JP2008513351A - IgE retargeting function-modifying molecule (ERFAM) for the treatment of allergic diseases - Google Patents

Abstract

The present invention relates to an IgE retargeting molecule (ERFAM) construct consisting of the chemical formula A′-B ′, wherein A ′ represents an IgE binding moiety and B ′ represents an inhibitory receptor binding moiety, or A ′ Provides a construct of formula A′-XB ′, wherein represents the IgE binding moiety, X represents the linker moiety, and B ′ represents the inhibitory receptor binding moiety. Also provided are methods for using these in the treatment of IgE-related diseases such as allergies. The present invention relates to molecules that bind to IgE antibodies and convert IgE antibodies into allergen-dependent inhibitors of allergies. Such molecules are useful, for example, in the treatment of allergies and other IgE-related diseases.

Description

(Field of Invention)
The present invention relates to molecules that bind to IgE antibodies and convert IgE antibodies into allergen-dependent inhibitors of allergies. Such molecules are useful, for example, in the treatment of allergies and other IgE-related diseases.

(Background of the Invention)
Over 5 million people worldwide suffer from allergies, and the prevalence of allergies is increasing rapidly, mainly affecting children and young people. Annual medical costs due to allergies are over £ 1 billion in the UK and over $ 10 billion in the US, but it is clear that allergy costs in society as a whole are much higher.

  Allergy is characterized by the production of IgE-type antibodies specific for certain antigens (allergens), which cause an immune response. Once these allergens enter the body, the presence of specific IgE triggers an allergic reaction. The biology of IgE as well as its role in allergic diseases has been reviewed. For example, see Non-Patent Document 1. Since IgE establishes a link between each allergen and a trigger mechanism represented by an allergen-effector cell activation device, IgE triggers an allergic reaction when the allergen enters the body. IgE builds such a linkage by virtue of its dual functional binding properties: it has two allergen-specific binding sites (F antigen binding site-Fab) at one end and its constant at the other end. It binds to the high affinity IgE receptor (FcεRI) at the binding site (Fc).

  FcεRI molecules are themselves bifunctional molecules. Its extracellular region binds IgE, and the intracellular region contains an activation site that can trigger signal cascade activation. A low affinity IgE receptor (FcεRII / CD32) may also be involved in allergy.

Other studies address the induction of IgG antibodies and their role in the process of allergen-specific immunotherapy (SIT). SIT has been shown to lead to an increase in pathogenic IgE but also leads to a further increase in the amount of IgG and IgG4. For example, see the review by DK Ledford in Non-Patent Document 2. This is further documented using a qualified in vivo skin prick test titration, which demonstrates that the amount of allergen-specific IgG elicited after SIT correlates with a decrease in skin response. . For example, see Non-Patent Document 3. In fact, allergen-specific IgE levels are still high, but when specific IgG4 is increased, clinical responsiveness to allergen disease decreases within a few weeks after the start of emergency immunotherapy. For example, see Non-Patent Document 4.
Gould et al., Annual Rev Immunol, 2003, 21: p. 579-628 RF Lockley and SC Bukantz, “ALLERGENS AND ALLERGEN IMMUNOTHERAPY”, Marcel Dekker 1999, p. 359-371 Witeman et al., International Archives of Allergy and Immunology, 1996, 109: p. 396-375 Rack et al., Journal of Allergy and Clinical Immunology, 1997, 99: p. 530-538

(Summary of the Invention)
Included within the scope of the present invention is at least one IgE retargeting function modifying molecule (ERFAM) having the chemical formula A′-B ′, where A ′ is Represents a moiety that binds to IgE and B ′ represents a moiety that binds to an inhibitory receptor. In some embodiments, A ′ and B ′ are operably linked. Alternatively, the ERFAM has the formula A′-XB ′, where A ′ represents a moiety that binds to IgE, X represents a linker moiety, and B ′ represents a moiety that binds to an inhibitory receptor. , Where A′-XB ′ is operably linked. The ERFAM construct is useful for treating IgE related diseases and disorders, including allergic reactions to at least one allergen. In one embodiment of the invention, ERFAM binds to IgE and converts this IgE into an allergy suppressor. In various embodiments, ERFAM specifically recognizes and binds at least one, at least two, or at least three or more epitopes. This is also said to be at least monospecific, at least bispecific, or at least multispecific. In a specific embodiment, the A ′ and B ′ portions of the ERFAM construct provide first and second specificities. In related embodiments in which ERFAM is at least bispecific, the first specificity is for IgE and the second specificity is functionally equivalent to the Fc portion of an IgG4 antibody. In a related embodiment, the at least bispecific ERFAM composition comprises a first portion consisting of an anti-IgE antibody portion of the IgG4 isotype, wherein the composition binds to at least one epitope comprising IgE. However, it does not crosslink with cell-bound IgE.

  In another embodiment, where the ERFAM is at least bispecific, the first specificity is for IgE and the second specificity is for inhibitory cell surface receptor binding. Another specific bispecific ERFAM composition is an inhibitory cell selected from the group consisting of an immunoreceptor tyrosine-inhibited motif (ITIM) containing inhibitory receptor and an apoptosis-inducing receptor. Contains structures that recognize and bind to surface receptors.

  In a specific embodiment, the present invention encompasses an ERFAM molecule containing an allergen specific IgG4 antibody. In various embodiments, at least one A 'moiety or at least one B' moiety is a cyclic peptide that spontaneously linearizes only when bound to IgE. In this embodiment, the cyclic peptide specifically binds to the IgE molecule and becomes linear. In a more specific embodiment, an ERFAM molecule containing one or more IgE-specific cyclic peptides becomes FcγR or a corresponding inhibitory receptor after the cyclic peptide is linearized after binding to IgE. Join.

  Various linkers X that operatively link at least one A 'moiety to at least one B' moiety are encompassed by the formula A'-X-B '. In a specific embodiment, linker X consists of a polyethylene glycol (“PEG”) linker. Other linker X compositions contain one or more amino acids, polypeptides, or any other chemical moiety known in the art that can operably link two or more polypeptide moieties. . In a preferred embodiment, the linker X composition is non-immunogenic. In ERFAM compositions containing PEG linker X, ERFAM has an extended circulating half-life in the body. In a related embodiment, ERFAM containing PEG linker X has reduced immunoantigenicity.

  In certain embodiments, the ERFAM composition is in a pharmaceutical carrier. In a preferred embodiment, a therapeutically effective amount of ERFAM is provided. Also provided is a kit comprising at least one ERFAM composition in a container.

  The present invention also provides a method of using the ERFAM composition. In one embodiment, the method includes administering a therapeutically effective amount of an ERFA molecule to a patient in need thereof to control the effect of an IgE-related hypersensitivity response. In a specific embodiment, the method of use is for treating allergies. In a preferred embodiment, the administered ERFAM molecule comprises an allergen specific IgG4 antibody portion.

