabinoside.

  These methods described herein are by no means exhaustive and additional methods suitable for a particular field of application will be apparent to those skilled in the art. Moreover, it is possible to further approximate the effective amount of the composition through analogy to compounds known to have the desired effect.

  The invention will now be described with reference to the following examples. These examples are provided for illustrative purposes only, and the invention is not limited to these examples, but rather encompasses all variations that are apparent as a result of the teachings provided herein.

The experiments disclosed herein were conducted to explore the regulation of antigen presentation by DCs to exploit DCs for the purpose of developing effective vaccines against various cancers and infectious agents. The results disclosed herein demonstrate that interference with negative immune regulatory pathways, otherwise known as inhibition of negative immune regulators within immune cells, enhances its immunostimulatory capacity. ing. The concept of inhibiting negative immune regulators to enhance cellular immunity serves as a new way to develop more effective vaccines.

  The materials and methods utilized in the experiments disclosed herein are now described.

Transfection of DCs with siRNA oligos Bone marrow DCs were transfected with 21, 26 or equivalent base pair siRNA oligos. For example, according to the manufacturer's protocol, GenePorter (Genlantis, San Diego, CA)
Diego, CA)) were used to transfect DCs with SOCS1-siRNA3 (5′-CTACCTGAGTTCCTTCCCCTT-3 ′; SEQ ID NO: 3). However, any siRNA oligonucleotide discussed elsewhere in this document can be transfected into DC using the methods discussed herein. Briefly, 3 μl of a 20 μM oligonucleotide solution was added to 3 μl Gene Porter reagent and 94 μl serum-free RPMI 1640. The mixture was incubated for 30 minutes at 25 ° C., after which 100 μl of the gene porter / oligonucleotide mixture was added to each well of the bone marrow-DC and incubated at 37 ° C. for 4 hours. After incubation, 500 μl / well RPMI 1640 supplemented with 20% FBS was added to bone marrow DC.

Transduction of bone marrow-derived DCs with lentiviral vectors Mouse bone marrow-derived DCs were prepared using methods known in the art. Briefly, mouse bone marrow was washed from the extremities, passed through a nylon mesh, and red blood cells were depleted with ammonium chloride. After extensive washing with RPMI-1640, cells were treated with 10% FBS, mGM-CSF / ml (20 ng / ml) and recombinant mouse IL-4 (20 ng / ml: PeproTech. Inc.). Incubated with 2.5 ml RPMI-1640 supplemented with Rocky Hill, NJ. On days 2 and 4 of culture, the supernatant was removed and replaced with fresh medium containing 20 ng / ml rmGM-CSF and 20 ng / ml rmIL-4. All cultures were incubated at 37 ° C. in 5% humidified CO ₂ . After 48 hours of culture, non-adherent granulocytes were removed and fresh medium was added. After 7 days of culture, over 80% of the cells expressed characteristic DC specific markers as determined by FACS. Transduction of mouse bone marrow-derived DCs (Days 5-7 of culture) was performed on 24-well plates by addition of 5 μg / ml Polybrene (Sigma, St. Louis, MO). DCs were washed and plated in 24-well plates at a concentration of 2 × 10 ⁵ cells / well in 400 μl of serum-free RPMI 1640. Cells were exposed to lentiviral vectors with different multiplicity of infection (MOI) at a cell density of 5 × 10 ⁵ cells / ml. After 8 hours of transduction, cells were washed with PBS and further incubated in fresh tissue medium.

Cytokines and Western blots Quantify various cytokine levels using cell culture supernatants using ELISA analysis (BD Biosciences, Lincoln Park, NJ) according to manufacturer's instructions Turned into. For Western blot analysis, pSUPER vectors expressing desired siRNA, including but not limited to SOCS1, A20, Foxj1, SUMO and Twist2-siRNA or control siRNA (eg, GFP-siRNA) And 293T cells were co-transfected with the corresponding tagged expression vector.

For example, 293T cells were co-transfected with a 10: 1 ratio of mouse SOCS1-siRNA or irrelevant GFP-siRNA and a FLAG-tagged SOCS1 vector. Cells were harvested 48 hours later and subjected to SDS-PAGE. After transfer to Hybond-P membrane (Amersham, Arlington Heights, Ill.), The samples were either anti-Flag (Sigma, St. Louis, MO) or actin ((Santa Cruz Biotechnology ( Santa Cruz Biotechnology, Inc., Santa Cruz, CA
Cruz, CA))) was analyzed by Western blotting with antibodies followed by detection with ECL-Plus reagent (Amersham, Arlington Heights, IL). Films were scanned with a Densitometer SI and SOCS-1 / actin bands were quantified with ImageQuant software (Molecular Dynamics, Piscataway, NJ). The intensity of the SOCS1 band was normalized to the intensity of the beta actin band.

Quantitative RT-PCR analysis of SOCS1 Relative expression of SOCS1 in transfected mouse BM-DC was assessed by quantitative real-time PCR. Total RNA was extracted from 3.5-5 × 10 ⁵ BM-DC using Trizol reagent (Invitrogen, Carlsbad, Calif.). 1.0 μg of total RNA for each sample was reverse transcribed using a random hexamer primer and SuperScript First-Strand Synthesis kit (Invitrogen, Carlsbad, Calif.). Real time on ABI 7900HT Sequence Detection System (Applied Biosystems, Foster City, Calif.) In a 20 μl quadruplicate reaction using an equivalent of 5 ng starting RNA material per reaction as template. 5'-nuclease fluorescent PCR analysis was performed. A pre-developed primer / probe set for mouse SOCS1 (6FAM) and 18S ribosome control (VIC) was applied to Applied Biosystems, Inc. (Foster City, Calif.) (Primer for SOCS1, 5′-ACCTCTTTGTGTGCGCGAC-3 ′; SEQ ID NO: 12 and 5′-AAGCCATCTTCACCGCTGAGC-3 ′; SEQ ID NO: 13 and hybridization probe, 6FAM-TCGCCAACGGGAACTGCTTTCTTCG-TAMRA; SEQ ID NO: 14). PCR parameters are recommended for the TaqMan Universal PCR Master Mix kit (Applied Biosystems, Foster City, Calif.) With SOCS1 and 18S reactions performed in separate tubes As it was. SOCS1 levels were normalized to 18S rRNA. SOCS1 expression in relation to control values for mock transfection and stimulated BM-DC was determined using the Comparative Ct method (Livak et al., 2001, Methods 25: 402-408). Used to calculate.

Quantitative RT-PCR analysis of A20, Foxj1 and SUMO1 The relative expression of A20, Foxj1 and SUMO1 in transfected mouse BM-DC was assessed by quantitative real-time PCR. Total RNA was extracted from 3.5-5 × 10 ⁵ BM-DC using Trizol reagent (Invitrogen, Carlsbad, Calif.). 1.0 μg of total RNA for each sample was reverse transcribed using a random hexamer primer and SuperScript First-Strand Synthesis kit (Invitrogen, Carlsbad, Calif.). Real-time 5′-nuclease fluorescence on ABI 7900HT Sequence Detection System (Applied Biosystems, Foster City, Calif.) In a 20 μl quadruplicate reaction, using an equivalent of 5 ng starting RNA material per reaction as template. PCR analysis was performed. Pre-developed primer / probe sets for mouse A20, Foxj1 and SUMO1 and 18S ribosome controls (VIC) were purchased from Applied Biosystems (Foster City, Calif.) (Primer for A20, 5′-GCATCTGCAGTACCTGTTTTC '-3; SEQ ID NO: 186 and 5'-GACAGGAGGCAGGGATA-3'; SEQ ID NO: 187 and hybridization probe: 5'-ACTACAGCAGAGCCCAGCTCCAGCC-3 '; SEQ ID NO: 188; primer for Foxj1, 5'-GCCATGCCAAGCCAGCAA-3'; SEQ ID NO: 189 and 5′-GCAGAGAGTTGCTCGTGATCCA-3 ′; SEQ ID NO: 190; and hybridization probe: 5 SEQ ID NO: 191; Primer for SUMO1, 5′-GAAGGTCAGAGAATTGCTGATAATCAT-3 ′; SEQ ID NO: 192 and 5′-CCCCGTTTGTTCCTGATAACTACT-3 ′; −3 ′; SEQ ID NO: 194). PCR parameters followed those discussed elsewhere in this document.

In vitro assay of OT-I cells Spleens from OT-I mice were harvested, pooled and split to obtain a single cell suspension. CD8 ⁺ OT-IT cells were collected by negative selection using a MACSCD8 ⁺ T cell isolation kit (Miltenyi Biotec Inc., Auburn, Calif.). Briefly, cells were coated with biotinylated antibodies specific for CD4 (L3T4), CD45R (B220), DX5, CD11b (Mac-1) and Ter-119. Anti-biotin magnetic microbeads (MicroBeads) (Miltenyi Biotech, Auburn, Calif.) Were added to the cells and they were passed through a separation column attached to a MACS magnet. Cells that did not bind to the column were collected and were ^> 95% CD8 ⁺ as judged by FACS. Round bottom 96-well in 200 μl RPMI 1640 medium supplemented with 10% FCS, 4 mM L-glutamine, 1 mM sodium pyruvate, 100 U / ml penicillin and streptomycin, 10 mM HEPES and 5 μM 2-ME. A total of 5 × 10 ⁴ purified CD8 ⁺ OT-IT cells and 5 × 10 ³ immature DCs were placed in each well of the microtiter plate. During the last 8 hours of culture, proliferation was measured after 2 days by adding 1 μCi [ ³ H] TdR per well. A triple determination is made, which corresponds to three experiments. Cytokine secretion within the OT-I / DC co-culture was determined using ELISA analysis for the indicated cytokine (BD Biosciences, San Jose, Calif.).

Flow cytometric analysis After pre-blocking the FC ^gamma receptor, cells were stained with FITC, PE, allophycocyanin (APC) or PerCP conjugated mAbs in PBS containing 0.1% NaN ₃ and 2% FCS. . Rat mAbs specific for rat CD4 (RM4-5), CD8 (53-6.7), CD11c (HL3), CD40 (3/23), CD80 (16-10A1), CD86 (GL1) and matched isotypes Controls were purchased from BD Biosciences (San Jose, Calif.). Stained cells were analyzed on a FACSCalibur (Becton Dickinson, Lincoln Park, NJ) flow cytometer and CELLQuest software.

Tetramer staining The H2-K ^b / ovalbumin tetramer assay was used to detect ovalbumin-specific CD8 ⁺ T cells. Spleen cells or T cells derived from immunized mice were treated with anti-CD8α-FITC and H2-K ^b / ovalbumin (SIINFEK) after different days after DC immunization.
L) -PE tetramer; double stained with SEQ ID NO: 11 (Beckman Coulter Immunos, San Diego, CA). Tetramer staining was performed with 1 μg anti-CD8α and 10 μl ovalbumin tetramer per 10 ⁶ cells for 1 hour at 4 ° C. according to the manufacturer's instructions.

Enzyme-linked immunospot (ELISPOT)
CTL peptide was used for CD8 ⁺ T cell stimulation. An irrelevant peptide from the human CD20 molecule was also used as a negative control. CD8 ⁺ T cells were transformed into MACS CD4 (L3T4) or MACS CD8 (Ly-2) microbeads (Miltenyi Biotech, Auburn, Calif.).
Was isolated from spleen cells.

CTL and NK assays CD8 ⁺ CTL responses were assessed with a standard chromium release assay that measures the ability of in vitro restimulated splenocytes to lyse target cells. Pooled splenocytes from immunized mice were restimulated in vivo in RPMI-1640 containing peptides for 4-6 days. Target and control cells were labeled with ⁵¹ Cr sodium chromate solution for 90 minutes. Different numbers of effector cells were incubated with a fixed number of target cells (1 × 10 ⁴ / well) in 96-well V-bottom plates (200 μl / well) at 37 ° C. for 3 hours. Supernatants (100 μl) from triplicate cultures were collected. Percent dissolution was calculated as (experimental release-spontaneous release) / (maximum release-spontaneous release) x 100. NK cells were generated from mouse spleen cells by culturing 1 × 10 ⁶ cells / ml with 500 U / ml recombinant mouse IL-2. YAC-1 cells highly susceptible to lysis by NK cells were incubated with ⁵¹ Cr for 1 hour at 37 ° C., washed and resuspended at 10 ⁵ cells / ml. To obtain different E: T cell ratios, NK cells were added in triplicate to the target cells. After incubation, the plates were centrifuged and the radioactivity in the supernatant fluid was counted with a gamma counter (Beckman Coulter, Inc., Fullerton, Calif.).

DC immunization and tumor model Lentivirus expressing the desired siRNA, including but not limited to SOCS1, A20, Foxj1, Foxo3a, SUMO, Twist-1 and Twist-2-siRNA, derived from bone marrow DC (bone marrow culture day 5) were transduced. For example, bone marrow-derived DCs were transduced with LV-SOCS1-siRNA or LV-GFP-siRNA at an MOI of 5. DCs were then pulsed with TRP2 peptide or ovalbumin protein for 8 hours, washed 3 times with PBS, and used for immunization in culture after an additional 36 hours. For some experiments, antigen-pulsed DCs were stimulated with LPS (100 ng / ml, Sigma, St. Louis, MO) for 24 hours, washed with PBS, and then footpadd into C57BL / 6 mice (Jackson Laboratory). Injected from. In the treatment model, EG7 or B16 tumor cells (2.5-5 × 10 ⁵ ) were injected subcutaneously (sc) into the right flank of syngeneic C57BL / 6 mice. Different days after tumor inoculation, mice were randomly grouped and injected with DC or PBC controls transduced with 50 μl of antigen pulses. In some mice, LPS was administered intraperitoneally (ip) after the number of days indicated after vaccination. Tumor volumes were measured with calipers 2-3 times a week.

Statistical analysis For statistical analysis, Student's t-test was used and a 95% confidence limit defined as P <0.05 was considered significant. Results are typically presented as mean ± standard error.

  The results of the experiment presented in this example will now be described.

Example 1: Identification and analysis of mouse SOC-1 siRNA SiRNA sequence targeting mouse SOCS1: SOCS1-siRNA1 (CCTCTCCCTCCCACTACTGA); Used a computer program to select. All target sequences were subjected to NCBI Blast queries to confirm the lack of homology to other known genes. Forward and reverse oligos were designed to encode sense and antisense 19 nt target sequences separated by a 9 nt spacer. This core siRNA sequence was flanked by the H1 RNA transcription start and 5T terminator sequences and incorporated a 5 ′ BglII and 3 ′ HindIII compatible overhang at the time of annealing. The DNA-based siRNA expression vector pSUPER (Brunmerkamp et al., 2002, Science 296: 550-553) uses an H1-RNA promoter to direct de novo synthesis of siRNA. The synthesized and annealed oligonucleotide pair was cloned into the pSUPER vector digested with BglII / HindIII. Positive clones were identified by restriction digest and confirmed by DNA sequencing.

Generation and production of lentiviral vectors for mouse SOCS1-siRNA The HIV transfer vector used in this study comprises an internal cytomegalovirus (CMV) promoter and is 3 ′ long to remove transcriptionally active sequences. PTRIPΔU3 CMV eGFP, a self-inactivating vector (SIN vector) with a 400 bp deletion in the U3 region of the terminal repeat (LTR). The lentiviral transfer vector pTRIPΔU3 CMV GFP contains a 178 bp fragment containing a central polyprinted lactate (cPPT) and a central termination sequence (CTS) within the unique ClaI site of the original pHR ′ backbone. pTRIPΔU3 CMV GFP was modified for expression of siRNA from the H1 RNA promoter and co-expression of the bicistronic blasticidin resistance / eYEP selectable marker. Primers (5′-GATCGAATTCACAAATGGC-3 ′; SEQ ID NO: 4 and 5′-CTAGGGATCCCATCGCCCCAAAGTGGG) to insert the 5′-EcoRI and 3′-BamHI sites for cloning in order to deal with cloning and remove the native CMV promoter -3 ′; SEQ ID NO: 5) was used to PCR amplify the central polyprinted lactate / central termination sequence (cPPT / CTS) of the pTRIP vector. The cPPT-CTS PCR product was then digested with EcoRI / BamHI and reinserted into the EcoRI / BamHI digested pTRIPΔU3 CMV GFP vector. The woodchuck post-transcriptional regulatory element (wPRE) sequence was PCR amplified from pBS-SK-WPRE using primers (5'-GATCCTCGAGGGTCGACAATCAACCCTTGGA-3 '; SEQ ID NO: 6 and 5'-GATCGGTACCCAGGCGGGAGG-3'; SEQ ID NO: 7). 5'-XhoI / SalI and 3'KpnI sites were added. The WPRE fragment was then digested with XhoI / KpnI and inserted into the modified pTRIPΔU3 CMV GFP backbone to generate pTRIP-W. siRNA and bicistronic selectable marker cassettes were first assembled in the pSUPER backbone for transfer into pTRIP-W. Bicistron selection marker CMV-Blasti ^R -IRES-eYFP (BY) was amplified using primer (5′-CAGTATCGATTTAATTAATCAATATTGGCCCATTAG-3 ′; SEQ ID NO: 8 and 5′-CAGTGTCGACTTAATTAAGTGGCCCGCTTTTACTTG-3 ′; SEQ ID NO: 9) 5'-ClaI and 3'-SalI sites were incorporated. The PCR product was digested with ClaI and SalI and then ligated into the CSUP / SalI digested pSUPER vector, and a BY marker was added at the 3 'end of the H1-RNA promoter and pSUPERMCS to generate pSUPER-BY. afterwards,
pSUPER-BY was digested with BamHI / SalI and ligated into the pTRIP-W backbone to generate pTRIP-H1-BY-W.

  Subsequent pSUPER vectors containing hrGFP or SOCS1 (3) siRNA hairpin sequences were digested with BstB1 and ClaI for insertion into pTRIP-H1-BY-W to obtain pTRIP-hrGFP-siRNA-BY-W ( GFP-siRNA), and pTRIP-SOCS1-siRNA-BY-W (SOCS1-siRNA). The last 390 bp spacer fragment was inserted at the ClaI site of the final vector to separate the siRNA termination sequence from the beginning of the CMV promoter. All vectors were confirmed by DNA sequencing (Lone Star Labs, Houston, TX, USA).

Recombinant pseudotyped lentiviral vector was generated by co-transfection of three plasmids into 293T cells. The HIV-derived packaging construct pCMVΔR8.9 encodes HIV-1 gag and pol precursors and regulatory proteins tat and rev. Vesicular stomatitis virus glycoprotein G (VSV-G) is expressed in plasmid pMD. Expressed from G. pCMVΔR8.9, pMD. Pseudotype lentivirus was generated by transient calcium phosphate co-transfection of 293T cells with G and lentiviral pTRIP siRNA transfer vectors. 60-72 hours after transfection, the supernatant was concentrated by ultracentrifugation at 50,000 × g for 2 hours at 4 ° C. The virus pellet was resuspended in RPMI and frozen at −80 ° C. for further study. By incubating 293T cells with serial dilutions of concentrated virus and 8 μg / ml polybrene for 6 hours followed by fluorescence activated cell sorting (FACS) analysis to determine eYEP-positive cells after 72-96 hours. The titer was determined. Vector titers were calculated as follows: titer = F × 2 × C ₀ / V × D (where D is the virus dilution factor, V is the volume of the inoculum, F is the frequency of eYFP positive 293T cells, And C ₀ is the number of target cells at the time of seeding).

Example 2: Transfection of mouse BM-DC with SOCS1 siRNA at GenePorter and SOCS1 mRNA downregulation To investigate the SOCS1 regulation of antigen presentation by DC, short interfering RNA (siRNA) that specifically downregulates SOCS1 ) Was identified as described below.

  In a DC derived from mouse bone marrow cells ex vivo in the presence of granulocyte-macrophage colony stimulating factor (GM-CSF) and IL-4 by a gene porter with 83% transfection efficiency at a synthetic siRNA oligo duplex Efficiently transfected. Briefly, bone marrow DCs were transfected with 21 base pair siRNA oligonucleotides (5'-CTACCTGAGTTCCTTCCCCTT-3 '; SEQ ID NO: 3) using a gene porter according to the manufacturer's protocol. Add 3 μl 20 μM oligonucleotide to 3 μl GenePorter reagent and 94 μl serum free RPMI 1640, incubate for 30 minutes at 25 ° C., then add 100 μl GenePorter / oligonucleotide mixture to each well of bone marrow-DC. Incubated at 37 ° C for 4 hours. After incubation, 500 μl / well RPMI 1640 supplemented with 20% FBS was added to bone marrow DC. Based on the present disclosure, synthetic siRNA oligos can be delivered to cells in the context of a physiologically acceptable carrier. An example of an acceptable carrier is a liposome.

FIG. 1A demonstrates that SOCS1 is down-regulated in cells transduced with a vector expressing SOCS1-siRNA. Briefly, mouse SOCS1-siRNA or irrelevant GFP-siRN at a 10: 1 ratio using a gene porter.
293T cells were co-transfected with a pSUPER (pSUR) vector expressing A and a FLAG-tagged mSOCS1 expression vector and subjected to Western blotting 48 hours later. The intensity of the SOCS1 band is normalized to that of the beta actin band, and the relative intensity (ratio) is shown. SOCS1-siRNA3 (5′-CTACCTGAGGTCTCTCCCCTTT-3 ′; SEQ ID NO: 3), called SOCS-siRNA, was used in subsequent studies.

  As confirmed by quantitative RT-PCR assay, the level of SOCS1 mRNA in the total DC population transfected with SOCS1 siRNA is subject to transfection with a SOCS1 siRNA mutant that cannot down-regulate SOCS1 (FIG. 1B). It was specifically reduced by about 60% compared to the level in DC. Moreover, SOCS1 expression was observed to be even higher during bone marrow DC culture in vitro and after maturation.

  Similarly, siRNA abruptity, as shown by enhanced phosphorylation of STAT1, I-κB and JNK at the time of stimulation and secretion of proinflammatory cytokines such as IL-6 and TNF-α (FIG. 2) It was also observed that DCs transfected with SOCS1 siRNA were more responsive to LPS or IFN-γ than DCs with mutants. FIG. 1B shows the secretion of siRNA oligo- or mock-transfected DCs in response to 24-hour LPS (100 ng / ml) or IFN-γ (10 ng / ml) from one of three independent experiments. Depicts the level of cytokines to be. The SiRNA mutant (5'-ACTATCTAAGTTACTACCCCT-3 '; SEQ ID NO: 10) contains 4 mutations in the SOCS1 siRNA3 sequence.

  These data are consistent with reports that SOCS1 is involved in regulation of the JAK / STAT pathway and the TLR / NF-κB pathway (Hanada et al., 2003, Immunity 19: 437-450; Chong ) Et al., 2003, Immunity 18: 475-487). DCs transfected with SOCS1 siRNA showed a slightly more mature phenotype than siRNA-DC mutants either before or after IFN-γ and LPS stimulation. Both transfected DCs were more mature than mock transfected DCs, which may reflect the effect of non-specific activation of the IFN gene by siRNA.

Example 3: Transfection of mouse BM-DC with viral vectors To assess whether SOCS1 negatively regulates DC antigen presentation in vivo, a lentivirus with the ability to transduce DCs in a stable fashion SOCS1 siRNA or control green fluorescent protein (GFP) siRNA was cloned into the vector (LV) (Rubinson et al., 2003, Nat. Genet. 33: 401-406; Scroar et al., 2004, Mols Mol. Biol.246: 451-459), the effect of silencing the SOCS1 can be evaluated with higher reliability. Two constructs, LV-SOCS1-siRNA and LV-GFP-siRNA, containing both yellow fluorescent protein (YFP) markers (FIG. 3) were generated according to the methods described elsewhere in this document. Transduction of bone marrow-derived DCs with either LV-SOCS1-siRNA or LV-GFP-siRNA vectors ( ^> 80% CD11c ⁺ ) routinely results in 58-63% of cultured cells positive for YFP. Generated. Consistent with previous observations on siRNA oligo-transfected DCs, SOCS1 mRNA in the total DC population transduced at the time of stimulation of LV-SOCS1-siRNA-DC compared to LV-GFP-siRNA-DC Decreased levels and increased secretion of pro-inflammatory cytokines was observed. To determine SOCS1 mRNA levels in transduced DCs, fluorescently activated cell sorting (FACS) was used to isolate DCs transduced with YFP ⁺ , followed by real-time quantitative PCR. The relative expression of SOCS1 mRNA was determined. It was observed that the level of SOCS1 mRNA in the YEP ⁺ LV-SOCS1-siRNA-DC population was approximately 90% lower than the level in mock-transduced DCs. DCs transduced with LV-SOCS1-siRNA and LV-GFP-siRNA with or without LPS stimulation showed comparable levels of CD86 and CD40 expression. While not wishing to be bound by any particular theory, the observation that LV-GFP-siRNA-DC resulted in higher levels of CD86 and CD40 than mock DC was the result of siRNA and lentiviral transduction. It is thought that there is a high probability that it is due to the effect of non-specific activation by.

