JP2008513385A - 2-acylaminothiazole derivatives - Google Patents

Abstract

The present invention relates to a compound of formula I for use as a medicament, wherein the variables are defined in each claim. This compound is an A _2A receptor ligand and is useful in the treatment of neurological and psychiatric disorders involving A _2A receptors.

Description

The compounds of the present invention belong to a new class of 2-acylaminothiazole derivatives that have affinity for the adenosine 2A (A _2A ) receptor. The compounds are A _2A receptor ligands, such as antagonists, agonists, reverse agonists or partial agonists, and are useful in the treatment of neurological and psychiatric disorders involving A _2A receptors. Examples of diseases involving A _2A receptors include Parkinson's disease (PD), Alzheimer's disease, Huntington's disease, cerebral ischemia, hemorrhagic stroke, neonatal ischemia and hypoxia, subarachnoid hemorrhage, traumatic brain Injuries, cardiac arrest, multiple sclerosis, depression and psychosis.

Adenosine is present in all cells, including neurons and glia in mammalian organisms, and regulates a variety of important physiological processes. The action of adenosine is regulated by specific receptors belonging to the family of G protein-coupled receptors. Four adenosine receptors, A ₁ , A _2A , A _2B and A ₃ have been cloned and characterized (Non-patent Document 1). Major intracellular signaling pathways are involved in the formation of cAMP together with the A ₁ and A ₃ receptors that cause inhibition of adenylate cyclase, and the A _2A and A _2B receptors that activate it (2). ).

All adenosine receptors are located in the CNS (Non-patent Documents 3 and 4). Receptor A _2A of interest herein is found primarily in dopamine-rich regions such as basal nuclei components, striatal and pallidal bulbs of various mammals, including humans. The basal ganglia with the striatum as a central component is involved in the integration of cortical, thalamic and limbic information to induce motor behavior (see Non-Patent Document 5 for a review).

The striatal A _2A and dopamine D ₂ receptors form a so-called indirect output pathway from the striatum and are closely together in the GABAergic neurons of the striatum pallidum that are involved in motor inhibition Known to be localized. _A2A receptors contribute to the control of motor behavior by regulating neurotransmission of GABA, dopamine, acetylcholine and glutamate in various ways. In recent years, the interaction between A _2A and D ₂ receptors, and in particular the action of A _2A antagonists, has been of great interest in the treatment of Parkinson's disease (PD). A _2A receptors D ₂ sustainability and receptors and antagonistically interact, upon stimulation, decrease the affinity of the D ₂ receptors for dopamine. Thus, A _2A antagonists can enhance the effects of endogenous dopamine as well as clinically used dopamine agonists and increase the duration of dopaminergic drug response (eg: Non-patent document 6; Non-patent document 7; (See Patent Document 8).

Selective A _2A receptor agonists and antagonists have been extensively described in experiments on pharmacology, behavior and neuroprotection in rodents and non-human primates (reviewed in Non-Patent Document 9; Non-Patent Document 10; (See Patent Document 11; Non-Patent Document 12).

Close interaction D ₂ and A _2A receptors are clearly demonstrated in a model of catalepsy, D ₂ receptor antagonists as well as A _2A receptor agonists hindered by A _2A receptor antagonists and D ₂ receptor agonists, respectively Catalepsy is induced (see Non-Patent Document 13 and references cited therein).

The promising anti-Parkinson syndrome effect of A _2A receptor antagonists has been recently reported by many researchers. For example, SCH58261 (2- (2-furanyl) -7- (2-phenylethyl) -7H-pyrazolo [4,3-e] [1,2,4] triazolo [1,5-c] pyrimidine-5- Amine) and KW-6002 (8-[(1E) -2- (3,4-dimethoxyphenyl) ethenyl] -1,3-diethyl-3,7-dihydro-7-methyl-1H-purine-2,6 -Dione) both enhance contralateral rotations induced by sub-threshold doses of levodopa in unilateral 6-OHDA (6-hydroxydopamine) disrupted mice and rats (14) (See cited references). Furthermore, KW-6002 is a motor impairment induced by MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine) in non-human primates, and a dopamine agonist L- It improves significantly without causing the motion abnormality normally reported in the long-term treatment using dopa (Non-patent document 15; Non-patent document 16; Non-patent document 17).

Thus, A _2A receptor antagonists not only suppress movement disorders, but can also slow or stop disease progression by promoting cell survival, thus enabling the next generation for long-term medication in PD patients. It shows great potential as a drug.

The neuroprotective effect of A _2A receptor antagonists has recently been reported in in vivo and in vitro models of various neurodegenerative diseases (see Non-Patent Document 18 and Non-Patent Document 19). A _2A antagonists have been shown to protect neurons in various PD models, as in MPTP-treated mice and 6-OHDA-destructed rats. Here, KW-6002 suppresses functional deletion of dopaminergic nerve endings in the striatum and suppresses around degenerating neurons that are normally induced by gliosis (Non-Patent Document 20; Patent Document 21; Non-Patent Document 22, Non-Patent Document 23). Similar results have been obtained in an experimental model of Huntington's disease (HD). In the rat HD model, quinolinic acid or kainic acid-induced damage decreased along with decreased striatal cell loss and motor changes after the use of an adenosine A _2A receptor antagonist (Non-Patent Literature) 24; Non-Patent Document 25). Furthermore, A _2A receptor antagonists have been shown to reduce neuronal cell death after ischemia in neonatal and adult rats and gerbils (Non-Patent Document 26; Non-Patent Document 27). A _2A knockout animals are from neonatal hypoxic and transient ischemia and from 3NP (3-nitropropionic acid) -induced presynaptic neurotoxic glutamate release It is reported that it is protected (Non-Patent Document 28, Non-Patent Document 29, Non-Patent Document 30). The protective effect of A _2A antagonists against neurodegeneration due to glutamate release has already been shown in rat models of ischemic injury to the cerebral cortex (Non-patent Document 31 and Non-patent Document 32).

Protection A _2A antagonists, bFGF induced astrogliosis rat model, neurotoxic symptoms in amyloid beta peptide 25-35 induced brain granule cells (CGCS), and QA induced in rats organotypic slice cultures of neuronal cell death It has also been reported in primary cultured astrocytes in a model (Non-patent document 33; Non-patent document 34; Non-patent document 35).

In summary, A _2A receptor antagonists can effectively protect various neurons from various forms of neurodegeneration induced by injury (Non-patent Document 36; Non-patent Document 37).

Adenosine and its analogs induce an “inhibitor-like” effect in animal models of psychiatric disorders (Non-Patent Document 38; Non-Patent Document 39). Moreover, these behavioral deficits (Behavioral Deficits) were found to be suppressed by adenosine A _2A receptor antagonist (Non-patent Document 40). In further studies, treatment with adenosine or 2-chloroadenosine increases immobilization time in the mouse forced swim test, another animal model of depression that is generally considered reliable (Non-patent Document 41).

Some compounds with affinity for both the A _2A and A ₁ receptor subtypes, known as 4-amino [1,2,3] triazolo [4,3-α] quinoxalines, It has been shown to be active in the forced swimming test of rats exhibiting antidepressant activity (Non-patent Document 42). Most recently, A _2A receptor knockout mice were found to be less sensitive to “inhibitor” challenges than wild-type littermates (Non-patent Document 43). Consistent with this data, the A _2A receptor antagonists SCH58261 and KW6002 reduced overall immobilization time in the mouse tail suspension test (Non-Patent Document 43). Antagonists SCH58261 and ZM241385 4- (2- [7-amino-2- (2-furyl) [1,2,4] triazolo [2,3-α] [1,3,5] triazin-5-ylamino]- Ethyl) phenol decreased immobilization when administered to mice prescreened as having a high immobilization time, and in addition, SCH58261 was selected in this model for mice that were selectively crossed for “helplessness”. It has also been found to reduce immobilization (Non-patent Document 43).

Studies with _A2A knockout mice show that these animals have a blunt response to psychostimulants such as amphetamine and cocaine, despite being unaffected in terms of D1 and D2 receptor expression and binding affinity It has been reported (Non-patent Document 44). Furthermore, it has been shown that inactivation of the A _2A receptor selectively attenuates amphetamine-induced behavioral sensitization (Non-patent Document 45). In addition, _A2A knockout mice exhibit reduced startle response and PPI of sound-stimulated startle response (46), and these measurements are frequently used to detect antipsychotic activity. This is further supported in studies where pharmacological blockade of A _2A receptors by selective antagonists completely suppresses prepulse inhibition (PPI) (Non-patent Document 47). Psychostimulants such as MK-801 and amphetamine were unable to prevent startle response and PPI in A _2A KO mice (Non-patent Document 46).

Thus, the evidence obtained suggests that adenosine A _2A receptor antagonists can specifically regulate the mesocorticolimbic or mesocorticolimbic dopaminergic pathway, thereby depressing antidepressants. And / or suggested to have antipsychotic properties.

Patent Document 1 discloses the following formula as an A _2B receptor antagonist:

In general, compounds that selectively inhibit activation of the A _2b receptor over the A ₁ and A _2A receptors are disclosed. This compound is disclosed as being useful in the treatment of inflammatory or obstructive airway diseases.

Accordingly, there is a need for A _2A receptor ligands such as antagonists, agonists, reverse agonists or partial agonists.
International Publication No. 02/42298 Pamphlet Fredholm et al, 1994, Pharmac. Rev., 46, 143-156 Olah et al, Pharacol. Ther., 2000, 85, 55-75 Impagnatiello et al, Emerg. Ther. Targets, 2000,4, 635-644 Rosin et al, J. Comp. Neurol., 1998, 401, 163-186 Svenningson et al, Prog. Neurobiol., 1999, 59, 355-396 Richardson et al, Trends Pharmacol. Sci., 1997, 18, 338-344 Svenningson et al, Prog. Neurobiol., 1999, 59, 355-396 Fuxe et al, Parkinson´s Dis. Adv., 2001, 86, 345-353 Richardson et al, Trends Pharmacol. Sci., 1997, 18, 338-344 Ribeiro et al, Prog. Neurobiol., 2003, 68, 377-392 Ongini et al, Il Farmaco, 2001, 56, 87-90 Wardas, Polish J. Pharmacology, 2003, 54, 313-326 Svenningson et al, Prog. Neurobiol., 1999, 59, 355-396 Ongini et al, Drug Dev. Res., 2001, 52, 379-386 Kanda et al, Ann. Neurol., 1998, 43, 507- 513 Grondin et al, Neurology, 1999, 52, 1673-1677 Kanda et al, Exp. Neurol., 2000, 162, 321-327 Wardas J., Pol. J. Pharmacol. 2002, 54, 313-26 Stone TW. Adv. Exp. Med. Biol. 2002, 513, 249-80 Ikeda et al, J. Neurochem., 2002, 80, 262-270 Hirsch et al, Adv. Neurol., 1999, 80, 9-18 Kanda et al, Ann. Neurology, 2000, 43 (4), 507-513 Lundblad et al. J. Neurochem. 2003, 84 (6), 1398-410 Reggio et al, Brain Res. 1999, 831, 315-318 Popoli et al, J. Neurosci., 2002, 22, 1967-1975 Gao Y, Phillis JW., Life Sci. 1994, 55 (3), PL61-5 Monopoli A. et al, Neuroreport, 1998, 9 (17), 3955-9 Bona E. et al, Neuropharmacology, 1997, 36 (9), 1327-38 Chen JF. Et al, J Neurosci, 1999, 19 (21), 9192-9200 Blum D. et al, J. Neurosci, 2003, 23, 5361-5369 Simpson RE, J Neurochem, 1992, 58, 1683-1690 O'Regan MH. Et al, Brain Res, 1992, 582, 22-26 Brambilla R. et al. Glia. 2003, 43,190-194 Dall'Igna OP. Et al. Br. J. Pharmacol. 2003, 138: 1207-1209 Tebano MT ,. et al. Eur. J. Pharmacol. 2002, 253-257 Abbracchio MP, Cattabeni F 1999 Ann. NY Acad. Sci. 890: 79-92 Ongini E. et al, Ann. NY Acad. Sci., 1997, 825: 30-48 Minor et al., Behav. Neurosci., 1994, 108: 265-276 Woodson et al., Behav. Neurosci. 1998, 112: 399-409 Minor et al., Behav. Brain Res. 2001, 120, 230-212 Porsolt et al., Arch. Int. Pharmacodyn. Ther., 1977, 229: 327-336 Sarges et al., J. Med. Chem., 1990, 33, 2240-2254 El Yacoubi et al., Br. J. Pharmacol. 2001, 134, 68-77 Chen et al., Neurosci., 2000, 97, 195-204 Chen et al., Neuropsychopharmacol., 2003, 28, 1086-1095 Wang et al., Behav. Brain Res., 2003, 143, 201-207 Nagel et al., Synapse, 2003, 49, 279-286

It is an object of the present invention to provide compounds that are _A2A receptor ligands, such as antagonists, agonists, reverse agonists or partial agonists.

  Accordingly, the present invention provides compounds of formula I for use as a medicament.