  Finally, at least one method for producing ERCAM molecules is provided, wherein the method comprises producing ERCAM molecules and purifying ERCAM molecules from impurities.

  Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned in this specification are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

  Other features and advantages of the invention will be apparent from the following detailed description and from the claims.

(Detailed explanation)
(ERFAM construct of the present invention)
A construct that converts an IgE antibody to an allergen-specific allergy suppressor is provided. Several such inhibitors are described herein and are called IgE-retargeting function-altering molecules (ERFAM).

  An illustration of ERFAM binding is provided in FIG. ERFAM binds to the Fc region of IgE. As a result of ERFAM binding, other molecules are shielded from interaction with the Fc region of IgE, thereby preventing IgE from binding to IgE receptors (FcεRI and FcεRII). At the same time, ERFAM provides a second binding site specific for receptors with different functions. IgE is converted to an allergic inhibitory antibody by a first binding where ERFAM binds to IgE and a second binding where ERFAM binds to a receptor with a different function.

  Since IgE is generally allergen-specific, binding to circulating IgE and mast cell-bound IgE makes it possible to suppress an IgE-mediated immune response to the allergen without inhibiting the response to other antigens.

  In addition, binding of ERFAM to IgE is not specific for any allergen of interest. ERFAM can bind to any IgE. Thus, unlike allergen-specific immunotherapy as well as other well-known anti-allergic therapies used to induce tolerance, ERFAM has a broad range of any allergen (for which allergens are It is an effective treatment for inducing anergy against allergen-specific IgE-mediated allergic reactions.

  Preferably, ERFAM induces production of allergen dependent inhibitors that are only active when allergens are also administered. This allows for effective adjustment of allergy treatment and avoids side effects.

  SIT targets the induction of production of inhibitory IgG antibodies. Thus, administration of ERFAM bypasses, for example, SIT by directly transforming existing pathogenic IgE that triggers an allergic reaction into an anti-allergic IgG-like allergy inhibitor. Since ERFAM is not related to allergen administration and does not crosslink FcεRI, there is no risk of hyperallergy. However, ERCAM itself is not immunotherapeutic.

  In some embodiments, the ERFAM molecule, when bound to IgE, confers on IgE the functional properties of an allergy inhibitory antibody such as IgG4. In one embodiment, the molecule is an IgG4 monoclonal antibody that binds IgE.

  In some embodiments, ERFAM is a multi-functional non-anaphylaxis molecule that contains an IgE binding site and a binding site for a receptor that binds to an inhibitory receptor such as IgG4. In some embodiments, the ERFAM also contains a “linker” moiety. This linker moiety is useful, for example, to increase the ERFAM serum half-life. Alternatively, the ERFAM molecule is represented by the chemical formula A′-B ′, where A ′ is the first functional element (eg, IgE binding site) and B ′ is the second functional element (eg, at least one inhibitor). Represents a binding site for a sex receptor. Alternatively, ERFAM is represented by the chemical formula A′-XB ′, where A ′ is the first functional element (eg, IgE binding site), X is the linker moiety, and B ′ is the second functional element. (Eg, a binding site for at least one inhibitory receptor).

  In other embodiments, the ERFAM molecule is a smaller bifunctional molecule that contains an IgE binding site (first function) and a site that has functional binding properties similar to the Fc portion of an IgG4 antibody (second function). It is. These two sites are linked directly or indirectly through a third moiety that provides the molecule with the desired pharmacological and immunological properties. Dual functional molecules are disclosed, for example, in PCT publications WO 96/40788, WO 98/09638, WO 02/088312, and WO 02/102320.

Thus, in a preferred embodiment, the ERFAM molecule is a bifunctional molecule having the following properties:
(1) The first binding site of these molecules, ie the IgE binding site, is preferably (but not exclusively) an IgG4 isotype anti-IgE antibody, or a fragment thereof, or a peptide or peptidomimetic molecule that binds IgE or An oligonucleotide;
(2) The second binding site, ie, the IgG4 binding site or its equivalent. Here this site has functional binding properties similar to the Fc portion of an IgG4 antibody. In various embodiments, this is an IgG4 antibody or Fc fragment thereof, or an anti-FcγR antibody, or a peptide or peptidomimetic molecule or oligonucleotide apatomer. All of these have the same effect as binding of IgG4 to its receptor. Where applicable, the receptor moiety making up the second site is preferably an immunoreceptor tyrosine inhibitory motif (ITIM) containing inhibitory receptor targeting molecule. In general, ITIM contains a consensus sequence {ILV} -xx-Yx- {LV} (SEQ ID NO: 3) within the cytoplasmic tail of inhibitory receptors.
(3) A linker moiety that operably connects the first binding site and the second binding site as required. The linker may have one or more functions, including increased ERFAM serum half-life, decreased degradation, and stereochemical optimization. The mediator moiety is a polyethylene glycol (PEG) moiety or a functionally equivalent molecule that binds to the site and provides the molecule with the desired pharmacological and immunological properties.

  An equivalent embodiment is represented by an allergen-specific IgG4 antibody that is administered to allergic patients to achieve a similar effect. The individual components of the ERFAM molecule are described in more detail below.

(IgE binding part of ERFAM)
In some embodiments, the ERFAM contains a sequence of IgE binding polypeptide known in the art.

Known IgE binding site portions of ERFAM peptides, antibodies, aptamers, other chemicals, and their equivalents include the following:
(A) Antibodies: include, but are not limited to, E25 (Novatis, patented), TNX-901 (Tanox, WO 92/17207), or other IgE binding antibodies described herein;
(B) Peptides: Peptides described in WO 98/04718 (ME Digan) and WO 99/05271 (Gould et al.) And any other IgE-binding peptides, whether natural or synthesized Functional sequences are included but are not limited to these. These contain L-amino acids or D-amino acids and may include glycosylation as well as post-translational modifications such as phosphorylation, myristoylation;
(C) Aptamer: Oligonucleotide that binds to human IgE described in J Immunol 157: 221-230, 1996 with high affinity and high specificity, ie 35-nucleotide truncated IGEL 1.2 (gggaggacgaugcgg; SEQ ID NO: 1) 2'-NH ₂ RNA group A ligand represented by (K _d = 30 nM), or ssDNA represented by 37-nucleotide truncated DI 7.4 (ggggcacgttttatccgtccctcctaggtggcgtgcccc; SEQ ID NO: 2) (K _d = 10 nM) Group ligands are included, but are not limited to these. They competitively inhibit the interaction of human IgE with Fc1εRI and block serotonin release from IgE-mediated cells caused by IgE-specific antigens or anti-IgE antibodies;
(D) Peptidomimetics: including, but not limited to, tetracycline compounds (see, eg, US Pat. No. 5,965,605).