Example 4: OVA-specific CTL and anti-tumor activity elicited by mouse SOCS1 siRNA DC To test whether DC stimulation of specific cytotoxic T lymphocytes (CTL) is regulated by SOCS1, the following A series of experiments was performed. Immature SOSC1-siRNA-DC or siRNA mutant DC, which was not further stimulated until maturity, was pulsed with ovalbumin I-peptide (SIINFEKL; SEQ ID NO: 11) to produce ovalbumin-specific TCRT cells (OT-I). OT-I cells proliferated more in SOCS1-siRNA-DC co-culture than in siRNA-DC mutant co-culture (FIG. 4A). Consistent with these data, higher levels of proinflammatory cytokines were secreted in SOCS1-siRNA-DC co-cultures (FIG. 4B). Furthermore, CTL assays of these cells showed more active cytotoxicity against ovalbumin ⁺ syngeneic EG7 cells after co-culture with SOCS1-siRNA-DC, indicating that SOCS1 is a DC of antigen-specific T cells. It has been demonstrated to contribute to the regulation of stimuli.

The ability of SOCS1-silenced DCs to be primed with an antigen-specific response in vivo, then directly immunize mice with transduced DCs pulsed with ovalbumin in the absence of ex vivo maturation By testing. Tetramer staining was only 0.64% and 0.43% in mice immunized with LV-GFP-siRNA-DC or mock DC, respectively (Figure 5A), compared to LV-SOCS1- In mice immunized with siRNA-DC, 2.3% of total CD8 ⁺ T cells showed positive for ovalbumin-tetramer. Since there were only slight differences in surface maturation markers between LV-SOCS1-siRNA-DC or LV-GFP siRNA-DC, these data indicate that only increased DC maturation is functional efficacy of LV-SOCS1-siRNA-DC. This suggests that it was not a factor contributing to The functional status of CD8 ⁺ T cells in immunized mice was further evaluated using an interferon gamma (IFNγ) ELISPOT assay. Mice immunized with immature LV-SOCS1-siRNA-DC were 2 × 10 ⁵ compared to 1 and 18 spots in those given immature mock DC or LV-GFP-siRNA-DC, respectively. Had 68 IFNγ ⁺ spots per CD8 ⁺ T cell (FIG. 5B). These results were consistent with a CTL assay showing more potent cytotoxicity of splenocytes from mice given immature LV-SOCS1-siRNA-DC to ovalbumin ⁺ target cells (FIG. 5C). ). Immunization with immature LV-SOC1-siRNA-DC also elicited an observable strong antigen-specific CD4 ⁺ T-helper response. Thus, SOCS1 silencing allowed immature antigen-presenting DCs to reach an immunogenic state with the ability to prime antigen-specific CD8 ⁺ CTL responses in vivo. While not wishing to be bound by any particular theory, since SOCS1-silenced DCs prime adaptive immunity without prior maturity, SOCS1 regulates in maintaining the tolerogenic state of DCs It is thought to play a role.

SOCS1-mediated regulation of mature DCs in vivo. The following experiments have demonstrated that priming the CTL response by SOCS1-silenced DCs resulted from enhanced maturation of DCs in response to endogenous environmental stimuli Conducted to investigate whether or not. LV-SOCS1-siRNA-DCs that received an ovalbumin pulse with LPS ex vivo for 24 hours were first matured and then washed 3 times before administering them into the body of mice. LPS-mature LV-SOCS1-siRNA-DC exhibits a mature phenotype comparable to that of mature LV-GFP-siRNA-DC, both DCs being more potent than CTL in the absence of ex vivo maturation Primed to. However, mature LV-SOCS1-siRNA-DC is still clearly superior to mature LV-GFP-siRNA-DC in inducing antigen-specific CTL, as demonstrated by ovalbumin tetramer staining (FIG. 5A). It was excellent. The IFN-γ ELISPOT assay also shows an enhanced ovalbumin-specific CD8 ⁺ T cell response in LV-SOCS1-siRNA-DC mice, where SOCS1 silencing is greater responsiveness of mature DC to endogenous environmental stimuli Suggesting that it may lead to an increase in CTL response.

In a further in vivo study, mice immunized with immature LV-SOCS1-siRNA-DC one day before were injected with LPS once. This stimulation, a CTL response in the immature LV-SOCS1-siRNA-DC mice significantly (P <0.01) elevated (CD8 ⁺ T cells in a 7.87% ovalbumin tetramer ⁺⁾ but immature DC-GFP-siRNA its effect in mice was low (CD8 ⁺ T cells in 0.64% of the ovalbumin - tetramer ⁺⁾ (Fig. 6A). Enhancement of the ovalbumin-specific CTL response in immature LV-SOCS1-siRNA-DC mice after in vivo LPS stimulation was confirmed by the IFN-γ ELISPOT assay (FIG. 6B).

  To test whether signaling of mature DCs in response to environmental stimuli plays a role in T cell priming, mice immunized with ex vivo matured LV-SOCS1-siRNA-DCs once or repeatedly one day ago LPS was injected. LPS injection significantly (P <0.01) enhanced the CTL response in mature LV-SOCS1-siRNA-DC mice, indicating the importance of mature DC signaling to prime the T cell response (FIGS. 6C and 6D). Moreover, LPS injection was further effective in enhancing ovalbumin-specific CTL responses in mice immunized with mature LV-SOCS1-siRNA-DC.

  To directly examine the responsiveness of DC-SOCS1-siRNA to repeated LPS stimulation, the ability of SOCS1-siRNA-DC and GFP-siRNA-DC to develop endotoxin tolerance in vitro was evaluated. SOCS1-siRNA-DC still responded strongly to repetitive LPS stimulation by producing high levels of pro-inflammatory cytokines, but GFP-siRNA-DC did not respond strongly, which was silenced in SOCS1 This suggests that DC responds continuously to stimuli. Furthermore, the threshold for DC responsiveness to endogenous stimuli such as heat shock proteins (HSP) that function as natural dangerous molecules was reduced by SOCS1 silencing.

  Taken together, these data indicate that silencing of SOCS1 in DCs is likely to reduce the DC responsiveness threshold, and immature and mature antigen-presenting DCs respond continuously to endogenous stimuli. , Which can result in an antigen-specific CTL response. This mechanism highlights the critical role of SOCS1 in controlling the extent of antigen presentation by mature DCs and thus the scale of adaptive immunity.

Enhancement of immunization of SOCS1-silenced DCs by in vivo stimulation To investigate whether in vivo stimulation with cytokines or toll-like receptor (TLR) agonists can further enhance the potency of SOCS1-silenced DCs , OV
Mice immunized with A-pulsed DC-LV-SOCS1-siRNA were injected intraperitoneally once daily for 3 consecutive days with LPS (30 μg / mouse), CpG (60 μg / mouse), PolyI: C (50 μg / Mice), anti-CD40 (100 μg / mouse) or IFN-g (1 μg / mouse). It was observed that these stimuli preferentially enhance the CTL response elicited by DC-LV-SOCS1-siRNA mice (FIG. 6E). These results indicate that numerous stimuli can further enhance the efficacy of immunization of SOCS1-silenced DCs in addition to LPS.

Enhancement of anti-tumor immunity by SOCS1 silencing in DC The observation of the regulatory function of SOCS1 in DC antigen presentation allows SOCS1-silenced DCs to induce stronger antigen-specific anti-tumor immunity, thus An investigation will be encouraged whether it will lead to pre-prepared control of tumor growth. Immunization with LV-SOCS1-siRNA-DC pulsed with ovalbumin in the absence of ex vivo maturation gives LV-GFP-siRNA-DC or mock DC that received ovalbumin pulse in the absence of ex vivo maturation. In contrast to the modest decrease in tumor growth in the generated mice, the pre-prepared ovalbumin ⁺ EG7 tumor growth was completely blocked in all tested mice (FIG. 7A). In vivo antibody blocking experiments have demonstrated that anti-CD8 antibody blocking but not anti-CD4 abolishes the anti-tumor activity elicited by ovalbumin pulsed LV-SOCS1-siRNA-DC (FIG. 7B). This indicates a critical role for CD8 ⁺ CTL in anti-tumor responses.

  To test whether DCs that had undergone oligo duplex transfection of SOCS1 siRNA showed enhanced anti-tumor activity, DCs were transfected with SOCS1 siRNA oligo duplex or control oligo duplex. Groups of mice were then immunized with transfected DCs pulsed with OVA or TC-1 tumor lysates. After immunization of mice with pulsed DC, mice were stimulated with LPS (30 μg / mouse) three times in vivo. Two weeks after DC immunization, immunized mice were challenged with OVA + EG7 or TC-1 tumors. In both EG7 and TC-1 tumor models (FIGS. 7C and 7D), enhanced anti-tumor activity was observed (FIGS. 7C and 7D). Moreover, the IFN-γ ELISPOT assay showed enhanced tumor-specific CTL responses in mice immunized with SOCS1 siRNA oligo-DC pulsed with TC-1 tumor lysate (FIG. 7E).

It was further tested whether SOCS1-silenced DCs could enhance the immune response against self tumor associated antigens. For these experiments, mouse melanoma differentiation antigen tyrosinase-related protein (TRP) 2 naturally expressed in weakly immunogenic B16 melanoma cells was used. Using mature LV-SOCS1-siRNA-DC or LV-GFP-siRNA-DC pulsed with TRP2 peptide stimulated ex vivo with LPS 3 days later in B57 tumor cells in C57BL / 6 mice These mice were treated once. Mature LV-SOCS1-siRNA-DC effectively blocked the growth of pre-prepared B16 tumors, while mature LV-GFP-siRNA-DC did not have any inhibitory effect (FIG. 8A). Enhanced anti-tumor activity correlated with a strong TRP2-specific CTL response in LV-SOCS1-siRNA-DC mice as detected by IFN-γ ELISPOT and CTL assays (FIGS. 8B and 8C). Active NK activity was detected only in mice fed mature LV-SOCS1-siRNA-DC. In contrast to the results with ovalbumin ⁺ EG7 tumors, immunization with LV-SOCS1-siRNA-DC that received immature TRP2 pulses produced a significant (P> 0.05) inhibitory effect on B16 tumors This suggests that full maturation of DC and continuous signaling after maturation are required to generate effective anti-tumor immunity. The non-specific stimulatory effect of GFP siRNA transduction on the CTL response to foreign antigen (ovalbumin) was consistently observed. However, non-specific stimulatory effects were insufficient to enhance the CTL response to self antigen (TRP2).

  Disadvantageous autoimmune lesions that were thought to be induced by immunization with LV-SOCS1-siRNA-DC were examined. Decolorization (white spots) was observed in mice immunized with SOCS1-silenced DC pulsed with TRP2. However, up to 3 months after immunization, no other apparent toxicity was observed in over 200 mice immunized with LV-SOCS1-siRNA-DC pulsed with ovalbumin or TRP2. All histological analyzes of the major organs and tissues of the immunized mice reveal no pathological inflammation and immunohistochemical staining does not show any IgG or IgM deposits in the kidney It was. The levels of IgG (IgG1, IgG2a) and anti-dsDNA were comparable in LV-SOCS1-siRNA-DC and mock DC mice. These data suggest that LV-SOCS1-siRNA-DC immunization does not cause pathological inflammation in the mouse body. While not wishing to be bound by any particular theory, SOCS1-silenced DCs are effective and antigen-specific anti-antigens that can block the growth of pre-prepared weakly immunogenic tumors. It is believed to have a greatly enhanced ability to elicit tumor immunity.

SOC1 silencing enhances antigen presentation by DC and antigen-specific anti-tumor immunity. The results presented here indicate that the stimulatory capacity of DC and the magnitude of adaptive immunity are critically regulated by SOCS1 in DC. This proves that Silencing SOCS1 within the antigen-presenting DC greatly enhances antigen-specific anti-tumor immunity. SOCS1 represents an inhibitory mechanism for qualitatively and quantitatively controlling the magnitude of antigen presentation by DC and adaptive immunity.

  This disclosure demonstrates the critical role of SOCS1 in regulating the extent of antigen presentation by mature DCs, thus demonstrating regulatory mechanisms that allow DCs to control the magnitude and duration of adaptive immunity. ing. The importance of SOCS1 in maintaining the tolerogenic state of DC is demonstrated here in contrast to wild-type DC, in which SOCS1-silenced DCs are in vivo without the need for ex vivo maturation. It is exemplified in that it is endowed with the ability to present stimulating antigens to prime cellular responses. While not wishing to be bound by any particular theory, the precise mechanism by which SOCS1 in DCs controls the magnitude of adaptive immunity is in response to cytokines, pathogenic products, and possibly also stimuli at cell-cell contacts. It is thought to be involved in mature DC signaling and output regulation with respect to antigenic peptide presentation, costimulation / co-inhibition and cytokine production.

  Mature DCs generally have a short lifetime based on a limited number of studies. However, recent studies using reliable genetic methods have demonstrated that the life span of mature antigen-presenting DCs is much longer than previously estimated and lasts 2 weeks in vivo, Supporting the need and importance of regulating the extent of antigen presentation by mature DCs.

  The present invention relates to a novel principle of silencing SOCS1 in DC as a genetic means to enhance the efficacy of tumor vaccines by overriding critical suppression in DC. Vaccination with SOCS1-silenced DCs allows antigen-specific anti-tumor immunity because silencing of SOCS1 allows antigen-presenting immunogenic DCs to continuously stimulate antigen-specific T cells in vivo. Will be greatly enhanced. SOCS1-silenced DCs can switch off regulatory T cells by enhancing the production of proinflammatory cytokines such as IL-6 that inhibit regulatory T cell suppression and DC maturation.

Blocking CTLA-4 on T cells effectively breaks tolerance but causes significant non-specific autoimmune inflammation in the patient's body. By targeting SOCS1 in DC at the antigen presentation level, it is possible to achieve a more antigen-specific anti-tumor response. First, immunization with SOCS1-silenced DCs rich in tumor-associated antigens is an approach that unavoidably activates autoreactive T cells against normal tumor tissue, effector CTL In contrast to CTLA-4 targeting above, it will elicit antigen-specific immunity. Secondly, the use of partially SOCS1-silenced DC with residual SOCS1 levels results in significant self-immunity since heterozygous SOCS1 ^+/− mice show no or only mild signs of autoimmune inflammation. It may not cause immune inflammation. Furthermore, the significant autoimmune inflammation seen in SOCS1 ^{− / −} mice requires a complete deficiency of SOCS1 not only in DC but also in other immune cell lines such as T and NKT cells. The results presented in this document are not only for understanding qualitative and quantitative regulation of antigen presentation and adaptive immunity, but also for the development of effective vaccines against cancer and infectious diseases by enhancing the stimulation potential of DC Also provide insight for.

Example 5: TRP2-specific CTL and anti-tumor activity elicited by mouse SOCS1-siRNA-DC The present disclosure shows that lentiviral vectors expressing reduced SOCS1 expression with SOCS1 siRNA in mature DCs are self-antigen-specific CTL responses It is demonstrating that the scale of can be increased. For this study, mouse melanocyte differentiation antigen tyrosinase-related protein 2 (TRP2) was used as a model autoantigen. TRP2 was used because it is naturally expressed in both normal melanocytes and weakly immunogenic B16 melanoma cells, and a number of class IMHC epitopes have been identified within TRP2 ( Van Elsas et al., 2001, J. Exp. Med. 194: 481-9).

  The materials and methods used in the experiments presented in this example are now described.

Mice / Animal Model 4-6 week old female C57BL / 6, CD4KO, CD8KO or p35 (IL-12) KO mice were purchased from Jackson Laboratories (Bar Harbor, Maine, USA) And maintained in a sterile mouse facility at Baylor College of Medicine (Houston, Texas, USA).

Peptides H2- ^Kb restricted TRP2a (VYDFFVWL; SEQ ID NO: 15) and TRP2b (SVYDFFVWL; SEQ ID NO: 16) (Van Elsus et al., 2001, J. Exp. Med. 194: 481-9) and A control H2- ^Kb restricted OVA-I (SIINFEKL; SEQ ID NO: 11) was synthesized and generated by Genemed Synthesis.
Synthesis Inc. ) (South San Francisco, Calif.) To a purity of greater than 95%. All peptides were dissolved in DMSO prior to final dilution in PBS without endotoxin (Sigma, St. Louis, MO).

Transduction of BM-derived DCs with lentiviral vectors Recombinant lentiviral vectors (LV-SOCS1-siRNA and LV-GFP-siRNA) are produced and titrated as described elsewhere in this document. Used to transduce DC.

Cytokine ELISA and enzyme linked immunospot (ELISPOT) assay DC culture supernatants for ELISA analysis (BD Biosciences, Lincoln Park, NJ) using the indicated stimuli according to the manufacturer's instructions. Used to quantify the levels of various proinflammatory cytokines. Huang et al., 2003, Cancer Res. No. 63: ELISPOT assay of isolated CD4 + or CD8 + T cells was performed as described in pages 7321-9. H2-K ^b / TRP2 class I peptides were used for mouse CD8 + T cell stimulation. An irrelevant peptide from OVA was also used as a negative subject. CD8 + T cells were isolated from splenocytes by using MACS CD8 (Ly-2) microbeads (Miltenyi Biotech, Auburn, CA).

Flow cytometry analysis Cells were stained with FITC or PE mAbs in PBS containing 0.1% NaN ₃ and 2% FCS. Mouse CD8 (53-6.7), CD11c (HL3), CD40 (3/23), CD80 (16-10A1), CD86 (GL1), OX40L (RM134L) or PDL1 (MIH5) and matched isotype controls Specific antibodies were purchased from BD Pharmingen (Franklin Lakes, NJ) or eBioscience (San Diego, Calif.). Stained cells were analyzed on FACS Cslibur (Becton Dickinson, Lincoln Park, NJ, Franklin Lakes, NJ) flow cytometry.

Tetramer staining The H2- ^Kb / TRP2-PE tetramer assay was used to detect TRP2-specific mouse CD8 + T cells. TRP2-tetramers were synthesized at Bayer College of Medicine, Tetramer Core Facility (Houston, Texas, USA). Spleens from immunized mice were co-stained with anti-CD8a-FITC / anti-CD3-PerCP and H2- ^Kb / TRP2-PE. Tetramer staining was performed at 4 ° C. for 1 hour using a 1: 100 dilution of TRP2-PE tetramer and 1 μg of anti-CD8α-Fitc per 10 ⁶ cells per manufacturer's instructions.

DC Immunization and Tumor Mouse Studies Transduced BM-derived DCs (BM cultures 4-5 days) with SOCS1-siRNA or GFP-siRNA at MOI of 5 as described elsewhere in this document . Briefly, DC were pulsed with peptide for 20 hours, washed 3 times with PBS, and 24 hours LPS (100 ng / ml, Sigma, St. Louis, MO) or TNFa (500 ng / ml, R & D Systems (R & D Systems). ), Minneapolis, MN), washed 3 times with PBS, then injected into the body of C57BL / 6, CD8KO, CD4KO or p35KO mice from the hind footpad. In the treatment model, B16 tumor cells (2.5 × 10 ⁵ ) were injected subcutaneously (sc) into the right flank of syngeneic mice to establish the tumor model. On day 3 after tumor inoculation, mice were randomly grouped and injected with 30 μl peptide-pulsed DC (50 μg / ml), transduced DC (1.5 × 10 ⁶ ) or PBS control. In some mice, LPS (30 μg / mouse) or recombinant mouse IL-12 protein (1 mg / mouse, Peprotech, Rocky Hill, NJ) was injected intraperitoneally (days after the indicated direction from DC vaccination). ip). Tumor volume was measured with calipers once every two days until the experiment was completed.

CTL Assay CD8 + CTL responses were assessed with a standard chromium release assay that measures the ability of in vitro restimulated splenocytes to lyse target cells (Hoan et al., 2003, Cancer Res. 63: 7321-9). Pooled splenocytes from 2-3 immunized mice were restimulated in vitro in RPMI-1640 containing H2- ^Kb / TRP2 peptide for 4-6 days. TRP2 + target B16 cells (H2-K ^b ) and control EG7 cells (ATCC, Manassas, Va.) Were labeled with ⁵¹ Cr sodium chromate solution for 90 minutes at 37 ° C. with shaking. Different numbers of effector cells were incubated with a fixed number of target cells (5 × 10 ⁴ / well) in 96-well U-bottom plates (200 μl / well) for 4 hours at 37 ° C. Supernatants from triplicate cultures were collected and analyzed. Percent dissolution was calculated as (experimental release-spontaneous release) / (maximum release-spontaneous release) x 100.

Statistical analysis For statistical analysis, Student's t-test was used and a 95% confidence limit defined as P <0.05 was considered significant. Results are typically presented as mean ± standard error.

  The results of the experiment presented in this example will now be described.

Signaling in mature DCs restricted by SOCS1 regulates specific CTL responses and tolerance Immunizing C57BL / 6 mice with transduced DCs receiving LPS and ex vivo matured TRP2 peptide pulses Turned into. Immunized mice were then stimulated in vivo once or three times in the presence or absence of LPS, and TRP2-specific CTL responses were measured using tetramer analysis. Because of the high number of pro-inflammatory cytokines to induce, many of which are regulated by SOCS1, and the role of SOCS1 in the direct regulation of NF-κB (p65) signaling has been demonstrated in vivo LPS was selected for stimulation (Ryo et al., 2003, Mol. Cell. 12: 1413-26). In mice immunized with SOCS1-siRNA-DC, in the absence of in vivo LPS stimulation, only 3.1% in mice immunized with GFP-siRNA-DC, TRP2-4 5.1% of total CD8 + T cells were positive for the mer (FIG. 9A). Upon one or three in vivo LPS stimulation, the percentage of CD8 + T cells that are positive for TRP2-tetramer is substantially increased in mice immunized with SOCS1-siRNA-DC (9.7% and 19.4%), there was generally no change in mice immunized with GFP-siRNA-DC (3.0% and 4.0%, respectively) (FIG. 9A). Consistent with this, the CTL test (FIG. 9C) and interferon gamma (IFNγ) ELISPOT showed similar results. In addition, 3 months after immunization, SOCS1-siRNA co-injected with LPS (FIG. 9B) and received a TRP2 peptide pulse.
In most of the mice immunized with DC, vitiligo (lightening, depigmentation and / or hair loss) of the coat is clearly visible, indicating self-tolerance to TRP2 normally expressed in host melanocytes. It represents destruction. In contrast, no vitiligo was observed in any of the mice immunized with GFP-siRNA DC even when repeatedly administered LPS in vivo, which maintains tolerance to self-antigens. Suggested a critical role for SOCS1 in DCs. These results demonstrate that signaling within mature antigen presenting DCs controls the magnitude of CTL responses and self-tolerance, and that mature DC signaling is severely restricted by SOCS1.

SOCS1-restricted signaling controls DC's ability to break self-tolerance and elicit effective anti-tumor immunity The primary objective of tumor vaccination is against self-antigens preferentially expressed on tumor cells To break self-tolerance by inducing a strong adaptive immune response. Since the role of SOCS1 in regulating the magnitude of autoantigen-specific CTL responses and self-tolerance has been observed, whether the ability of mature DCs to induce effective anti-tumor immunity is controlled by SOCS1 expression Investigation was encouraged. To test this, C57BL / 6 mice were inoculated subcutaneously with B16 tumor cells and 3 days later immunized once with TRP2 pulsed transduced DCs matured ex vivo with LPS. FIG. 10A shows that SOCS1-siRNADC immunization alone could significantly inhibit B16 tumor growth compared to GFP-siRNA-DC immunization (P <0.01). However, 50% of the mice immunized with SOCS1-siRNA-DC eventually died due to systemic tumor tissue volume exceeding 1500 mm ³ 30 days after tumor inoculation. To determine if mouse survival can be improved in mice immunized with SOCS1-siRNA-DC by enhancing proinflammatory signals, mice were once in vivo with LPS one day after DC immunization. I was stimulated. Addition of LPS stimulation to the immunization protocol substantially blocked B16 tumor growth in mice immunized with SOCS1-siRNA-DC (FIG. 10B). This contrasted well with GFP-siRNA-DC that did not show any reduction in systemic tumor volume compared to mice that did not receive LPS stimulation and DC control that received mock transduction (FIG. 10A). And 10B). The combination of immunization with SOCS1-siRNA-DC and LPS challenge similarly significantly increased mouse survival to 100% for over 60 days (FIG. 10C). The enhancement of anti-tumor activity was correlated with strong TRP2-specific CTL activity in the body of mice immunized with SOCS1-siRNA-DC (FIG. 10D). By immunizing CD4 and CD8 knockout (KO) mice with SOCS1-siRNA-DC, only weak anti-tumor activity was observed in immunized CD4 KO mice, but anti-tumor activity was observed in both CD8 + and CD4 + cells. Was further demonstrated (FIGS. 10B-10D). Collectively, these results indicate that SOCS1-restricted signaling in mature DCs controls their ability to break tolerance and elicit effective anti-tumor immunity, and the additional regulation normally by SOCS1 It has been shown that pro-inflammatory signals can further increase the ability of the induced anti-tumor immune response to control pre-prepared whole body tumor tissue volume.