A compound represented by:
Wherein R ¹ is phenyl, thien-2-yl or thien-3-yl, each phenyl and thienyl optionally selected from halogen, C _1-6 -alkyl or C _1-6 -alkoxy 1 Substituted with species or more substituents;
R ² is furan-2-yl, furan-3-yl, [1,2,4] -oxadiazol-3-yl, [1,2,4] -oxadiazol-5-yl, [1, 2,5] -oxadiazol-3-yl, [1,2,4] -thiadiazol-3-yl, [1,2,4] -thiadiazol-5-yl, [1,2,5] -thiadiazole 5-membered heteroaryl selected from the group consisting of -3-yl, wherein said heteroaryl is optionally C _1-6 -alkyl, phenyl-C _1-6 -alkyl, C _1-6 -alkoxy and C _1-6 - alkoxy -C _1-6 - or is substituted with one or more substituents selected from the group consisting of alkyl, or, R ² in 1- or 2-position C _1-6 - alkyl Or tetrazol-5-yl substituted with phenyl-C _1-6 -alkyl or C _3-8 -cycloalkyl-C _1-6 -alkyl, or R ² is 5-oxo-4,5- Dihydro- [1,3,4] -oxadiazol-2-yl;
And R ³ is C _1-6 -alkyl, C _3-8 -cycloalkyl, C _3-8 -cycloalkyl-C _1-6 -alkyl, furanyl, furanyl-C _1-6 -alkyl, thienyl, thienyl- Selected from the group consisting of C _1-6 -alkyl, phenyl, phenyl-C 2-6 -alkene and phenyl-C _1-6 -alkyl, said phenyl-C _1-6 -alkyl optionally in the phenyl ring, halogen, C _1-6 - alkyl or C _1-6 - is substituted with one or more substituents selected from alkoxy, regarding the compounds.

In a second aspect, the present invention relates to a method of using a compound of formula I as defined above for the manufacture of a medicament for the treatment of diseases involving A _2A receptors.

  In a third aspect the present invention relates to a compound of formula I as defined above, provided that said compound is N- [5- (5-nitro-furan-2-yl) -4-phenyl-thiazole Condition is not -2-yl] -benzamide.

The compounds of the present invention are humans of 5 μM or less, typically 1 μM or less, preferably 550 nM or less, more preferably 200 nM or less, even more preferably 50 nM or less, and most preferably 10 nM or less. An A _2A receptor ligand with A _2A binding affinity (Ki), such as an antagonist, agonist, reverse agonist or partial agonist.

<Detailed Description of the Invention>
In certain embodiments, the present invention relates to a compound of formula I as defined above, wherein the A _2A -receptor is involved and Parkinson's disease, Alzheimer's disease, Huntington's disease, cerebral ischemia, hemorrhagic stroke, neonate The present invention relates to a method for use in the manufacture of a medicament for the treatment of a disease selected from the group consisting of ischemia and hypoxia, subarachnoid hemorrhage, traumatic brain injury, cardiac arrest, multiple sclerosis, depression and psychosis.

  In a further particular embodiment, the invention relates to a method of using said compound for the manufacture of a medicament for the treatment of Parkinson's disease.

In a further particular embodiment, the invention relates to said compound which is an _A2A receptor antagonist.

In another specific embodiment, the compound is a ligand that is selective for the A _2A receptor over the A ₁ or A _2B receptor. In a more specific embodiment, the compound is a ligand that is selective for the A _2A receptor over the A ₁ receptor. Similarly, in certain embodiments, the compound is a ligand that is selective for the A _2A receptor over the A _2B receptor.

In certain embodiments, the present invention relates to a compound of formula I, as defined above, wherein R ¹ is phenyl.

In another particular embodiment, the invention relates to compounds of formula I, as defined above, wherein R ¹ is thien-2-yl.

In another particular embodiment, the invention relates to compounds of formula I, as defined above, wherein when R ² is tetrazol-5-yl, it is substituted at the 2-position.

In another particular embodiment, the invention relates to compounds of formula I, as defined above, wherein when R ² is tetrazol-5-yl, it is substituted at the 1-position.

In a more specific embodiment, the invention is as defined above and when R ² is tetrazol-5-yl, it is methyl, ethyl, propyl, butyl, isobutyl, cyclopropanemethyl or phenethyl Relates to compounds of the formula I substituted by

In another particular embodiment, the invention is as defined above, R ² is furan-2-yl or furan-3-yl and heteroaryl is optionally C _1-6 -alkyl, phenyl Of the formula I substituted with one or more substituents selected from the group consisting of -C _1-6 -alkyl, C _1-6 -alkoxy and C _1-6 -alkoxy-C _1-6 -alkyl Relates to compounds.

In another particular embodiment, the invention is as defined above, R ² is [1,2,4] -oxadiazol-3-yl and heteroaryl is optionally C _1-6 Substituted with one or more substituents selected from the group consisting of -alkyl, phenyl-C _1-6 -alkyl, C _1-6 -alkoxy and C _1-6 -alkoxy-C _1-6 -alkyl Relates to compounds of formula I.

In another particular embodiment, the invention is as defined above, R ² is [1,2,4] -oxadiazol-5-yl and heteroaryl is optionally C _1-6 Substituted with one or more substituents selected from the group consisting of -alkyl, phenyl-C _1-6 -alkyl, C _1-6 -alkoxy and C _1-6 -alkoxy-C _1-6 -alkyl Relates to compounds of formula I.

In another particular embodiment, the invention is as defined above, R ² is [1,2,5] -oxadiazol-3-yl and heteroaryl is optionally C _1-6 Substituted with one or more substituents selected from the group consisting of -alkyl, phenyl-C _1-6 -alkyl, C _1-6 -alkoxy and C _1-6 -alkoxy-C _1-6 -alkyl Relates to compounds of formula I.

In another particular embodiment, the invention is as defined above and R ² is 5-oxo-4,5-dihydro- [1,3,4] -oxadiazol-2-yl Relates to compounds of formula I.

In another particular embodiment, the invention is as defined above, wherein R ³ is C _1-6 -alkyl, C _3-8 -cycloalkyl, C _3-8 -cycloalkylmethyl, furan-2 -Yl, furan-3-yl, thien-2-yl, thien-2-yl-methyl, thien-3-yl, phenylmethyl, phenethylene, and optionally benzyl substituted in the phenyl ring Relates to compounds of the formula I selected from the group.

  In a further particular embodiment, the present invention relates to a compound of formula I as defined above, wherein benzyl is substituted with one or two methoxy groups in the phenyl ring.

  Similarly, in certain embodiments, the invention relates to compounds of formula I as defined above, wherein benzyl is substituted at the 3 and / or 4 position of the phenyl ring, for use as a medicament.

In certain embodiments, the present invention relates to a compound of formula I as defined above and selected from the following group:
2- (3,4-dimethoxy-phenyl) -N- [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
2- (3,4-dimethoxy-phenyl) -N- (5- [1,2,4] oxadiazol-3-yl-4-phenyl-thiazol-2-yl) -acetamide,
N- (5-furan-3-yl-4-phenyl-thiazol-2-yl) -isobutyramide,
Cyclopropanecarboxylic acid [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
Furan-3-carboxylic acid [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
N- [5- (2-Ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -isobutyramide,
Furan-2-carboxylic acid [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
Cyclohexanecarboxylic acid [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
2-cyclopentyl-N- [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
N- [5- (2-Ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -propionamide,
Cyclopropanecarboxylic acid (5- [1,2,4] oxadiazol-3-yl-4-phenyl-thiazol-2-yl) -amide,
Thiophene-3-carboxylic acid [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
2-cyclopentyl-N- (5- [1,2,4] oxadiazol-3-yl-4-phenyl-thiazol-2-yl) -acetamide,
Furan-3-carboxylic acid [5- (2-phenethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
N- (5-furan-2-yl-4-phenyl-thiazol-2-yl) -isobutyramide,
Furan-2-carboxylic acid (5-furan-3-yl-4-phenyl-thiazol-2-yl) -amide,
2- (3,4-dimethoxy-phenyl) -N- (5-furan-2-yl-4-phenyl-thiazol-2-yl) -acetamide,
Cyclopropanecarboxylic acid (5-furan-3-yl-4-phenyl-thiazol-2-yl) -amide,
2- (3-methoxy-phenyl) -N- (5- [1,2,4] oxadiazol-3-yl-4-phenyl-thiazol-2-yl) -acetamide,
2- (3-methoxy-phenyl) -N- [5- (2-phenethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
N- (5-furan-2-yl-4-phenyl-thiazol-2-yl) -2,2-dimethyl-propionamide,
N- (5-furan-3-yl-4-phenyl-thiazol-2-yl) -propionamide,
N- [5- (2-phenethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -isobutyramide,
N- (5-furan-2-yl-4-phenyl-thiazol-2-yl) -propionamide,
Furan-2-carboxylic acid [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
3,3-dimethyl-N- [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -butyramide,
Cyclopropanecarboxylic acid [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
2-cyclopentyl-N- [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
N- [5- (2-Methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -isobutyramide,
3-methyl-N- [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -butyramide,
N- [5- (2-Methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -propionamide,
N- [5- (2-Methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -2-phenyl-acetamide,
Hexanoic acid [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
N- [5- (2-Methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -2-thiophen-2-yl-acetamide,
N- [5- (2-Methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
2,2-dimethyl-N- [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -propionamide,
Thiophene-3-carboxylic acid [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
N- [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -isobutyramide,
3-methyl-N- [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -butyramide,
N- [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -propionamide,
2-phenyl-N- [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -acetamide,
N- [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -2-thiophen-2-yl-acetamide,
N- [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -acetamide,
2,2-dimethyl-N- [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -propionamide,
Thiophene-3-carboxylic acid [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -amide,
N- [5- (2-butyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -isobutyramide,
2-cyclopentyl-N- [5- (2-isobutyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
N- [5- (2-isobutyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -2-thiophen-2-yl-acetamide,
N- [5- (2-cyclopropylmethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -3-methyl-butyramide,
Furan-2-carboxylic acid [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
3,3-dimethyl-N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -butyramide,
N- [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -benzamide,
N- [5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -benzamide,
N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -benzamide,
Cyclopropanecarboxylic acid [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
Cyclopropanecarboxylic acid [5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
Cyclopropanecarboxylic acid [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -amide,
Cyclopropanecarboxylic acid [5- (5-ethyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -amide,
2-cyclopentyl-N- [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
2-cyclopentyl-N- [5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
2-cyclopentyl-N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -acetamide,
2-cyclopentyl-N- [5- (5-ethyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -acetamide,
Cyclohexanecarboxylic acid [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
Cyclohexanecarboxylic acid [5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
Cyclohexanecarboxylic acid [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -amide,
N- [5- (1-Methyl-1H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -isobutyramide,
N- [5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -isobutyramide,
3-methyl-N- [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -butyramide,
N- [5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -3-methyl-butyramide,
3-methyl-N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -butyramide,
N- [5- (3-Methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -propionamide,
N- [5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -propionamide,
N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -propionamide,
N- [5- (3-Methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -2-phenyl-acetamide,
N- [5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -2-phenyl-acetamide,
N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -2-phenyl-acetamide,
N- [5- (5-oxo-4,5-dihydro- [1,3,4] oxadiazol-2-yl) -4-phenyl-thiazol-2-yl] -2-phenyl-acetamide,
2- (3,4-dimethoxy-phenyl) -N- [5- (2-methyl-2H-tetrazol-5-yl) -4-thiophen-2-yl-thiazol-2-yl] -acetamide,
N- [5- (5-ethyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -3-phenyl-acrylamide,
Hexanoic acid [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
Hexanoic acid [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -amide,
N- [5- (3-Methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -2-thiophen-2-yl-acetamide,
N- [5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -2-thiophen-2-yl-acetamide,
N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -2-thiophen-2-yl-acetamide,
N- [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
N- [5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -acetamide,
2,2-dimethyl-N- [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -propionamide,
N- [5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -2,2-dimethyl-propionamide,
2,2-dimethyl-N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -propionamide,
Furan-3-carboxylic acid [5- (2-methyl-2H-tetrazol-5-yl) -4-thiophen-2-yl-thiazol-2-yl] -amide,
Thiophene-3-carboxylic acid [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
Thiophene-3-carboxylic acid [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -amide.

  The compounds of general formula I can exist as their optical isomers and such optical isomers are also encompassed by the present invention. Throughout this specification and the claims, when referring to a particular compound, it represents a racemate unless otherwise indicated.

The term C _1-6 -alkyl refers to 1 to 1, such as methyl, ethyl, 1-propyl, 2-propyl, 1-butyl, 2-butyl, 2-methyl-2-propyl and 2-methyl-1-propyl. Represents a branched or unbranched alkyl group having 6 carbon atoms.

The term C _3-8 -cycloalkyl represents a monocyclic or bicyclic carbocycle having 3 to 8 C atoms, such as cyclopropyl, cyclopentyl, cyclohexyl and the like.

  Halogen means fluoro, chloro, bromo or iodo.

As used herein, the term acyl refers to formyl, C _1-6 -alkylcarbonyl, arylcarbonyl, aryl-C _1-6 -alkylcarbonyl, C _3-8 -cycloalkylcarbonyl, or C _{3- It} represents an ₈ -cycloalkyl-C _1-6 -alkyl-carbonyl group.

C _1-6 -alkoxy, C _3-8 -cycloalkyl-C _1-6 -alkyl, phenyl-C _1-6 -alkyl, heteroaryl-C _1-6 -alkyl, C _1-6 -alkylamino, C Phrases such as _1-6 -alkylcarbonyl represent groups wherein C _1-6 -alkyl, aryl, heteroaryl and C _3-8 -cycloalkyl groups are as defined above.

The phrase C _2-6 -alkene is branched with 2 to 6 carbon atoms such as ethylene, 1-propylene, 2-propylene, isopropylene, methylpropylene, 1-butylene, 2-butylene and 3-butylene. Or an unbranched alkene group.