  It is contemplated that these known IgE binding moieties will be used in the present invention or that one skilled in the art will generate new moieties with similar or equivalent functions. These or other publications mentioned herein are intended to be part of the present invention. All publications cited herein are hereby incorporated by reference in their entirety.

  Publications that report anti-IgE non-stimulatory antibodies include PCT publications WO 92/17207, WO 92/21031, WO 99/38531, WO 00/16804, and WO 02/079257, as well as US Pat. No. 6,329, 509 etc. are mentioned, but it is not limited to these. Alternatively, soluble FcεRI receptors or derivatives thereof that bind IgE, for example via FcεRIα chain fragments, include US Pat. No. 6,090,384 and PCT publications WO 98/04718 and WO 99/05271. In particular, WO 98/04718 (ME Digan) describes FcεRIα chain fragments that bind to IgE fused to human serum albumin and have a long life in the circulation and a low risk of side effects.

  Other publications that report peptides or other compounds that inhibit IgE binding to its receptor include Cheng et al., Who report inhibition of binding of IgE to its receptor by tetracycline-based compounds, and to Heska Helm et al., 1997 Allergy 52: 1155-1169; McDonnell et al., 1996 Nature Struct Biol 3: 419-425; Iwasaki et al., 2002 Biochem Biophys Res Comm. 293: 542-548; and Wiegand et al., 1996 J Immunol 157: 221-230.

  Further aptamers and other chemical moieties known in the art that specifically bind IgE can be used in the generation of ERCAM molecules. Alternatively, new IgE binding structures are discovered using traditional techniques. This traditional approach includes, but is not limited to, monoclonal antibodies, phage display, and / or aptamer techniques.

(Linker part of ERFAM)
The first functional part and the second functional part of ERFAM are directly coupled to each other by a covalent bond. Alternatively, the first and second functional portions of ERFAM are indirectly linked through a linker (eg, glycol, polypeptide sequence, resin, carbohydrate, polymer, or saccharide as described below). This binding complex is preferably non-immunogenic, with or without a linker.

  Linker molecules such as polyethylene glycol (or other structures and chemical moieties), when present, provide a “framework” on which the binding portion of the inhibitory receptor can be operably linked to the IgE binding site. To produce the final ERFAM molecule. The intended function of the linker moiety is to increase the serum half-life of the ERFAM molecule, reduce degradation, increase the molecular size, and / or modify the stereochemical relationship between the ERFAM moieties. . For example, by increasing the molecular size of ERFAM, the linker inhibits the rapid renal excretion of ERFAM, increases circulation half-life, or provides other advantageous pharmacokinetic properties.

  PEGylation methods for altering the pharmacodynamic properties of drugs are known to those skilled in the art and are contemplated to be part of the present invention. PEG polymers are branched or unbranched and include PEG polymers composed of a single PEG subunit or multiple PEG subunits. Alternatively, the linker is operably linked in-frame to a polypeptide sequence such as a movable hinge. Other linker moieties as well as methods of making them are known to those skilled in the art and generally include, for example, chemical linkers, polymers, peptides, polypeptides, sugars, rigid beads, synthetic degradable moieties, carbohydrates, and glycerol More specifically, biotin, streptavidin, cytokine, antibody hinge region, ficoll, polyethylene glycol (PEG), methoxypolyethylene glycol (MPEG), polyethylene diglycol diacid, PEG monoamine, MPEG monoamine, MPEG hydrazide , MPEG imidazole, methoxy polypropylene glycol, copolymers of polyethylene glycol and methoxy polypropylene glycol, dextran, and polylactic acid-polyglycolic acid. See, for example, U.S. Patent Nos. 6,309,633, 6,552,167, 6,541,610, and 6,592,847. Also, the binding of polypeptides to low molecular weight compounds (eg, amino lecithin, fatty acids, vitamin B12, and glycosides) is also known in the art. For example, R.A. Igarishi et al., Proceed. Intern. Symp. Control. Rel. Bioact. Materials, 17, 366 (1990); Taniguchi et al., Ibid 19, 104, (1992); J. et al. See Russel-Jones, Ibid, 19, 102, (1992); M Baudys et al., Ibid, 19, 210, (1992). The linker molecule is monovalent, divalent, or multivalent.

  The linker can further function as a spacer. The spacer is of any suitable desired length, which may be about 10-20 nm, about 20-40 nm, about 40-60 nm, about 60-100 nm, about 500 nm, or up to about 1 μm or more. It includes about 100 nm or more as described above.

(Inhibitory receptor binding part of ERCAM)
In an embodiment, the ERFAM molecule of the invention contains an inhibitory receptor binding molecule that interacts with an inhibitory receptor. Inhibitory receptor binding molecules include peptides and fragments of antibody Fc regions. In some embodiments of ERCAM, an IgG4 antibody or Fcγ fragment thereof is used. Alternatively, binding to FcγR is ensured by antibodies to FcγR (eg, antibodies to FcγRIIb) or fragments thereof, peptides or aptamers with equivalent binding properties. FcγR targeted therapies are known in the art. FcγR as well as FcγR targeting molecules (antibodies, bifunctional antibodies, peptides) are described, for example, in US Pat. No. 4,954,617 (MW Fanger et al., IgG against Fc receptors on human mononuclear phagocytes. US Pat. No. 6,365,161 (Yashwant et al., Discloses therapeutic compounds containing anti-Fc receptor binding agents); and PCT publication WO 96/08512 (discloses monoclonal antibodies). PM Hogarth et al., Which discloses polypeptides with Fc binding ability).

  In a preferred embodiment, the ERFAM binds to an inhibitory receptor containing an immunoreceptor tyrosine inhibitory motif (ITIM). This ITIM-containing inhibitory receptor is present on the surface of any immune-related cell. Examples of immune related cells include, but are not limited to, basophils, mast cells, B cells, platelets and antigen presenting cells (APC). APC includes dendritic cells, macrophages, and monocytes. Preferably, the ITIM-containing receptor is present on the surface of basophils or mast cells. A typical ITIM-containing inhibitory receptor is CD31, also called PECAM-1 (platelet / endothelial cell adhesion molecule 1), present on basophils (Fureder et al., Allergy, 1994; 49: 861-5). It has been demonstrated that cross-linking of CD31 suppresses platelet activation, at least in part due to inhibition of signaling from the collagenous glycoprotein VI receptor. (See Newman et al., Blood. 2001 97 (8): 2351-7). CD31 also inhibits antigen receptors on B lymphocytes via CD31 ITIM (see Wilkinson et al., Blood. 2002; 100 (1): 184-93).

  Another exemplary ITIM-containing inhibitory receptor is CD32B (also known as FcγRIIb). CD32B is a receptor for the Fc fragment of IgG and is a low affinity IIb; (Accession number NP_003992.2).