The critical role of SOCS1-restricted signal 3 in the regulation of self-tolerance and anti-tumor immunity SOCS1 signals mature DC signaling and production by regulating antigen peptide / MHC presentation / co-stimulation and / or cytokine signaling and secretion High probability of affecting quantity. The following experiments were undertaken to investigate which of these three signals are primarily regulated by SOCS1 for the control of autoantigen-specific CTL responses and anti-tumor immunity.

  First, it was tested whether SOCS1 silencing affects the expression of costimulatory molecules (signal 2). Co-stimulatory / inhibitory molecules (B7.) That were undetectable or slightly enhanced on SOCS1-siRNA-DC compared to GFP-siRNA-DC both before and after LPS-induced maturation by flow cytometry assay. 1, B7.2, OX40L, CD40 or PDL1) It was consistently observed that surface levels were present (FIG. 11A). Comparable levels of MHC-I and II molecules were also detected on SOCS1-siRNA-DC and GFP-siRNA-DC.

Because of the importance of CD8 + T cells in inducing anti-tumor immunity, whether MHC-I restricted peptide immunogenicity (TCR affinity) plays an important role in SOCS1-restricted antigen presentation in vivo Further investigation was made. A high affinity form (TRP2b) and a low affinity form (TRP2a) of the TRP2CTL peptide have been previously identified (van
Elsas) et al., 2001, J. MoI. Exp. Med. 194: 481-9) to test whether the intensity of signal 1 can affect the ability of transduced DCs to elicit an anti-tumor immune response. used. FIG. 11B shows that either low (TRP2a) or high (TRP2b) affinity peptide, although GFP-siRNA-DC loaded with TRP2b peptide showed only little antitumor activity (not statistically significant). This shows that mature GFP-siRNA-DC loaded with can not induce regression of B16 tumors by in vivo LPS stimulation. In contrast, both SOCS1-siRNA-DCs loaded with either low or high affinity TRP2 peptides effectively blocked tumor growth. TRP2-specific CTL activity in immunized mice was also investigated using the IFNγ ELISPOT assay. FIG. 11C shows that GFP-siRNA-DC loaded with high affinity peptide elicited a stronger IFNγ response than GFP-siRNA-DC loaded with low affinity peptide. However, both SOCS1-siRNA-DC groups loaded with either low or high affinity peptides elicited a much stronger IFNγ response than GFP-siRNA-DC loaded with high affinity peptides. (P <0.01), which is consistent with the observed antitumor activity (FIG. 11B). Furthermore, SOCS1-siRNA-DC loaded with low or high affinity peptides elicited similar IFNγ responses (FIG. 11C).

  The results of these experiments indicate that SOCS1 silencing has a significant effect on the expression of costimulatory / inhibitory molecules (signal 2) and MHC-I and II molecules on DCs in the presence or absence of maturation. And, unless SOCS1 is silenced, demonstrates that mature DCs loaded with high or low affinity TRP2 peptide (signal 1) are not effective in inducing a strong IFNγ response .

Example 6: Murine SOCS1-siRNA-DC-induced CTL and in vivo IL-12 enhancement of antitumor activity Initiation of cytotoxic T cell (CTL) responses by dendritic cells (DC) has been well studied. However, the mechanisms for adjusting self-tolerance or regulating breakage still remain poorly defined. In this example, mature DCs, in which the suppressor of cytokine signaling (SOCS) 1 is signaled, but not mature wild-type DCs, break self-tolerance, especially when stimulated in vivo by pathogenic products or IL-12 It has been proven to be effective in doing so. Experiments disclosed herein show that SOCS1-restricted signal 3 (IL-12) provided by antigen-presenting DC (rather than antigen affinity (signal 1) and costimulatory molecule level (signal 2)) is self-tolerant. Demonstrates control. Furthermore, the present disclosure demonstrates that SOCS1-silenced DC elicits a strong immune response against self-antigens and blocks the growth of pre-prepared B16 tumors. Moreover, human SOCS1-silenced DCs have a better ability to fully activate autoantigen-specific human CTLs with lytic effector function, and the translational potential of this SOCS1 silencing approach Is implied.

The high probability that signal 3 restricted with SOCS1 is important in the control of autoantigen-specific CTL activation and tolerance prompted the identification of the major cytokines regulated by SOCS1 in mature DCs. The importance of multiple pro-inflammatory cytokines known to affect CTL activation is initially genetically homozygous for DC vaccination in combination with SOCS1 silencing Tested by using DCs from different KO mice. When DCs from IL-12 (p35 ^{− / −} ) KO mice were used for immunization, p35 ^{− / −} SOCS1-siRNA-DCs loaded with TRP2 peptide no longer inhibit B16 tumors Observed (FIGS. 12A-12B), suggesting a critical role for SOCS1 restricted and DC produced IL-12 for tumor regression. To further determine the role of IL-12 in SOCS1-restricted DC function, the CTL response elicited by p35 ^{− / −} SOCS1-siRNA-DC was further assessed. Using IFNγ ELISPOT and CTL assay, it was observed that the ability of p35 ^{− / −} SOCS1-siRNA-DC to elicit a TRP2-specific CTL response was significantly reduced compared to wild-type SOCS1-siRNA-DC (FIG. 12C and 12D). Furthermore, in vivo stimulation with LPS failed to enhance the CTL response elicited by p35 ^{− / −} SOCS1-siRNA DC as measured by TRP2-tetramer analysis (FIG. 9A). Interestingly, in contrast to the basic role of IL-12 produced by antigen-presenting DCs, IL-12 (p35 ^{− / −} ) KO mice immunized with wild type SOCS1-siRNA-DC are It has also been observed to elicit active anti-tumor immunity and CTL responses, indicating that IL-12 produced by resident host cells is not required for the induction of autoantigen-specific CTL responses. (FIGS. 12A-12B). Taken together, these results indicate that SOCS1-restricted IL-12 produced by antigen-presenting DCs is important in inducing a potent TRP2-specific CTL response and B16 tumor eradication. .

Relationship between sustained and enhanced production of IL-12 and IL-12-induced cytokines by SOCS1-silenced DCs and transient and low production by wtDC DCs respond to pathogenic products such as LPS and CD40 ligation Significant amounts of IL-12 (Schulz et al., 2000, Immunity 13: 453-62). The production of IL-12 by DC is tightly limited to a short period (8-16 hours) after induction of maturation (Langenkamp et al., 2000, Nat. Immunol. 1: 311-6). ), Regulated by SOCS1 (Eyles et al., 2002, J. Biol. Chem. 277: 43735-40). Since the important role of SOCS1-restricted IL-12 in the regulation of adaptive immunity has been identified, it is closely related to the ability of SOCS1-siRNA-DC to break immune tolerance and elicit an effective anti-tumor immune response against TRP2. The effect of SOCS1 silencing on the intensity and duration of IL-12 production by the resulting DCs was investigated.

  FIG. 13A shows significantly increased levels of IL-by SOCS1-siRNA-DC in response to continuous stimulation with LPS and anti-CD40 mAb over 72 hours compared to GFP-siRNA-DC and mock-transduced DC. 12 (p70) was produced. Next, IL-12 levels were achieved despite the removal of the original stimulus by stimulating with LPS / anti-CD40 for 24 hours and then transferring DCs in fresh medium without LPS to a new culture plate. The ability of SOCS1-siRNA-DC to maintain the FIG. 13B shows that GFP-siRNA-DC and mock-transduced DC produce IL-12 only transiently at the time of stimulation, while SOCS1-siRNA-DC shows much higher levels regardless of stimulation removal. It shows that IL-12 was produced continuously. While not wishing to be bound by any particular theory, prolonged production of IL-12 by SOCS1-siRNA-DC after removal of LPS / anti-CD40 is secreted by IL-12 or other DCs. May be due to prolonged activation of signaling pathways triggered by possibly autocrine / paracrine stimuli and / or original stimuli by selected pro-inflammatory cytokines. These results indicate that SOCS1 silencing allows DCs to produce sustained increased levels of IL-12 in response to stimulation, which is SOCS1 silenced that breaks tolerance and eradicates pre-prepared tumors. This indicates that it may be the cause of DC capability.

SOCS1 is a critical regulator of the Jak / Stat pathway that mediates IL-12 and other cytokine signaling (Kubo et al., 2003, Nat. Immunol. 4: 1169-76; Alexander et al. 2004, Annu.Rev.Immunol.22: 503-29), SOC in DCs through the development of cytokine feedback loops between each other and possibly other nearby DCs.
In order to test whether S1 silencing increases cytokine production, the next set of experiments was undertaken. In response to this, the production of tumor necrosis factor (TNF) α and IL-6 by SOCS1-siRNA-DC was measured. Since such cytokines are known to be induced by IL-12 stimulation, (TNF) α and IL-6 were tested (Trinchieri et al., 2003, Nat. Rev. Immunol. No. 3). : 133-46).

FIG. 13C shows that, unlike GFP-siRNA-DC and mock-transduced DC that only produced transiently low levels of TNFα and IL-6, SOCS1-siRNA-DC removed the original stimulus. It was later shown that sustained higher levels of TNFα and IL-6 were produced. To further determine the importance of IL-12 for feedback loop development, the production of TNFα and IL-6 by p35 ^{− / −} SOCS1-siRNA-DC and wtSOCS1-siRNA-DC was compared. FIG. 13D shows that p35 ^{− / −} SOCS1-siRNA-DC could no longer produce increased amounts of TNFα and IL-6 over time, indicating that IL-12 feedback Are the major inducers of TNFα and IL-6 production by SOCS1-siRNA-DC. These data show that SOCS1 silencing abolishes critical signaling repression in DC, so they are not only IL-12 but also IL-12-induced pro-inflammatory through continuous feedback loops It also means that it is able to respond to and produce cytokines. The results disclosed herein provide a well-established mechanism that accounts for the ability of TRP2-loaded SOCS1-siRNA-DC to elicit both vitiligo and effective anti-tumor immunity against B16 tumor cells.

The importance of SOCS1-restricted IL-12 signaling to control the ability of DC to break self-tolerance The ability of SOCS1-siRNA-DC to elicit a strong CTL response against self-tumor-associated antigens is Suggest for therapeutic use. Whether or not IL-12, whose signaling is regulated by SOCS1, is also effective in enhancing the efficacy of SOCS1-siRNA-DC because it is too toxic for clinical use of LPS as a stimulus in the patient's body Was assessed.

  C57BL / 6 mice were inoculated with B16 tumor cells and 3 days later, mice were immunized once with DCs transduced with TRP2 pulses matured ex vivo with recombinant mouse TNFα. Following DC immunization, recipient mice were stimulated 3 times in vivo with low doses of recombinant mouse IL-12 (1 μg per mouse). FIG. 14A shows that B16 tumor growth in mice immunized with SOCS1-siRNA-DC was efficiently blocked. In contrast, immunization with GFP-siRNA-DC with in vivo administration with IL-12 had little effect on tumor effect compared to PBS control. Anti-tumor activity was correlated with increased TRP2-specific CTL activity in mice immunized with SOCS1-siRNA-DC as shown by the IFNγ ELISPOT assay (FIG. 14B). Consistent with previous observations (FIG. 10A), immunization with SOCS1-siRNA-DC undergoing TRP2 pulse, TNFα maturation in the absence of IL-12 stimulation in vivo is also similar to GFP-siRNA. -Also showed increased anti-tumor activity compared to DC control.

These results probably come from enhanced signaling of IL-12 and IL-12-induced cytokines, although in vivo administration of IL-12 significantly enhances the immunostimulatory capacity of SOCS1-silenced DCs It shows that the wild type DC does not enhance. These results further indicate that SOCS1-restricted cytokine signaling in antigen-presenting DCs, but not systemic concentrations of cytokines such as IL-12, is important for inducing effective anti-tumor immunity against self-tumor associated antigens. It implies.

  No obvious toxicity other than vitiligo was observed in SOCS1-siRNA-DC mice receiving TRP2 pulses co-injected with either LPS or IL-12 up to 6 months after immunization. Histological analysis of all major organs and tissues of immunized mice did not reveal any pathological inflammation. IgG and anti-dsDNA levels were comparable in SOCS1-siRNA-DC and mock DC mice. These data suggest that immunization with SOCS1-siRNA-DC receiving TRP2 pulses does not cause pathological inflammation in mice.

The intensity of SOCS1-restricted signal 3 controls CTL activation, tolerance, and anti-tumor immunity The results disclosed herein are directed to the regulation of CTL responses by mature DCs that should have a deep implication in tumor vaccine development Provide new insights. Maturation is known to be a control point for DC transition from an immature tolerogenic state to a mature immunogenic state (Banschlow et al., 1998, Nature 392: 245-52; Steinmann et al., 2003, Annu. Rev. Immunol. 21: 685-711). The magnitude of initial contact between antigen-presenting DCs and T cells (signals 1 and 2) is such that the magnitude and fate of the CTL response since mature DCs are considered short-lived based on a limited number of studies. (Pordador et al., 1998, Journal of Experimental Medicine 188: 1075-82; Ingulli et al., 1997, J. Exp. Med. 185: 2133). ˜41; Ruedl et al., 2000, J. Immunol. 165: 4910-6). However, more recent studies using reliable genetic methods have demonstrated that the life span of mature antigen-presenting DCs is much longer than previously estimated and lasts 2 weeks in vivo ( Garg et al., 2003, Nat. Immunol. 4: 907-12), suggesting that mature DCs play a regulatory role after initial engagement with T cells.

  This result demonstrates that pro-inflammatory signaling in mature DCs that is tightly restricted by SOCS1 critically controls the magnitude of autoantigen-specific CTL responses. This means that the CTL response is at least two levels: the DC maturation required for initiation of the CTL response and the ongoing cytokine signaling of the mature DC with itself and the CTL, the magnitude of which is regulated by SOCS1 expression This means that it is controlled by DC. The results further imply a dynamic interaction between the DC of various immune cells and their surrounding environment and the composition and concentration of cytokines and pathogen products, which collectively maintain or break self-tolerance, As a result, the fate of the autoantigen-specific CTL reaction is determined.

  The results disclosed herein reveal a novel mechanism for adjusting self-tolerance maintenance or breakage. It was discovered that SOCS1-restricted signal 3 (IL-12) provided by DC (rather than peptide affinity and costimulatory molecule levels) controls self-tolerance critically. Autoimmune disease (Banschlo et al., 2004, Immunity 20: 539-50) and other models (Kartsinger et al., 2003, J. Exp. Med. 197: 1141-51; Valenzuela et al., (2002, J. Immunol. 169: 6842-9), the importance of cytokines for DC-mediated activation or overactivation of T cells has been implied.

The production of cytokines such as IL-12 by wtDC is transient and is described in this and other studies (Langecamp et al., 2000, Nat. Immunol. 1: 311-6.
As demonstrated in page), it is inhibited by SOCS1 at the time of stimulation. In contrast to wtDC, SOCS1-silenced DCs have intruded autocrine (and possibly in some cases) through the Jak / Stat signaling pathway within the DC after disabling the inducible feedback inhibitor of this pathway. It was observed that by forming a signaling loop (also paracrine), it was possible to continuously produce significantly enhanced IL-12 and IL-12-induced cytokine levels in response to initial stimulation. Consistent with this, in vivo administration with low doses of IL-12 was found to effectively enhance the ability of SOCS1-silenced DCs to break self-tolerance (rather than wtDC).

  Collectively, these results indicate that continuous and enhanced production and signaling of IL-12 and IL-12-induced cytokines produced by SOCS1-silenced DCs are disrupted by self-tolerance and anti-tumor CTL responses This means that there is a high probability of playing a major role in augmenting These results further suggest that intracellular inhibition of stimulatory signaling by SOCS1 in DCs contributes to maintaining self-tolerance. SOCS1 was found to directly block NF-κB signaling by targeting the p65 protein for ubiquitin-mediated proteolysis through its SOCS box region (Ryo et al., 2003, Mol. Cell. 12th). No. 1413-26) reported that SOCS1 indirectly regulates TLR signaling in macrophages for LPS-induced toxicity by inhibiting type I IFN signaling (Gingla ( Gingras) et al., 2004, J. Biol. Chem. 279: 54702-7). Unlike LPS-induced toxicity through type I IFN signaling, the results herein demonstrate that the CTL response elicited by SOCS1-silenced DCs is mediated primarily by IL-12. The results in this document also demonstrate enhanced production of various cytokines such as TNF-α, IL-6 and IL-12 by SOCS1-silenced DC in response to LPS.

  This study demonstrates the need for silencing SOCS1 within DCs to elicit effective anti-tumor immunity against self-tumor associated antigens. DC vaccines are considered one of the most promising strategies for tumor vaccination, as evidenced in 98 published DC vaccine trials involving more than 1000 patients in recent years (Rosen (Rosenberg et al., 2004, Nat. Med. 10: 909-15). These attempts, primarily aimed at promoting DC maturation and antigen presentation through a variety of approaches, are extremely disappointing and highly disappointing with the targeted clinical response success (Rosenberg et al., 2004, Nat. Med. 10: 909-15). The data in this document demonstrates that wtDC loaded with high affinity peptides was still unable to break self-tolerance even after in vivo stimulation with LPS or IL-12. Thus, the results in this document can explain the general ineffectiveness of the currently described tumor vaccines (Rosenberg et al., 2004, Nat. Med. 10: 909-15) and the DC antigen Provides a new way to develop more effective tumor vaccines by silencing critical signaling inhibitors such as SOCS1 in combination with current strategies that promote the presentation and maturation of (Gilboa ( Gilboa), 2004, Nat. Rev. Cancer 4: 401-11; You et al., 2000, J. Immunol. 165: 4581-4592; Soiffer et al., 2003. J. Clin. Oncol 21: 3343-50; 2002, Nat.Rev.Immunol No. 2:. 227-38, pp.).

This SOCS1 silencing approach, which has the ability to specifically enhance antigen-specific immune responses elicited by antigen-loaded DCs, also differentiates autoreactive T cells, including those against major tissues or organs, without discrimination. It is also more attractive than the approach of systemically blocking CTLA4 on effector T cells that are overactivated (Hodi et al., 2003, Proc. Natl. Acad. Sci. USA 100: 4712-7; Phan et al., 2003, Proc. Natl. Acad. Sci. USA 100: 8372-7). In summary, since the intensive efforts to enhance tumor vaccines have been focused on improving antigen affinity / dose and costimulation, the enhancement of SOCS1 silenced DCs found in this study New mechanisms for modulating the immunostimulatory capacity and self-tolerance should provide a generally applicable new vaccination strategy that breaks the self-tolerance limit on tumors.

Example 7: HIV, specific antibodies and CTL responses elicited by murine SOCS1-siRNA-DC This example demonstrates an alternative strategy for inducing an anti-HIV immune response by inhibiting the host's natural immune inhibitors is doing. This study demonstrates that SOCS1, a negative immune regulator of the JAK / STAT pathway in DC, regulates antibody responses as well as HIV-specific cytotoxic T lymphocytes (CTLs). SOCS1 silenced DCs are resistant to HIV envelope mediated suppression and effectively induce a balanced memory HIV envelope specific antibody and CTL response in the mouse body. The present disclosure is the first attempt to elicit HIV-specific antibodies and CTL responses by inhibiting host immune inhibitors.

  The materials and methods used in the experiments presented in this example are now described.

Transduction of BM-derived DCs with lentiviral vectors Recombinant lentiviral vectors, LV-SOCS1-siRNA and LV-GFP-siRNA were produced, titrated and DCs as described elsewhere in this document. Was used to transduce.

Cytokine and antibody ELISA assays Cytokine levels in cell culture supernatants were quantified by ELISA analysis (BD Biosciences, Lincoln Park, NJ) according to the manufacturer's instructions. To determine the titer of Gp120-specific antibodies and subclasses, gp120 protein (5 μg / ml in carbonate buffer [pH 9.6]) was coated overnight at 4 ° C., 1 hour at room temperature, PBS-5% on the wall A 12-fold serial dilution of serum in FBS was added. After 8 washes, biotinylated anti-mouse antibody (anti-mouse IgM, IgG, IgG1, IgG2a, IgG2b or IgG3) was added to the wells for 1 hour at room temperature. Streptavidin-HRP was used as the peroxidase substrate. The reaction was stopped by adding 50 μl of 2M H ₂ SO ₄ . Optical density was read at 450 nm on a bioassay reader. Assuming that the χ axis scale is the logarithm, the result is expressed as a mutual end point titer determined from a scatter diagram in which the dilution 1 is taken on the χ axis and the optical density (OD) value is taken on the y axis. After plotting the data, a logarithmic curve fit was applied to each individual dilution series to determine the point at which the curve fit crossed the positive and negative cutoff values. Cut-off values were calculated for each antibody isotype as the average (+3 SD) of all dilutions from control mouse sera. All samples tested in each experiment were assayed simultaneously.

T Cell Enzyme Linked Immunospot (ELISPOT) Assay An ELISPOT assay of isolated CD4 + or CD8 + T cells was performed as described elsewhere in this document.

B cell isolation and single cell suspensions prepared from spleen gp120 antibody producing B cells ELISPOT assays in complete RPMI1640 medium, in 5% CO _2, and a flat plate fixed on the 1 hour plastic dishes at 37 ° C. Adhesive macrophages were removed. Non-adherent cells were treated with anti-Thg1.2 and rabbit complement at 37 ° C. for 45 minutes to lyse T cells. The purity of the remaining B cells was usually above 90%. A B cell ELISPOT assay was performed by the modified method as described above ((Le Bon et al., 2001, Immunity No. 14: 461-7023)). Briefly, 96 well nitrocellulose based plates (Millipore Multiscreen PI) were coated overnight with gp120 in PBS. The plates were washed 6 times with PBS and blocked with RPMI 1640 containing 10% FBS at 37 ° C. for 2 hours. Isolated B cells were seeded in wells (5 × 10 ⁵ cells / well) and incubated for 20 hours at 37 ° C. in 5% CO ₂ . The cells were then removed by washing 6 times with PBS 0.5% Tween 20 (Sigma, St. Louis, MO). Biotinylated anti-mouse IgG (BD Farmingen) diluted to 1 μg / ml in PBS containing 0.5% FBS was added and the mixture was incubated for 2 hours at 37 ° C. Avidin: biotinylase complex (ABC, Vector Laboratories, Inc., Burlingame, Calif.)) Was added for an additional hour. After reacting for 4 minutes with AEC (3-amino-9-ethylcarbazole; Sigma, St. Louis, MO), anti-gp120 IgG was detected. Using the KSELISPOT 4.3 software, an automated ELISPOT reader system (Carl Zeiss, Inc., Thornwood, NY) at ZellNet Consulting Inc. ( New York, NY evaluated the results.