  The term furanyl represents furan-2-yl or furan-3-yl.

  The term thienyl represents thien-2-yl or thien-3-yl.

  The term aryl represents a carbocyclic aromatic group such as phenyl or naphthyl, especially phenyl.

  The phrase heteroaryl is 1H-tetrazolyl, 3H-1,2,3-oxathiazolyl, 3H-1,2,4-oxathiazolyl, 3H-1,2,5-oxathiazolyl, 1,3,2-oxa-thiazolyl, 1,3,4-oxathiazolyl, 1,4,2-oxathiazolyl, 3H-1,2,4-dioxazolyl, 1,3,2-dioxazolyl, 1,4,2-dioxazolyl, 3H-1,2,3- Dithiazolyl, 3H-1,2,4-dithiazolyl, 1,3,2-dithiazolyl, 1,4,2-dithiazolyl, 1,2,3-oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,5- Oxa-diazolyl, 1,3,4-oxadiazolyl, 1,2,3-thiadiazolyl, 1,2,4-thiadiazolyl, 1,2,5-thiadiazolyl, 1,3,4-thiadiazolyl, 1H-1,2, 3-triazolyl, 1H-1,2,4-triazolyl, isoxazolyl, oxazolyl, isothiazolyl, thiazolyl, 1H-imidazolyl, 1H-pyrazolyl, 1H-pyrrolyl, furanyl, thienyl, 1H-pentazol 5-membered monocycle such as: 1,2,3-oxathiazinyl, 1,2,4-oxathiazinyl, 1,2,5-oxathiazinyl, 4H-1,3,5-oxathiazinyl, 1,4 , 2-oxathiazinyl, 1,4,3-oxa-thiazinyl, 1,2,3-dioxazinyl, 1,2,4-dioxazinyl, 4H-1,3,2-dioxazinyl, 4H-1,3,5- Dioxazinyl, 1,4,2-dioxazinyl, 2H-1,5,2-dioxazinyl, 1,2,3-dithiazinyl, 1,2,4-dithiazinyl, 4H-1,3,2-dithiazinyl, 4H-1, 3,5-dithiazinyl, 1,4,2-dithiazinyl, 2H-1,5,2-dithiazinyl, 2H-1,2,3-oxadiazinyl, 2H-1,2,4-oxadiazinyl, 2H-1,2, 5-oxa-diazinyl, 2H-1,2,6-oxadiazinyl, 2H-1,3,4-oxadiazinyl, 2H-1,3,5-oxadiazinyl, 2H-1,2,3-thiadiazinyl, 2H-1, 2,4-thiadiazinyl, 2H-1,2,5-thiadiazinyl, 2H-1,2,6-thiadiazinyl, 2H-1,3,4-thiadiazinyl, 2H-1,3,5-thiadiazinyl 1,2,3-triazinyl, 1,2,4-triazinyl, 1,3,5-triazinyl, 2H-1,2-oxazinyl, 2H-1,3-oxazinyl, 2H-1,4-oxazinyl, 2H 6-membered singles like -1,2-thiazinyl, 2H-1,3-thiazinyl, 2H-1,4-thiazinyl, pyrazinyl, pyridazinyl, pyrimidyl, pyridyl, 2H-pyranyl, 2H-thiinyl Ring; and 3H-1,2,3-benzoxathiazolyl, 1,3,2-benzodioxazolyl, 3H-1,2,3-benzodithiazolyl, 1,3,2-benzodithi Azolyl, benzfurazanyl, 1,2,3-benzoxiadiazolyl, 1,2,3-benzothiadiazolyl, 2,1,3-benzothiadiazolyl, 1H-benzotriazolyl, 1,2-benz Isoxazolyl, 2,1-benzisoxazolyl, benzoxazolyl, 1,2-benzisothiazolyl, 2,1-benzisothiazolyl, benzothiazolyl, 1H-benzimidazolyl, 1H-indazo Lyl, 3H-1,2-Benzoxathiolyl, 1,3-Benzoxathiolyl, 3H-2,1-Benzoxathiolyl, 3H-1,2-benzodi Oxolyl (3H-1,2-benzo-dioxolyl), 1,3-benzodioxolyl 3H-1,2-benzodithiolyl, 1,3-benzodithiolyl, 1H-indolyl, 2H-isoindolyl, benzofuranyl, isobenzofuranyl 1-benzothienyl, 2-benzothienyl, 1H-2,1-benzoxazinyl, 1H-2,3-benzoxazinyl, 2H-1,2-benzoxazinyl, 2H-1,3- Benzoxazinyl, 2H-1,4-benzoxazinyl, 2H-3,1-benzoxazinyl, 1H-2,1-benzothiazinyl, 1H-2,3-benzothiazinyl, 2H-1,2 -Benzothiazinyl, 2H-1,3-benzothiazinyl, 2H-1,4-benzothiazinyl, 2H-3,1-benzothiazinyl, quinolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, iso Represents a bicyclic ring such as quinolyl, quinolyl, 1H-2-benzopyranyl, 2H-1-benzopyranyl, 1H-2-benzothiopyranyl or 2H-1-benzothiopyranyl.

  The word rac stands for racemic body.

  The acid addition salts of the compounds of the present invention are pharmaceutically acceptable salts formed with non-toxic acids. Examples of the organic salts include maleic acid, fumaric acid, benzoic acid, ascorbic acid, succinic acid, oxalic acid, bis-methylenesalicylic acid, methanesulfonic acid, ethanedisulfonic acid, acetic acid, propionic acid, tartaric acid, salicylic acid, citric acid , Gluconic acid, lactic acid, malic acid, mandelic acid, cinnamic acid, citraconic acid, aspartic acid, stearic acid, palmitic acid, itaconic acid, glycolic acid, p-aminobenzoic acid, glutamic acid, benzenesulfonic acid and theophylline acetic acid, and 8 -Salts using halotheophylline, such as 8-bromotheophylline. Examples of the inorganic salt include salts using hydrochloric acid, hydrobromic acid, sulfuric acid, sulfamic acid, phosphoric acid and nitric acid.

  The pharmaceutical composition of the present invention or the pharmaceutical composition produced in accordance with the present invention is administered orally in a suitable route, for example in the form of tablets, capsules, powders, syrups, etc. or parenterally in the form of an injectable solution. can do. To prepare the formulation, methods known in the art can be used and pharmaceutically acceptable carriers, diluents, excipients or other commonly used in the art. Additives can be used.

  Conveniently, the compound of the invention is administered in a unit dosage form containing the compound in an amount of about 0.01-100 mg.

  The total daily dose is generally about 0.05 to 500 mg, most preferably about 0.1 to 50 mg of the active compound of the invention per day.

The compounds of the present invention are prepared by the following general method:
For compounds of formula II in which R ¹ and R ² are defined as above, activated carboxylic acid R ³ —COOH or carboxylic acid chloride R ³ —COCl or anhydrous R ³ wherein R ³ is as defined above Coupling with -CO-O-CO-R ³ .

II
Coupling of a compound of formula II with a carboxylic acid R ³ —COOH is carried out by standard methods known to those skilled in the art, for example at a temperature of 20-80 ° C. in the presence of a carbodiimide coupling agent. Carboxylic acid chloride R ³ —COCl or anhydride, carried out in a suitable polar or nonpolar solvent, for example 1-methyl-2-pyrrolidinone or 1,2-dichloroethane, or starting material of formula II Coupling with R ³ —CO—O—CO—R ³ is carried out in a suitable solvent, for example 1,2-dichloroethane, in the presence of a suitable base, for example pyridine, at a temperature of 20-60 ° C. .

  Compounds of formula II are prepared according to methods known to those skilled in the art or as illustrated in Scheme A.

Compounds of formula III can be prepared by literature methods (Aicart et al., J. Heterocycl. Chem., 1985, 22, 921-925; Chakrasali et al., Synthesis, 1988, EN; 6, 453-455) or It can be produced by methods known to those skilled in the art. The furan analog 3- (2-phenyl- [1,3] dithian-2-ylmethyl) -furan can be synthesized, for example, by a suitable metallation reagent such as n-butyllithium (Lipshutz et al. Tett Lett., 1990, 31, 7261) using 2-phenyl- [1,3] dithiane (Kamal et al. Tetrahedron Lett. 2002, 43, 1347) metallation followed by 3-bromomethyl-furan (Mateos et al. J. Org. Chem., 1995, 60 3580). For example, deprotection with N-bromosuccinimide or HgO / HgCl ₂ gives 3- (2-phenyl- [1,3] dithian-2-ylmethyl) -furan. When R ² is 1-alkyltetrazole or 2-alkyltetrazole, III can be synthesized by methods known to those skilled in the art. Starting from 3-oxo-3-phenyl-propionitrile, the nitrile can be converted to tetrazole by standard methods. Here, azide as sodium azide and triethylammonium chloride in a suitable solvent, for example toluene or DMF, at a temperature of 80-120 ° C. are included. Alkylation of tetrazole with an alkylating reagent, such as ethyl bromide, in the presence of a base such as potassium carbonate and a solvent such as acetone at a temperature of 20-80 ° C. yields 2- (1-alkyl-2H A mixture of -tetrazol-5-yl) -1-phenyl-ethanone and 2- (2-alkyl-2H-tetrazol-5-yl) -1-phenyl-ethanone is obtained. These two compounds can be separated by chromatographic methods.

The α-halogenation of the carbonyl group was performed by reacting the compound of formula III with SO ₂ Cl ₂ , Br ₂ or I ₂ in a suitable solvent such as 1,2-dichloroethane, diethyl ether or chloroform. The halogenated product (IV) was then cyclized to the aminothiazole of formula II by reaction with thiourea in a solvent such as ethanol at a suitable temperature, for example 20-100 ° C.

Compounds of formula IIa can be prepared from compounds of formula V (Scheme B). Compounds of formula V can be prepared by literature methods (similar to those prepared by “Benjamin. Et al., J. Med. Chem., 1983, 26, 100-103”) or by 3-oxo-3 Starting from -phenyl-propionitrile, it can subsequently be prepared by methods known to those skilled in the art according to the methods described above in which the amine is protected by a suitable protecting group. 2-Amino-4-phenyl-thiazole-5-carbonitrile is hydroxylated in a suitable solvent such as ethanol / water at a temperature of 50-100 ° C. in the presence of a suitable base such as potassium carbonate or sodium carbonate. Amide oxime (VI) can be obtained by reacting with amine hydrochloride. Thereafter, for example, by acylation of the amide oxime with acid chloride or anhydride, or reaction with trimethylorthoformate or triethylorthoformate in the presence of a Lewis acid, for example BF ₃ -Et ₂ O, and Subsequent dehydration can produce 1,2,4-oxadiazole (VII). Removal of the protecting group gives IIa. Alternatively, acylation of an amide oxime (eg, with an acid chloride or anhydride, or in the presence of a Lewis acid, eg, BF ₃ -Et ₂ O, without the use of a protecting group, trimethyl orthoformate or triethyl ortho Compound VII, in which PG is an acyl group from an acid chloride or anhydride, is used by reaction with formate and subsequent dehydration). Removal of the protecting group gives IIa.

  Compounds of formula IIb can be prepared from compounds of formula VIII (Scheme C). Compounds of formula VIII can be prepared according to literature methods (similar to those prepared by “Choudhari et al. J. Indian. Chem. Soc., 1978, 55, 401”) or by the methods described above, where R2 is It can be prepared from a compound of formula II which is a carboxylic acid ester. Protection of the amine with a suitable protecting group (PG) such as boc (t-butoxycarbonyl) results in compound IX. The ester is then [1,2, by methods known to those skilled in the art such as reaction with an amide oxime in the presence of a suitable base such as sodium hydride or pyridine at a temperature of 25-100 ° C. It can be converted to 4] -oxadiazole. Removal of the protecting group gives IIb.

  Compounds of formula IIc can be prepared from compounds of formula VIII (Scheme D). The ester group of the compound of formula VIII may be converted to a hydrazide group by methods known to those skilled in the art, for example by reaction with hydrazine in a suitable solvent such as methanol at a suitable temperature of 25-65 ° C. Can give the compound of formula XI. Thereafter, an oxadiazolone ring can be formed by methods known to those skilled in the art. This includes reaction of the hydrazide of formula XI with carbonyldiimidazole or carbonyl dichloride in a solvent such as tetrahydrofuran in the presence of a suitable base such as triethylamine at a temperature of 25-50 ° C.

  Analytical LC-MS data was obtained on a PE Sciex API 150EX instrument equipped with an ion spray source and a Shimadzu LC-8A / SLC-10A LC system. Column: 30 x 4.6 mm Waters Symmetry C18 column with a particle size of 3.5 μm; solvent system: A = water / trifluoroacetic acid (100: 0.05) and B = water / acetonitrile / trifluoroacetic acid (5: 95: 0.03); method : Elution with a linear gradient from 90% A to 100% B in 4 minutes and a flow rate of 2 mL / min.

  LC-MS-Preparative LC-MS-purification was performed on the same apparatus. Column: 10 x 50 mm Waters Symmetry C18 with 5 μm particle size; Method: Elution with a linear gradient from 30% A to 100% B in 7 minutes and a flow rate of 5.7 mL / min. The fraction was collected by split-flow MS detection.

  Purity was determined by integration of UV (254 nm) and ELSD trace. Retention time (RT) is expressed in minutes.