  Other ITIM-containing receptors are known in the art, including PCT publication WO 96/40788 (PM Guyre and M Fanger); WO 98/09638 (Katz et al., Gp49B1 and FcεRI receptor cross-linking). WO 02/088317 (Saxon et al., Indicating cross-linking of FcγRIIb and FcεRI receptor); WO 02/102320 (An et al., Indicating cross-linking of FcγRIIb and FcεRI receptor); and Daeron et al. , 1995, J Clin Invest 95: 577-585. ITIM-containing receptors can be identified based on the presence or absence of ITIM. These motifs can be identified by methods known in the art (see Staub et al., Cellular Signaling 2004, 16: 435-456).

  Basophils and mast cells contain many ITIM-containing inhibitory receptors. The present invention provides a method for administering to a patient two or more separately targeted ERFAM molecules. The ERFAM molecules are provided sequentially or simultaneously. Therefore, a stronger suppressive effect is achieved by the synergistic action between multiple ERFAMs.

  In certain patient populations, it is desirable to minimize the effects of ERFAM binding only to the IgG4 receptor, or the ITIM / inhibitory receptor to which the ERFAM second functional moiety binds or targets. Thus, ERFAM may contain a cyclic peptide that spontaneously linearizes (“decyclized”) only when bound to IgE. In this model, only then can ERFAM subsequently bind to FcγR, or the corresponding inhibitory receptor. This avoids “blocking” of FcγR by non-IgE-bound ERFAM. Synthetic cyclic peptides that inhibit the interaction between IgE and its high affinity receptor FcεRI are known in the art. For example, McDonnell et al. , 1996 Nat Struct Biol 3: 419-425. A similar methodology can be used to make cyclic peptides that are linear only when bound to IgE. In one embodiment, the peptide is circularized by disulfide bond formation between terminal cysteine residues. In a different embodiment, the cyclic peptide is an L-amino acid peptide and / or a retro-enantiomeric D-amino acid peptide.

(ERFAM apoptosis-inducing receptor binding portion)
In an embodiment, the ERFAM molecule of the invention contains an apoptosis-inducing receptor binding molecule that interacts with an apoptosis-inducing receptor. Apoptosis-inducing receptors are known in the art, and include TNF-related apoptosis-inducing ligand receptor 2, TRAIL receptor 2, TNFR1, Fas, DR3, and AIR / LARD.
[To Victor: Add information you know about this kind of apoptosis-inducing receptor]
(ERFAM characteristics)
An ERFAM molecule contains one or more of the following properties.

  • Safety: The risk of anaphylaxis is reduced because no allergen is given first. Thus, in general, a hospital environment is not required for administration.

  Efficacy: Allergic patients to be treated once the amount of ERFAM modified IgE antibody (IgG4-like antibody) once bound on mast cells reaches a ratio of “suppression” relative to unmodified IgE bound They can eat food allergens freely or be exposed to environmental allergens without symptoms such as anaphylaxis, asthma, rhinitis. Indeed, as IgE is converted to “IgG4-like” antibodies by ERFAM, blood IgE levels rapidly decrease.

  -The effect of ERFAM is limited to its allergen: Since the target antibody is only IgE, there is no interference due to antibody immune responses to other antigens. However, the effect of ERFAM binding only to the IgG4 receptor may be significant. Thus, in one embodiment, ERFAM is a cyclic peptide that spontaneously “decyclizes” only when it is able to bind to IgE and subsequently bind to FcγR. This prevents FcγR from being “blocked” by non-IgE-bound ERFAM.

  -ERFAM does not need to be matched to allergen: Since it is the existing IgE that is responsible for allergen specificity, ERFAM is effective against all IgE-mediated allergies regardless of the allergen. In fact, without even having to identify the causative allergen, the only diagnostic approach to perform is to confirm that the allergy is caused by IgE (ie, that the amount of IgE is increasing).

  • ERFAM need not be tailored to the patient: IgE-Fc is relatively constant and the final polymorphism does not affect its binding to ERFAM. However, if such a polymorphism prevents ERFAM from binding to a particular IgE, IgE will also be unable to bind to its natural ligand, high affinity FcεRI, and no allergic reaction will occur. In addition, FcγR may contain a polymorphism. In this case, the second functional part of this ERFAM is composed of peptides, aptamers, and / or monoclonal antibodies against such polymorphic receptors, which is higher compared to ERFAM containing an IgG4Fc moiety Indicates effectiveness.

  • ERFAM works quickly: allergic symptoms resolve during hours or days of treatment because of the increased ratio of ERCAM-bound IgE / IgE within the patient being treated. In one embodiment, ERFAM is used in anaphylaxis and asthma attacks to stop allergen-induced mast cell degranulation. The ERFAM formulation is administered alone or with an antihistamine.

  • Only short-term treatment is required: several doses over a limited period are sufficient. This avoids long-term daily or periodic administration. When ERCAM-bound IgE becomes the predominant allergen-specific antibody in the circulation, its half-life preferably matches that of natural IgG4. Furthermore, the pharmacokinetic properties of ERFAM are altered using pegylation or other modifications.

  ・ Permanent (long-term) effect: no relapse of allergy. When there is little or no risk to anaphylaxis due to the presence of ERFAM-modified IgE, T cells are gradually immunized by repeated exposure to allergens to ensure natural production of IgG4 instead of allergen-specific IgE production. It becomes. Treatment methods for long-term induction of allergen tolerance can be utilized in combination with one or more treatment methods using ERCAM.

  Easily accepted: ERFAM is not a vaccine and is not related to genetic vaccination or other problematic drugs. Indeed, ERFAM simply converts the patient's own “pathogenic” IgE into a “naturally occurring” protective IgG4-like antibody.

  • Lower cost: Compared to the molecular weight of 150,000 of a monoclonal IgG antibody, peptides are generally smaller than antibodies and have a molecular weight of several thousand daltons depending on the length. For this reason, economic scale-up is possible. First, the therapeutic dose of antibody is mg / kg, while the equivalent dose of peptide is microgram / kg. Second, peptide synthesis is generally less expensive than antibody production. Furthermore, peptide synthesis is relatively easy and does not require as sophisticated equipment as antibody (eg, monoclonal antibody) production.

  Activity depends on the presence of allergens: ERCAM molecules have their antiallergic activity triggered by both specific IgE and allergens, thereby causing co-group formation of inhibitory and provocative receptors Distinguish from other molecules that treat allergic diseases. This molecule has no antiallergic activity unless both specific IgE and allergen are present. Thus, continued naturally occurring exposures provide long-term tolerance. None of the other molecules designed to treat allergic diseases have this activity depending on the presence of specific allergens.

(Quantification of ERCAM activity)
ERFAM activity is quantified using assays well known to those skilled in the art. For example, ERFAM activity can be quantified by measuring ERFAM binding to IgE. Alternatively, ERFAM activity can be quantified by measuring ERFAM binding to an inhibitory receptor, a stimulatory receptor, or an inhibitory receptor. Some assays measure the downstream effects of ERCAM activity.