Quantitative RT-PCR analysis of BAFF and APRIL The relative expression of SOCS1 in transfected mouse BM-DC was assessed by quantitative real-time PCR. Total RNA was extracted from DCs using Trizol reagent (Invitrogen, Carlsbad, Calif.) And random hexamer primers and SuperScript First Strand Synthesis Kit (Invitrogen, CA) Carlsbad) was used to reverse transcribe 1.0 μg of total RNA for each sample. On an ABI 7900HT Sequence Detection System (Applied Biosystems, Foster City, Calif.) In a 20 μl quadruplicate reaction using an equivalent of 5 ng starting RNA material per reaction as a template. Time 5'-nuclease fluorogenic PCR analysis was performed. The following primers were used for BAFT and APRIL: BAFF, sense 5′-TGCTATGGGTCATGTCATCCA-3 ′ (SEQ ID NO: 17) and antisense 5′-GGCAGTGTTTGGGGCATATTC-3 ′ (SEQ ID NO: 18); APRIL, sense 5 ′ -TCACAATGGGTCAGGTGGTATC-3 '(SEQ ID NO: 19) and antisense 5'-TGTAAATGAAACAACCCTGCACTGT-3' (SEQ ID NO: 20). Tag Man probes, forward and reverse primers for 18S, were obtained from Taqman Rodent 18S control reagent (Applied Biosystems, Foster City, Calif.). PCR parameters are recommended for the TaqMan Universal PCR Master Mix kit (Applied Biosystems, Foster City, Calif.), BAFF, APRIL and 18S. The reaction was performed in a separate tube. The levels of BAFF and APRIL were normalized to 18S rRNA, while BAFF or APRIL expression (in relation to the control values of the mock-transfected simulated DC) was compared to the compatibilized Ct method (Ribach et al., 2001, Met
hods No. 25: pages 402-8).

CTL Assay CD8 + CTL response was assessed with a standard chromium release assay as described elsewhere in this document that measures the ability of in vitro restimulated splenocytes to lyse target cells. Splenocytes pooled from immunized mice were restimulated in vitro in RPMI-1640 containing gp120 protein (20 μg / ml) for 4-6 days. Target cells pulsed with 20 μg / ml gp120 protein overnight were labeled with ⁵¹ Cr sodium chromate solution for 90 minutes. Different numbers of effector cells were incubated with a fixed number of target cells (1 × 10 ⁴ / well) in 96-well V-bottom plates (200 μl / well) at 37 ° C. for 3 hours. Supernatants (100 μl) were collected from triplicate cultures. The percentage of cell lysis was calculated as (experimental release-spontaneous release) / (maximum release-spontaneous release) x 100.

T and B cell proliferation assays CD4 + or CD8 + T cells (1 x 10 ⁶ per well) and B cells (1 x 10 ⁵ per well) isolated as described elsewhere in this document Cultured in complete medium in triplicate wells of 96-well plates in the presence or absence of various stimuli. On day 4 of culture, the wells were pulsed with 1 μCi [ ³ H] -thymidine for 16 hours. Plates were then harvested and [ ³ H] -thymidine incorporated was measured using a Micro Beta scintillation counter (Top Count NXT, Packard).

DC Immunization Bone marrow derived DCs (BM culture day 5) were transduced with LV-SOCS1-siRNA or LV-GFP-siRNA at 5 MOIs as described elsewhere in this document.

  The results of the experiment presented in this example will now be described.

Silencing of SOCS1 in DC enhances HIV Env-specific antibody response We first investigated the effect of SOCS1 silencing on the ability of DC to elicit anti-HIV antibodies. HIV Env was used in this study because it can elicit both cellular and neutralizing antibody responses. Recombinant lentiviral vector (LV-SOCS1-siRNA) expressing SOCS1 siRNA with the ability to down-regulate about 90% of SOCS1 mRNA in transfected cells as described elsewhere in this document And a control vector (LV-GFP-siRNA) was generated. Mouse bone marrow (BM) -derived DCs were transduced with LV-SOCS1-siRNA or LV-GFP-siRNA, loaded with recombinant HIV gp120 protein, and matured ex vivo with LPS. Groups of mice were then immunized twice weekly with transduced DCs, followed by LPS stimulation in vivo after each DC immunization. In vivo stimulation was used based on the observation that CTL responses to tumor-associated antigens elicited by SOCS1-silenced DCs could be further enhanced as described elsewhere in this document. FIG. 15A shows that LV-SOCS1-siRNA-DC elicited a gp120-specific IgM and IgG response that was significantly more robust than the control LV-GFP-siRNA-DC.

The production of different antibody subclasses whose profiles represent completely different immunological states depends on the function of CD4 + T-helper (Th) 1 and Th2-polarized cytokines and Th cells (Allen et al., 1997 Immunol.Today 18: 387-92). FIG. 15B shows a significant increase in HIV Env-specific antibody titers in all IgG subclasses in mice immunized with LV-SOCS1-siRNA-DC compared to the corresponding subclass in LV-GFP-siRNA-DC mice. Shows an increase. The profile of the Env-specific antibody subclass shows a mixed response of the product of the Th2 response, IgG1 and the subclass IgG2a associated with the Th1 response, indicating that both Th1- and Th2-dependent immune responses are LV -Indicates that it was induced by SOCS1-siRNA-DC. Similar results were obtained in repeated experiments. Since mice are not suitable species for reliable testing of HIV neutralizing antibodies, neutralization assays were not performed ((Burton et al., 2004, Nat. Immunol. 5: 233). -6 pages)). Furthermore, SOCS1 silencing was observed to enhance antibody responses to other strains of HIV Env protein and antigens such as ovalbumin (OVA). These results demonstrate that the HIV Env-specific antibody response, encompassing all IgG subclasses, is greatly enhanced by silencing of SOCS1 in DCs, indicating that the antigen-specific antibody response is The critical role of SOCS1 in the DC in controlling is implied.

Silencing of SOCS1 in DC enhances HIV gp120-specific CTL response The following experiment was performed to assess whether SOCS1 silencing can enhance a HIV Env-specific CTL response. To test the functional status of CD8 + T cells in immunized mice, IFNγ ELISPOT, intracellular cytokine staining and CTL assay were used. CTL activity against gp120-pulsed target cells in LV-SOCS1-siRNA-DC mice was much more potent than in LV-GFP-siRNA-DC mice (P <0.01) (FIG. 15C). ). The CTL activity detected in these assays was gp120 specific because spleen cells from LV-SOCS1-siRNA-DC mice lacked any apparent CTL activity against target cells not receiving gp120 pulses. Met. Consistent with this, in mice immunized with LV-SOCS1-siRNA-DC, 363 IFNγ + spots per 5 × 10 ⁵ CD8 + T cells, respectively, compared to 191 spots in LV-GFP-siRNA-DC mice. Was detected (FIG. 15D). Intracellular staining of splenocytes with IFN-γ also showed a higher percentage of IFN-γ ⁺ T cells in LV-SOCS1-siRNA-DC mice. Taken together, these results demonstrate a balanced and enhanced antibody and CTL response to HIVEnv in mice immunized with SOCS1-silenced DCs, indicating that SOCS1 in DCs is fluid It suggests critical regulation of both sexual and cellular immunity.

Mixed enhanced Th1 and Th2 responses elicited by SOCS1-silenced DCs While not wishing to be bound by any particular theory, in view of the role of cytokines in programming Th1 versus Th2 responses (MacDonald et al., 2002, J. Immunol. 168: 3127-30; Gor et al., 2003, Nat. Immunol. 4: 503-5), SOCS1 silencing Are thought to have the potential to affect CTL and antibody responses by modulating the production of cytokines by DCs. FIG. 16A shows IL-12, IFN-γ and TNFα levels that promote the Th1 polarized response produced by LV-SOCS1-siRNA-DC compared to GFP-siRNA-DC after stimulation with LPS. Has demonstrated a significant increase in Interestingly, significant responses of IL-4, IL-6, and IL-10 that promote a Th2-polarized response were also found in SOCS1-silenced DCs (P <0.01). Higher levels of both Th1 and Th2-promoting cytokines produced by SOCS1-silenced DCs explain the enhanced ability of SOCS1-silenced DCs to elicit both HIV Env-specific CTL and antibody responses be able to.

Based on these results, SOCS1 silencing in DCs is due to antibody and CTL
Clearly promoted the response. The following experiments focus on whether the HIVEnv-specific CD4 + Th response, which is closely involved in the induction of antibody and CTL responses, is also enhanced by SOCS1 silencing. CD4 + T cells were isolated from immunized mice using CD4 + microbeads and analyzed using various assays. As depicted in FIG. 16B, the frequency of gp120-specific CD4 + T cells was significantly higher in LV-SOCS1-siRNA-DC mice than in LV-GFP-siRNA-DC mice. ^{The 3} H-thymidine incorporation assay shows that LV-SOCS1-siRNA-DC-derived CD4 + T cells are more active than those from LV-GFP-siRNA-DC mice in response to stimulation with DCs receiving gp120 pulses. It was shown to proliferate (FIG. 16C). Analysis of the cytokine profile produced by CD4 + T cells isolated from LV-SOCS1-siRNA-DC after stimulation with DCs receiving gp120 pulses was analyzed for Th1 polarization (IFN-γ, IL-2 and TNFα) and Th2 polarization. Increased levels of both (IL-4 and IL-10) cytokines were revealed (FIG. 16D). These results indicate that SOCS1-silenced DC induces an enhanced mixed Th1 and Th2 response to HIV Env, which is consistent with the mixed gp120-specific IgG subclass profile in FIG. 15B. I'm doing it.

Enhanced gp120-specific B cell activation by SOCS1-silenced DCs DCs stimulate B-lymphocytes, also known as APRIL (proliferation-inducing ligand) and BAFF (also known as BLyS), members of the TNF superfamily Have been shown to directly induce B cell proliferation, maturation and class switch recombination (Balass et al., 2002, Immunity 17: 341-52; Litinsky). ) Et al., 2002, Nat. Immunol. 3: 822-9; MacLennan et al., 2002, Immunity 17: 235-8). Therefore, the effect of SOCS1 silencing on the production of APRIL and BAFF by DC using real-time RT-PCR was assessed. LV-SOCS1-siRNA-DC expressed higher levels of APRIL and BAFF mRNA at the time of LPS stimulation than LV-GFP-siRNA-DC, consistent with increased expression of BAFF and APRIL in SOCS1 ^{− / −} DC ( FIG. 17A) (Hanada et al., 2003, Immunity 19: 437-50).

In order to directly test the frequency of anti-gp120 IgG producing B cells in the immunized mice to test the ability of SOCS1-silenced DCs to enhance the activation of gp120-specific B cells, anti-gp120 IgG A specific B cell Elispot assay was used. The frequency of anti-gp120 IgG producing B cells was significantly higher in LV-SOCS1-siRNA-DC mice than in LV-GFP-siRNA-DC mice (P <0.01) (FIG. 17B). An activated phenotype characterized by a higher percentage of B cells compared to B cells from LV-GFP-siRNA-DC mice is characterized by high levels of CD69, CD40 and CD86 in LV-SOCS1-siRNA-DC mice showed that. In addition, B cells derived from the spleens of immunized mice were purified and stimulated with various stimuli. FIG. 17C shows that B cells derived from LV-SOCS1-siRNA-DC mice proliferated more vigorously when co-stimulated with anti-CD40 and IL-4 than B cells derived from LV-GFP-siRNA-DC mice. Is shown. Interestingly, B cells derived from LV-SOCS1-siRNA-DC mice but not from LV-GFP-siRNA-DC mice responded strongly to IL-4 or anti-CD40 only, This suggests that an increased number of B cells were already activated in vivo by immunization with LV-SOCS1-siRNA-DC. Similarly, it has been observed that B cells from LV-SOCS1-siRNA-DC mice produce higher levels of various cytokines including IL-6, IL-2 and TNF-α in response to various stimuli. (Fig. 17
D). Collectively, these results indicate that SOCS1-silenced DCs produce enhanced levels of B-lymphocyte stimulating factors (BAFF and APRIL) and Th2 polarized cytokines, and that of HIV Env-specific B cells and Th cells. It suggests that it leads to more effective activation.

Long-term HIV Env-specific CTL and antibody responses elicited by SOCS1-silenced DCs Although SOCS1 silencing within DCs has been shown to enhance primary HIV Env-specific CTL and antibody responses, SOCS1 silencing It was further assessed whether the singed DC would elicit a memory HIV specific CTL and antibody response. FIG. 18A shows that mice immunized with LV-GFP-siRNA-DC have very low levels of gp120-specific antibody 6 months after immunization, while LV-SOCS1-siRNA-DC mice still have their serum. It shows that gp120-specific IgG1 and IgG2 antibodies were retained at significant titers. One week after booster LV-SOCS1-siRNA-DC mice show a strong recall antibody response, with an average titer of anti-gp120IgG1 of 2 × 10 ⁵ and an average titer of anti-gp120IgG2 of 1 × 10 ⁵ On the other hand, LV-GFP-siRNA-DC mice showed a low recall antibody response, with an average IgG1 titer of 3 × 10 ³ and IgG2 of 4 × 10 ² . These data represent that SOCS1-silenced DCs show approximately 64-fold and 255-fold increases in IgG1 and IgG2a antibody titers, respectively, compared to GFP-siRNA-DC.

Maintenance of memory HIV-specific CTL and Th was assessed by examining gp120-specific CD8 ⁺ and CD4 + T cell responses with an IFNγ-ELISPOT assay. FIG. 18B shows that a strong gp120-specific CTL response was detected in the body of LV-SOCS1-siRNA-DC mice but not LV-GFP-siRNA-DC mice 6 months after immunization ( (249 IFNγ spots per 5 × 10 ⁵ CD8 + T cells in LV-SOCS1-siRNA-DC mice vs. 3 IFNγ spots in LV-GFP-siRNA-DC mice)). A vigorous gp120-specific CTL response in LV-SOCS1-siRNA-DC mice was rapidly elicited by boost, but not in LV-GFP-siRNA-DC mice ((7 days after boost) Eyes: 446 IFNγ spots per 5 × 10 ⁵ CD8 + T cells in LV-SOCS1-siRNA-DC mice versus 16 IFNγ spots in LV-GFP-siRNA-DC mice) (FIG. 18B). Co-staining of surface CD44 memory marker and intracellular IFN-γ also resulted in a higher percentage of CD44hi in the body of LV-SOCS1-siRNA-DC mice compared to LV-GFP-siRNA-DC mice 6 months after immunization. And IFNg + CD8 + T cells (FIG. 18C). 6 months after immunization, a gp120-specific CD4 + Th response was maintained and rapidly induced in LV-SOCS1-siRNA-DC mice (LV-SOCS1-siRNA-DC mice 7 days after booster immunization). 391 IFNγ spots per 5 × 10 ⁵ CD4 + T cells in vivo vs 37 LV-GFP-siRNA-DC mice (FIG. 18D), thus immunization with SOCS1-silenced DCs Effectively induces long-term HIV Env-specific CTL, Th and antibody responses.

From the 7th month after immunization, no obvious toxicity was observed in the body of mice immunized with LV-SOCS1-siRNA-DC pulsed with gp120. Histological analysis of all major organs and tissues of immunized mice revealed no pathological inflammation. IgG and anti-dsDNA levels were comparable in DC-LV-SOCS1-siRNA and mock DC mice. These data suggest that immunization of LV-SOCS1-siRNA-DC that received gp120 pulses does not cause pathological inflammation in the mouse body.

Resistance of SOCS1-silenced DCs to HIV Env-mediated immunosuppression HIV viruses containing the gp120 protein can suppress the ability of DCs to produce pro-inflammatory cytokines and stimulate T cells (Fantuzzi et al. 2004, J. Virol. 78: 9763-72; Granelli-Pipeno et al., 2004, Proc.Natl.Acad.Sci.USA.101: 7669-74; (Barron et al., 2003, J. Infect. Dis. 187: 26-37; Pacanoski et al., 2001, Blood 98: 3016-21). In order to assess whether enhanced activation of DC by SOCS1 silencing could overcome the inhibitory effect of gp120 protein on DC cytokine production and immunostimulatory capacity, the following experiment was undertaken. DC-derived IL-12 was found to play a dual role in driving Th1 development and signaling B cells directly to generate a humoral response. IL-12 was selected as a representative cytokine for (Dubois et al., 1998, J. Immunol. 161: 2223-31; Duboa et al., 1997, J. Exp. Med. 185. No .: 941-51; Skok et al., 1999, J. Immunol. 163: 4284-91).

  As shown in FIG. 19A, LV-SOCS1-siRNA-DC in the presence of gp120 protein retained the ability to respond to LPS. In contrast, the response of LV-GFP-siRNA-DC to LPS stimulation was severely reduced by the presence of gp120 protein. The sensitivity of SOCS1-silenced DCs to gp120-mediated suppression was further investigated in vivo. Mice were immunized with transduced DCs pulsed with OVA with or without ex vivo pretreatment of gp120 protein. Pre-exposure to gp120 protein has no obvious effect on the ability of LV-SOCS1-siRNA-DC to elicit an OVA-specific antibody response (FIGS. 19B and 19C) OVA induced by LV-SOCS1-siRNA-DC It did not reduce specific CD8 + CTL and CD4 + Th responses (P> 0.05) (FIGS. 19D and 19E). However, such pretreatment significantly reduced the ability of LV-GFP-siRNA-DC to elicit OVA specific antibodies and CTL responses (P <0.05) (FIGS. 19B-19E). These results indicate that SOCS1 silencing confers resistance to HIV gp120-mediated suppression, presumably due to enhanced cytokine production and the over-activated state of SOCS1-silenced DCs. (Hanada et al., 2003, Immunity, 19: 437-50).

Example 8: In vivo DNA vaccination to enhance HIV-specific antibodies and CTL responses This example demonstrates that co-immunization with SOCS1 siRNA expressing DNA significantly enhances the efficacy of HIV DNA vaccination. Yes. This study represents the first attempt to elicit HIV-specific antibodies and CTL responses by inhibiting host immune inhibitors, which presents a new path to developing more effective HIV vaccines. is doing.

  The materials and methods used in the experiments presented in this example are now described.

DNA vaccination As previously described elsewhere in this document, pSuper-SOCS1-siRNA
An expression vector was generated. To generate a HIV Env retrogen expression vector, the gp140CF plasmid is deleted by deleting the gp120 / gp41 cleavage site of HIV gp160 and the fusion domain of gp41 (JRFL with codon usage optimization) to promote secretion of HIV Env. First built. The resulting pCMV / R-gp140CF-Fc retrogen vector contains the gp140CF gene fused to an IgG Fc fragment under the control of a CMV promoter. Recombinant gp120 (JFRL) protein was produced from CHO cells and was provided by the NIHAIDS research reference program. Endotoxin-free DNA is prepared with the Qiagen kit and resuspended in endotoxin-free PBS (Sigma, St. Louis, MO; Aldrich, St. Louis, MO) at a final concentration of 1 μg / μl. And stored at −20 ° C. until used for injection. On the scheduled day of vaccination, 50 μg of gp140CF-FcDNA or a mixture of gp140CF-FcDNA (50 μg) and pSuper-SOCS1-siRNA expressor DNA (150 μg) was injected intramuscularly into the quadriceps of each mouse (Houser (Hauser et al., 2004, Gene Ther. No. 11: 924-32; You et al., 2001, Cancer Research 61: 3704-11). Immunized mice were then treated 3 times with LPS (30 μg / mouse) (IP) 1, 3, and 5 days after each DNA immunization.

  The experimental results presented in this example will now be described.

Efficacy of HIV DNA vaccines enhanced by co-immunization with SOCS1 siRNA DNA The ability of SOCS1-silenced DCs to enhance both HIV Env-specific CTL and antibody responses may improve the efficacy of HIV DNA vaccination. It has been suggested that this SOCS1 silencing approach may be useful. A “retrogen” immunization strategy that uses receptor-mediated endocytosis to enhance DC targeting and MHC presentation of antigens has been described by Hauser et al., 2004, Gene Ther. 11: 924-32 and You et al., 2001, Cancer Research 61: 3704-11. Briefly, gp140CF retrogen was produced by in-frame fusion of an IgG Fc fragment to the gp140CF gene lacking the gp120 / gp41 split site and the gp41 fusion domain. The resulting gp140CF-Fc fusion protein was expressed and secreted from cells that had been transfected with the gp140CF-Fc vector.

To test the effect of SOCS1 siRNA at the time of DNA vaccination, mice were injected with gp140CF-FcDNA alone or a mixture of gp140CF-FcDNA and pSuper-SOCS1-siRNA expressing DNA once a week for 3 weeks. The mice were then monitored for HIV Env-specific immune responses one week later. Enhancement of HIV Env-specific antibody titers was evident in mice co-immunized with pSuper-SOCS1-siRNA DNA (FIG. 20A). PSuper-SOCS1-siRNA as demonstrated by CTL and ELISPOT assays (FIGS. 20B and 20C)
Simultaneous injection of DNA significantly enhanced the HIV Env-specific CTL response. Moreover, co-injection of SOCS1-siRNA DNA enhanced the HIVEn specific CD4 + Th response (FIG. 20D). Intracellular staining with cytokines also showed enhanced gp120-specific CD4 + T cell responses in mice co-immunized with pSuper-SOCS1 siRNA DNA. These results indicate that co-immunization of pSuper-SOCS1 siRNA DNA demonstrates the efficacy of HIV DNA vaccination due to the enhanced immunostimulatory capacity of antigen-presenting cells that have been co-transfected in the immunized mouse. It means to strengthen. Thus, the SOCS1 silencing strategy presented herein is applicable to ex vivo DC-based and in vivo vaccination settings.

Alternative and Effective HIV Vaccination Approach Based on Inhibition of Natural Immune Inhibitors in DC The present disclosure shows that silencing of the negative signaling regulator SOCS1 in DCs causes HIV Env-specific antibodies and CTLs in the mouse body It demonstrates that it results in a significant enhancement of both responses. It was observed that both HIV Env-specific antibodies and CTL responses elicited by SOCS1-silenced DCs last long. Furthermore, the results demonstrated that co-immunization with SOCS1 siRNA DNA significantly enhances the efficacy of HIV DNA vaccination. Thus, a balanced memory humoral and cellular response to HIV can be induced in SOCS1-silenced DCs, and this SOCS1 silencing strategy is applicable to both therapeutic and prophylactic HIV vaccination settings It is.

The role of DCs in inducing humoral responses has traditionally been considered a natural consequence of CD4 + Th priming for cognate interactions between T and B cells. However, the direct role of DCs in stimulating humoral responses has been demonstrated in vitro and in vivo (Duboa et al., 1997, J. Exp. Med. 185: 941-5138; Inaba et al. 1983, Proc. Natl. Acad. Sci. USA 80: 6041-5). In particular, DC was found to strongly enhance both proliferation and antibody production of CD40 activated B cells (Duboa et al., 1997, J. Exp. Med. 185: 941-51). ). Immunization with DCs loaded with antigen can elicit a protective humoral response (Flamand et al., 1994, Eur. J. Immunol. 24: 605-10)). The results in this document indicate that ThCS1-silenced DC is likely to be responsible for the enhanced Th and B cell activation found in mice immunized with SOCS1-silenced DC. It has been demonstrated to enhance the production of polarized cytokines and B-lymphocyte stimulating cytokines (BAFF and APRIL). This finding is supported by a previous report that (SOCS1 ^{− / −} DC induces abnormal expansion of B cells and autoreactive antibody production (Hanada et al., 2003, Immunity 19: 437-50)). Has been. Thus, this study demonstrates the critical role of SOCS1 in DCs in controlling HIV-specific antibody responses, and comprehensively uses SOCS1 silencing to develop antibody responses against antigens other than HIV Env. It implies that it can be increased.

An important finding of this study is that SOCS1-silenced DCs elicit with a balanced memory HIV-Env-specific antibody and CTL response that may be desirable to prevent or control HIV infection (Burton et al., 2004, Nat. Immunol. 5: 233-6; McMichael et al., 2003, Nat. Med. 9: 874-80; Nabel, 2001, Nature 410: 1002-7; Letvin et al., 2002, Annu. Rev. Immunol. 20: 73-99; Zolla-Pazner, 2004, Nat Rev. Immunol. No. 4: pp. 199-210; Imai et al. 002 years, J.Virol No. 76:.. 9011-23, pp; Retobin et al., 2003, Nat.Med No. 9: 861-6 pages)). While not wishing to be bound by any particular theory, the mechanisms by which SOCS1 silencing induces a balanced memory humoral and cellular response include SOCS1-silenced DC and gp120-specific CD4 + T Production of a mixed pattern of Th1 and Th2 polarized cytokines by the cell may be involved. These results are consistent with naturally occurring mixed antibodies and CTL responses against a number of pathogens such as viruses (Allen et al., 1997, Immunol. Today 18: Pp. 387-92), indicating that Th1 and Th2 polarizations are not mutually exclusive (Gor)
Et al., Nat. Immunol. 4: 503-5; Colonna, 2001, Nat. Immunol. No. 2: pages 899-900)).