¹ H NMR spectra were recorded at 500.13 MHz using a Bruker Avance DRX500 instrument, 250.13 MHz using a Bruker AC 250 instrument, or 400 MHz using a Bruker instrument. Deuterium-substituted chloroform (99.8% D) or dimethyl sulfoxide (99.8% D) was used as a solvent. TMS was used as an internal reference standard. Chemical shifts are expressed in ppm. The following abbreviations: s = singlet, d = doublet, t = triplet, q = quartet, qui = quintet, h = heptet, dd = double doublet, dt = double triplet, dq = double quartet, tt = triplet triplet, m = Multiplet, br s = broad singlet and br = broad signal were used for the multiplicity of NMR signals.

For Kieselgel 60 type column chromatography silica gel, 40-60 mesh ASTM (or Al ₂ O ₃ (active, manufacturer: Qualigens India Ltd)) was used. Microwave heating experiments were performed with an Emrys synthesizer from Personal Chemistry or an Emrys optimizer from Personal Chemistry.

<Production of intermediate>
1-phenyl-2- (2H-tetrazol-5-yl) -ethanone (intermediate for 5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-ylamine):

  3-Oxo-3-phenyl-propionitrile (6.5 g, 45 mmol), sodium azide (3.3 g, 50 mmol) and triethylammonium chloride (6.7 g, 50 mmol) were added to argon in dry toluene (100 mL). Under stirring at 90 ° C. for 18 hours. A two-phase system formed. The reaction mixture was cooled and extracted with NaOH (2M, 2x50 mL). The aqueous solution was poured into hydrochloric acid (4M, 200 mL) to precipitate the crude product, filtered and recrystallized from acetonitrile. Yield: 74%.

2- (1H-tetrazol-5-yl) -1-thiophen-2-yl-ethanone:
A mixture of 2-thenoylacetonitrile (9 g, 59.3 mmol), sodium azide (4.33 g, 66.7 mmol) and triethylammonium chloride (9.14 g, 66.9 mmol) was placed in dry toluene (139 mL) at 90 ° C. under an argon atmosphere. For 18 hours. A two-phase system was formed, cooled, extracted with NaOH (2M, 3x50 mL), the aqueous solution was added to hydrochloric acid (4M, 200 mL), the crude tetrazole was filtered and recrystallized from acetonitrile . Yield: 43.5%.

5- (2-Ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-ylamine:
1-Phenyl-2- (2H-tetrazol-5-yl) -ethanone (3.3 g, 17.5 mmol), ethyl iodide (1.4 g, 17.5 mmol) and potassium carbonate (2.4 g, 17.5 mmol) were added under argon. The mixture was heated to reflux in acetone (50 mL) for 5 hours. The reaction mixture was then added to water, acidified with 6M HCl and extracted with diethyl ether. The organic extract was dried and evaporated to give a red / orange oil. The oil was dissolved in diethyl ether (100 mL) and bromine (17.5 mmol) was added. The mixture was stirred overnight at ambient temperature, after which the solvent was removed under reduced pressure and the residue was redissolved in ethanol (100 mL). Thiourea (35 mmol) was added and the resulting mixture was heated to reflux for 10 minutes, after which a solid precipitated. The reaction mixture was added to water containing NaOH (17.5 mmol) and the orange crude product was collected by filtration. The crude product was recrystallized from acetonitrile to give a pale yellow solid. Yield: 0.6 g, 17%.
¹ H NMR (d ₆ -DMSO) (250 MHz): δ7.65-7.61 (m, 2H), 7.54 (s br, 2H, NH2), 7.38-7.32 (m, 3H), 4.63 (q, 2H), 1.48 (t, 3H).

The following compounds were prepared similarly:
5- (2-Phenethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-ylamine:
¹ H NMR (d ₆ -DMSO): δ7.6-7.5 (m, 4H); 7.35-7.3 (m, 3H); 7.25 (t, 2H); 7.16 (m, 1H); 7.1 (d, 2H) 4.90 (t, 2H); 3.22 (t, 2H).

5- (2-Methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-ylamine:
¹ H NMR (d ₆ -DMSO) (400 Mhz): δ 7.62 (m, 2H); 7.54 (s, 2H); 7.36-7.33 (m, 3H); 4.29 (s, 3H).

4-Phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-ylamine
¹ H NMR (CDCl ₃ ) (400Mhz): δ 7.70 (m, 2H); 7.40 (m, 3H); 6.20-5.80 (br, 2H) 4.51 (t, 2H); 2.01 (m, 2H); 0.96 (t, 3H).

5- (2-Butyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-ylamine
¹ H NMR (CDCl ₃ ) (400Mhz): δ 7.70 (m, 2H); 7.40 (m, 3H); 6.20-5.80 (br, 2H) 4.55 (t, 2H); 1.99-1.91 (m, 2H) 1.40-1.31 (m, 2H); 0.96 (t, 3H).

5- (2-Isobutyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-ylamine
¹ H NMR (MeOD) (400 Mhz): δ 7.57 (m, 2H); 7.36 (m, 3H); 4.41 (d, 2H); 2.26 (m, 1H); 0.93 (d, 6H).

5- (2-Cyclopropylmethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-ylamine
¹ H NMR (MeOD) (400Mhz): δ7.61 (m, 2H); 7.37 (m, 3H); 4.45 (d, 2H); 1.37 (m, 1H); 0.67-0.62 (m, 2H); 0.48 -0.44 (m, 2H).

5- (2-Methyl-2H-tetrazol-5-yl) -4-thiophen-2-yl-thiazol-2-ylamine:
Prepared from 2- (1H-tetrazol-5-yl) -1-thiophen-2-yl-ethanone and MeI and thiourea.
¹ H NMR (d ₆ -DMSO) (400 Mhz): δ 8.29 (d, 1H); 7.64 (s, 2H); 7.57 (d, 1H); 7.12 (t, 1H); 4.41 (s, 3H).

2- (1-Methyl-1H-tetrazol-5-yl) -1-phenyl-ethanone:
1-Phenyl-2- (2H-tetrazol-5-yl) -ethanone (13.24 g, 70.4 mmol) was dissolved in acetone (300 mL). MeI (4.6 mL, 73.9 mmol) and KCO ₃ (10.68 g, 77.4 mmol) were added and the reaction mixture was heated to reflux for 30 minutes. The reaction mixture was filtered and the solvent was removed under reduced pressure. The crude product is a mixture of 2- (1-methyl-1H-tetrazol-5-yl) -1-phenyl-ethanone and 2- (2-methyl-2H-tetrazol-5-yl) -1-phenyl-ethanone Is included. The two compounds were separated by flash column chromatography using ethyl acetate / hexane (6/4) as eluent. 2- (1-Methyl-1H-tetrazol-5-yl) -1-phenyl-ethanone was obtained as a white solid. Yield: 34%.
¹ H NMR (d ₆ -DMSO) (500 MHz): δ 8.09 (d, 2H), 7.73 (t, 1H), 7.60 (t, 2H), 5.05 (s, 2H), 4.00 (s, 3H).

5- (1-Methyl-1H-tetrazol-5-yl) -4-phenyl-thiazol-2-ylamine:
2- (1-Methyl-1H-tetrazol-5-yl) -1-phenyl-ethanone (4.9 g, 24.2 mmol) was dissolved in 1,2-dichloroethane (150 mL) and ether (100 mL). Bromine (Brom: 1.24 mL, 24.2 mmol) was added. The reaction mixture was stirred at room temperature for 1 hour and the solvent was removed under reduced pressure. The residue was dissolved in ethanol (250 mL). Thiourea (3.67 g, 48.5 mmol) was added and the reaction mixture was heated to reflux for 20 minutes. The reaction mixture was added to water / ice. Concentrated NaOH (aq) was added until pH = 10. The mixture was filtered and the solid product was recrystallized from ethyl acetate / hexane. Yield: 58%.
¹ H NMR (d ₆ -DMSO) (500 MHz): δ7.7 (s, 2H), 7.35 (m, 3H), 7.25 (m, 2H), 3.5 (s, 3H).

2-furan-2-yl-1-phenyl-ethanone (intermediate for 5-furan-2-yl-4-phenyl-thiazol-2-ylamine):
2-furan-2-yl-3-oxo-3-phenyl-propionic acid ethyl ester prepared as described in “Dorsch JB and McElvain SM, J. Am. Chem. Soc 1932, 54, 2960-2963” (10.0 g, 39 mmol) was dissolved in N-methylpyrrolidin-2-one (13 mL) and acetic acid (3.9 mL), and lithium chloride (4.7 g, 110 mmol) was added. The reaction mixture was heated to reflux for 7 hours, after which saturated aqueous NaHCO ₃ was added and the mixture was extracted with diethyl ether. The organic extract was dried over sodium sulfate, filtered, concentrated under reduced pressure and purified by flash column chromatography using 1% ethyl acetate in hexane as eluent. Yield: 6.2 g, 85%.
¹ H NMR (CDCl ₃ ) (400Mhz): δ 8.00 (m, 2H); 7.56 (m, 1H); 7.46 (m, 2H); 7.36 (m, 1H); 6.33 (q, 1H); 6.23 (q , 1H); 4.31 (s, 2H).

N- (5-furan-2-yl-4-phenyl-thiazol-2-yl) -formamide (intermediate of 5-furan-2-yl-4-phenyl-thiazol-2-ylamine):
2-furan-2-yl-1-phenyl-ethanone (14.0 g, 75 mmol) and thiourea (11.5 g, 150 mmol) were dissolved in DMF (30 mL) and iodine (19.1 g, 75 mmol) was added. . The reaction mixture was heated at 100 ° C. overnight, then diluted with water, made alkaline with saturated aqueous NH ₄ OH and extracted with ether. The organic phase was washed with water, dried over sodium sulfate, filtered, concentrated and purified by flash column chromatography using 1% ethyl acetate in hexane as the eluent. Yield: 9.2 g, 45%.
¹ H NMR (CDCl ₃ ) (400 MHz): δ 7.57 (m, 2H); 7.50 (m, 3H); 7.44 (s, 1H); 7.38 (m, 1H); 6.28 (m, 1H); 6.20 (s , 1H).

5-furan-2-yl-4-phenyl-thiazol-2-ylamine:
N- (5-furan-2-yl-4-phenyl-thiazol-2-yl) -formamide (3.9 g, 14.5 mmol) was dissolved in a mixture of methanol (45 mL) and THF (62 mL) and HCl ( (Concentrated) (6 mL) was added dropwise. The reaction mixture was stirred overnight and the solvent was evaporated. The residue was extracted with ethyl acetate, washed with NaHCO ₃ (saturated aqueous solution), then washed with water, dried over sodium sulfate and concentrated under reduced pressure. The crude product was purified in a neutral Al ₂ O ₃ using 30-35% ethyl acetate in hexane as eluant. Yield: 2.6 g, 76%.
¹ H NMR (CDCl ₃ ) (400 MHz): δ 7.54 (m, 2H); 7.33 (m, 4H); 6.32 (q, 1H); 6.17 (q, 1H); 5.45 (br s, 2H).

2-Phenyl- [1,3] dithiane (intermediate of 5-furan-3-yl-4-phenyl-thiazol-2-ylamine):
To a solution of benzaldehyde (15.0 g, 141 mmol) in chloroform (150 mL), propane-1,3-dithiol (16.9 g, 155 mmol) and boron trifluoride etherate (26.1 g, 183 mmol) Was added. The reaction mixture was stirred at room temperature for 24 hours, then placed in ice-cooled sodium hydroxide solution (10%) and extracted with chloroform. The combined chloroform extracts were washed with water, dried over sodium sulfate, concentrated and purified by flash column chromatography using 1% ethyl acetate in hexane as the eluent. Yield: 21.2 g, 77%.
¹ H NMR (CDCl ₃ ) (400MHz): δ7.46 (m, 2H); 7.30 (m, 3H); 5.16 (s, 1H); 3.06 (m, 2H); 2.90 (m, 2H); 2.17 ( m, 1H); 1.93 (m, 1H).

3- (2-Phenyl- [1,3] dithian-2-ylmethyl) -furan (intermediate of 5-furan-3-yl-4-phenyl-thiazol-2-ylamine):
To a stirring suspension of sodium tert-butoxide (5.16 g, 54 mmol) in dry hexane (120 mL) was added n-butyllithium (34 mL, 51 mmol) at 0 ° C. and 1 hour at 0 ° C. Stir then stirred at room temperature for 1 hour. The mixture was cooled to -78 ° C and 2-phenyl- [1,3] dithiane (10.0 g, 51 mmol) and n-butyllithium (34 mL) dissolved in dry THF (120 mL) at -78 ° C. , 51 mmol) of the preformed mixture and left for 15 minutes. A dark brown solution was observed. After stirring at -78 ° C. for 1 hour, 3-bromomethyl-furan (Danso-Danquah RE and Scott AI Tetrahedron, 1993, 49, 8195-8210; New DG et al, J. Org. Chem., 1996, 61, 1578 -1598) (10.7 g, 66 mmol) was added via cannula. After 30 minutes, the reaction mixture was quenched with water and allowed to warm to ambient temperature. The reaction mixture was extracted with diethyl ether and the organic extract was dried over sodium sulfate and concentrated. The crude product was purified by flash column chromatography using 0.2-0.5% ethyl acetate in hexane as the eluent. Yield: 5.6 g, 32%.
¹ H NMR (CDCl ₃ ) (400 MHz): δ 7.79 (m, 2H); 7.33 (m, 2H); 7.26 (m, 1H); 7.17 (m, 1H); 6.92 (m, 1H); 5.73 ( s, 1H); 3.11 (s, 2H); 2.68 (m, 4H); 1.93 (m, 2H).