  In an embodiment of the invention, ERFAM activity is tested in an in vitro system by assessing the ability of ERFAM to inhibit allergen-dependent IgE-mediated human basophil activation. This in vitro model system is well known to those skilled in the art and reproduces phenomena that occur in vivo during the course of allergic reactions.

  In this system, basophils are purified from blood, such as by using a basophil isolation kit available from Milteny Biotec (Berschig Gladbach, Germany, catalog number 130-053-401).

  If basophils are purified from an allergic donor, they are used in the assay without further processing. Alternatively, when purifying basophils from non-allergic individuals, basophils can be obtained by incubating in the presence of allergen-specific IgE antibodies, either purified or contained in the plasma of allergic donors. Sensitize.

Basophils are incubated with ERFAM in the presence of allergen-specific IgE antibodies that are either purified or contained in the plasma of allergic donors. During this process, ERFAM binds to IgE in plasma and FcγR on basophils. Allergens are added to this basophil preparation and a commercially available ELISA (Orpesgen Pharma, Heidelberg, Germany's Basotest ^(r) , or other histamine ELISAs: Neogen catalog number # 409010 or Research Diagnostics Inc. RERE59-RE # 5959) Activation / degranulation is measured by quantifying histamine release using an immunotech # 2015) or radioimmunoassay. Alternatively, basophil activation is assessed by flow cytometry. In this system, the effect of ERFAM is determined by the ability to suppress basophil degranulation.

(Antibody part)
As used herein, the term “antibody” includes immunoglobulin molecules as well as immunologically active portions of immunoglobulin (Ig) molecules, ie, antigen binding sites that specifically bind to (immunoreact with an antigen) an antigen. Refers to molecules that Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, F _ab , F _{ab ′} , F _{(ab ′) 2} fragments, and a F _ab expression library. In general, antibody molecules obtained from humans relate to any of the classes IgG, IgM, IgA, IgE, and IgD, which differ from each other in the nature of the heavy chains present in the molecule. Certain classes have subclasses such as IgG ₁ , IgG ₂ , IgG ₃ , IgG ₄ as well. Furthermore, in humans, the light chain is a kappa chain or a lambda chain. Reference herein to antibodies includes terms that refer to all classes, subclasses, and types of such human antibody species.

The term “epitope” includes any protein determinant capable of specific binding to an immunoglobulin or T cell receptor. Epitopic determinants usually consist of chemically active surface grouping molecules, such as amino acids or sugar side chains, and usually have specific charge characteristics and specific three-dimensional structural characteristics. A polypeptide or fragment thereof contains one or more antigenic epitopes. For example, the anti-IgE antibody of the present invention specifically binds to IgE, and its equilibrium binding constant (K _D ) is ≦ 1 μM, preferably ≦ 100 nM, more preferably ≦ 10 nM, and most preferably ≦ 100 pM. ~ 1 pM, which is measured by radioligand binding assays or similar assays known in the art.

  As used herein, the terms “antigen”, “antigenic”, “allergen”, “allergenic” are intended to denote a substance that causes an immune response when presented to an immune cell of an organism. The The antigen contains one or more immunogenic epitopes recognized by a B cell receptor (ie, an antibody on the B cell membrane) or a T cell receptor. That is, as used herein, these terms refer to any substance that elicits an immune response (eg, peanut allergen, feline scales, etc.) and a hapten that is rendered antigenic under suitable conditions known to those skilled in the art. Point to.

  The constructs of the present invention, or derivatives, fragments, analogs, homologues or orthologs thereof, are used as tolerogens in the generation of immune responses that bind immunospecifically to allergenic components. For example, when ERFAM binds to an allergen-specific IgE antibody, it binds indirectly to the allergen.

  Various techniques known in the art are used for production of polyclonal antibodies or monoclonal antibodies against IgE of the present invention, or derivatives, fragments, analogs, homologues, and orthologs thereof. For example, ANTIBODIES: A LABORATORY MANUAL, Harlow E. et al. , And Lane D, 1988, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. This is incorporated herein by reference.

The invention includes polyclonal antibodies, monoclonal antibodies, humanized antibodies (or human antibodies), _Fab fragments (and single chain antibodies), bispecific antibodies (specific binding to two or more different antigens). Monoclonal antibodies (preferably human or humanized antibodies)), as well as heteroconjugated antibodies (antibodies are composed of two conjugated antibodies). The invention also includes modification of the antibody with respect to effector function, for example, to enhance the effectiveness of the antibody in treating allergies. The invention also relates to immunoconjugates consisting of antibodies conjugated as formula A′-B ′ or A′-XB ′. Conjugates consisting of A ′ and B ′ moieties are N-succinimidyl-3- (2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imide esters (eg, dimethylazi Pimidate HCL), active esters (eg, suberic acid disuccinimide), aldehydes (eg, glutaraldehyde), bisazide compounds (eg, bis (p-azidobenzoyl) hexanediamine), bisdiazonium derivatives (eg, bis ( various duplexes such as p-diazonium benzoyl) -ethylenediamine), diisocyanates (eg toluene 2,6-diisocyanate), and bis-active fluorine compounds (eg 1,5-difluoro-2,4-dinitrobenzene) Functional protein coupling agent It is assembled by use. For example, ERFAM constructs are described in Vitetta et al. , Science, 238: 1098 (1987).

(Diagnostic use for ERCAM)
ERFAM is used in methods known in the art for protein localization and / or quantification (eg, used in diagnostic procedures for use in determining the amount of protein in an appropriate physiological sample) For use in imaging). In certain embodiments, antibodies to IgE or inhibitory receptors, proteins containing antigen binding regions, or derivatives, analogs or homologues thereof are utilized as pharmacologically active compounds. For example, when used for imaging, detection can be facilitated by coupling (ie, physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase, and suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin, suitable Examples of fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin, examples of luminescent materials include luminol, bioluminescent materials Examples include luciferase, luciferin, and aequorin, and examples of suitable radioactive materials include ¹²⁵ I, ¹³¹ I, ³⁵ S, or ³ H.

(ERFAM treatment)
The ERFAM constructs of the present invention, including polyclonal, monoclonal, humanized, and fully human antibodies, are contemplated as therapeutic agents. Such agents are generally used to treat or prevent a patient's disease or disorder. It is preferably used to treat allergen-mediated allergic reactions. The antibody preparation is administered to the patient and generally works by binding to the target. Such an effect is one of two and depends on the special nature of the interaction between the administered antibody molecule and the target antigen in question. In the first example, administration of this antibody may abolish or inhibit the binding of FcεRI to the IgE antibody to which it naturally binds. In this case, the ERFAM molecule binds to the IgE Fc region and blocks the FcεRI α subunit from binding to IgE. In this way, ERFAM molecules reduce the cascade reaction induced by cross-linking of mast cell-bound IgE.