  SOCS1 functions as a feedback inhibitor of the JAK / STAT signaling pathway used by various cytokines and is involved in directly or indirectly regulating the TLR signaling pathway (Baetz et al., 2004, J Biol. Chem. 279: 54708-15; Gingla et al., 2004, J. Biol. Chem. 279: 54702-7). The results in this document consistently indicate enhanced production of various cytokines such as TNF-α, IL-6 and IL-12 by SOCS1-silenced DCs in response to LPS. LPS-TLR signaling activates abundant NF-κβ responsive genes, including numerous inflammatory cytokines that can function in autocrine and paracrine (Bets et al., 2004, J. Biol. Chem. 279: 54708-15; Grohmann et al., 1998, Immunity 9: 315-23; Pan et al., 2004, Immunol. Lett. 94: 141-51) . Given the fact that SOCS1 is involved in indirectly attenuated TLRSGL, cytokines can establish autocrine or / and paracrine stimulation loops by overriding critical suppression of the JAK / STAT pathway This should lead to an enhancement rather than a reduction in cytokine production. The results disclosed herein involving the use of cytokines and cytokine receptor knockout mice suggest that the autocrine cytokine stimulation loop contributes to cytokine overproduction by SOCS1-silenced DCs.

  In HIV-infected individuals, DC functional defects and depletion are common and have a high probability of contributing to progressive immune deficiency. The HIV gp120 protein can suppress the ability of DC to produce pro-inflammatory cytokines and stimulate T cells (Fantuge et al., 2004, J. Virol. 78: 9763-72; Carbonneil). Et al., 2004, J. Immunol., 172: 7832-40). It has been demonstrated that SOCS1-silenced DCs are resistant to HIV gp120-mediated suppression because of the enhanced production of pro-inflammatory cytokines and the over-activated state of SOCS1-silenced DCs ((Hanada et al. 2003, Immunity 19: 437-50)). This finding is particularly relevant to the development of therapeutic HIV vaccines that would be used in immunosuppressed HIV-infected individuals (Lu et al., 2004, Nat. Med. No. 10: 1359-1365).

The vaccination strategy described here is the first effort to enhance the anti-HIV immune response by inhibiting host immune inhibitors in DCs. Since innate immunity is not effective in controlling HIV-1 infection, disabling host immune inhibitors can be crucial in generating an effective anti-HIV immune response. However, enhancing HIV-specific immune responses alone cannot lead to the induction of protective HIV antibodies and CTL responses. In this regard, the strategy provides an opportunity for combined immunization with currently available vaccines, as demonstrated by co-immunization of DNA vaccines and SOCS1 siRNA DNA. Improved HIV immunogens and delivery systems ((Burton et al., 2004, Nat. Immunol. 5: 233-6; Yang et al., 2002, J. Virol. 76: 4634-42 This vaccination approach, when used in conjunction with))) enhances the weak protective immune response or not only against a dominant epitope but also against a weak immunogenic or latent and protective epitope It can provide a new way to generate broader and stronger responses. In summary, this disclosure demonstrates the principle of inhibiting host signaling inhibitors in DCs to enhance both HIV-specific antibodies and CTL responses, and this strategy protects anti-HIV in monkeys and ultimately humans. Requests further investigation to determine if a response can be triggered. Furthermore, this SOCS1 silencing strategy could be used to enhance the immune response against other pathogens.

Example 9: Identification and analysis of human SOCS1 siRNA Human SOCS1: hSOCS1-siRNA1 (CACGCACUUCCCCACAUC.UC). Computer program was used to select siRNA sequences targeting .dT; SEQ ID NO: 23). All target sequences were subjected to NCBIBlast queries to confirm the lack of homology to other known genes. The designation “.dT.dT” means a poly dT sequence immediately downstream of the siRNA target sequence.

Example 10: Human Monocyte-DC Transfection with Gene Porter To investigate the role of human SOCS1 in the regulation of human DC, a small interfering RNA (siRNA) with the ability to specifically down-regulate human SOCS1 Was first identified. A computer program was used to select siRNA sequences targeting human SOCS1 and 293T cells. Each synthetic human SOCS-1-siRNA oligonucleotide duplex is then co-transfected into 293T cells with human SOCS1 expression flagged at a 10: 1 ratio using Gene Porter transfection reagent. It was. Forty-eight hours after transfection, cells were harvested and analyzed by Western blot as described elsewhere in this document.

  FIG. 21A shows that human SOCS1 siRNA1 efficiently downregulated human SOCS1 expression. The specificity of human SOCS1 mRNA downregulation by siRNA was confirmed by the inability of scrambled siRNA1 oligonucleotides to downregulate SOCS1 mRNA. Therefore, human SOCS1 siRNA1 was selected for further investigation. Synthetic siRNA duplexes were transfected into DCs derived from human monocytes by Gene Porter with a transfection efficiency of 85.5% (FIG. 21B). As confirmed by quantitative RT-PCR assay, the level of hSOCS1 mRNA in the total DC population transfected with hSOCS1 siRNA duplex was only about 60% compared to the level in mock-transfected DCs. There was a specific decrease (FIG. 21C, P <0.01). The siRNA efficiency and SOCS1 RNA reduction is similar to that observed in experiments with synthetic siRNA duplexes targeting mouse SOCS1 within the total mouse bone marrow derived DC population.

  The relative expression of human SOCS1 in human DCs was assessed by quantitative real-time RT-PCR as described elsewhere in this document. A pre-developed primer / probe set for human SOCS1 (Primer, 5′-TTTTTCGCCCCTTAGCGGGAA-3 ′; SEQ ID NO: 24 and 5′-CTGCCCATCCAGGTGAAAGC-3 ′; SEQ ID NO: 25, manufactured by Applied Biosystems of Foster City, Calif. And the probe, 6FAM-ATGGCCCTGGGACCCACGAG-TAMRA; SEQ ID NO: 26).

Characterization of human SOCS1 silenced DCs To assess whether human SOCS1 regulates the expression of costimulatory molecules on DCs by flow cytometry analysis, the following set of experiments was performed. Flow cytometric analysis for human SOCS1 proceeded as described in assessing mouse SOCS1 as described elsewhere in this document. Consistent with observations in mouse DC, h
DCs transfected with SOCS1-siRNA and DCs transfected with control hSOCS1-siRNA mutant differ in their expression of representative costimulatory molecules before and after LPS-induced maturation Was observed to show only a small amount (FIG. 22A). Comparable levels of MHC-I and II molecules were also detected on hSOCS1-siRNADC and mutant-siRNADC. In contrast, DCs transfected with hSOCS1 siRNA, as shown by greatly enhanced secretion of pro-inflammatory cytokines such as IL-12, IL-6 and TNF-α, It was observed that responsiveness to stimulation with LPS was higher than human DCs that had been transfected with siRNA mutants (FIGS. 22B and 22C).

Generation of recombinant adenoviral vectors expressing human SOCS1 siRNA AdEasy system (Ad (5) with E1 and E3 deleted; Quantum Biotechnologies Inc., Palo Alto, Calif.) , CA)) was used to construct and generate a replication defective adenovirus. The shuttle vector Ad-hSOCS1-siRNA was constructed by inserting the H1-human SOCS1-siRNA DNA fragment into the adeasy vector (FIG. 28). The insertion of human SOCS1-siRNA was confirmed by DNA sequencing. Subsequently, recombinant adenovirus Ad-hSOCS1-siRNA was generated according to the manufacturer's instructions (Quantum Biotechnology, Palo Alto, Calif.). Recombinant adenovirus was produced and titrated in 293 cells according to the manufacturer's instructions (Quantum Biotechnology, Palo Alto, Calif.). It was observed that recombinant Ad (5) can transfect DCs derived from human monocytes.

Example 11: MAGE3-specific CTL response primed with human SOCS1-siRNADC The following experiment was undertaken to investigate the role of human SOCS1 in modulating the immunostimulatory capacity of human DC. The results presented in this example show that human SOCS1 silenced DCs overreact to stimulation with pathogen products and prime autoantigen-specific human cytotoxic T lymphocytes (CTLs) It has been demonstrated that it has the ability to stimulate. Importantly, human SOCS1 silenced DCs, but not wild type DCs, have the ability to fully activate CTLs with active lytic activity against native antigen-expressing human tumor cells. Similarly, it is believed that the ability of human SOCS1-silenced DCs to prime CTL is likely to be controlled by SOCS1 restriction of IL-12 production and signaling. These results demonstrate the critical role of human SOCS1 in negatively regulating human DCs and translation of this SOCS1 silencing approach to develop more effective tumor vaccines for human patients We consider that potential is involved.

  The materials and methods utilized in the experiments disclosed herein are now described.

The peptide MAGE3 CTL peptide (FLWGPRALV; SEQ ID NO: 27) (van der burgen), which was HLA-A2-restricted to> 95% purity using HPLC by the peptide GeneMed Synthesis (South San Francisco, Calif., USA) Brugen) et al., 1994, European Journal of Immunology 24: 3038-43) and control H-2K ^b -restricted OVA-I (SIINFEKL; SEQ ID NO: 11) was synthesized and purified. Peptides were dissolved in DMSO (Sigma, St. Louis, MO) prior to final dilution in PBS without endotoxin.

Western Blot Analysis of Human SOCS1 Expression 293T cells were synthesized at a 10: 1 ratio using GenePorter reagent as described elsewhere in this document, and a human SOCS-1-siRNA oligonucleotide duplex (21 bp) Or co-transfected with an irrelevant oligo duplex and flag-tagged human SOCS1 expression vector (pCMV-hSOCS1). 48 hours after transfection, cells were harvested and subjected to SDS-PAGE. Western with anti-Flag (Sigma, St. Louis, MO) or actin (Santa Cruz Biotechnology, Santa Cruz, CA) antibodies after transfer to Hybond-P membranes (Amersham, Arlington Heights, Ill.) Following blotting, samples were analyzed by detection with ECL-Plus reagent (Amersham, Arlington Heights, Ill.). Thin films were scanned with a densitometer SI and SOCS-1 / actin bands were quantified with Image Quant software (Molecular Dynamics, Piscataway, NJ). The intensity of the SOCS1 band was normalized to the intensity of the beta actin band.

Quantitative RT-PCR analysis of human SOCS1 expression Relative expression of human SOCS1 in human DCs was assessed by quantitative real-time RT-PCR as described elsewhere in this document.

Transfection of DCs derived from human monocytes and in vitro priming of human T cells Schroers et al., 2003, Clinical Can. Res. 9: 4743-4755; and Scroars et al., 2004, Methods.
Mol. Biol. No. 246: Human DCs derived from PBMC were generated and cultured as described on pages 451-9. Heparinized blood was collected from healthy volunteers with HLA-A2 +. HLA classification was performed by PCR-SSP-DNA based procedure (The Methodist Hospital, Houston, TX). PBMC were resuspended in serum-free DC medium (CellGenix, Antioch, Ill.) And incubated at 37 ° C. in humidified 5% CO ₂ . The cell fraction adhered to the plastic was treated with 1000 IU / ml recombinant human GM-CSF (rhGM-CSF; R & D Systems, Minneapolis, MN) and 1000 IU / ml rhIL-4 (R & D Systems). And cultured in serum-free DC medium with Minneapolis, Minnesota). On day 5 or 6, monocyte-derived DCs were transfected with 120 nM siRNA oligonucleotides using a gene porter according to the manufacturer's instructions. The transfected DCs were then pulsed overnight with MAGE3 peptide (20 μg / ml). A total of 1 × 10 ⁶ human T cells per well of a 24-well plate was collected with 5% AB human serum, rhIL-2 (50 U / ml), and TNFa (10 ng / ml, R & D Systems, Minnesota) 5 × 10 ⁴ MAGE3 pulsed transfected DCs were co-cultured (20: 1) in 0.5 ml RPMI-1640 supplemented with Minneapolis. Co-cultured T cells were restimulated once on day 7 of co-culture with autotransplanted MAGE3 pulsed transfected DCs. For some experiments, anti-human IL-12 (p70) antibody (20 mg / ml, R & D Systems, Minneapolis, Minn.) Was added to DC and T cell co-culture once every three days. . After 2 weeks of co-culture, T cells were used for immunoassay.

Cytokine ELISA and Enzyme Linked Immunospot (ELISPOT) Assay DC culture supernatant for ELISA analysis (BD Biosciences, Lincoln Park, NJ) at the indicated time points according to the manufacturer's instructions Was used to quantify the levels of various pro-inflammatory cytokines. E of human peripheral lymphocytes
The LISPOT test was performed as described elsewhere in this document.

Flow cytometry analysis Cells were stained with FITC or PE mAbs in PBS containing 0.1% NaN ₃ and 2% FCS. Antibodies specific for human CD40, CD80 and CD86 and matched isotype controls were purchased from BD Biosciences (San Jose, Calif.). Stained cells were analyzed on a FACSCalibur (Becton Dickinson, Lincoln Park, NJ) flow cytometer.

Tetramer Staining Human MAGE3 / HLA-A2 tetramer was synthesized at Baylor College of Medicine Tetramer Core Facility (Houston, Texas, USA). Lymphocytes in co-culture or human peripheral blood lymphocytes were co-stained with anti-hCD8a-FITC / anti-hCD3-PerCP and MAGE3-PE trimers. Tetramer staining was performed at 4 ° C. for 1 hour according to the manufacturer's instructions using 1 μl of anti-CD8α and MAGE3-PE tetramer 1: 100 dilution per 10 ⁶ cells.

DC immunization of HLA-A2 transgenic mice 4-6 week old female HLA-A2.1 transgenic mice were purchased from Jackson Laboratory (Maine, USA) and in accordance with institutional guidelines Baylor College of Medicine Maintained in a sterile mouse facility (Houston, Texas, USA). Mouse BM-derived DCs were prepared from HLA-A2.1 transgenic mice as described elsewhere in this document and recombinant retroviral vectors LV-SOCS1-siRNA or LV-GFP- at a MOI of 5 Transduced with siRNA. DC were then pulsed with MAGE3 peptide for 20 hours, washed 3 times with PBS, and stimulated with TNFα for 24 hours (500 ng / ml, R & D Systems, Minneapolis, MN). Thereafter, DC was injected into the HLA-A2 transgenic mouse via the hind footpad. In some mice, LPS (30 μg / mouse) or recombinant mouse IL-12 (1 μg / mouse, Peprotech, Rocky Hill, NJ) was injected intraperitoneally (ip) after the days indicated after DC vaccination. .) Was administered.

CTL Assay A CD8 + CTL response was assessed in a standard chromium release assay that measures the ability of in vitro restimulated splenocytes to lyse target cells as described elsewhere in this document (Huan et al., 2003, Cancer Res. 63: 7321-9). Pooled splenocytes from 2-3 immunized mice were restimulated in vitro in RPMI-1640 containing MAGE3 peptide for 4-6 days. Human MAGE3 ^+, HLA-A2 ⁺ melanoma cells (SK-Mel-37) and control human MAGE3 ^+, HLA-A2 ^- melanoma cells (NA-6-Mel) Sodium 90 min ⁵¹ Cr chromic acid at 37 ° C. solution Labeled with Different numbers of effector cells were incubated with a fixed number of target cells (5 × 10 ⁴ / well) in 96-well U-bottom plates (200 μl / well) for 4 hours at 37 ° C. Supernatants from triplicate cultures were collected and analyzed. Percent dissolution was calculated as (experimental release-spontaneous release) / (maximum release-spontaneous release) x 100.

  The results of the experiment presented in this example will now be described.

Enhanced immunostimulatory efficacy of human SOCS1-silenced DC for priming antigen-specific CTL responses Silenced human SOCS1 stimulates human DC to prime autoantigen-specific CTL The next set of experiments was undertaken to assess whether it could be enhanced. HLA-A2 restricted peptide from human MAGE3, a germinoma antigen known to be expressed in adult human testicular and melanoma cells (Van der Burgen et al., 1994, European Journal of Immunology 24: 3038-43) was used as a model human autoantigen. Human monocyte-derived DCs from HLA-A2 + healthy volunteers were transfected with hSOCS1 siRNA oligonucleotides and then pulsed overnight with MAGE3 peptide (20 μg / ml). 5 × 10 ⁴ MAGE3 pulsed transfected DCs in the presence of TNFα (maturation stimulant) (10 ng / ml, R & D Systems, Minneapolis, Minn.) And a total of 1 × per well 10 ⁶ autologous human T cells were co-cultured (20: 1). Co-cultured T cells were restimulated once on day 7 of co-culture with DCs transfected with autografted MAGE-3 pulses. After two weeks of co-culture, T cells were used for immunoassay. In co-cultures with DCs transfected with hSOCS siRNA pulsed with MAGE3 peptide, 5.4% and 4.3% respectively in co-cultures with mut-siRNADC or mock DC pulsed with MAGE3 Compared to only 13.9% of CD8 + T cells were positive for MAGE3-tetramer (FIG. 23A). Tetramer staining of experimental (unstimulated) primary human lymphocytes from the same donor showed a low level of positive MAGE3 tetramer staining (0.5% CD8 + T cells). Consistent with this, intracellular IFNγ staining (FIG. 23B) was compared to mut-siRNADC (6.9% IFNγ + CD8 + T cells) or mock DC (5.7% IFNγ + CD8 + T cells) that received MAGE3 peptide pulse, It was shown that hSOCS1-siRNADC substantially improved the MAGE3-specific CTL response (11.18% IFNγ + CD8 T cells). Furthermore, the IFNγ ELISPOT assay (FIG. 23C) showed that hSOCS1-siRNADC activated an increased number of MAGE3-specific CTLs. Repeated experiments from HLA-A2 + donors showed similar results. The majority of primary human T cells died after 2 weeks of co-culture with DCs not pulsed with antigen. Collectively, these results indicate that human SOCS1 silenced DCs have an enhanced immunostimulatory ability to prime autoantigen-specific CTLs.

The critical role of SOCS1-restricted IL-12 in CTL priming SOCS1-silenced DCs augmented IL-12, a major cytokine in the activation of CTL responses in response to stimulation with pathogenic products Only in quantities (Trinquieri, 2003, Nat. Rev. Immunol. 3: 133-46) and that IL-12 signaling is restricted by SOCS1 (Ayles et al., 2002, J. Biol. Chem., 277: 43735-40)), the role of IL-12 in priming CTLs with human SOCS1 silenced DCs was examined. Therefore, anti-human IL-12 antibody was added once every 3 days to cocultures of DCs transfected with T cells and pulsed with MAGE3. FIGS. 23A-23C show hSOCS1 that stimulates MAGE3-specific CTL as inhibition of IL-12 using anti-IL12 (p70) antibody is demonstrated by tetramer staining, intracellular IFN-γ staining and ELISPOT assay. -Indicates that the enhanced ability of siRNADC has been negated.

Humanized HLA-A2.1 transgenic mice were used to further test the role of IL-12 in the enhanced CTL response induced by SOCS1-silenced DCs. Transduced HLA-A2.1 transgenic mouse BM-derived DCs with a recombinant lentiviral vector (LV-mSOC1 siRNA) expressing mouse SOCS1-siRNA or a control vector LV-GFP siRNA and pulsed with A2 restricted MAGE3 peptide . After maturation with TNFα, DC transduced from the footpad were administered twice into the body of the HLA-A2.1 transgenic mice at an interval of once a week. After each DC immunization,
Mice were stimulated in vivo three times with LPS or low doses of recombinant TL-12 cytokines. LPS is used because it induces a number of pro-inflammatory cytokines, many of which are regulated by SOCS1 and allows a direct role for SOCS1 in the regulation of NF-κB (p65) signaling. (Ryo et al., 2003, Mol. Cell, 12: 1413-26). In vivo IL-12 stimulation, MAGE3 pulses were compared to only 10 IFNγ + spots per 2 × 10 ⁵ T cells in mice immunized with GFP-siRNA-DC pulsed with MAGE3. In mice immunized with the received SOCS1-siRNA-DC, 239 IFNγ + spots were detected per 2 × 10 ⁵ T cells (FIG. 24). LPS stimulation in vivo is also similar to SOCS1-siRNA DCs (63 IFNγ + spots per 2 × 10 ⁵ T cells in SOCS1-siRNA-DC mice versus 2 × 10 ⁵ T cells in GFP-siRNA-DC mice. CTL responses elicited by IFNγ + 24 spots per) were preferentially enhanced (FIG. 24). However, IL-12 stimulation was even more effective than LPS stimulation to enhance the MAGE3-specific CTL response in mice immunized with SOCS1-siRNA-DC (P <0.01). This even greater stimulation ability of IL-12 is activated in the body of mice immunized with SOCS1-siRNA-DC as well as the ability of SOCS1 to directly modulate IL-12 stimulation through the Jak / Stat pathway. There is a high probability that it is attributed to the direct effect of IL-12 on CTL ((Trinkieri, 2003, Nat. Rev. Immunol. No. 3: 133-46)). Taken together, these results provide further evidence that SOCS1 limits IL-12 signaling in antigen-presenting cells. These results also highlight the importance of cytokine signaling in determining the efficacy of cytokine-based tumor therapy.

Human CTLs activated by human SOCS1 silenced DCs, but not by wild type DCs, have oncolytic effector functions. Activated T cells specific for the autologous tumor-associated antigen MAGE3 have oncolytic effectors. In order to determine whether it has function, natural MAGE3 + human tumor cells were used as target cells for the CTL assay. Human T cells activated by SOCS1-siRNA-DC or mut-siRNADC that received MAGE3 pulses readily killed MAGE3 peptide-pulsed MAGE3 + HLA-A2 + melanoma cells (SK-Mel-37). However, mut-siRNADCs that received MAGE3 pulse showed only weak cytolytic activity against native SK-Mel-37 cells that were not pulsed with MAGE3 (FIG. 25). In contrast, these T cells activated by SOCS1-siRNA-DCs that received MAGE3-pulse showed strong cytolytic activity against native SK-Mel-37 cells that were not pulsed with MAGE3. It still had (FIG. 25). The oncolytic activity of T cells in co-culture with hSOCS1-siRNA-DC was significantly reduced by anti-hIL-12 antibody treatment. Since only human T cells activated by SOCS1-siRNA-DC that received MAGE3 pulses had background cytolytic activity against HLA-A2-negative, MAGE3 + melanoma cells (NA-6-Mel), Tumor cytolytic activity was specifically mediated by CTL. Repeated experiments from different donors showed similar results.

In order to confirm the above observation facts, the oncolytic activity of T cells derived from HLA-A2.1 transgenic mice immunized with MAGE3-pulsed SOCS1-siRNA-DC or GFP-siRNA-DC was tested. FIG. 26 shows that T cells derived from transgenic mice immunized with MAGE3-pulsed mSOCS1-siRNA-DC have active cytolytic activity against native MAGE3 + HLA-A2-positive melanoma cells SK-Mel-37. It shows that he was doing. In contrast, only T cells from transgenic mice immunized with GFP-siRNA-DC pulsed with MAGE3 were found in natural melanoma cells, consistent with the results shown in FIG. Had weak cytolytic activity against. Furthermore, it was also observed that in vivo stimulation with low doses of recombinant IL-12 significantly enhanced the CTL response elicited by SOCS1-siRNA-DC but not GFP-siRNA-DC (FIG. 26). Taken together, the results herein are unique to fully activate CTL with active lytic effector function on native tumor cells, presumably due to enhanced production and signaling of IL-12 by antigen presenting cells It shows that human SOCS1-silenced DCs have the ability of

Complete activation of autoantigen-specific human CTLs by human SOCS-silenced DCs This disclosure demonstrates a regulatory role for human SOCS1 in human DCs and is an inhibitor of the JAK / STAT signaling pathway Provides an alternative strategy to enhance the immunostimulatory efficacy of human DCs. The results disclosed herein demonstrate the critical role of human SOCS1 in negatively regulating the immunostimulatory ability of human DCs that prime antigen-specific CTL. Human SOCS1 silenced DCs have the inherent ability to fully activate human CTLs with robust lytic function against native antigen-expressing tumor cells. The ability of human SOCS1-silenced DCs to prime CTLs is likely to be controlled by the production of IL-12 and SOCS1 restriction of signaling. Thus, the present disclosure demonstrates the translational potential of this generally applicable SOCS1 signaling approach to develop more effective tumor vaccines.