2-furan-3-yl-1-phenyl-ethanone (intermediate of 5-furan-3-yl-4-phenyl-thiazol-2-ylamine):
3- (2-Phenyl- [1,3] dithian-2-ylmethyl) -furan (11.5 g, 41 mmol) was suspended in 9: 1 methanol / water (v / v) (150 mL) with slight heating. It became cloudy. A solution of HgCl ₂ (22.3 g, 82 mmol) in methanol / water (50 mL) and solid HgO (8.0 g, 36.9 mmol) were added and the mixture was heated to reflux under a nitrogen atmosphere for 6-7 hours. The reaction mixture was filtered through celite to remove solids and then concentrated. The resulting aqueous mixture was extracted with ethyl acetate and the combined organic extracts were washed with water, dried over sodium sulfate and evaporated. The crude product was purified by flash column chromatography using 2% ethyl acetate in hexane as the eluent. Yield: 5.7 g, 75%.
¹ H NMR (CDCl ₃ ) (400MHz): δ8.00 (m, 2H); 7.57 (s, 1H); 7.47 (m, 2H); 7.39 (m, 2H); 6.36 (s, 1H); 4.11 ( s, 2H).

N- (5-furan-3-yl-4-phenyl-thiazol-2-yl) -formamide (intermediate of 5-furan-3-yl-4-phenyl-thiazol-2-ylamine):
To a solution of 2-furan-3-yl-1-phenyl-ethanone (5.7 g, 31 mmol) and thiourea (4.7 g, 61 mmol) in DMF (57 mL) was added iodine (7.8 g, 31 mmol). The reaction mixture was heated at 100 ° C. overnight, then diluted with water, made alkaline with saturated aqueous NH ₄ OH and extracted with ether. The organic phase was washed with water, dried over sodium sulfate, concentrated and purified on neutral Al ₂ O ₃ using 50% ethyl acetate in hexane as eluent. Yield: 5.7 g, 69%.
GC-MS (M ⁺ ) 270.

5-furan-3-yl-4-phenyl-thiazol-2-ylamine:
N- (5-furan-3-yl-4-phenyl-thiazol-2-yl) -formamide (5.7 g, 21 mmol) was dissolved in a mixture of methanol (210 mL) and THF (90 mL) and concentrated hydrochloric acid. Aqueous solution (8.7 mL) was added dropwise at room temperature. The reaction mixture was stirred overnight and the solvent was removed by evaporation. The residue was extracted with ethyl acetate, washed with NaHCO ₃ (aq; saturated) and water and dried over sodium sulfate. The solvent was removed and the crude product was purified on neutral Al ₂ O ₃ using 30-35% ethyl acetate in hexane as eluent. Yield: 2.5 g, 49%.
¹ H NMR (CDCl ₃ ) (400 MHz): δ 7.53 (m, 2H); 7.38 (q, 1H); 7.31 (m, 4H); 6.19 (m, 1H); 5.26 (br s, 2H).

3-oxo-3-phenylpropionitrile (intermediate of 5- [1,2,4] oxadiazol-3-yl-4-phenyl-thiazol-2-ylamine):
Ethyl benzoate (20 g, 133 mmol) and NaOMe in methanol (133 mmol, from 3 g Na) were mixed and heated at 80 ° C. with stirring until a homogeneous gel mass formed. Thereafter, acetonitrile (6.8 g, 165 mmol) was slowly added under the surface of the mass over 30 minutes. The temperature was raised to 120 ° C. and heated to reflux for 24 hours, after which the reaction mixture was cooled on an ice bath and treated with water and diethyl ether until the solid material dissolved. The aqueous layer was separated, acidified with 5% H ₂ SO ₄ , washed with NaHCO ₃ (aq; saturated), dried over sodium sulfate, and concentrated. The crude product was used in the next reaction without further purification. Yield: 7.3 g, 37.8%.
¹ H NMR (CDCl ₃ ) (400 MHz): δ 7.91 (m, 2H); 7.66 (m, 1H); 7.51 (m, 2H); 4.08 (s, 2H).

2-Bromo-3-oxo-3-phenylpropionitrile (intermediate of 5- [1,2,4] oxadiazol-3-yl-4-phenyl-thiazol-2-ylamine):
3-Oxo-3-phenylpropionitrile (1.5 g, 10 mmol) was dissolved in dry chloroform (10 mL) at 0 ° C., and pyridine (0.81 mL, 10 mmol) was added. Bromine (4.7 mL, 10 mmol) dissolved in chloroform (4.7 mL) was added dropwise over 1 hour, after which the reaction mixture was heated at 45 ° C. overnight. The reaction mixture was diluted with chloroform and washed with water. The organic phase was dried over sodium sulfate and evaporated to give the crude product. This was used in the next reaction without further purification.

2-Amino-4-phenyl-thiazole-5-carbonitrile (intermediate of 5- [1,2,4] oxadiazol-3-yl-4-phenyl-thiazol-2-ylamine):
2-Bromo-3-oxo-3-phenylpropionitrile (0.5 g, 3.4 mmol) is mixed with thiourea (0.52 g, 6.8 mmol) and iodine (0.43 g, 3.4 mmol) and the mixture is placed in a steam bath with 12 Heated for hours. Then, it was diluted with water, made alkaline with saturated NH ₄ OH aqueous solution, and extracted with ethyl acetate. The organic phase was washed with water and brine, dried over sodium sulfate and evaporated to dryness to give the crude product. This was used in the next reaction without further purification. Yield: 0.2 g, 29%.
¹ H NMR (d ₆ -DMSO) (400 MHz): δ -8.26 (s, 2H); 7.91 (m, 2H); 7.50 (m, 3H).

2-Amino-N-hydroxy-4-phenyl-thiazole-5-carboxamidine (intermediate of 5- [1,2,4] oxadiazol-3-yl-4-phenyl-thiazol-2-ylamine):
2-Amino-4-phenyl-thiazole-5-carbonitrile (0.13 g, 0.6 mmol) was suspended in 1: 1 water / ethanol (v / v) (24 mL) and hydroxyamine hydrochloride (1.47 g, 21 mmol) and potassium carbonate (1.86 g, 13 mmol) were added. The reaction mixture was heated to reflux for 3 days, after which the solvent was reduced and the aqueous phase was extracted with dichloromethane. The organic layer was washed with water and brine and dried over sodium sulfate. A yellow solid was obtained by evaporating the solvent. Yield: 0.1 g, 66%.
¹ H NMR (D ₆ -DMSO) (400 MHz): δ-9.52 (s, 1H); 7.64 (m, 2H); 7.31 (m, 3H); 7.14 (s, 2H); 5.50 (s, 2H).

5- [1,2,4] oxadiazol-3-yl-4-phenyl-thiazol-2-ylamine:
Ortogi containing 2-amino-N-hydroxy-4-phenyl-thiazole-5-carboxamidine (1.0 g, 4.3 mmol) in methanol (20 mL) containing boron trifluoride ether complex (0.2 mL, 1.6 mmol) Trimethyl acid (1.2 mL, 11 mmol) was added and the mixture was heated to reflux for 3 hours. The reaction mixture was cooled and the solvent was removed at 20 ° C. under reduced pressure. The residue was extracted with ethyl acetate and the solution was washed with saturated aqueous NaHCO ₃ solution, dried over sodium sulfate and evaporated. The crude product was purified by flash column chromatography eluting with a gradient of 10-18% ethyl acetate in hexanes to give the product (the product was eluted with 18% ethyl acetate in hexanes). Yield: 0.1 g, 10%.
¹ H NMR (d ₆ -DMSO) (400 MHz): δ 9.47 (s, 1H); 7.72 (s, 2H); 7.63 (m, 2H); 7.38 (m, 3H).

N- [5- (5-Ethyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -propionamide:
2-Amino-N-hydroxy-4-phenyl-thiazole-5-carboxamidine (1.5 g, 6.4 mmol) was dissolved in dry THF (50 mL). Ethyl-diisopropyl-amine (2.5 mL) and propionyl chloride (2.8 mL, 5 eq) were added. The reaction mixture was stirred at room temperature overnight. The pH was adjusted to less than 2 by addition of HCl in ethanol. The reaction mixture was stirred at room temperature overnight. The solvent was evaporated to give a yellow oil. The crude product was purified by flash column chromatography eluting with 30% ethyl acetate in hexanes to give the product as a white solid. Yield: 49%.

The following compounds were prepared similarly:
N- [5- (5-Methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -acetamide
Prepared from 2-amino-N-hydroxy-4-phenyl-thiazole-5-carboxamidine acetyl chloride.
¹ H NMR (CDCl ₃ ) (500 MHz): δ 11.55 (s, 1H); 7.75 (m, 2H); 7.43 (m, 3H); 2.59 (s, 3H); 1.5 (s, 3H).

5- (5-Ethyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-ylamine:
N- [5- (5-Ethyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -propionamide (1.02 g, 3.1 mmol) was added to MeOH (40 Concentrated HCl (aq) was added and the reaction mixture was heated to reflux for 2 h. Saturated aqueous NaHCO ₃ solution (100 mL) was added to the reaction mixture. The aqueous phase was extracted with ethyl acetate (2 x 75 mL). The organic phase was dried over MgSO ₄ and the solvent was evaporated to give a white solid. Yield: 91%.

The following compounds were prepared similarly:
5- (5-Methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-ylamine
Prepared from N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -acetamide.
¹ H NMR (CDCl ₃ ) (500 MHz): δ 7.7 (m, 2H); 7.4 (m, 3H); 5.3 (s, 2H); 2.55 (s, 3H).

2-tert-Butoxycarbonylamino-4-phenyl-thiazole-5-carboxylic acid ethyl ester
2-Amino-4-phenyl-thiazole-5-carboxylic acid ethyl ester (2 g, 8.1 mmol) was dissolved in THF (50 mL). Triethylamine (25 mL), dimethyl-pyridin-4-yl-amine (0.1 g, 0.8 mmol), and ditert-butyl-dicarbonate (2 g, 9.2 mmol) were added. The reaction mixture was stirred overnight. The reaction mixture was filtered and the solvent was removed under reduced pressure. The crude product was purified by flash column chromatography eluting with a gradient of 0-10% ethyl acetate to give the product as a white solid. Yield: 53%.

N-hydroxy-propionamidine
Hydroxyl ammonium chloride (69.5 ml, 1 mol) was dissolved in ethanol. NaOH (28% aqueous solution, 110 mL) and propionitrile (71 mL, 1 mol) were added. The reaction mixture was stirred at 40 ° C. for 48 hours. The reaction mixture was filtered. The solvent was removed from the filtrate by evaporation under reduced pressure. The crude product was purified by flash column chromatography eluting with a gradient of ethyl acetate / ethanol (9/1) to give the product. Yield: 52%.

The following compounds were prepared similarly:
N-hydroxy-acetamidine Prepared from acetonitrile.

[5- (3-Methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -carbamic acid tert-butyl ester:
2-Tert-butoxycarbonylamino-4-phenyl-thiazole-5-carboxylic acid ethyl ester (1.9 g 5.6 mmol) was dissolved in dry THF (60 mL). Sodium hydride (60% in oil) and N-hydroxy-acetamidine (0.83 g, 11.2 mmol) dissolved in THF (30 mL) were added. The reaction mixture was heated to reflux overnight. The reaction mixture was cooled and ethyl acetate (75 mL), glacial acetic acid (0.43 g) were added. The organic mixture was washed with brine (75 mL). The aqueous phase was extracted with ethyl acetate. The combined organic phases were washed with brine (50 mL), dried over MgSO ₄ and the solvent removed under reduced pressure to give a solid. Yield: 36%.
¹ H NMR (CDCl ₃ ) (500 MHz): δ 8.55 (br, 1H); 7.72 (m, 2H); 7.43 (m, 3H); 2.4 (s, 3H); 1.5 (s, 9H).

The following compounds were prepared similarly:
[5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -carbamic acid tert-butyl ester:
Prepared from 2-tert-butoxycarbonylamino-4-phenyl-thiazole-5-carboxylic acid ethyl ester and N-hydroxy-propionamidine.

5- (3-Methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine:
[5- (3-Methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -carbamic acid tert-butyl ester suspended in glacial acetic acid (20 mL) It became cloudy. TFA (20 mL) was added. The reaction mixture was stirred at room temperature overnight. To the reaction mixture was added brine (100 mL) and the pH was adjusted to a pH of less than 10 with ammonia. The mixture was extracted with EtOAc (2 x 75 mL). The combined organic phases were washed with brine (50 mL), dried over MgSO ₄ and the solvent removed under reduced pressure to give a white solid. Yield: 98%.
¹ H NMR (d ₆ -DMSO) (500 MHz): δ 8.03 (br, 2H); 7.64 (m, 2H); 7.43 (m, 3H); 2.25 (s, 3H).

The following compounds were prepared similarly:
5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine:
Prepared from [5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -carbamic acid tert-butyl ester.
¹ H NMR (d ₆ -DMSO) (500 MHz): δ 8.03 (br, 2H); 7.64 (m, 2H); 7.43 (m, 3H); 2.67 (q, 2H); 1.18 (t, 3H).