  Alternatively, the ERFAM molecule has the effect of leading to physiological results due to its ability to bind to an effector binding site that induces suppression of allergic reactions. Although the inventor does not want to be bound by this, one mechanism that is contemplated is that the IgG4 portion of the ERFAM molecule recruits inhibitory subunits to the Fc receptor complex, thereby binding it to the stimulating immune cell. It mediates a cascade reaction that leads to repression rather than activation.

  A therapeutically effective amount of antibody generally relates to the amount required to achieve a therapeutic purpose. The amount required to administer further depends on the binding affinity of the ERFAM molecule to its specific antigen / receptor, and the administered ERFAM molecule is removed from the blood volume of the patient receiving it. Varies with speed. For example, a general range of therapeutically effective doses of antibody or antibody fragment is about 0.1 mg / kg body weight to about 50 mg / kg body weight, but is not limited thereto. The general frequency of administration can range, for example, from twice a day to once a week. In a preferred embodiment, the ERFAM molecular bolus is administered as a single injection followed by SIT treatment to induce permanent tolerance without the risk of side effects such as anaphylactic shock.

(Pharmaceutical composition)
The antibody constructs of the present invention can be administered in the form of pharmaceutical compositions for the treatment of various diseases, together with related molecules readily recognized by those skilled in the art. Principles and considerations in the preparation of such compositions, as well as guidance in component selection, are described, for example, in REMINGTON: THE SCIENCE AND PRACTICE OF PHARMACY, 19th Edition (Alfonso R. Gennaro, et al.) Mack Pub. Co. Easton, Pa. 1995; DRUG ABSORPTION ENHANCEMENT: CONEPEPTS, POSSIBILITIES, LIMITATIONS, AND TRENDS, Harwood Academic Publishers, Langhome, Pa. , 1994; and PEPTIDE AND PROTEIN DRUG DELIVERY (Advanceds In Parental Sciences, Vol. 4), 1991, M .; Available at Dekker, New York.

  Peptides consisting of ERFAM constructs can be chemically synthesized and / or produced by recombinant DNA methods. For example, Marasco et al. , Proc. Natl. Acad. Sci. USA, 90: 7889-7893 (1993). The composition may contain one or more active ingredients necessary for the particular usage being treated, and preferably have complementary activities that do not adversely affect each other. Alternatively or in addition, the composition can be an agent that enhances the function of the composition (eg, IL-2, INF-γ, IL-10 and / or TGF-β), or IL-4 or IL-13 Can contain drugs that bind and / or sequester. Such molecules are suitably present in compositions and amounts that are effective for the purpose intended.

  The active ingredient can be encapsulated in microcapsules prepared, for example, by coacervation or interfacial polymerization. Examples of these are hydroxymethylcellulose or gelatin microcapsules and polymethylmethacrylate microcapsules, respectively, colloid drug delivery systems (eg liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules) or macroemulsions. Present in liquid.

  The composition used for in vivo administration is sterilized. This is easily accomplished by filtering through a sterile filtration membrane.

Sustained release preparations can be prepared. Suitable examples of sustained release preparations include a semi-permeable matrix consisting of a solid hydrophobic polymer containing antibodies, which matrix is in the form of a molding such as a film or microcapsule. Examples of sustained release matrices include polyesters, hydrogels (eg, poly (2-hydroxyethyl-methacrylate), or poly (vinyl alcohol), polylactide (US Pat. No. 3,773,919), L-glutamic acid and γ Degradable lactic acid-glycolic acid copolymers such as copolymers with ethyl-L-glutamate, non-degradable ethylene-vinyl acetic acid, LUPRON DEPOT ^™ (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), And poly-D-(-)-3-hydroxybutyric acid, although polymers such as ethylene-vinylacetic acid and lactic acid-glycolic acid can release molecules for over 100 days, some hydrogels are more Releases protein for a short period of time.

  The ERFAM constructs of the present invention, and derivatives, fragments, analogs and homologues thereof can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically consist of an ERFAM construct and a pharmaceutically acceptable carrier. As used herein, “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents that are compatible with pharmaceutical administration. Etc. are intended to be included. Suitable carriers are described in the latest edition of Remington's Pharmaceutical Sciences, a standard reference text in this field (which is incorporated herein by reference). Preferred examples of such carriers or solvents include, but are not limited to, water, saline, finger solution, dextrose solution, and 5% human serum albumin. Nonaqueous carriers such as liposomes and fixed oils can also be used. The use of such solvents and drugs for pharmaceutically active substances is well known in the art. It is contemplated to use them in this composition, except in any conventional solvents or drugs that are incompatible with the active compound. Supplementary active substances can also be combined with the compositions.

  A pharmaceutical composition is formulated to be compatible with its intended route of administration. Examples of administration routes include intravenous administration, intraperitoneal administration, parenteral administration such as subcutaneous administration, oral administration (for example, inhalation), transdermal administration (for example, topical administration), transmucosal administration, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous administration can contain the following ingredients. : Sterile diluents such as water for injection, physiological saline solution, fixed oil, polyethylene glycol, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methylparaben, antioxidants such as ascorbic acid or sodium bisulfite Agents; Chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers for acetic acid, citric acid, phosphoric acid and the like, and agents for adjusting osmotic pressure such as sodium chloride and dextrose. The pH can be adjusted using an acid or base such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL ^™ (BASF, Parsippany, NJ), or physiological saline phosphate buffer (PBS). In all cases, the composition is sterile and liquid so that it can simply be injectable. It is stable under manufacturing and storage conditions and is stored against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. . Prevention of the action of microorganisms can be achieved, for example, by using various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal and the like. In many cases, it is preferable to contain, for example, sugar, polyhydric alcohols such as mannitol, sorbitol, and sodium chloride in the composition. By including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin, long-term absorption of the injectable compositions is possible.

  Sterile injectable solutions can be prepared by mixing the required amount of ERFAM construct with one or a combination of the above listed required components in a suitable solvent followed by filter sterilization. Generally, dispersions are prepared by mixing the active compound with a sterile carrier that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the methods of preparation include vacuum drying and lyophilization methods in which any other desired ingredient is obtained in addition to the active ingredient powder from a pre-filter sterilized solution It is.

  Oral compositions generally contain an inert diluent or an edible carrier. These are enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with pharmaceutical additives and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a liquid carrier for use as a mouthwash, in which case the compound in the liquid carrier is orally administered and exhaled or swallowed. Pharmaceutically acceptable binding agents, and / or adjuvant materials can be included as part of the composition. These tablets, pills, capsules, troches and the like can contain any of the following components or compounds having similar properties; binders such as microcrystalline cellulose, tragacanth gum or gelatin; starch or lactic acid, etc. Pharmaceutical additives; disintegrating agents such as alginic acid, primogel, or corn starch; lubricants such as magnesium stearate or sterotes; lubricants such as colloidal silicon dioxide; sweeteners such as sucrose or saccharin; or peppermint, methyl salicylate, Or a flavor such as orange flavor.