The SOCS1 signaling approach of the present invention has the ability to enhance antigen-specific immune responses elicited by DCs loaded with tumor-associated antigens. Over the past decade, a major advance in tumor immunology has been the identification and authentication of a number of human tumor-specific or related antigens ((Van den Einde et al., 1997, Current Opinion in Immunology 9: 684-93)). Thus, vaccination with SOCS1-silenced DCs loaded with tumor-associated antigens is more attractive than blocking CTLA4 on CTLs to elicit antigen-specific anti-tumor responses I think that the. SOCS1 silenced DCs may not cause significant autoimmune inflammation since heterozygous SOCS1 ^+/− mice show no or only mild signs of autoimmune inflammation. The use of silenced DC immunization provides additional therapeutic benefits. Moreover, the serious autoimmune inflammation seen in the body of SOCS1 ^{− / −} mice requires a complete deficiency of SOCS1 not only in DC but also in other strains of immune cells such as T and NKT cells. 2003, Nat.Immunol.4: 1169-76; Alexander et al., 2004, Annu.Rev.Immunol.22: 503-29; Metcalf et al., 2003, Proc. Natl. Acad. Sci. USA 100 "8436-41; Chong et al., 2003, Immunity 18: 475-87; Hanada et al., 2003, Immunity 19: 437-50. Kinjo et al., 2002, Immunity 17: 583-91) .

Large-scale research efforts to enhance the efficacy of tumor vaccines have focused on improving the affinity / dose (signal 1) and costimulatory molecule-mediated signal 2 levels of tumor-associated antigens (Gilboa, 2004) Nat. Rev. Cancer 4: 401-11; Rosenberg et al., 2004, Nat. Med. 10: 909-15). The present disclosure indicates that the superior ability of human SOCS1-silenced DCs to prime antigen-specific CTL is likely due to enhanced production and signaling of IL-12 (signal 3). Show. This conclusion is based on the following observation facts. 1) Human SOCS1 silenced DCs produce enhanced levels of IL-12 in response to stimulation with pathogenic products; 2) IL-12 antibody blockade is a human SOCS1 Reduces the immunostimulatory capacity of the silenced DC, and 3) in vivo administration of low doses of IL-12 induces antigen-specific CTL response induced by SOCS1 silenced DC but not wild type DC Will be greatly enhanced. These results are reported by Eyles J. et al. L, et al. (Iles et al., 2002, J. Biol. Chem. 277; 43735-40) evidence of mouse SOCS1 regulation of IL-12 signaling and the results disclosed elsewhere in this document. Has been.

  Cytokines have been proposed as a third signal provided by DCs to activate CTL (Kartsinger et al., 2003, J. Exp. Med. 197: 1141-51). Cytokine production and signaling are closely regulated to activate an immune response against exogenous antigens while limiting excessive autoimmune activation (Darnell et al., 1994, Science 264: 1415-21). Cytokines generally activate JAK, which in turn phosphorylates the cytoplasmic domain of the cytokine receptor to create docking sites for signaling agents and transcription activator (STAT) members (Alexander et al., 2004, Annu. Rev. Immunol.22: 503-29). Cytokines likewise up-regulate the expression of SOCS1 as feedback inhibitors, which in turn switches off proinflammatory cytokine production and signaling by DCs, thus attenuating the ongoing immune response and maintaining self-tolerance (Alexander et al., 2004, Annu. Rev. Immunol. 22: 503-29). SOCS1 represses STAT by specifically binding to the JAK active loop through its SH2 domain as a pseudosubstrate inhibitor and targeting JAK2 for ubiquitin-dependent proteolysis (Kubo et al., 2003, Nat. Immunol. 4: 1169-76; Alexander et al., 2004, Annu. Rev. Immunol. 22: 503-29). Taken together, the results disclosed herein represent the critical importance of IL-12 production and signaling limited by SOCS1 in antigen presenting cells in determining the magnitude of the CTL response.

  One significant finding of this study is that human SOCS1-silenced DCs have the unique ability to fully activate autoreactive T cells with active lytic effector function. In clinical and laboratory studies, autoantigen-specific T cells can be activated by DC vaccination or in vitro sensitization, as determined by various immunoassays such as tetramer staining and ELISPOT assays. Has been observed frequently. However, although such activated T cells can effectively kill tumor cells that have received artificial antigen pulses that have been genetically modified to express self-antigens, they are usually weak against natural tumor cells. It exhibits cytolytic activity, which is the main reason for the low efficacy of current tumor vaccines (Zaks et al., 1998, Cancer Research 58: 4902-8; Yu et al., 2002) J. Clin. Invest. 110: 289-94). The results disclosed herein show that the sustained and enhanced antigen presentation / stimulation provided by SOCS1-silenced DCs fully activates autoreactive, low affinity T cells and naturally Suggests that they may be required to give them active lytic effector function on tumor cells.

Example 12: SOCS1 siRNA oligo duplex enhances protein immunization To test whether in vivo immunization with SOCS1 siRNA oligo duplex can enhance protein immunization 1) OVA with BCG The CTL response elicited by protein immunization was compared to 2) co-immunization with OVA protein with BCG and SOCS1-siRNA oligo duplex liposomes. Groups of mice are immunized with a mixture of OVA protein and BCG, SOCS1-siRNA oligo duplex-liposomes and a mixture of OVA protein and BCG, twice a week at a footpad, or with OVA protein A mixture of BCG and SOCS1 siRNA oligo duplex-liposomes was co-injected. Two weeks after the second immunization, intracellular cytokine staining and ELISPOT assay (IFNγ) induce a more potent OVA-specific CTL response in mice co-immunized with SOCS1 siRNA oligo duplex Was observed (FIGS. 27A and 27B).

Example 13: SOCS1 Silenced CTL Has Enhanced Cytolytic Activity To investigate whether SOCS1 in T cells plays a role in regulating CTL activity, OT-I CD8 + OT-I cells (Jackson Laboratory, Bar Harbor, Maine) with a transgenic TCR specific for the OVA epitope isolated from transgenic mice were transfected with SOCS1 or mutant siRNA oligos using a gene porter. did. Transfected OT-I cells were used for CTL assays without further stimulation. OT-I transfected with SOCS1-siRNA oligo has enhanced cytolytic activity against syngeneic OVA-positive EG7 cells compared to OT-I cells transfected with mutant siRNA-oligo Was observed (FIG. 29). This result indicates that SOCS1 signaling in T cells enhances their cytolytic activity.

Example 14: Enhancement of immune capacity of immune cells by modulating A20 A20 is a zinc finger protein expressed by numerous cell types. A20 is rapidly induced by TLR4 ligand and TNF. A20 has a dual function in the regulation of ubiquitination and deubiquitination of signaling proteins critically involved in NF-κB signaling. A20 participates in deubiquitination through the deubiquitinase domain found in proteins. This domain can remove the K63-linked ubiquitin chain from the receptor-interacting protein (RIP), an important component of the TNF receptor complex. Removal of the K63-linked ubiquitin chain on RIP by A20 leads to RIP degradation. Moreover, the zinc finger at the carboxyl terminus of A20 serves as a ubiquitin ligase by joining RIP and K48-linked ubiquitin chains for proteasome degradation. Therefore, removal of K63 ubiquitin chain from RIP and addition of K48-linked ubiquitin chain by A20 leads to degradation of RIP.

  Furthermore, A20 similarly deubiquitinates the K63-linked ubiquitin chain in TRAF6, which results in the degradation of TRAF6. Given the fact that TRAF6 is a common signal component shared by all members of the TLR family, A20 is a unique negative that can suppress both MyD88-dependent and MyD88-independent TLR signaling pathways. Is an immunoregulatory factor.

  The following experiment and combination of results demonstrate that modulating A20 in immune cells results in cellular immunity.

A20 mRNA down-regulation of mouse BM-DC with A20 siRNA oligos using gene porters To investigate the A20 regulation of antigen presentation by DC, a small interfering RNA (siRNA) that specifically down-regulates A20 is first described below. Identified as described.

Synthetic siRNA oligo duplexes derived from mouse bone marrow cells ex vivo in the presence of granulocytes, macrophages, colony stimulating factor (GM-CSF) and IL-4 using a gene porter with a transfection efficiency of about 83% Transfected into DC. Briefly, bone marrow DCs were transfected with 21 base pair siRNA oligonucleotides using a gene porter and following the manufacturer's protocol. Add 3 μl of 20 μM oligonucleotide to 3 μl of Gene Porter reagent and 94 μl of serum-free RPMI 1640, incubate for 30 minutes at 25 ° C., then add 100 μl of Gene Porter / oligonucleotide mixture to each well of bone marrow-DC, Incubated for 4 hours at 37 ° C. After incubation, 500 μl RPMI 1640 per well supplemented with 20% FBS was added to bone marrow DC. Based on the present disclosure, synthetic siRNA oligos can be delivered to cells in the context of a physiologically acceptable carrier. An example of an acceptable carrier is a liposome.

  FIG. 31 demonstrates that A20 was downregulated in bone marrow-DC transduced with A20-siRNA oligos. As determined by quantitative RT-PCR assay, A20 mRNA levels in the total DC population transfected with the 20 siRNA-2 oligos indicate transfection with an A20 siRNA mutant that is unable to down-regulate A20. There was a reduction of approximately 70% compared to the level in bone marrow-DC received. The mouse A20 siRNA sequence was 5'-CAAAGCACUUAUUGACAGA-3 '; SEQ ID NO: 58.

Enhanced antigen-specific T cell response elicited by mouse A20 siRNA oligo DC A series of tests to test whether DC stimulation of antigen-specific cytotoxic T lymphocytes (CTLs) and CD4 + T helper was regulated by A20 The experiment was conducted. To test whether DCs transfected with A20 siRNA oligo duplex have an enhanced efficacy in eliciting an antigen-specific T cell response, A20 siRNA-2 oligo duplex or control oligo duplex DCs were transfected with the strands. Next, groups of mice were immunized with DCs transfected with OVA pulsed. After immunization of mice with pulsed DC, mice were stimulated in vivo with or without PolyI: C (50 μg / mouse) three times. Two weeks after DC immunization, the immune response in the immunized mice was examined. Tetramer staining and IFNγ ELISPOT assay showed enhanced OVA-specific CD8 + and CD4 + T cell responses in mice immunized with A20 siRNA oligo-DC with or without in vivo PolyI: C stimulation (FIG. 32-34). Consistent with this, the IFNγ ELISPOT assay showed enhanced TRP2-specific CD8 + T cell responses in mice immunized with A20 siRNA oligo-DC with or without in vivo PolyI: C stimulation (FIG. 35).

Enhanced anti-tumor response elicited by murine A20 siRNA oligo DC To test the effect of inhibiting A20 in DC with respect to its ability to elicit anti-tumor immunity, DC was tested with A20 siRNA-2 oligo duplex or control Transfected with oligo duplex. Groups of mice were immunized with transfected DCs pulsed with OVA antigen. After immunization of mice with pulsed DC, mice were stimulated in vivo with or without CpG (50 μg / mouse) three times. Two weeks after DC immunization, the immunized mice were challenged with OVA + EG7 tumors. Enhanced anti-tumor activity was observed in immunized mice with or without in vivo stimulation (FIGS. 36 and 37). Immunizations that received siA20 oligo-transfected DC were pre-prepared in vivo in EG. 7 tumors were observed to eradicate.

Enhanced antibody response elicited by murine A20 siRNA oligo DCs To test whether DCs that received A20 siRNA oligo duplex transfections have an enhanced efficacy to elicit an antigen-specific antibody response: The experiment was designed. Briefly, DCs were transfected with A20 siRNA-2 oligo duplex or control oligo duplex. A group of mice was then immunized with transfected DCs pulsed with OVA. After immunization of mice with pulsed DCs, mice were stimulated with PolyI: C (50 μg / mouse) three times in vivo. Two weeks after DC immunization, antibody responses in the immunized mice were examined. The ELISA assay showed an enhanced OVA specific antibody response in the body of mice immunized with A20 siRNA oligo-DC (FIG. 38). Furthermore, SUMO1 siRNA oligo-DC and Foxj1 siRNA oligo-DC also showed enhanced efficacy in inducing OVA-specific antibody responses in immunized mice (FIG. 38).

Enhanced immunostimulatory efficacy of mouse BM-DCs transduced with viral vectors The following experiment was designed to evaluate whether A20 negatively regulates DC antigen presentation in vivo. Briefly, A20 siRNA or control green fluorescent protein (GFP) siRNA was cloned into a lentiviral vector (LV). Lentiviral vectors have the ability to transduce DCs in a stable fashion (Rubinson et al., 2003, Nat. Genet. 33: 401-406; Scroars et al., 2004, Methods Mol. Biol. 246: 451-459), and therefore, it was selected because it is considered that the effect of silencing A20 can be evaluated with higher reliability. According to the methods described elsewhere in this document, two constructs were generated, LV-A20-siRNA and LV-GFP-siRNA, both containing a yellow fluorescent protein (YFP) marker (FIG. 33). Transduction of bone marrow-derived DCs using either LV-A20-siRNA or LV-GFP-siRNA vectors (> 80% CD11c ⁺ ) routinely resulted in approximately 58-63% cultured cells positive for YFP Generated. Secretion of lower levels of A20 mRNA and enhanced pro-inflammatory cytokines in the total transduced DC population at the time of stimulation of LV-A20-siRNA-DC compared to LV-GFP-siRNA-DC Was observed.

  The next set of experiments was designed to test whether LV-A20-siRNA-DC has an enhanced ability to elicit an immune response. Groups of mice were immunized with LV-A20-siRNA-DC pulsed with OVA or TRP2. Following immunization of mice with pulsed DC, mice were stimulated in the absence of in vivo stimulation. Two weeks after DC immunization, the immune response in the immunized mice was examined. Intracellular IFNγ staining showed an enhanced TRP2-specific CD8 + T cell or OVA-specific CD4 + T cell response in mice immunized with LV-A20-siRNA-DC (FIGS. 39 and 40).

  To test the ability of LV-A20-siRNA-DC to elicit an anti-tumor response, C57BL / 6 mice were inoculated with B16-OVA tumor cells. Three days later, mice were treated once with mature LV-A20-siRNA-DC or LV-GFP-siRNA-DC that received LPS ex vivo stimulated OVA-pulse. LV-A20-siRNA-DC was observed to effectively block the growth of pre-prepared B16-OVA tumors (FIGS. 41 and 42). It was also observed that LV-Foxj1-siRNA-DC was effective in inducing an anti-tumor response.

Enhanced HIV-specific T cell response elicited by LV-A20-siRNA DCs Whether DCs undergoing A20 siRNA oligo duplex transfection have an enhanced efficacy to elicit an immune response against HIV The following experiments were designed to test. Briefly, DCs were transfected with LV-A20 siRNA-2 or control. Groups of mice were then immunized with transduced DCs pulsed with HIV gp120. After immunization of mice with pulsed DC, mice were stimulated with PolyI: C (50 μg / mouse) three times in vivo. Two weeks after DC immunization, the immune response in the immunized mice was examined. Intracellular IFNγ staining showed an enhanced HIV gp120-specific CD8 + T cell response in mice immunized with A20 siRNA oligo-DC (FIG. 43).

Example 15: Enhanced immunostimulatory efficacy of Foxj1-silenced DC While not wishing to be bound by any particular theory, it is believed that induction of IκB expression modulates the immune stimulatory efficacy of DC Yes. IκB expression is under dynamic control, and IκB undergoes constant turnover without an activation signal and is constantly recruited through the synthesis of new IκB molecules to prevent NF-κB from being activated. . Foxo3a and Foxj1 are members of the forkhead transcription factor family recently identified as activators of IκB transcription. Foxj1 and Foxo3a actively contribute to the negative regulation of NF-κB. The knockout of the foxj1 gene leads to early in utero death. Chimeric animals with foxj1 ^{− / −} lymphatic system in the RAG ^{− / −} background were found to show multi-organ systemic inflammation, increased TH1 cytokine production and T cell hyperproliferation. This is believed to be due to dysregulation of the NF-κB signaling pathway.

IκBβ, one major isoform of IκB, is absent in foxj1-deficient T cells, which is responsible for overactivation of NF-κB and TCR stimulation in dormant foxj1 ^{− / −} T cells. It explains the hypersensitivity of these cells. Foxo3a-deficient T cells have a high basal level of NF-κB activity due to the lack of expression of two IκB isoforms, IκBβ and IκBε, as in foxj1 ^{− / −} T cells, Indicates that Foxo3a is required for production of IκB in resting T cells, similar to Foxj1. Foxo3a deficient T cells showed hyperproliferation and substantial elevation of both TH1 and TH2 cytokines after TCR signaling. Foxj1 and Foxo3a appear to have overlapping but not fully redundant functions. The presence of IκBα has no observable effect on NF-κB up-regulation in both foxj1 ^{− / −} and foxo3a ^{− / −} mice, indicating that three IκB proteins in basal level regulation of NF-κB activity. It shows that there is a lack of functional redundancy.

  The following experimental set was designed to examine the role of Foxj1 in regulating antigen presentation. FIG. 44 demonstrates that Foxj1 was down-regulated in cells transfected with Foxj1 siRNA oligo (5′-AGAUCACUCUGUCGCCAU-3 ′; SEQ ID NO: 60). Briefly, 293T cells were co-transfected with Foxj1 siRNA oligo and FLAG-tagged mFoxj1 expression vector in a 10: 1 ratio using a gene porter. 48 hours after transfection, cells were treated and the corresponding cell lysates were subjected to Western blotting. Western blot shows the intensity of the Foxj1 band normalized to the intensity of the beta actin band. DCs transfected with Foxj1-siRNA2 oligos (referred to as Foxj1-siRNA in subsequent studies) showed siRNA mutations as shown by enhanced secretion of pro-inflammatory cytokines such as IL-6. Higher responsiveness to IL-6LPS was observed compared to DCs transfected with the mutant (FIG. 45).

Based on the fact that Foxj1-siRNA oligos were effective in enhancing IL-6 secretion, recombination to assess the ability of LV-Foxj1-siRNA to enhance the immunostimulatory efficacy of transduced DCs Type LV-Foxj1-siRNA was generated. DC transduction (greater than CD11c + 80%) with either LV-Foxj1-siRNA or LV-GFP-siRNA vectors routinely produced 60% cultured cells that were positive for YFP. Transduced DCs were used to test whether LV-A20-siRNA-DC had an enhanced ability to elicit an immune response.

  A group of mice was then immunized with LV-Foxj1-siRNA-DC pulsed with the desired antigen, eg, TRP2 or HIV gp120. After immunization of mice with pulsed DC, mice were stimulated without in vivo stimulation. Two weeks after DC immunization, the immune response in the immunized mice was examined. Intracellular IFNγ staining showed enhanced TRP2-specific CD8 + T cell responses in mice immunized with LV-Foxj1-siRNA-DC (FIG. 46). Furthermore, intracellular IFNγ staining showed enhanced HIV gp120-specific CD8 + and CD4 + T cell responses in mice immunized with LV-Foxj1-siRNA-DC (FIG. 47).

Example 16: Enhanced immunostimulatory efficacy of Twist2-silenced DC Although not wishing to be bound by any particular theory, inhibition of NF-κB target gene expression results in DC immunostimulatory efficacy It is considered. Twist is a negative immune regulator of NF-κB signaling. In mammals, there are two twist proteins, Twist-1 and Twist-2, which are expressed at low levels in a wide range of postnatal tissues. Twist-2 gene deficiency results in enhanced pro-inflammatory cytokine gene expression in multiple tissues with resulting cachexia and growth disorders. This phenotype is repeated in twist-1 and twist-2 complex heterozygotes, reflecting the redundancy and dose dependence of these genes in inhibiting cytokine expression. The phenotype of twist-2 knockout mice appears to reflect the loss of a negative feedback loop that Twist normally associates with p65 of NF-κB and suppresses the cytokine promoter. Twist binds to the E box in the cytokine promoter and inhibits the activity of NF-κB bound to the adjacent NF-κB site. Twist can also inhibit NF-κB-mediated activation of target promoters independently of DNA binding through protein-protein contacts with p65.

  The following experimental set was designed to examine the role of Twist2 in regulating antigen presentation. FIG. 48 demonstrates that Twist2 is downregulated in cells transfected with Twist2 siRNA oligos. Briefly, 293T cells were co-transfected with Twist2 siRNA oligo and FLAG-tagged Twist2 expression vector at a 10: 1 ratio using a gene porter. 48 hours after transfection, the cells were treated and the corresponding cell lysates were subjected to Western blot. The intensity of the Twist2 band is normalized to the intensity of the beta actin band, and the relative intensity (ratio) is shown (FIG. 48). Twist expression was downregulated by Twist-2 siRNA oligos (5'-GCGACGAGAUGGACAAUAA-3 '; SEQ ID NO: 61 and 5'-CAAGAAAUCGAGGCGAAGAU-3'; SEQ ID NO: 62).

  To test whether DCs transfected with Twist2 siRNA oligo duplex have enhanced potency to elicit an antigen-specific T cell response, Twist2 siRNA-2 oligo duplex or control oligo 2 The heavy chain was transfected into DC. A group of mice was then immunized with transfected DCs pulsed with OVA. Following immunization of mice with pulsed DCs, mice were stimulated with PolyI: C (50 μg / mouse) three times in vivo. Two weeks after DC immunization, the immune response in the immunized mice was examined. Tetramer staining and IFNγ ELISPOT assay showed enhanced OVA-specific CD8 + T cell responses in mice immunized with Twist2 siRNA oligo-DC with in vivo PolyI: C stimulation (FIGS. 49 and 50). ).

Example 17: Enhanced immunostimulatory efficacy of SUMO1-silenced DCs SUMO proteins bind by altering their transport, positioning and stability (also known as SUMOylation). Adjust partner negatively. SUMO has four members in vertebrate species: SUMO1, SUMO2, SUMO3 and SUMO4. SUMO1 negatively regulates NF-κB signaling by sumoylating IκBα on K21, a site that can be joined to a K48-linked ubiquitin chain by ubiquitin ligase. Modification of IκBα by SUMO protects IκBα from ubiquitin-mediated degradation and consequently inhibits NF-κB activation. Furthermore, a functional variant of SUMO4 in which the conserved methionine (Met55) is internally replaced by a valine residue (M55V) reduces the inhibitory effect of SUMO4 on NF-κB activation and is associated with type I diabetes It was discovered that

  The following experimental set was designed to examine the role of SUMO1 in regulating antigen presentation. In order to test whether C transfected with the SUMO1 siRNA oligo duplex has an enhanced efficacy in eliciting an antigen-specific T cell response, the DC is transformed into the desired SUMO1 siRNA oligo duplex (5 '-GAUGUGAUUGAAGUUUAUC-3'; SEQ ID NO: 59). A group of mice was then immunized with transfected DCs pulsed with OVA. Following immunization of mice with pulsed DCs, mice were stimulated with LPS (30 μg / mouse) three times in vivo. Two weeks after DC immunization, the immune response in the immunized mice was examined. The IFNγ ELISPOT assay showed enhanced OVA-specific CD8 + T cell responses in mice immunized with SUMO1 siRNA oligos (2 and 3) -DC with in vivo PolyI: C stimulation (FIG. 51). Furthermore, there was an observable increase in phosphorylation of IKβα in DCs transfected with SUMO1 siRNA oligo (3) at the time of stimulation with 100 ng / ml LPS (FIG. 52).

Example 18: Inhibition of genes involved in the regulation of molecular stability Strategies frequently utilized by various negative immune regulators regulate the stability of key signaling molecules by ubiquitination / deubiquitination and By increasing the stability of the inhibitory component of the signaling molecule complex by sumoylation and other mechanisms. Many of these negative immunomodulators, such as TRIAD3A, Cyld, SUMO, Clb and A20, modify target Toll-like receptors (TLR) and signaling molecules and promote their degradation to promote TLR and tumors. A ubiquitin-modifying enzyme that attenuates necrosis factor receptor (TNFR) signaling.

  TRIAD3A is a TRIAD3 family RING finger E3 ubiquitin ligase. TRIAD3A can bind and ubiquitylate the cytoplasmic domains of TLR4 and TLR9, which results in their degradation. TRIAD3A overexpression reduces TLR4 and TLR9 mediated activation of NF-κB in response to LPS and CpG DNA. Thus, based on the present disclosure, down-regulation of TRIAD3A expression levels using the methods disclosed herein can lead to enhanced TLR expression and increased responses to LPS and CpG in vitro. Thus, the present invention includes enhancing the immune capacity of immune cells by inhibiting TRIAD3A.