2-Amino-4-phenyl-thiazole-5-carboxylic acid hydrazide:
2-Amino-4-phenyl-thiazole-5-carboxylic acid ethyl ester (5.0 g, 20 mmol) was suspended in methanol. Hydrazine monohydrate (5 mL, 100 mmol) was added and heated to reflux for 2 hours. Hydrazine monohydrate (10 mL) was added and heated to reflux for 48 hours. Water (100 mL) was added to the reaction mixture and methanol was removed by evaporation under reduced pressure. The product precipitate and solid product were collected by filtration. Yield: 70%.
¹ H NMR (d ₆ -DMSO) (500 MHz): δ8.9 (s, 1H); 7.6 (m, 2H); 7.3 (m, 5H); 4.35 (s, 2H).

5- (2-Amino-4-phenyl-thiazol-5-yl) -3H- [1,3,4] oxadiazol-2-one:
2-Amino-4-phenyl-thiazole-5-carboxylic acid hydrazide (1 g, 4.3 mmol) was suspended in tetrahydrofuran (50 mL). Triethylamine (5 mL, 40 mmol) and carbonyldiimidazole (0.83, 5.1 mmol) were added. The reaction mixture was stirred at room temperature for 1 hour. The solvent was removed under reduced pressure. The crude product was purified by flash column chromatography eluting with ethyl acetate / hexane (1/1) to give the product as a solid. Yield: 20%.

(3,4-Dimethoxy-phenyl) -acetyl chloride:
(3,4-Dimethoxy-phenyl) -acetic acid was dissolved in 1,2-dichloroethane (7 mL) and DMF (0.07 nL). Oxalyl chloride was added dropwise and the reaction mixture was stirred at room temperature under argon for 1 hour. The solvent was removed under reduced pressure. The crude product was used without further purification.

<Production of the compound of the present invention>
1: 2- (3,4-Dimethoxy-phenyl) -N- [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide
200 μL of a 0.6 M stock solution of (3,4-dimethoxy-phenyl) -acetic acid was mixed with 200 μL of a 0.3 M stock solution of EDC containing 1 equivalent of ethyl-diisopropyl-amine. Thereafter, 100 μL of a 0.3 M stock solution of 5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-ylamine containing 1 equivalent of DMAP was added. The reaction mixture was shaken overnight at ambient temperature. Purification was performed by preparative LC-MS. Yield: 13%.
LC / MS (m / z) 452.0 (MH +); RT = 2.82; Purity (UV, ELSD): 97%; 100%.

The following compounds were prepared similarly:
2: 2- (3,4-Dimethoxy-phenyl) -N- (5- [1,2,4] oxadiazol-3-yl-4-phenyl-thiazol-2-yl) -acetamide
LC / MS (m / z) 422.9 (MH +); RT = 2.75; Purity (UV, ELSD): 98%; 99%.
3: N- (5-furan-3-yl-4-phenyl-thiazol-2-yl) -isobutyramide
LC / MS (m / z) 313.1 (MH +); RT = 3.15; Purity (UV, ELSD): 92%; 99%.
4: Cyclopropanecarboxylic acid [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide
LC / MS (m / z) 341.1 (MH +); RT = 2.70; Purity (UV, ELSD): 98%; 100%.
5: Furan-3-carboxylic acid [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide
LC / MS (m / z) 367.1 (MH +); RT = 2.89; Purity (UV, ELSD): 72%; 92%.
6: N- [5- (2-Ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -isobutyramide
LC / MS (m / z) 343.0 (MH +); RT = 2.81; Purity (UV, ELSD): 98%; 99%.
7: Furan-2-carboxylic acid [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide
LC / MS (m / z) 367.2 (MH +); RT = 2.79; Purity (UV, ELSD): 97%; 99%.
8: Cyclohexanecarboxylic acid [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide
LC / MS (m / z) 383.2 (MH +); RT = 3.31; Purity (UV, ELSD): 93%; 99%.
9: 2-Cyclopentyl-N- [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide
LC / MS (m / z) 383.2 (MH +); RT = 3.34; Purity (UV, ELSD): 99%; 100%.
10: N- [5- (2-Ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -propionamide
LC / MS (m / z) 329.1 (MH +); RT = 2.63; Purity (UV, ELSD): 99%; 100%.
11: Cyclopropanecarboxylic acid (5- [1,2,4] oxadiazol-3-yl-4-phenyl-thiazol-2-yl) -amide
LC / MS (m / z) 312.9 (MH +); RT = 2.55; Purity (UV, ELSD): 95%; 100%.
12: Thiophene-3-carboxylic acid [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide
LC / MS (m / z) 383.1 (MH +); RT = 3.03; Purity (UV, ELSD): 90%; 99%.
13: 2-Cyclopentyl-N- (5- [1,2,4] oxadiazol-3-yl-4-phenyl-thiazol-2-yl) -acetamide
LC / MS (m / z) 355.1 (MH +); RT = 3.18; Purity (UV, ELSD): 97%; 99%.
14: Furan-3-carboxylic acid [5- (2-phenethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide
LC / MS (m / z) 443.0 (MH +); RT = 3.38; Purity (UV, ELSD): 70%; 93%.
15: N- (5-furan-2-yl-4-phenyl-thiazol-2-yl) -isobutyramide
LC / MS (m / z) 313.1 (MH +); RT = 3.12; Purity (UV, ELSD): 98%; 97%.
16: Furan-2-carboxylic acid (5-furan-3-yl-4-phenyl-thiazol-2-yl) -amide
LC / MS (m / z) 337.0 (MH +); RT = 3.14; Purity (UV, ELSD): 96%; 99%.
17: 2- (3,4-Dimethoxy-phenyl) -N- (5-furan-2-yl-4-phenyl-thiazol-2-yl) -acetamide
LC / MS (m / z) 421.1 (MH +); RT = 3.02; Purity (UV, ELSD): 98%; 98%.
18: Cyclopropanecarboxylic acid (5-furan-3-yl-4-phenyl-thiazol-2-yl) -amide
Add 100 μL of a 0.3 M storage solution of 5-furan-3-yl-4-phenyl-thiazol-2-ylamine and 120 μL of a 0.3 M storage solution of pyridine to 0.3 M of cyclopropanecarbonyl chloride. Mixed with 120 μL of stock solution. The reaction mixture was shaken overnight at ambient temperature. Purification was performed by preparative LC-MS. Yield: 1.1 mg (12)%.
LC / MS (m / z) 311.1 (MH +); RT = 3.11; Purity (UV, ELSD): 80%; 97%.