  In one embodiment, the active compound is prepared with a carrier that prevents the compound from being rapidly eliminated from the body (eg, a sustained release formulation), including implants as well as microcapsule delivery systems. Biodegradable biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such compositions will be apparent to those skilled in the art. Materials are available from Alza Corporation as well as Nova Pharmaceuticals, Inc. Can also be purchased from

  For ease of administration and uniformity of dosage, it may be advantageous to formulate the ERFAM construct in a unit dosage form. As used herein, a unit dosage form refers to a physically separated unit suitable as a unit dosage for the patient being treated, each unit together with the required pharmaceutical carrier desired. A predetermined amount of active compound calculated to produce a therapeutic effect. The breakdown of this unit dosage form depends on the unique properties of the active compound and the specific therapeutic effect to be achieved, as well as the inherent limitations in the technology for formulating such active compounds for the treatment of individuals, and Depends directly on these.

  The pharmaceutical composition can be included in a container, pack, kit, or dispenser together with instructions for administration. In one embodiment, ERFAM is packaged together with an antihistamine in one kit. In another embodiment, the ERFAM formulation contains an antihistamine. Ideally, the ERFAM formulation is administered shortly before or after exposure of the patient to the allergen. ERFAM formulations containing antihistamines are grouped together for use by allergic patients as a popular drug to suppress anaphylactic reactions.

(Therapeutic ERCAM constructs conjugated with polymers)
Based on the disclosure herein, a chemically modified (eg, polymer conjugated) ERFAM construct is prepared by one of ordinary skill in the art. The most suitable chemical moiety for addition to the ERFAM construct (referred to as “derivatization” of the ERFAM construct) includes a water soluble polymer. A water-soluble polymer is advantageous because the protein to be bonded does not precipitate in an aqueous environment such as a physiological environment. In some embodiments, the polymer is pharmaceutically acceptable for the preparation of a therapeutic product or composition.

  It is contemplated that two or more polymer molecules will be similarly bonded, but if desired, only one polymer molecule is used for binding to the ERFAM construct. In some embodiments, two, three, or four polymer molecules are used for conjugation, but preferably three polymer molecules are used for conjugation, eg, first and second The polymer molecule is attached to the N-terminal amino acid of the ERFAM construct and the third polymer molecule is conjugated to an internal amino acid (ie, a non-terminal amino acid). The conjugated ERFAM construct has utility in both in vivo and non-in vivo applications. Further, it is understood that polymer attachment may utilize any other functional group, moiety, or other attachment species as appropriate for the final application. By way of example, in some applications, a functional moiety that imparts UV degradation resistance or antioxidant power, or sustained serum retention, or other properties or properties to the polymer is covalently attached to the polymer. Is useful. As yet another example, in some applications, to alter the properties of the polymer to give the polymer reactivity or crosslinkability in properties, to enhance various properties or properties of the overall conjugated material. It is advantageous to add functionality. Thus, the polymer may contain any functionality, recurring functional groups, binding states, or other partial constituents that do not interfere with the effectiveness of the ERFAM conjugating construct for the intended purpose.

  The skilled artisan will determine whether the polymer / protein conjugate is used therapeutically and, if so, based on the desired dosage, circulation time, proteolytic resistance, and other considerations. A polymer can be selected. The effectiveness of derivatization can be achieved by administering the derivative in the desired form (eg, by osmotic pump, or by injection or infusion, or further configured for oral, pulmonary, or other delivery routes). And confirmed by determining its effectiveness.

  Suitable water-soluble polymers include polyethylene glycol, ethylene glycol / propylene glycol copolymer, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly 1,3-dioxolene, poly 1,3,6-trioxane, ethylene / maleic anhydride Copolymers, polyamino acids (either homopolymers or random copolymers), and dextran or poly (n-vinylpyrrolidone) polyethylene glycol, propylene glycol homopolymers, polypropylene oxide / ethylene oxide copolymers, polyoxyethylenated polyols ( Including, but not limited to, glycerol), polyvinyl alcohol, and mixtures thereof. Due to its stability in water, polyethylene glycol propionaldehyde may have advantages in manufacturing.

  The polymer is of any suitable molecular weight, which is branched or unbranched.

  For polyethylene glycol (PEG), the molecular weight is preferably between about 2 kDa and about 100 kDa for convenient operation and production (the term “about” as used herein refers to the preparation of polyethylene glycol). Means that some molecules are larger or somewhat smaller than the stated molecular weight). Desired therapeutic properties (eg, desired sustained release time; in some cases effects on biological activity; ease of handling; degree or lack of antigenicity, and effects of known polyethylene glycols on therapeutic proteins or variants thereof Etc.) Use other sizes. In some embodiments, the preferred molecular weight is about 10 kDa.

  The number of polymer molecules thus adhered can vary and one skilled in the art can ascertain their effect on function. One provides two, three, four, or some combination of derivatizations that have the same or different chemical moieties (eg, polymers such as polyethylene glycols of various molecular weights), even one derivatization May be. The ratio of polymer molecules to protein (or polypeptide) molecules varies and the concentration in the reaction mixture varies as well. In general, the optimal ratio (with respect to the effectiveness of the reaction in which there is no excess that does not reach the protein or polymer) depends on the degree of derivatization desired (eg monoderivatives, diderivatives, triderivatives etc.), the molecular weight of the polymer chosen Depending on factors such as whether the polymer is branched or unbranched, and reaction conditions.

In one embodiment, a polyethylene glycol molecule (or other chemical moiety) is attached to the protein, taking into account the effect on the functional or antigenic region of the protein. There are a number of bonding methods available to those skilled in the art. For example, EP 0 401384
(Coupling of PEG to G-CSF); Mark et al. , Exp. Hematol. 20: 1028-1035, 1992 (reports PEGylation of GM-CSF using tresyl chloride).

  For example, polyethylene glycol is covalently bonded via an amino acid residue via a reactive functional group such as a free amino group or a carboxyl group. A reactive functional group is a functional group to which an activated polyethylene glycol molecule binds. Amino acid residues having a free amino group can include lysine residues and the N-terminal amino acid residue. Those having a free carboxyl group may include aspartic acid residues, glutamic acid residues, and the C-terminal amino acid residue. Also, a sulfhydryl group can be used as a reactive functional group for adhering polyethylene glycol molecules. For therapeutic purposes, in some embodiments, attachment at the amino group is preferred, such as attachment at the N-terminus or lysine group. If receptor binding is desired, adhesion at residues important for receptor binding is avoided.