Another gene involved in protein stability regulation is CYLD. CYLD is a tumor suppressor gene that encodes a protein with 956 amino acids. Mutations in the CYLD gene, including premature termination or frameshift alterations, have been found in columnomatosis, a disease associated with many benign skin appendage tumors. In the NF-κB signaling cascade, TRAF2 and IKKγ are joined to lysine 63 (K63) -linked polyubiquitin chains. Unlike normal ubiquitination of proteins with K48 polyubiquitin chains for proteasome degradation, K63 ubiquitination of TRAF2, IKKγ and possibly TRAF6 is required for assembly and activation of the IKK complex. CYLD has the ability to deubiquitinate the K63 polyubiquitin chain on TRAF2 and IKKγ, resulting in degradation of the IKK complex and inhibition of NF-κB activation. Loss of mutated CYLD deubiquitination activity correlates with sustained activation of NF-κB. Thus, inhibition of CYLD in immune cells using the methods disclosed herein enhances the cell's immunity.

  Another gene involved in molecular stability is Cbl (corresponding to Casitas B lymphoma). The Cbl protein family has three members: Cbl, Cbl-b and Cbl-c. The signature motif of the Cbl protein family is two highly conserved N-terminal domains, the tyrosine kinase binding (TKB) domain and the RING finger domain that interacts with the ubiquitin conjugating enzyme (E2). Together, these two domains define the basic functional unit of the Cbl protein, a ubiquitin ligase directed at activated tyrosine kinases. Based on the disclosure presented herein, inhibiting Cbl helps to prevent degradation of activated tyrosine kinases, preferably tyrosine kinases associated with enhanced immune responses. Thus, by inhibiting Cbl in immune cells using the methods disclosed herein, the immune capacity of the cells is enhanced.

  The arrestin family is another family of proteins involved in the regulation of molecular stability. The arrestin family includes four members: β-arrestin 1, β-arrestin 2, x-arrestin and s-arrestin. One function of β-arrestin 1 and β-arrestin 2 is to desensitize second messenger signaling mediated by β2-adrenergic receptors. Another function of β-arrestin 1 and β-arrestin 2 is believed to be to abolish signal-induced activation of NF-κB, which stems from measures against IκBα phosphorylation / degradation. β-arrestin binds to the carboxy terminus of IκBα and IKK cannot access the PEST domain of IκBα, and phosphorylation of the PEST domain promotes IκBα degradation, leading to stabilization of the IκBα protein. Thus, inhibition of arrestin family members in immune cells using the methods disclosed herein enhances the immune capacity of the cells.

  TOLLIP (Toll interacting protein) facilitates the ubiquitination of IRAK1 and its subsequent degradation. TOLLIP interacts with IRAK1 and the level of IRAK1 autophosphorylation is reduced in the presence of TOLLIP. TOLLIP overexpression results in inhibition of TLR2 and TLR4 mediated NF-κB activation. Based on the present disclosure presented herein, the immunity of cells is enhanced by inhibiting TOOLIP in immune cells using the methods disclosed herein.

Example 19: Inhibition of signaling molecules by their non-functional homologues Another strategy for modulating Toll-like receptor (TLR) and tumor necrosis factor receptor (TNFR) signaling has no stimulatory activity Competitive inhibition of major signaling molecules by non-functional homologues or isoforms. Negative immune modulators such as RP105, ST2, SIGIRR, IRAK-2, IRAK-M, sMyD88 and sTLR illustrate this strategy.

Soluble decoy TLR (sTLR) suppresses the interaction of TLR and pathogenic products. Soluble TLR2 can compete with TLR2 for interaction with pathogenic ligands.
Soluble TLR4 can interact with MD2 and inhibit the formation of the MD2-TLR4 complex, thus blocking LPS-mediated signaling by TLR4.

  Although not wishing to be bound by any particular theory, negative such as RP105, ST2, SIGIRR, IRAK-2, IRAK-M, sMyD88 and sTLR in immune cells using the methods disclosed herein It is believed that inhibiting immune regulators enhances the immunity of cells.

Non-functional TIR homologs Another strategy for enhancing the immune stimulatory efficacy of immune cells is a membrane-bound non-functional TIR homologue that contains a TIR domain and has no stimulating activity, such as SIGIRR, ST2 and RP105. It is to inhibit proteins associated with the body. These proteins can suppress TLR signaling. RP105 is a homologue of TLR4 and is expressed on APC. RP105 forms a complex with MD-1, which directly interacts with TLR4-MD-2 and inhibits binding of the TLR4-MD-2 complex to LPS. RP105 is a physiological regulator of TLR4 signaling in primary dendritic cells and the response to endotoxin in vivo.

  SIGIRR-deficient mice were found to be very sensitive to endotoxin shock induced by LPS. SIGIRR attenuates TLR4 signaling by competing with TLR4 to interact with signaling molecules. Similarly, ST2-deficient mice showed increased production of inflammatory cytokines in response to LPS and poor induction of LPS tolerance. Since ST2 associates with MyD88 and TIRAP and sequesters them, overexpression of ST2 is thought to inhibit NF-κB activation.

Signaling molecule isoforms Several non-functional isoforms of major signaling molecules such as MyD88 and IRAK have been found to suppress TLR signaling. MyD88s, an alternatively spliced short variant of MyD88 that lacks an intermediate domain, is induced in monocytes when stimulated with LPS. MyD88s inhibits LPS-induced NF-κB activation because it cannot bind to IRAK4 and promote IRAK1 phosphorylation.

  IRAK-M lacks kinase activity and functions as a global negative immune regulator of TLR signaling in APCs. The IRAK family of kinases comprises four members: IRAK1, IRAK2, IRAK4 and IRAKM. Unlike other ubiquitously expressed IRAKs, unstimulated IRAK-M expression is restricted to monocytes and macrophages and is expressed in an inducible form after stimulation with TLR ligands. IRAK-M-deficient mice showed an increase in inflammatory cytokine production in response to TLR ligands and a deficiency in LPS tolerance induction. IRAK-M prevents dissociation of the IRAK1-IRAK4 complex from MyD88, either by inhibiting the phosphorylation of IRAK1 and IRAK4, or by stabilizing the TLR-MyD88-IRAK4 complex, thus Prevents formation of IRAK1-TRAF6 complex.

IRAK2 has four splice variants in the mouse body: IRAK2a, IRAK2b, IRAK2c and IRAK2d. IRAK2c and IRAK2d lack the death domain found in full-length IRAK2 and in IRAK2a and IRAK2b isoforms and are expressed in an inducible form in macrophages after LPS stimulation. Overexpression of IRAK2c and IRAK2d was shown to inhibit LPS-induced NF-κB activation in a dose-independent manner, involving a negative feedback effect on signaling.

  Two members of the IFN regulator (IRF) family of transcription factors, IRF-5 and IRF-7, interact with MyD88 and induce proinflammatory cytokines and type I IFNs, respectively. However, IRF-4 also interacts with MyD88 and acts as a negative immune regulator of TLR signaling. IRF-4 mRNA is induced by TLR activation and IRF-4 competes with IRF-5 for MyD88 interaction. TLR-dependent induction of pro-inflammatory cytokines is markedly enhanced in peritoneal macrophages from Irf4 gene-deficient mice, while induction is inhibited by ectopic expression of IRF-4 in macrophage cell lines. The critical function of IRF-4 function in TLR signaling in vivo is the observation that Irf4-deficient mice are hypersensitive to DNA-induced shock with high serum proinflammatory cytokine levels Is emphasized by.

  FLN29 is a novel interferon and LPS-inducible gene containing a TRAF6-related zinc finger motif and a TANK (TRAF family member-related NF kappa B activator) -related sequence. Expression of FLN29 in macrophage-like RAW cells results in suppression of TLR-mediated NF-kappa B and MAP kinase activation, while reduction of FLN29 expression by small interfering RNA is a down-regulation of LPS signaling Was partially disabled. Furthermore, it has been demonstrated that NF-kappa B activation induced by TRAF6 and TAB2 was impaired by coexpression of FLN29, indicating that FLN29 can be regulated downstream of TRAF6 . FLN29 is believed to be a negative feedback regulator of TLR signaling.

Negative component of signaling molecule complex The NF-κB protein is sequestered in the cytoplasm in an inactive form as a result of its association with IκB proteins including IκBα, IκBβ and IκBε. The IκB protein promotes the nuclear export process more effectively by masking the nuclear localization sequence (NLS) on the NF-κB subunit or than the nuclear transport process between the nucleus and the cytoplasm By doing so, NF-κB is retained in the cytoplasm. IκBα regulates transient NF-κB activation, and IκBβ maintains sustained NF-κB activation. IκBα is rapidly degraded in response to stimuli and is rapidly re-synthesized due to the presence of the NF-κB response element in its promoter. In contrast, IκBβ is less responsive to irritant-induced degradation than IκBα. Genetic studies have shown both completely different and redundant functions of IκBα, IκBβ and IκBε in controlling NF-κB activation. IκBα deficiency results in high NF-κB activity in hematopoietic tissues.

  A critical event in the activation of NF-κB is the phosphorylation of IκBs mediated by the IKK complex. The IKK complex is the confluence of NF-κB activation by various stimuli including TLR ligands and TNF. The IκB kinase (IKK) complex contains two catalytic subunits, IKKα and IKKβ, and controls the activation of the NF-κB transcription factor. IKKβ mediates NF-κB activation in response to proinflammatory cytokines and pathogenic products.

IKKα has been demonstrated to be involved in a negative immune regulatory role in the control of NF-κB activation. IKKα contributes to the suppression of NF-κB activity by accelerating both the degradation of the NF-κB subunits RelA and c-Rel and the removal of RelA and c-Rel from the pro-inflammatory gene promoter. Inactivation of IKKα in the mouse body enhances inflammation and bacterial clearance (Lawrence et al., 2005 Nature 43
4: pp. 1138).

  While not wishing to be bound by any particular theory, inhibiting any gene or combination thereof discussed herein serves as a method of inhibiting the inhibitor. Based on the present disclosure, the immune capacity of a cell can be enhanced by inhibiting negative immune regulators in the body of the immunizer.

Example 20: Modulation of signaling molecule phosphorylation The MAPK pathway undergoes feedback inhibition by MAPK phosphatases (MKPs). MKPs are induced after activation of the MAPK pathway. Two of MKPs, MKP5 and MKP6 negatively regulate T cell activation by inhibiting the activity of their respective MAPK targets.

  MKP5 was initially characterized as a phosphatase that acts preferentially on JNK and p38. Mkp5 knockout animals showed upregulation of JNK activity and the resulting dysregulation of both innate and adaptive immunity responses. MKP6 has been identified as a protein that interacts with the cytoplasmic tail of the CD28 coreceptor.

  MKP6 is induced when CD28 co-stimulates primary human T cells. Retrovirus-driven ectopic expression of a dominant negative form of MKP6 increases IL-2 expression in response to TCR and CD28 costimulation. Increased IL-2 production was also obtained by using a mutant CD28 coreceptor that can no longer interact with MKP6. Taken together, these observations demonstrate that MKP6 is involved in the negative regulation of the MAPK pathway in response to CD28 costimulation.

  While not wishing to be bound by any particular theory, inhibiting phosphatase in one cell where phosphatase is associated with inhibition of kinases involved in the immune response signaling pathway enhances the cell's immune capacity It serves as a way to do this.

Example 21: Other Regulator Mechanisms Dok-1 and Dok-2
Dok-1 and Dok-2 were originally identified as substrates for a number of protein tyrosine kinases (PTKs) (Shinohara et al., 2005, J Exp Med. 3: 333-339). Dok-1 and Dok-2 are adapter proteins that negatively regulate Ras-Erk signaling downstream of PTK. LPS rapidly induced adapter function and tyrosine phosphorylation of Dok-1 and Dok-2. Stimulation by LPS of macrophages from mice lacking Dok-1 or Dok-2 induced high Erk activation, but not other MAP kinases or NF-κB, and an excess of TNF-α and nitric oxide The result was production. Furthermore, the mutant mice showed overproduction of TNF-α and hypersensitivity to LPS. Any forced expression of Dok-1 or Dok-2 in macrophages inhibited LPS-induced Erk activation and TNF-α production. Thus, Dok-1 and Dok-2 are considered negative immune regulators of TLR4 signaling.

NOD2
NOD2 is a member of the nucleotide-binding oligomerization domain family that can recognize the bacterial product muramyl dipeptide (MDP). Spleen cells from NOD2-deficient mice generated a high T _H 1 cell response in response to exposure to TLR2 agonists, but not in response to other TLR ligands. NOD2 is therefore regarded as a negative immune regulator of TLR2 signaling. Consistent with this, patients with Crohn's disease carry mutations in the NOD2 gene leucine-rich repeat region, which results in impaired MDP recognition. Furthermore, NOD2 dysfunction results in bias of proinflammatory cytokines after stimulation of mononuclear cells with TLR2 stimulation.

PI3K
PI3K is a heterodimer composed of a p85 regulatory subunit and a p110 catalytic chain. PI3K is constitutively expressed by most cells and functions as an early signal in many intracellular events. p85-deficient mice showed enhanced TLR signaling and a dominant TH1 cell response. IL-12 synthesis by dendritic cells from PI3K-deficient mice was significantly increased in response to TLR4, TLR2 and TLR9 ligands LPS, peptidoglycan and CpG DNA, respectively. In vivo, susceptible BALB / c background PI3K-deficient mice were more resistant to infection by Leishmania major, a prototype TH2-mediated parasitic disease, than wild-type mice. These results, PI3K is a valid negative immune regulator of TLR signaling, indicating that it resulted in inhibition of IL-12 synthesis and prevent over-expression of T _{H 1} responses. While not wishing to be bound by any particular theory, it is believed that the mechanism by which PI3K inhibits TLR signaling involves the suppression of p38, JNK, ERK1 / ERK2 and NF-κB.

Prostaglandin cyPG15-deoxy-D ^12,14 -prostaglandin J ₂ (15d-PGJ ₂ ) is a natural ligand and an agonist of cyclopentenone prostaglandin. 15d-PGJ ₂ is induced from the dehydration and isomerization of cyclooxygenase metabolite prostaglandin _{D 2.} Activation of peroxome growth factor activated receptor γ (PPARγ) may antagonize the transcriptional activity of NF-κB. 15d-PGJ ₂ inhibits phosphorylation and degradation of IBα through inhibition of the kinase activity of IKK [beta]. The characteristic structure of 15d-PGJ ₂ and its metabolites is in the cyclopentenone ring containing electrophilic reactive α, β unsaturated carbonyl groups. Similarly, the cyclopentanone ring structure of 15d-PGJ ₂ can explain the covalent modification of cysteine residues in the p50 and p65 subunits that impair the DNA binding activity of NF-κB.

TRAIL-R
TRAIL-R, which is a receptor for TRAIL, does not have a TIR domain and belongs to the TNF superfamily. TRAIL-deficient and TRAILR-deficient mice showed enhanced clearance of mouse cytomegalovirus infection, which correlated with increased levels of IL-12, IFN-β and IFN-γ. Furthermore, stimulation of macrophages with TLR2, TLR3 and TLR4 ligands resulted in higher levels of TRAIL up-regulation and enhanced cytokine production in TRAILR-deficient cells. These results indicate that TRAILR signaling is a selective negative immune regulator of TLR.

Roquin (Rc3h1)
Rokin is a highly conserved member of the RING-type E3 ubiquitin ligase protein family. Rokin proteins are characterized by the presence of CCCH zinc fingers found in RNA-binding proteins and their localization to cytosolic RNA granules. Rokin is thought to be involved in the regulation of messenger RNA translation and stability. Without wishing to be bound by any particular theory, mutations in the rokin gene in mature T cells (otherwise inhibition of rokin) cause an excessive number of follicular helper T cells and germinal centers to form. It is thought to be the cause. Based on the present disclosure, inhibiting rokin may help to enhance the immune capacity of immune cells.

  The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated by reference in their entirety.

  While the invention has been disclosed with reference to specific embodiments, those skilled in the art can devise other embodiments and variations of the invention without departing from the true spirit and scope of the invention. Is obvious. The appended claims are to be construed to include all such embodiments and equivalent variations.