The following compounds were prepared similarly:
19: 2- (3-Methoxy-phenyl) -N- (5- [1,2,4] oxadiazol-3-yl-4-phenyl-thiazol-2-yl) -acetamide
LC / MS (m / z) 393.1 (MH +); RT = 2.95; Purity (UV, ELSD): 96%; 100%.
20: 2- (3-Methoxy-phenyl) -N- [5- (2-phenethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide
LC / MS (m / z) 497.1 (MH +); RT = 3.58; Purity (UV, ELSD): 77%; 99%.
21: N- (5-furan-2-yl-4-phenyl-thiazol-2-yl) -2,2-dimethyl-propionamide
LC / MS (m / z) 327.2 (MH +); RT = 3.48; Purity (UV, ELSD): 77%; 99%.
22: N- (5-furan-3-yl-4-phenyl-thiazol-2-yl) -propionamide
LC / MS (m / z) 299.1 (MH +); RT = 2.95; Purity (UV, ELSD): 96%; 99%.
23: N- [5- (2-Phenethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -isobutyramide
LC / MS (m / z) 419.3 (MH +); RT = 3.33; Purity (UV, ELSD): 97%; 99%.
24: N- (5-furan-2-yl-4-phenyl-thiazol-2-yl) -propionamide
LC / MS (m / z) 299.1 (MH +); RT = 2.99; Purity (UV, ELSD): 99%; 99%.
25: Furan-2-carboxylic acid [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide
LC / MS (m / z) 353.1 (MH +); RT = 2.62; Purity (UV, ELSD): 96%; 99%.
26: 3,3-Dimethyl-N- [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -butyramide
LC / MS (m / z) 357.1 (MH +); RT = 3.06; Purity (UV, ELSD): 98%; 99%.
27: Cyclopropanecarboxylic acid [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide
LC / MS (m / z) 327.2 (MH +); RT = 2.49; Purity (UV, ELSD): 77%; 95%.
28: 2-Cyclopentyl-N- [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide
LC / MS (m / z) 369.1 (MH +); RT = 3.13; Purity (UV, ELSD): 94%; 99%.
29: N- [5- (2-Methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -isobutyramide
LC / MS (m / z) 329.1 (MH +); RT = 2.63; Purity (UV, ELSD): 96%; 99%.
30: 3-Methyl-N- [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -butyramide
LC / MS (m / z) 343.1 (MH +); RT = 2.86; Purity (UV, ELSD): 96%; 99%.
31: N- [5- (2-Methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -propionamide
LC / MS (m / z) 315.0 (MH +); RT = 2.40; Purity (UV, ELSD): 90%; 99%.
32: N- [5- (2-Methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -2-phenyl-acetamide
LC / MS (m / z) 377.1 (MH +); RT = 2.85; Purity (UV, ELSD): 90%; 99%.
33: Hexanoic acid [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide
LC / MS (m / z) 357.1 (MH +); RT = 3.13; Purity (UV, ELSD): 99%; 99%.
34: N- [5- (2-Methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -2-thiophen-2-yl-acetamide
LC / MS (m / z) 383.1 (MH +); RT = 2.83; Purity (UV, ELSD): 80%; 95%.
35: N- [5- (2-Methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide
LC / MS (m / z) 301.0 (MH +); RT = 2.13; Purity (UV, ELSD): 94%; 99%.
36: 2,2-Dimethyl-N- [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -propionamide
LC / MS (m / z) 343.1 (MH +); RT = 2.92; Purity (UV, ELSD): 95%; 99%.
37: Thiophene-3-carboxylic acid [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide
LC / MS (m / z) 369.1 (MH +); RT = 2.85; Purity (UV, ELSD): 85%; 99%.
38: N- [4-Phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -isobutyramide
LC / MS (m / z) 357.1 (MH +); RT = 3.08; Purity (UV, ELSD): 99%; 99%.
39: 3-Methyl-N- [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -butyramide
LC / MS (m / z) 371.2 (MH +); RT = 3.28; Purity (UV, ELSD): 97%; 99%.
40: N- [4-Phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -propionamide
LC / MS (m / z) 343.1 (MH +); RT = 2.87; Purity (UV, ELSD): 90%; 97%.
41: 2-Phenyl-N- [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -acetamide
LC / MS (m / z) 405.1 (MH +); RT = 3.29; Purity (UV, ELSD): 94%; 99%.
42: N- [4-Phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -2-thiophen-2-yl-acetamide
LC / MS (m / z) 411.1 (MH +); RT = 3.22; Purity (UV, ELSD): 88%; 97%.
43: N- [4-Phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -acetamide
LC / MS (m / z) 329.1 (MH +); RT = 2.65; Purity (UV, ELSD): 98%; 99%.
44: 2,2-Dimethyl-N- [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -propionamide
LC / MS (m / z) 371.2 (MH +); RT = 3.34; Purity (UV, ELSD): 95%; 99%.
45: Thiophene-3-carboxylic acid [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -amide
LC / MS (m / z) 397.1 (MH +); RT = 3.29; Purity (UV, ELSD): 93%; 99%.
46: N- [5- (2-Butyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -isobutyramide
LC / MS (m / z) 371.2 (MH +); RT = 3.31; Purity (UV, ELSD): 97%; 99%.
47: 2-Cyclopentyl-N- [5- (2-isobutyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide
LC / MS (m / z) 411.2 (MH +); RT = 3.73; Purity (UV, ELSD): 98%; 99%.
48: N- [5- (2-Isobutyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -2-thiophen-2-yl-acetamide
LC / MS (m / z) 425.1 (MH +); RT = 3.40; Purity (UV, ELSD): 84%; 95%.
49: N- [5- (2-Cyclopropylmethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -3-methyl-butyramide
LC / MS (m / z) 383.2 (MH +); RT = 3.32; Purity (UV, ELSD): 86%; 98%.
50: Furan-2-carboxylic acid [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide
Prepared from 5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and furan-2-carbonyl chloride.
LC / MS (m / z) 353.4 (MH +); RT = 2.84.
51: 3,3-Dimethyl-N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -butyramide
Prepared from 5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-ylamine and 3,3-dimethyl-butyryl chloride.
LC / MS (m / z) 357.4 (MH +); RT = 3.21.
52: N- [5- (3-Methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -benzamide
Prepared from 5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and benzoyl chloride.
LC / MS (m / z) 363.4 (MH +); RT = 3.22.
53: N- [5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -benzamide
Prepared from 5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and benzoyl chloride.
LC / MS (m / z) 377.4 (MH +); RT = 3.48.
54: N- [5- (5-Methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -benzamide
Prepared from 5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-ylamine and benzoyl chloride.
LC / MS (m / z) 363.4 (MH +); RT = 3.11.
55: Cyclopropanecarboxylic acid [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide
Prepared from 5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and cyclopropanecarbonyl chloride.
LC / MS (m / z) 327.4 (MH +); RT = 2.74.
56: Cyclopropanecarboxylic acid [5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide
Prepared from 5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and cyclopropanecarbonyl chloride.
LC / MS (m / z) 341.4 (MH +); RT = 3.05.
57: Cyclopropanecarboxylic acid [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -amide
Prepared from 5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-ylamine and cyclopropanecarbonyl chloride.
LC / MS (m / z) 327.4 (MH +); RT = 2.62.
58: Cyclopropanecarboxylic acid [5- (5-ethyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -amide
Prepared from 5-ethyl-3- (4-phenyl-thiazol-5-yl)-[1,2,4] oxadiazole and cyclopropanecarbonyl chloride.
LC / MS (m / z) 341.4 (MH +); RT = 2.96.
59: 2-Cyclopentyl-N- [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide
Prepared from 5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and cyclopentyl-acetyl chloride.
LC / MS (m / z) 369.5 (MH +); RT = 3.43.
60: 2-Cyclopentyl-N- [5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide
Prepared from 5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and cyclopentyl-acetyl chloride.
LC / MS (m / z) 383.5 (MH +); RT = 3.68.
61: 2-Cyclopentyl-N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -acetamide
Prepared from 5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-ylamine and cyclopentyl-acetyl chloride.
LC / MS (m / z) 369.5 (MH +); RT = 3.30.
62: 2-Cyclopentyl-N- [5- (5-ethyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -acetamide
Prepared from 5-ethyl-3- (4-phenyl-thiazol-5-yl)-[1,2,4] oxadiazole and cyclopentyl-acetyl chloride.
LC / MS (m / z) 383.5 (MH +); RT = 3.57.
63: Cyclohexanecarboxylic acid [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide
Prepared from 5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and cyclohexanecarbonyl chloride.
LC / MS (m / z) 369.5 (MH +); RT = 3.41.
64: Cyclohexanecarboxylic acid [5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide
Prepared from 5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and cyclohexanecarbonyl chloride.
LC / MS (m / z) 383.5 (MH +); RT = 3.67.
65: Cyclohexanecarboxylic acid [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -amide
Prepared from 5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-ylamine and cyclohexanecarbonyl chloride.
LC / MS (m / z) 369.5 (MH +); RT = 3.29.
66: N- [5- (1-Methyl-1H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -isobutyramide
Prepared from 5- (1-methyl-1H-tetrazol-5-yl) -4-phenyl-thiazol-2-ylamine and isobutyryl chloride.
LC / MS (m / z) 329.4 (MH +); RT = 2.48.
67: N- [5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -isobutyramide
Prepared from 5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and isobutyryl chloride.
LC / MS (m / z) 343.4 (MH +); RT = 3.17.
68: 3-Methyl-N- [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -butyramide
Prepared from 5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and 3-methyl-butyryl chloride.
LC / MS (m / z) 343.4 (MH +); RT = 3.13.
69: N- [5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -3-methyl-butyramide
Prepared from 5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and 3-methyl-butyryl chloride.
LC / MS (m / z) 357.4 (MH +); RT = 3.40.
70: 3-Methyl-N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -butyramide
Prepared from 5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-ylamine and 3-methyl-butyryl chloride.
LC / MS (m / z) 343.4 (MH +); RT = 3.00.
71: N- [5- (3-Methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -propionamide
Prepared from 5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and propionyl chloride.
LC / MS (m / z) 315.4 (MH +); RT = 2.63.
72: N- [5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -propionamide
Prepared from 5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and propionyl chloride.
LC / MS (m / z) 329.4 (MH +); RT = 2.94.
73: N- [5- (5-Methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -propionamide
Prepared from 5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-ylamine and propionyl chloride.
LC / MS (m / z) 315.4 (MH +); RT = 2.52.
74: N- [5- (3-Methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -2-phenyl-acetamide
Prepared from 5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and phenyl-acetyl chloride.
LC / MS (m / z) 377.4 (MH +); RT = 3.15.
75: N- [5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -2-phenyl-acetamide
Prepared from 5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and phenyl-acetyl chloride.
LC / MS (m / z) 391.5 (MH +); RT = 3.39.
76: N- [5- (5-Methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -2-phenyl-acetamide
Prepared from 5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-ylamine and phenyl-acetyl chloride.
LC / MS (m / z) 377.4 (MH +); RT = 3.04.
77: N- [5- (5-oxo-4,5-dihydro- [1,3,4] oxadiazol-2-yl) -4-phenyl-thiazol-2-yl] -2-phenyl-acetamide
Prepared from 5- (2-amino-4-phenyl-thiazol-5-yl) -3H- [1,3,4] oxadiazol-2-one and phenyl-acetyl chloride.
LC / MS (m / z) 379.4 (MH +); RT = 2.59.
78: N- [5- (5-Ethyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -3-phenyl-acrylamide
Prepared from 5-ethyl-3- (4-phenyl-thiazol-5-yl)-[1,2,4] oxadiazole and 3-phenyl-acryloyl chloride.
LC / MS (m / z) 403.5 (MH +); RT = 3.54.
79: Hexanoic acid [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide
Prepared from 5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and hexanoyl chloride.
LC / MS (m / z) 357.4 (MH +); RT = 3.41.
80: Hexanoic acid [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -amide
Prepared from 5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-ylamine and hexanoyl chloride.
LC / MS (m / z) 357.4 (MH +); RT = 3.29.
81: N- [5- (3-Methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -2-thiophen-2-yl-acetamide
Prepared from 5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and thiophen-2-yl-acetyl chloride.
LC / MS (m / z) 383.5 (MH +); RT = 3.06.
82: N- [5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -2-thiophen-2-yl-acetamide
Prepared from 5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and thiophen-2-yl-acetyl chloride.
LC / MS (m / z) 397.5 (MH +); RT = 3.31.
83: N- [5- (5-Methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -2-thiophen-2-yl-acetamide
Prepared from 5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-ylamine and thiophen-2-yl-acetyl chloride.
LC / MS (m / z) 383.5 (MH +); RT = 2.97.
84: N- [5- (3-Methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide
Prepared from 5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and acetyl chloride.
LC / MS (m / z) 301.3 (MH +); RT = 2.38.
85: N- [5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide
Prepared from 5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and acetyl chloride.
LC / MS (m / z) 315.4 (MH +); RT = 2.65.
86: N- [5- (5-Methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -acetamide
Prepared from 5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-ylamine and acetyl chloride.
LC / MS (m / z) 301.3 (MH +); RT = 2.28.
87: 2,2-Dimethyl-N- [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -propionamide
Prepared from 5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and 2,2-dimethyl-propionyl chloride.
LC / MS (m / z) 343.4 (MH +); RT = 3.27.
88: N- [5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -2,2-dimethyl-propionamide
Prepared from 5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and 2,2-dimethyl-propionyl chloride.
LC / MS (m / z) 357.4 (MH +); RT = 3.46.
89: 2,2-Dimethyl-N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -propionamide
Prepared from 5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-ylamine and 2,2-dimethyl-propionyl chloride.
LC / MS (m / z) 343.4 (MH +); RT = 3.07.
90: Furan-3-carboxylic acid [5- (2-methyl-2H-tetrazol-5-yl) -4- (4H-1 lambda * 4 * -thiophen-2-yl) -thiazol-2-yl]- Amide
Prepared from 5- (2-methyl-2H-tetrazol-5-yl) -4-thiophen-2-yl-thiazol-2-ylamine and furan-3-carbonyl chloride.
LC / MS (m / z) 361.4 (MH +); RT = 2.75.
91: Thiophene-3-carboxylic acid [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide
Prepared from 5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-ylamine and thiophene-3-carbonyl chloride.
LC / MS (m / z) 369.4 (MH +); RT = 3.18.
92: Thiophene-3-carboxylic acid [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -amide
Prepared from 5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-ylamine and thiophene-3-carbonyl chloride.
LC / MS (m / z) 369.4 (MH +); RT = 3.01.
93: 2- (3,4-Dimethoxy-phenyl) -N- [5- (2-methyl-2H-tetrazol-5-yl) -4-thiophen-2-yl-thiazol-2-yl] -acetamide
Prepared from 5- (2-methyl-2H-tetrazol-5-yl) -4-thiophen-2-yl-thiazol-2-ylamine and (3,4-dimethoxy-phenyl) -acetyl chloride.
LC / MS (m / z) 445.5 (MH +); RT = 2.69.

<Pharmacological test>
The compounds of the present invention were tested according to the following method.

(A _2A efficacy study)
Cloning of human cDNA encoding A _2a receptor.

CDNA was obtained by reverse transcription of human fetal brain RNA (Clonetech) using random primers. Subsequently, polymerase chain reaction (PCR) for amplification was performed using the cDNA as a template and oligonucleotides TTTACGCGTGGCCATGCCCATCATGGGCTCCTC and TTTCTAGAATCAGGACACTCCTGCTCCATC as primers. Amplification was performed using Pfu polymerase (Stratagene, according to manufacturer's recommendations) at an annealing temperature of 54 ° C. The reaction mixture was analyzed by agarose gel electrophoresis, and a 1.2 kb band was cut out to elute DNA. The eluted DNA was digested with restriction enzymes MluI and XbaI, and ligated with pCIneo, a vector cleaved with the same enzymes. DNA was isolated and the nucleotide sequence was confirmed. CHO cells, by introducing a pCIneo clone expressing the A _2a receptor, After culturing for 2-3 weeks in the presence of 5 mg / ml or 10mg / ml of G418, single-the plasmids were stably integrated cell Released.

The CHO cells transfected with A _2A receptor described above with 10% FCS, 1% glutamine and 1% penicillin / streptomycin and 1 mg / mL of G418 was added was F12 medium (Kaighs modification, Life technologies Inc.) In culture.

  Twenty-four hours prior to conducting the test, 10000 cells / well were seeded at 60-80% confluency in G418-free medium in a costar 96-well plate. The cells were stimulated with NECA (00-9498, final concentration 75 nM) corresponding to about 80% of agonist efficacy.

  Remove cell media and wash cells 3 times with PBS pre-equilibrated at 37 ° C, with 10 μL of acceptor bead suspension, and 10 μL of test or standard compound solution (0-10 μM) After incubation for 30 minutes in the dark at 25 ° C. (on a shaker), 30 μl of the donor bead suspension was added and incubated for an additional 60-120 minutes in the dark. Plates were analyzed according to manufacturer's instructions (Alphascreen, Perkin Elmer (Pachard Biosciense)).

  Acceptor beads were suspended in stimulation buffer (0.1% BSA in phenol red-free Hanks balanced salt (Gibco) at 5 mM HEPES, pH 7.4). Donor beads were suspended in lysis buffer (stimulation buffer with 0.3% Tween 20 and biotinylated cAMP) according to manufacturer's instructions (Alphascreen, Perkin Elmer (Pachard Biosciense)).

Fitting the data to the non-linear regression, the following equation and IC ₅₀ and K _i values:
IC ₅₀ = ([I] / (100 / (100-% INH)) / (1 + ([ag] / EC ₅₀ )
and
K _i = IC ₅₀ / (1- [ag] / EC ₅₀ )
Calculated with Wherein, [I] is the inhibitor concentration, [ag] is the examination agonist concentration and EC ₅₀ of an agonist concentration required for obtaining a half-maximal effect.

(A _2A binding test)
Expression in the membrane fraction of Preparation insect cells for A _2A binding assay
Human A _2a encoding DNA was excised from pCIneo construct with MluI and XbaI and subcloned into pFASTBAC2 vector cleaved with XbaI and BssHII. The insert was re-incorporated into a baculo vector using the Bac-to-Bac ^(R) system (Invitrogen). Growth and isolation of baculovirus was performed as described by the vendor (Invitrogen). High Five cells (Invitrogen) were cultured at 27 ° C. in suspension to a density of 1 * 10 ⁶ and infected at a MOI of 0.5. Cells were harvested 72 hours after infection and membrane fractions were prepared.

The High Five cells expressing A _2A receptors were homogenized in 50 mM tris-buffer (pH 7.4) using an Ultra-Turrax homogenizer (ultra Turrax homogenisator). The membrane fraction was diluted to a concentration of 0.6 mg / ml and 2 U of adenosine deaminase (Roche) was added per ml of membrane suspension. The solution was preincubated for 30 minutes at 37 ° C. before use.

A _2A binding test:
Binding tests were performed on 96-Fell flat-bottom plates, and 10.6 μg of protein was added per well of standard or test compound solution (final concentration 0-10 μM) and 1 nM final concentration of ³ H-ZM241385 (from Tocris) R1036). All test compounds were diluted from DMSO-stock (2 mM or 10 mM) into 50 nM Tris buffer. The reaction solution (final volume = 200 μL) was incubated at 25 ° C. for 30 minutes and washed with water on the unifilter GF / B. The felter was dried for 20 minutes (37 ° C.), 35 μl of Microscient-0 or Optiphase supermix was added and counted in a Trilux counter for 1 minute.

Fitting the data to the non-linear regression, the following equation and IC ₅₀ and K _i values:
IC ₅₀ = ([I] / (100 / (100-% INH)) / (1 + ([L] / K _D )
and
K _i = IC ₅₀ / (1- [L] / K _D )
Calculated with Wherein, [I] is the inhibitor concentration, the concentration and dissociation equilibrium constant of [L] and K _D respectively radiotracers.

The described compounds 1-93 of the present invention are A _2A receptor ligands having a human A _2A binding affinity (K _i ) of 210 nM or less, such as antagonists, agonists, reverse agonists or partial agonists.

<Formulation Example>
The pharmaceutical preparation of the present invention can be produced by a conventional method in this technical field.

  For example: a tablet can be prepared by mixing the active ingredient with the usual adjuvants and / or diluents and subsequently compressing the mixture on a conventional tablet press. Examples of adjuvants or diluents include corn starch, potato starch, talc, magnesium stearate, gelatin, lactose, thickeners (gums) and the like. Other adjuvants or additives commonly used for such purposes, such as colorants, flavorings, preservatives, etc., can also be used provided that they are compatible with the active ingredients.