This figure comprising FIGS. 1A and 1B is a series of diagrams demonstrating that the expression of SOCS1 is down-regulated by SOCS1-siRNA. FIG. 1A depicts a Western blot assay of 293T cells co-transfected with mouse SOCS1 siRNA. FIG. 1B depicts a quantitative RT-PCR assay for DCs that have been oligo-transfected with SOCS1 siRNA. DCs transfected with SOCS1 siRNA are even higher for LPS or IFN-γ compared to siRNA mutants as indicated by enhanced secretion of pro-inflammatory cytokines such as IL-6 and TNF-α It is a chart demonstrating having reactivity. 1 is a schematic representation of recombinant lentiviral vectors, LV-SOCS1-siRNA and LV-GFP-siRNA. FIG. 4, comprising FIGS. 4A and 4B, is a series of diagrams demonstrating that SOCS1 negatively regulates the ability of DCs to stimulate antigen-specific CTL in vitro. FIG. 4A depicts the fact that ovalbumin-specific TCRT cells (OT-I) proliferated more in SOCS1-siRNA-DC co-culture than in siRNA-DC mutant co-culture. Consistent with these data, higher levels of pro-inflammatory cytokines were secreted in SOCS1-siRNA-DC co-cultures (FIG. 4B). FIG. 5, comprising FIGS. 5A-5C, is a series of diagrams demonstrating that SOCS1 negatively regulates the ability of DCs to prime antigen-specific T cell responses in vitro. Figure 5A is indicative of the percentage of ^{H2-K b} / ovalbumin -PE tetramer ⁺ T cells in the total gated CD8 ⁺ T cell population. FIG. 5B depicts the interferon-γ (IFNγ) ELISPOT assay. FIG. 5C depicts a CTL assay that demonstrates more potent cytotoxicity of splenocytes from mice given immature LV-SOCS1-siRNA-DC to ovalbumin ⁺ target cells. FIG. 6, comprising FIGS. 6A-6E, is a series of diagrams demonstrating that in vivo LPS stimulation strongly enhances CTL responses elicited by SOCS1-silenced DCs. FIG. 6 depicts the percentage of ovalbumin-PE tetramer positive T cells in gated CD8 ⁺ T cells. FIG. 6B shows IFN-γ ELISPOT of CD8 ⁺ T cells in mice immunized with ovalbumin pulsed DCs, transduced DCs or mock DCs without LPS-induced maturation followed by in vivo LPS stimulation. Draw numbers. FIGS. 6C and 6D depict the ovalbumin-PE tetramer ⁺ percentage and IFN-γ ELISPOT number of CD8 ⁺ T cells, respectively, in mice immunized with mature DC followed by in vivo LPS stimulation. FIG. 6E demonstrates that in vivo stimulation with various cytokines and TLR agonists enhances the CTL response (ELISPOT) by SOCS1-silenced DCs. FIG. 7, comprising FIGS. 7A-7E, is a series of charts demonstrating enhanced anti-tumor immunity induced by SOCS1-silenced DCs. FIG. 7A depicts the fact that immunization with LV-SOCS1-siRNA-DC that received a pre-prepared ovalbumin pulse blocks the growth of pre-prepared ovalbumin ⁺ EG7 tumors. FIG. 7B depicts the fact that anti-CD8 antibody abolished anti-tumor activity elicited by LV-SOCS1-siRNA-DC that received an ovalbumin pulse, but anti-CD4 antibody did not. FIGS. 7C-7E depict enhanced antitumor activity by DCs subjected to oligo duplex transfection of SOCS1 siRNA in the mouse body. FIG. 8, comprising FIGS. 8A-8C, is a series of charts demonstrating an enhanced CTL response to self-tumor associated antigens by SOCS1-silenced DCs. FIG. 8 shows that mature LV-SOCS1-siRNA-DC effectively blocked the growth of pre-prepared B16 tumors, whereas mature LV-GFP-siRNA-DC has no observable inhibitory effect. It depicts the fact that it did not. FIGS. 8B and 8C depict the IFN-γ ELISPOT and CTL assays, respectively, of strong TRP2-specific CTL responses in LV-SOCS1-siRNA-DC mice. FIG. 9, comprising FIGS. 9A-9C, is a series of images demonstrating that mature DC signaling restricted by SOCS1 controls CTL responses against self-antigens and anti-tumor immunity. FIG. 9A depicts the percentage of H2-K ^b -TRP2-PE tetramer positive T cells in CD8 + T cells of splenocytes in mice 2 weeks after immunization. FIG. 9B depicts representative vitiligo in SOCS1-siRNADC immunized mice that received TRP2a pulses undergoing in vivo LPS stimulation once or three months after immunization. FIG. 9C shows the splenocytes of wild-type mice immunized with SOCS1 siRNADC against in vitro restimulation against TRP2 ⁺ B16 (upper panel) of splenocytes pooled from a group of immunized mice and with TRP2a peptide. TRP2 ^- EG. 7 depicts cytotoxicity against 7 target cells (bottom plate). FIG. 10, comprising FIGS. 10A-10D, is a series of charts demonstrating the eradication of pre-prepared B16 tumors by SOCS1-siRNA DC immunization. FIGS. 10A and 10B depict tumor growth curves in wild-type mice without and with LPS in vitro stimulation, respectively. FIG. 10C depicts the survival percentage of mice monitored for 60 days. FIG. 10D depicts an IFN-γ ELISPOT assay of CD8 + T cells isolated from pooled splenocytes of immunized mice that received LPS co-injection and subjected to stimulation with TRP2a peptide. FIG. 11, comprising FIGS. 11A-11C, demonstrates a strong CTL response and antitumor activity elicited by SOCS1-silenced DCs pulsed with either low or high affinity peptides. It is a chart of. FIG. 11A depicts a flow cytometric analysis of costimulatory / inhibitory molecules on DCs transduced without (FIG. 11A-1) or with (FIG. 11A-2) LPS stimulation. FIG. 11B depicts the eradication of pre-prepared B16 tumors by SOCS1-siRNA DCs pulsed with low and high affinity peptides. FIG. 11C depicts a comparison of antigen-specific CTL responses as measured by IFNγ ELISPOT assay stimulated with TRP2a or TRP2b peptides. FIG. 12, comprising FIGS. 12A-12D, is a series of charts demonstrating the lack of induction of an effective anti-tumor response by IL-12KOSOCS1 siRNA-DC. 12A and 12B depict tumor volume and survival rate, respectively. FIG. 12C depicts the IFNγ ELISPOT assay after in vitro stimulation with TRP2a peptide. FIG. 12D depicts CTL assay after in vitro stimulation with TRP2a peptide using TRP2 ⁺ B16 target cells. FIG. 13, comprising FIGS. 13A-13D, is a series of charts demonstrating that SOSC1 controls the production of IL-12 and IL-12-induced cytokines by DC. FIG. 13A depicts the level of IL-12 secreted by SOCS1 siRNADC in response to continuous stimulation with LPS and plate-coated anti-CD40 mAb. FIG. 13B depicts IL-12 levels followed by removal of these stimuli after the first 24 hours of stimulation. FIG. 13C depicts the levels of TNFα and IL-6 secreted by SOCS1 siRNA DCs in response to stimulation with LPS and plate-coated anti-CD40 mAb for 24 hours followed by removal of stimulation. FIG. 13D depicts the levels of TNFα and IL-6 secreted by p35 − / − or wtSOCS1-siRNA DCs in response to continuous stimulation with LPS and plate-coated anti-CD40 mAb. FIG. 14, comprising FIGS. 14A and 14B, is a series of charts demonstrating that in vivo IL-12 administration enhances immunization of SOCS1-silenced DCs. FIG. 14A depicts antitumor activity enhanced by in vivo IL-12 administration. FIG. 14B depicts a TRP2-specific CTL response by IL-12. FIG. 15, comprising FIGS. 15A-15D, is a series of diagrams demonstrating that gp120-specific antibodies and CTL responses are enhanced by silencing of SOCS1 in DC. FIG. 15A illustrates that LV-SOCS1-siRNA-DC elicited a much stronger gp120-specific IgM and IgG response compared to the control LV-GFP-siRNA-DC. FIG. 15B shows a significant increase in HIV Env-specific antibody titers in all IgG subclasses in mice immunized with LV-SOCS1-siRNA-DC compared to the corresponding subclasses in LV-GFP siRNA-DC mice. Is shown. FIG. 15C shows that CTL activity against target cells that received gp120 pulses in LV-SOCS1-siRNA-DC mice was much more potent than in LV-GFP-siRNA-DC mice. FIG. 15D shows a higher percentage of IFN-γ + T cells in LV-SOCS-siRNA-DC mice. FIG. 16, comprising FIGS. 16A-16D, is a series of charts demonstrating enhanced production of both Th1 and Th2 polarized cytokines by SOCS1-silenced DCs. FIG. 16A depicts the levels of IL-12, IFN-γ and TNFα produced by LV-SOCS1-siRNA-DC compared to GFP-siRNA-DC after stimulation with LPS. FIG. 16B depicts the frequency of gp120-specific CD4 + T cells. FIG. 16C shows that CD4 + T cells from LV-SOCS1-siRNA-DC mice proliferated more actively than those from LV-GFP-siRNA-DC mice in response to stimulation with DC receiving gp120 pulses. Illustrated. FIG. 16D shows increased levels of both Th1 polarized (IFN-γ, IL-2 and TNFα) and Th2 polarized (IL-4 and IL-10) cytokines in SOCS1-silenced DCs. FIG. 17 comprising FIGS. 17A-17D is a series of charts demonstrating enhanced gp120-specific B cell activation by SOCS1-silenced DCs. FIG. 17A depicts the expression levels of APRIL and BAFF mRNA at the time of LPS stimulation. FIG. 17B depicts the frequency of anti-gp120 IgG producing B cells in LV-SOCS1-siRNA-DC and LV-GFP-siRNA-DC mice. FIG. 17C shows that B cells derived from LV-SOCS1-siRNA-DC mice proliferated more vigorously than B cells derived from LV-GFP-siRNA-DC mice when co-stimulated with anti-CD40 and IL-4. It depicts that. FIG. 17D shows that B cells from LV-SOCS1-siRNA-DC mice produce various cytokines, including IL-6, IL-2, and TNF-α, at higher levels in response to various stimuli. It is drawn that. FIG. 18 comprising FIGS. 18A-18B is a series of charts demonstrating long-term gp120-specific antibodies and CTL responses elicited by SOCS1-silenced DCs. FIG. 18A depicts gp120-specific antibodies in mice immunized with LV-GFP-siRNA-DC compared to mice immunized with LV-SOCS1-siRNA-DC. FIG. 18B illustrates gp120-specific CTL responses in LV-SOCS1-siRNA-DC mice compared to LV-GFP-siRNA-DC mice. FIG. 18C illustrates the percentage of CD44hi and IFNγ + CD8 + T cells in LV-SOCS1-siRNA-DC mice compared to LV-GFP-siRNA-DC mice 6 months after immunization. FIG. 18D illustrates that gp120-specific CD4 + Th response was maintained and rapidly elicited in LV-SOCS1-siRNA-DC mice 6 months after immunization. FIG. 19, comprising FIGS. 19A-19E, is a series of charts demonstrating the resistance of SOCS1-silenced DCs to HIV Env-mediated immunosuppression. FIG. 19A illustrates that LV-SOCS1-siRNA-DC in the presence of gp120 protein retained the ability to respond to LPS. Post-exposure to gp120 protein had no apparent effect on the ability of LV-SOCS1-siRNA-DC to elicit an OVA-specific antibody response (FIGS. 19B and 19C) and was induced by LV-SOCS1-siRNA-DC. Nor did it compromise the OVA-specific CD8 + CTL and CD4 + Th responses (FIGS. 19D and 19E). FIG. 20, comprising FIGS. 20A-20D, is a series of diagrams demonstrating the enhancement of HIV DNA vaccines by SOCS1 siRNA. FIG. 20A depicts the enhancement of HIV Env-specific antibody titers in mice co-immunized with pSuper-SOCS1-siRNA DNA. FIGS. 20B and 20C illustrate that the HIV Env-specific CTL response was significantly enhanced by co-injection of p Super-SOCS1-siRNA DNA, as demonstrated by CTL and ELISPOT assays, respectively. Yes. FIG. 20D depicts the fact that the HIV Env specific CD4 + Th response was enhanced by co-injection of SOCS1-siRNA DNA. FIG. 21, comprising FIGS. 21A-21C, is a series of charts demonstrating silencing of human SOCS1 in DCs derived from human monocytes. FIG. 21A illustrates that human SOCS1 siRNA efficiently downregulated human SOCS1 expression. FIG. 21B illustrates the transfection efficiency of synthetic siRNA duplexes into DCs derived from human monocytes. FIG. 21C depicts the level of hSOC1 mRNA in the total DC population transfected with hSOCS1 siRNA duplex. FIG. 22, comprising FIGS. 22A-22C, is a series of charts characterizing human SOCS1 silenced DCs. FIG. 22A depicts a flow cytometric analysis for the labeled human SOCS1. Figures 22B and 22C show pro-inflammatory cytokines such as IL-12, IL-6 and TNF-α in DCs transfected with hSOCS1 siRNA compared to human DCs transfected with siRNA mutants. Explains the level of secretion. FIG. 23, comprising FIGS. 23A-23C, is a series of diagrams demonstrating the enhanced immunostimulatory efficacy of human SOCS1 silenced DCs priming antigen-specific CTL responses. From one of four independent experiments with different HLA-A2 + donors, MAGE3-PE tetramer + T cell percentage (FIG. 23A), intracellular IFNγ + T cell percentage within gated CD3 + and CD8 + T cell populations (FIG. 23B). , And IFN-γ + ELISPOT numbers (FIG. 2C). FIG. 4 is a diagram depicting enhanced human MAGE3-specific CTL responses in humanized HLA-A2,1 transgenic mice. FIG. 25 comprising FIGS. 25A and 25B is a series of charts demonstrating the oncolytic activity of human CTL activated by human SOCS1-siRNA-DC. From 4 independent experiments, human MAGE3 ⁺ after 2 weeks co-culture of autologous T cells and MSO3 pulsed hSOCS1-siRNADC or control DC in the absence or presence of anti-human IL-12 antibody, HLA-A2 ⁺ melanoma cells (SK-Mel-37) (Figure 25A) and control human MAGE3 ^+, HLA-A2 ^- melanoma cells (NA-6-Mel) is shown cytolytic activity against (Figure 25B) Yes. FIG. 26 comprising FIG. 26A and FIG. 26B is a series of charts demonstrating the oncolytic activity of activated CTL of immunized HLA-A2.1 transgenic mice. From one of three experiments, human SK-Mel-37 cells (FIG. 26A) and control human HLA-A2 ^- NA-6-Mel cells (FIG. 26B) after 5 days in vitro restimulation with MAGE3 peptide. Cytotoxicity against has been determined and presented. FIG. 27, which comprises FIGS. 27A and 27B, is a series of diagrams demonstrating that co-immunization with SOCS1 siRNA oligo duplexes enhances protein immunization in vivo. It is the graph which drawn the schematic of the replication defect | deletion adenovirus vector which expresses human SOCS1 siRNA. FIG. 28 also demonstrates the transfection of human DCs with Ad-human SOCS1 siRNA. FIG. 6 is a diagram depicting enhanced CTL activity by TCS SOCS1 siRNA oligo duplex transfection. It is a chart which draws the nucleic acid sequence of siRNA candidate. Diagram demonstrating that the expression of A20 mRNA in BM-DC transfected with A20-siRNA (siA20) is down-regulated by siA20 oligos as measured using quantitative RT-PCR assays. It is. 32, comprising FIGS. 32A-32D, is a series of charts demonstrating the enhanced in vivo immune stimulatory efficacy of BM-DC that has received OVA pulses and has received siA20 oligotransfection. Figures 32A-32D show mice immunized with mutant siRNADC (in the absence of CpG), A20-2 siRNADC (in the absence of CpG), mutant siRNADC (in the absence of CpG) and A20-2 siRNADC (in the absence of CpG), respectively. It depicts the percentage of ^{H2-K b} / ovalbumin -PE tetramer ⁺ T cells in the total CD8 ⁺ T cell populations that have undergone gated in the body. FIG. 33 comprising FIGS. 33A and 33B shows the anti-OVACD8 T cell response in BM-DCs receiving siA20 oligo-transfected in vivo OVA pulses in the presence and absence of PolyI: C stimulation, respectively. Figure 2 is a series of charts demonstrating enhancement. FIG. 34 comprising FIGS. 34A and 34B shows the anti-OVACD4 T cell response in BM-DC that received siA20 oligo-transfected in vivo OVA pulses in the presence and absence of PolyI: C stimulation, respectively. Figure 2 is a series of charts demonstrating enhancement. FIG. 35, comprising FIGS. 35A and 35B, is a series of charts demonstrating enhanced anti-TRP2CD8 T cell responses in BM-DC that received siA20 oligo-transfected TRP2 pulses in vivo. FIGS. 35A and 35B show the number of IFN-γ ELISPOT of CD8 ⁺ T cells in transfected or mock DC immunized mice that received TRP2 pulses in the presence and absence of PolyI: C stimulation, respectively. Is drawn. Pre-prepared EG. By DC immunization with siA20 oligo-transfected with OVA pulse in the absence of CpG in vivo stimulation. 7 is a chart of tumor growth curves demonstrating eradication of 7 tumors. Pre-prepared EG. By DC immunization with siA20 oligo-transfected with OVA pulse in the absence of CpG in vivo stimulation. 7 is a chart of tumor growth curves demonstrating eradication of 7 tumors. 6 is a diagram demonstrating that silencing of SOCS1, A20, SUMO1 or Foxj1 in DC enhances OVA-specific antibody responses. FIG. 5 is a chart depicting the percentage of TRP2-specific IFN-γ ⁺ of CD8 T cells in mice immunized with LV-siA20-transduced DCs that received TRP2-pulses. FIG. 6 is a chart depicting the percentage of OVA-specific IFN-γ ⁺ of CD4 ⁺ T cells in mice immunized with LV-siA20-transduced DCs that received OVA pulses. FIG. 6 is a graph demonstrating inhibition of pre-prepared B16-OVA tumors by immunization of DCs that received OVA pulses and received LV-siA20 or siFoxj1-transduced. FIG. 5 is a graph depicting the survival rate of mice immunized with LV-siA20-transduced DCs or siFoxj1 transduced DCs that received OVA pulses. FIG. 5 is a diagram demonstrating enhanced HIV gp120-specific CD8 + T cell responses in immunized mice immunized with LV-siA20-transduced DCs that received HIV gp120 pulses. FIG. 6 is an image of a Western blot assay demonstrating the down-regulation of Foxj1 protein in 293 cells co-transfected with Foxj1 expressing DNA and Foxj1-siRNA (siFoxj1) oligo. Demonstration that DCs transfected with siFoxj1 oligo were more responsive to LPS stimulation than DCs transfected with siRNA mutants, as indicated by enhanced IL-6 secretion. It is a chart to do. 1 is a chart demonstrating TRP2-specific CD8 and CD4 T cells in mice immunized with transduced DCs receiving TRP2 pulses. 1 is a diagram demonstrating HIV gp120-specific CD8 and CD4 T cells in the body of mice immunized with transduced DCs receiving HIV gp120 pulses. FIG. 6 is a Western blot assay diagram demonstrating down-regulation of Twist2 protein in 293 cells co-transfected with Twist1 and Twist2 expressed DNA in combination with Twist2-siRNA (siTwist2) oligos. FIG. 5 is a diagram of OT-I tetramer staining demonstrating enhanced immunostimulatory efficacy of BM-DCs that received OVA pulses in vivo and received siTwist2 oligotransfection. FIG. 5 is a graph of an IFNγ-ELISPOT assay demonstrating that Twist2 silencing enhances the immunostimulatory efficacy of BM-DCs that received OVA pulses in vivo and that received siTwist2 oligotransfection. FIG. 3 is a graph demonstrating that SUMO1 silencing enhances the immunostimulatory efficacy of BM-DCs that have undergone siSUMO1 (SUMO1-2 and SUMO1-3) oligotransfection in vivo. FIG. 51 depicts an IFNγ-ELISPOT assay of CD8 ⁺ T cells in mice immunized with transfected DCs or mock DCs that received ovalbumin pulses with in vivo PolyI: C stimulation. . FIG. 6 is an image of a Western blot assay demonstrating enhanced activation of IKβα in DCs transfected with SUMO1 siRNA (siSUMO1). FIG. 4 is a diagram depicting siRNA targeted sequences for A20, SUMO1, SUMO2, SUMO3, SUMO4, Twist-1, Twist-2, Foxj1 and Foxo3a.

Claims (66)

  A composition for enhancing the immune capacity of an immune cell, comprising an inhibitor of a negative immune regulator, wherein the inhibitor interferes with the negative immune regulator in the cell and the negative immune regulator The above composition wherein the factor is selected from the group consisting of a transcription factor that induces expression of a protein involved in molecular stability and an inhibitor of NFκB or suppresses transcription of an NFκB target gene, or any combination thereof.   The composition according to claim 1, wherein the protein involved in molecular stability is selected from the group consisting of A20, SUMO (SUMO1, SUMO2, SUMO3, SUMO4) and any variants thereof.   2. The transcription factor that suppresses transcription of an NFκB target gene or induces expression of an inhibitor of NFκB is selected from the group consisting of Twist-1, Twist-2, Foxj1, Foxo3a and any variants thereof. A composition according to 1.   The inhibitor is selected from the group consisting of small interfering RNA (siRNA), microRNA, antisense nucleic acid, ribozyme, expression vector encoding trans dominant negative mutant, intracellular antibody, peptide, and small molecule. 2. The composition according to 1.   2. The composition of claim 1, wherein the inhibitor is siRNA.   The composition according to claim 5, wherein the siRNA is selected from the group consisting of a double-stranded oligonucleotide, a single-stranded oligonucleotide, and a polynucleotide.   6. The composition of claim 5, wherein the siRNA is chemically synthesized.   The composition of claim 1 further comprising a physiologically acceptable carrier.   9. A composition according to claim 8, wherein the physiologically acceptable carrier is a liposome.   The composition of claim 1, wherein the inhibitor is encoded by an isolated polynucleotide cloned into an expression vector.   The composition according to claim 10, wherein the expression vector is selected from the group consisting of plasmid DNA, viral vector, bacterial vector and mammalian vector.   11. The composition of claim 10, wherein the expression vector further comprises an integration signal sequence that facilitates integration of the isolated polynucleotide into the genome of the host cell.   2. The composition of claim 1, further comprising an antigen having at least one epitope, wherein the epitope has the ability to elicit an immune response in a mammalian body.   14. The composition of claim 13, wherein the antigen is expressed by an expression vector.   14. The composition of claim 13, wherein the antigen is an isolated polypeptide.   14. The composition of claim 13, wherein the at least one epitope induces a CD4 + T cell response in the mammal.   14. The composition of claim 13, wherein the at least one epitope induces a CD8 + T cell response in the mammal.   14. The composition of claim 13, wherein the at least one epitope elicits a B cell response in the mammal.   14. The composition of claim 13, wherein the antigen is associated with one disease.   20. A composition according to claim 19, wherein the disease is selected from the group consisting of infectious diseases, cancer and autoimmune diseases.   14. The composition of claim 13, wherein the antigen is associated with an infectious disease.   23. The composition of claim 21, wherein the infectious disease is caused by a pathogenic microorganism selected from the group consisting of viruses, bacteria, fungi and protozoa.   14. The composition of claim 13, wherein the antigen is encoded by a viral gene.   24. The composition of claim 23, wherein the viral gene is derived from a virus selected from the group consisting of hepatitis B virus, hepatitis C virus, human immunodeficiency virus, papilloma virus, and herpes virus.   24. The composition of claim 23, wherein the antigen is encoded by a viral gene selected from the group consisting of hepatitis B virus e antigen gene, hepatitis B virus surface antigen gene and hepatitis B virus core antigen gene.   24. The composition of claim 23, wherein the antigen is encoded by a viral gene selected from the group consisting of human immunodeficiency virus Env gp160 gene, Gag gene, Pol gene, Rev gene, Tat gene, Vif gene and Nef gene. .   24. The composition of claim 23, wherein the antigen is encoded by a viral gene selected from the group consisting of papilloma virus E7 gene and papilloma virus E6.   Herpes selected from the group consisting of type 1 herpes simplex virus, type 2 herpes simplex virus, Epstein-Barr virus, cytomegalovirus, human herpes virus type 6, human herpes virus type 7 and human herpes virus type 8 24. The composition of claim 23, encoded by a viral gene derived from a virus.   14. The composition of claim 13, wherein the antigen is associated with cancer.   30. The composition of claim 29, wherein the cancer is selected from the group consisting of breast cancer, cervical cancer, melanoma, kidney cancer and prostate cancer.   The antigen is an overexpressed tumor associated antigen, testicular tumor antigen, mutant tumor associated antigen, differentiated tumor associated antigen tyrosinase, MART, trp, MAGE-1, MAGE-2, MAGE-3, gp100, HER-2, 30. The composition of claim 29, which is a tumor associated antigen selected from the group consisting of Ras and PSA. The tumor-associated antigen is BCR-ABL, CASP, CDK, Ras, p53, HER-2 / neu, CEA, MUC, TW1, PAP, survivin, telomerase, EGFR, P
The SMA, PSA, PSCA, tyrosinase, MART, TRP, gp100, MART, MAGE, BAGE, GAGE, LAGE / NY-ESO, RAGE, SSX-2, CD19 and CD20. Composition.   14. The composition of claim 13, wherein the disease is selected from the group consisting of rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, psoriasis and Crohn's disease.   14. The composition of claim 13, further comprising a cytokine.   The cytokine is selected from the group consisting of IL-12, TNFα, IFNα, IFNβ, IFNγ, IL-7, IL-1, IL-2, IL-6, IL-15, IL-21 and IL-23. 35. The composition of claim 34.   14. The composition of claim 13, which is further a Toll-like receptor (TLR) agonist.   The composition according to claim 1, wherein the inhibitor further suppresses inhibition of antigen receptor signaling.   A composition for enhancing immunity of a cell, which encodes an inhibitor that interferes with a negative immune regulator in the cell, wherein the negative regulator is a protein involved in molecular stability and an inhibitor of NFκB A first polynucleotide selected from the group consisting of a transcription factor that induces expression or suppresses transcription of an NFκB target gene, or any combination; and an antigen having at least one epitope, said at least one epitope A composition comprising a vector comprising a second polynucleotide that elicits an immune response in a mammal.   39. The composition of claim 38, wherein the protein involved in molecular stability is selected from the group consisting of A20, SUMO (SUMO1, SUMO2, SUMO3, SUMO4) and any variants thereof.   The transcription factor that suppresses the transcription of an NFκB target gene or induces the expression of an inhibitor of NFκB and suppresses the transcription of the NFκB target gene comprises Twist-1, Twist-2, Foxj1, Foxo3a, and any mutants thereof 40. The composition of claim 38, selected from the group.   The inhibitor is selected from the group consisting of small interfering RNA (siRNA), microRNA, antisense nucleic acid, ribozyme, expression vector encoding trans dominant negative mutant, intracellular antibody, peptide, and small molecule. 41. The composition according to 40.   41. The composition of claim 40, wherein the vector is selected from the group consisting of plasmid DNA, viral vectors, bacterial vectors, and mammalian vectors.   A composition for enhancing immunity of a cell, which encodes an inhibitor that interferes with a negative immune regulator in the cell, wherein the negative regulator is a protein involved in molecular stability and an inhibitor of NFκB A first polynucleotide selected from the group consisting of a transcription factor that induces expression or suppresses transcription of an NFκB target gene, or any combination thereof, and encodes at least one cytokine or Toll-like receptor (TLR) agonist A composition comprising a vector comprising a second polynucleotide. The proteins involved in molecular stability are A20 and SUMO (SUMO1, SUMO2
44. The composition of claim 43, selected from the group consisting of: SUMO3, SUMO4).   The transcription factor that suppresses transcription of an NFκB target gene or induces expression of an inhibitor of NFκB and suppresses transcription of the NFκB target gene is selected from the group consisting of Twist-1, Twist-2, Foxj1 and Foxo3a Item 44. The composition according to item 43.   The inhibitor is selected from the group consisting of small interfering RNA (siRNA), microRNA, antisense nucleic acid, ribozyme, expression vector encoding trans dominant negative mutant, intracellular antibody, peptide and small molecule. 44. The composition according to 43.   Said second polynucleotide encoding a cytokine is IL-12, TNFα, IFNα, IFNβ, IFNγ, IL-7, IL-1, IL-2, IL-6, IL-15, IL-21 and IL- 44. The composition of claim 43, selected from the group consisting of 23.   A cell comprising an inhibitor of a negative immune regulator, wherein the negative immune regulator induces expression of a protein involved in molecular stability and an inhibitor of NFκB or suppresses transcription of an NFκB target gene A cell selected from the group consisting of factors, or any combination.   49. The cell according to claim 48, wherein the protein involved in molecular stability is selected from the group consisting of A20, SUMO (SUMO1, SUMO2, SUMO3, SUMO4) and any variants thereof.   The transcription factor that suppresses transcription of an NFκB target gene or induces expression of an inhibitor of NFκB and suppresses transcription of the NFκB target gene is composed of Twist-1, Twist-2, Foxj1, Foxo3a, and any variants thereof 49. The cell of claim 48, selected from the group.   The inhibitor is selected from the group consisting of small interfering RNA (siRNA), microRNA, antisense nucleic acid, ribozyme, expression vector encoding trans dominant negative mutant, intracellular antibody, peptide, and small molecule. 48. The cell according to 48.   49. The cell of claim 48, wherein the cell is an immune cell selected from the group consisting of APC, dendritic cells, monocytes / macrophages, T cells and B cells.   53. The cell of claim 52, wherein the T cell is a cytotoxic T cell, a helper T cell, and a regulatory T cell.   49. The cell of claim 48, further comprising an antigen having at least one epitope, wherein the epitope is capable of eliciting an immune response in a mammalian body.   49. The cell of claim 48, further comprising an expression vector comprising a polynucleotide encoding a cytokine.   A method for producing a silenced cell comprising the step of contacting the cell with an inhibitor of a negative immune regulator, wherein the negative immune regulator is involved in molecular stability and an inhibitor of NFκB The method described above, wherein the method is selected from the group consisting of transcription factors or any combination that induces expression of or suppresses transcription of an NFκB target gene. The protein involved in molecular stability is A20, SUMO (SUMO1, SUMO2,
58. The method of claim 56, selected from the group consisting of SUMO3, SUMO4) and any variant thereof.   57. The transcription factor that induces expression of an inhibitor of NFκB or represses transcription of an NFκB target gene is selected from the group consisting of Twist-1, Twist-2, Foxj1, Foxo3a and any variants thereof. The method described in 1.   The inhibitor is selected from the group consisting of small interfering RNA (siRNA), microRNA, antisense nucleic acid, ribozyme, expression vector encoding trans dominant negative mutant, intracellular antibody, peptide and small molecule. 56. The method according to 56.   In a method of generating silencing and pulsed cells, i) contacting a cell with an inhibitor of a negative immune regulator, wherein the negative immune regulator is involved in molecular stability and NFκB A step selected from the group consisting of transcription factors or any combination thereof that induces the expression of inhibitors of or suppresses transcription of NFκB target genes; and ii) further contacting the cells with an antigen having at least one epitope And wherein said epitope comprises the ability to elicit an immune response in a mammal.   A method of eliciting an immune response in a mammalian body comprising the step of administering a composition comprising an inhibitor of said negative immune modulator to the body of a mammal in need thereof, Wherein said immunomodulatory factor is selected from the group consisting of a protein involved in molecular stability, a transcription factor that induces expression of an inhibitor of NFκB or suppresses transcription of an NFκB target gene, or any combination thereof.   A method of eliciting an immune response in a mammalian body comprising the step of administering a composition comprising an inhibitor of said negative immune modulator into a tumor in said mammalian body, said negative The above method, wherein the immunomodulator is selected from the group consisting of a protein involved in molecular stability, a transcription factor that induces expression of an inhibitor of NFκB or suppresses transcription of an NFκB target gene, or any combination thereof.   A method of eliciting an immune response in a mammalian body, encoding an inhibitor of a negative immune regulator, wherein said negative immune regulator induces expression of a protein involved in molecular stability and an inhibitor of NFκB Or a transcription factor that suppresses transcription of an NFκB target gene, or a first polynucleotide selected from the group consisting of any combination, and an antigen having at least one epitope, wherein the at least one epitope is present in the mammal Administering the composition comprising a vector comprising a second polynucleotide that elicits an immune response.   A method of eliciting an immune response in a mammalian body comprising the step of administering a composition comprising silenced cells into the mammalian body in need thereof, said silencing Transcribed cells comprising an inhibitor of a negative immune regulator, wherein said negative immune regulator induces expression of a protein involved in molecular stability, an inhibitor of NFκB or suppresses transcription of an NFκB target gene The above method, selected from the group consisting of factors, or any combination thereof.   65. The method of claim 64, wherein the silenced cell is contacted in vitro with an antigen prior to administering the silenced cell to a mammal in need thereof.   65. The method of claim 64, wherein the silenced cell is contacted in vivo after administration of the silenced cell into the body of a mammal in need thereof.

Images