  Injectable solutions are made by dissolving the active ingredient and possible additives in a portion of an injectable solvent, preferably sterile water, adjusting the solution to the desired volume and sterilizing the solution in a suitable ampoule or vial. It can be manufactured by filling. Appropriate additives usually used in the art can be added, for example, isotonic agents, preservatives, antioxidants and the like.

A typical formulation example for the formulation of the present invention is as follows.
1) Tablets containing 5.0 mg of the compound of the present invention calculated as the free base:
Compound 1 5.0 mg
Lactose 60 mg
Maze starch 30 mg
Hydroxypropylcellulose 2.4 mg
Microcrystalline cellulose 19.2 mg
Croscarmellose sodium type A 2.4 mg
Magnesium stearate 0.84 mg
2) Tablets containing 0.5 mg of the compound of the present invention calculated as the free base:
Compound 1 0.5 mg
Lactose 46.9 mg
Maze starch 23.5 mg
Povidone 1.8 mg
Microcrystalline cellulose 14.4 mg
Croscarmellose sodium type A 1.8 mg
Magnesium stearate 0.63 mg
3) Syrup containing the following per milliliter:
Compound 1 25 mg
Sorbitol 500 mg
Hydroxypropylcellulose 15 mg
Glycerol 50 mg
Methyl-paraben 1 mg
Propyl-paraben 0.1 mg
Ethanol 0.005 mL
Flavor 0.05 mg
Saccharin sodium 0.5 mg
1 mL with water
4) Injection solution containing the following per milliliter:
Compound 1 0.5 mg
Sorbitol 5.1 mg
Acetic acid 0.05 mg
Saccharin sodium 0.5 mg
1 mL with water

Claims (19)

Formula I for use as a medicament

A compound represented by:
Wherein R ¹ is phenyl, thien-2-yl or thien-3-yl, each phenyl and thienyl optionally selected from halogen, C _1-6 -alkyl or C _1-6 -alkoxy 1 Substituted with species or more substituents;
R ² is furan-2-yl, furan-3-yl, [1,2,4] -oxadiazol-3-yl, [1,2,4] -oxadiazol-5-yl, [1, 2,5] -oxadiazol-3-yl, [1,2,4] -thiadiazol-3-yl, [1,2,4] -thiadiazol-5-yl, [1,2,5] -thiadiazole 5-membered heteroaryl selected from the group consisting of -3-yl, wherein said heteroaryl is optionally C _1-6 -alkyl, phenyl-C _1-6 -alkyl, C _1-6 -alkoxy and C _1-6 - alkoxy -C _1-6 - or is substituted with one or more substituents selected from the group consisting of alkyl, or, R ² in 1- or 2-position C _1-6 - alkyl , Phenyl-C _1-6 -alkyl or tetrazol-5-yl substituted with C _3-8 -cycloalkyl-C _1-6 -alkyl, or R ² is 5-oxo-4,5- Dihydro- [1,3,4] -oxadiazol-2-yl;
And R ³ is C _1-6 -alkyl, C _3-8 -cycloalkyl, C _3-8 -cycloalkyl-C _1-6 -alkyl, furanyl, furanyl-C _1-6 -alkyl, thienyl, thienyl- Selected from the group consisting of C _1-6 -alkyl, phenyl, phenyl-C _2-6 -alkene and phenyl-C _1-6 -alkyl, said phenyl-C _1-6 -alkyl optionally halogenated in the phenyl ring , C _1-6 - alkyl or C _1-6 - is substituted with one or more substituents selected from alkoxy, said compounds. R ¹ is phenyl The compound of claim 1, wherein for use as a medicament. R ¹ is thien-2-yl, a compound according to claim 1 for use as a medicament. When R ² is tetrazol-5-yl, it is substituted at the 2-position, the compounds according to any one of claims 1 to 3 for use as a medicament. When R ² is tetrazol-5-yl, it is substituted in 1-position, the compounds according to any one of claims 1 to 3 for use as a medicament. When R ² is tetrazol-5-yl, either it is a methyl, ethyl, propyl, butyl, isobutyl, substituted with cyclopropane methyl or phenethyl, of claims 1 to 5 for use as a medicament A compound according to one. R ² is furan-2-yl or furan-3-yl and the heteroaryl is optionally C _1-6 -alkyl, phenyl-C _1-6 -alkyl, C _1-6 -alkoxy and C _1-6- alkoxy -C _1-6 - is substituted with one or more substituents selected from the group consisting of alkyl, a compound according to any one of claims 1 to 3 for use as a medicament. R ² is [1,2,4] -oxadiazol-3-yl and heteroaryl is optionally C _1-6 -alkyl, phenyl-C _1-6 -alkyl, C _1-6 -alkoxy and C _{4. The} use as claimed in any one of claims 1-3 for use as a medicament, substituted with one or more substituents selected from the group consisting of _1-6- alkoxy-C1-6-alkyl. Compound. R ² is [1,2,4] -oxadiazol-5-yl and heteroaryl is optionally C _1-6 -alkyl, phenyl-C _1-6 -alkyl, C _1-6 -alkoxy and C _{4. The} use as claimed in any one of claims 1-3 for use as a medicament, substituted with one or more substituents selected from the group consisting of _1-6- alkoxy-C1-6-alkyl. Compound. R ² is [1,2,5] -oxadiazol-3-yl and heteroaryl is optionally C _1-6 -alkyl, phenyl-C _1-6 -alkyl, C _1-6 -alkoxy and C _{4. The} use as claimed in any one of claims 1-3 for use as a medicament, substituted with one or more substituents selected from the group consisting of _1-6- alkoxy-C1-6-alkyl. Compound. R ² is 5-oxo-4,5-dihydro - [1,3,4] - oxadiazole-2-yl, according to any one of claims 1 to 3 for use as a medicament Compound. R ³ is C _1-6 -alkyl, C _3-8 -cycloalkyl, C _3-8 -cycloalkylmethyl, furan-2-yl, furan-3-yl, thien-2-yl, thien-2-yl 12. Any one of claims 1-11 for use as a medicament selected from the group consisting of -methyl, thien-3-yl, phenylmethyl, phenethylene, and benzyl optionally substituted on the phenyl ring. Compounds described in 1.   13. A compound according to claim 12, for use as a medicament, wherein benzyl is substituted with one or two methoxy groups in the phenyl ring.   14. A compound according to any one of claims 12 or 13, for use as a medicament, wherein benzyl is substituted at the 3-position and / or 4-position of the phenyl ring. Less than:
2- (3,4-dimethoxy-phenyl) -N- [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
2- (3,4-dimethoxy-phenyl) -N- (5- [1,2,4] oxadiazol-3-yl-4-phenyl-thiazol-2-yl) -acetamide,
N- (5-furan-3-yl-4-phenyl-thiazol-2-yl) -isobutyramide,
Cyclopropanecarboxylic acid [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
Furan-3-carboxylic acid [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
N- [5- (2-Ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -isobutyramide,
Furan-2-carboxylic acid [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
Cyclohexanecarboxylic acid [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
2-cyclopentyl-N- [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
N- [5- (2-Ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -propionamide,
Cyclopropanecarboxylic acid (5- [1,2,4] oxadiazol-3-yl-4-phenyl-thiazol-2-yl) -amide,
Thiophene-3-carboxylic acid [5- (2-ethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
2-cyclopentyl-N- (5- [1,2,4] oxadiazol-3-yl-4-phenyl-thiazol-2-yl) -acetamide,
Furan-3-carboxylic acid [5- (2-phenethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
N- (5-furan-2-yl-4-phenyl-thiazol-2-yl) -isobutyramide,
Furan-2-carboxylic acid (5-furan-3-yl-4-phenyl-thiazol-2-yl) -amide,
2- (3,4-dimethoxy-phenyl) -N- (5-furan-2-yl-4-phenyl-thiazol-2-yl) -acetamide,
Cyclopropanecarboxylic acid (5-furan-3-yl-4-phenyl-thiazol-2-yl) -amide,
2- (3-methoxy-phenyl) -N- (5- [1,2,4] oxadiazol-3-yl-4-phenyl-thiazol-2-yl) -acetamide,
2- (3-methoxy-phenyl) -N- [5- (2-phenethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
N- (5-furan-2-yl-4-phenyl-thiazol-2-yl) -2,2-dimethyl-propionamide,
N- (5-furan-3-yl-4-phenyl-thiazol-2-yl) -propionamide,
N- [5- (2-phenethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -isobutyramide,
N- (5-furan-2-yl-4-phenyl-thiazol-2-yl) -propionamide,
Furan-2-carboxylic acid [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
3,3-dimethyl-N- [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -butyramide,
Cyclopropanecarboxylic acid [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
2-cyclopentyl-N- [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
N- [5- (2-Methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -isobutyramide,
3-methyl-N- [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -butyramide,
N- [5- (2-Methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -propionamide,
N- [5- (2-Methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -2-phenyl-acetamide,
Hexanoic acid [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
N- [5- (2-Methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -2-thiophen-2-yl-acetamide,
N- [5- (2-Methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
2,2-dimethyl-N- [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -propionamide,
Thiophene-3-carboxylic acid [5- (2-methyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
N- [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -isobutyramide,
3-methyl-N- [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -butyramide,
N- [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -propionamide,
2-phenyl-N- [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -acetamide,
N- [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -2-thiophen-2-yl-acetamide,
N- [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -acetamide,
2,2-dimethyl-N- [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -propionamide,
Thiophene-3-carboxylic acid [4-phenyl-5- (2-propyl-2H-tetrazol-5-yl) -thiazol-2-yl] -amide,
N- [5- (2-butyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -isobutyramide,
2-cyclopentyl-N- [5- (2-isobutyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
N- [5- (2-isobutyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -2-thiophen-2-yl-acetamide,
N- [5- (2-cyclopropylmethyl-2H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -3-methyl-butyramide,
Furan-2-carboxylic acid [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
3,3-dimethyl-N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -butyramide,
N- [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -benzamide,
N- [5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -benzamide,
N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -benzamide,
Cyclopropanecarboxylic acid [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
Cyclopropanecarboxylic acid [5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
Cyclopropanecarboxylic acid [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -amide,
Cyclopropanecarboxylic acid [5- (5-ethyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -amide,
2-cyclopentyl-N- [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
2-cyclopentyl-N- [5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
2-cyclopentyl-N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -acetamide,
2-cyclopentyl-N- [5- (5-ethyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -acetamide,
Cyclohexanecarboxylic acid [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
Cyclohexanecarboxylic acid [5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
Cyclohexanecarboxylic acid [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -amide,
N- [5- (1-Methyl-1H-tetrazol-5-yl) -4-phenyl-thiazol-2-yl] -isobutyramide,
N- [5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -isobutyramide,
3-methyl-N- [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -butyramide,
N- [5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -3-methyl-butyramide,
3-methyl-N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -butyramide,
N- [5- (3-Methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -propionamide,
N- [5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -propionamide,
N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -propionamide,
N- [5- (3-Methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -2-phenyl-acetamide,
N- [5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -2-phenyl-acetamide,
N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -2-phenyl-acetamide,
N- [5- (5-oxo-4,5-dihydro- [1,3,4] oxadiazol-2-yl) -4-phenyl-thiazol-2-yl] -2-phenyl-acetamide,
2- (3,4-dimethoxy-phenyl) -N- [5- (2-methyl-2H-tetrazol-5-yl) -4-thiophen-2-yl-thiazol-2-yl] -acetamide,
N- [5- (5-ethyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -3-phenyl-acrylamide,
Hexanoic acid [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
Hexanoic acid [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -amide,
N- [5- (3-Methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -2-thiophen-2-yl-acetamide,
N- [5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -2-thiophen-2-yl-acetamide,
N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -2-thiophen-2-yl-acetamide,
N- [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
N- [5- (3-ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -acetamide,
N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -acetamide,
2,2-dimethyl-N- [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -propionamide,
N- [5- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -2,2-dimethyl-propionamide,
2,2-dimethyl-N- [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -propionamide,
Furan-3-carboxylic acid [5- (2-methyl-2H-tetrazol-5-yl) -4-thiophen-2-yl-thiazol-2-yl] -amide,
Thiophene-3-carboxylic acid [5- (3-methyl- [1,2,4] oxadiazol-5-yl) -4-phenyl-thiazol-2-yl] -amide,
Thiophene-3-carboxylic acid [5- (5-methyl- [1,2,4] oxadiazol-3-yl) -4-phenyl-thiazol-2-yl] -amide,
2. The compound of claim 1, for use as a medicament, selected from the group consisting of: A method of using a compound of formula I, wherein R ¹ , R ² and R ³ are defined in any one of claims 1 to 15 for the manufacture of a medicament for the treatment of diseases involving A _2A receptors. Diseases involving A _2A receptors are Parkinson's disease, Alzheimer's disease, Huntington's disease, epilepsy, cerebral ischemia, hemorrhagic stroke, neonatal ischemia and hypoxia, subarachnoid hemorrhage, traumatic brain injury, brain following cardiac arrest 20. A method of using a compound selected from the group consisting of disorders and for the treatment of depression and psychosis. 18. The method for using a compound according to claim 17, wherein the disease involving A _2A receptor is Parkinson's disease. R ¹ , R ² and R ³ are compounds of formula I as defined in any one of claims 1 to 15, provided that said compound is N- [5- (5-nitro-furan-2- Yl) -4-phenyl-thiazol-2-yl] -benzamide.