  In particular, an N-terminal chemically modified protein may be desired. The description of the ERFAM composition of the present invention uses polyethylene glycol, but from various (molecular weight, branched, etc.) polyethylene glycol molecules, the ratio of polyethylene glycol molecules to protein (or peptide) in the reaction mixture, the pegylation performed. The type of reaction as well as the method of obtaining the selected N-terminal PEGylated protein can be selected. The method of obtaining an N-terminal PEGylated preparation (ie separating this part from other mono-PEGylated if necessary) is by purifying the N-terminal PEGylated material from a population of PEGylated protein molecules. Selective N-terminal chemical modification is achieved by reductive alkylation, which provides different reactivity (lysine vs. N-terminus) than other types of primary amino groups available for derivatization in specific proteins. use. Under appropriate reaction conditions, substantially selective protein derivatization is achieved at the N-terminus with polymers containing carbonyl groups. For example, reaction at a pH at which the pKa between the epsilon amino group (e-amino group) of the lysine residue and the alpha amino group (a-amino group) of the N-terminal residue of the protein can be obtained. Can be used to selectively N-terminal PEGylate proteins. Such selective derivatization modulates the adhesion of the water-soluble polymer to the protein. That is, the binding to the polymer occurs predominantly at the N-terminus of the protein, and no significant modification occurs at other functional groups such as lysine side chain amino groups.

  When using reductive alkylation, the water-soluble polymer is of the type described above and has one reactive aldehyde for binding to the protein. Polyethylene glycol propyl aldehyde containing one reactive aldehyde is used.

  The invention encompasses the use of ERFAM expressed in prokaryotic cells, expressed in eukaryotic cells, or synthesized.

  Pegylation is achieved by any pegylation reaction known in the art. See, for example, Focus on Growth Factors, 3 (2): 4-10, 1992; EP 0 154 316; EP 0 401 384; and other publications related to pegylation cited herein. Pegylation is accomplished via an acylation reaction or an alkylation reaction using reactive polyethylene glycol (or a similar reactive water-soluble polymer).

  Pegylation by acylation generally involves reacting an active ester derivative of polyethylene glycol (PEG). This pegylation is achieved using any known or later discovered reactive PEG molecule. A preferred activated PEG ester is PEG esterified to N-hydroxysuccinimide (NHS). As used herein, “acylation” includes, but is not limited to, the following types of linkages between the therapeutic protein and water-soluble polymers such as PEG: amides, carbamates, urethanes, etc. . Bioconjugate Chem. 5: 133-140, 1994. The reaction conditions are well known in the field of pegylation or are selected from any later developed, but the temperature, solvent, and pH that inactivates the ERFAM construct to become a polymer conjugate. Avoid such conditions.

  PEGylation by acylation generally results in a poly-pegylated ERCAM product. In some embodiments, the linking bond is an amide. Also, in some embodiments, the resulting product is substantially (eg,> 95%) only monopegylated, dipegylated, or tripegylated. However, depending on the specific reaction conditions used, species with a higher degree of pegylation may be formed. If desired, more purified PEGylated species can be converted to unreacted species, etc. by standard purification techniques including dialysis, salting out, ultrafiltration, ion exchange chromatography, gel filtration chromatography and electrophoresis as an example. Separate from the mixture.

Pegylation by alkylation generally involves reacting a terminal aldehyde derivative of PEG with ERFAM in the presence of a reducing agent. PEGylation by alkylation also results in polyPEGylated ERCAM products. Furthermore, reaction conditions that substantially promote pegylation (ie, monopegylated protein) only at the N-terminal α-amino group of ERFAM can be skillfully set. In either case of monoPEGylation or polypegylation, the PEG group can be attached to the protein via the —CH ₂ —NH— group. This type of linkage, particularly for the —CH ₂ — group, is referred to herein as an “alkyl” linkage.

  Derivatization via reductive alkylation to make monopegylated products exploits the different reactivity (lysine versus N-terminus) of the various types of primary amino groups available for derivatization. This reaction is carried out at a pH that benefits from the difference in pKa between the e-amino group of the lysine residue and the a-amino group of the N-terminal residue of the protein. Such selective derivatization modulates the adhesion of water-soluble polymers containing reactive functional groups such as aldehydes to proteins. That is, adhesion to the polymer occurs mainly at the N-terminus of the protein, and no significant modification of other reactive functional groups such as amino groups of lysine side chains occurs.

  The polymer molecules used in both the acylation method and the alkylation method are selected from the water-soluble polymers described above. The selected polymer is modified to have one reactive functional group (eg, an active ester for acylation or an aldehyde for alkylation), so that the degree of polymerization is provided in the method of the present invention. Adjusted to An exemplary reactive PEG aldehyde is water-stable polyethylene glycol propionaldehyde, or its mono C1-C10 alkoxy or aryloxy derivative (see US Pat. No. 5,252,714). The polymer is branched or unbranched. For the acylation reaction, the selected polymer has one reactive ester group. In general, water-soluble polymers will not be selected from natural glycosyl residues since they are usually more conveniently made by mammalian recombinant expression systems. The polymer is of any molecular weight and is branched or unbranched.

  An exemplary water soluble polymer for use herein is polyethylene glycol. As used herein, polyethylene glycol includes any form of PEG that has been used to derivatize other proteins, such as mono- (C1-C10) alkoxy polyethylene glycol or aryloxy polyethylene glycol. Means.

  In general, chemical derivatization is performed under any suitable conditions used to react biologically active materials with activated polymer molecules. Methods for preparing pegylated ERFAM generally include: (a) ERFAM protein or ERFAM peptide is converted to polyethylene glycol (reactive ester or aldehyde derivative of PEG) under conditions in which the ERFAM molecule is attached to one or more PEG groups. And (b) obtaining a reaction product. In general, the optimum reaction conditions for the acylation reaction will be determined from case to case based on known parameters as well as the desired result. For example, the larger the ratio of PEG / protein, the greater the ratio of polypegylated products.

  Reductive alkylation to create a practically homogeneous population of monopolymer / ERFAM generally (a) reduction at the appropriate pH to allow selective modification of the a-amino group at the amino terminus of ERCAM. A step of reacting an ERFAM protein or an ERFAM peptide with a reactive PEG under static alkaline conditions, and (b) obtaining a reaction product.

  The pH also affects the ratio of polymer to protein to be utilized. In general, the lower the pH, the more polymer is desired for the protein (ie, the lower the reactivity of the N-terminal a-amino group, the more polymer is needed to achieve optimal conditions ). If the pH is high, the polymer: protein ratio need not be as large (ie, the more reactive functional groups available, the fewer polymer molecules are required). For the purposes of the present invention, the pH generally falls within the range of 3-9, preferably 3-6.

  Another important consideration is the molecular weight of the polymer. In general, the higher the molecular weight of the polymer, the fewer polymer molecules bound to the protein. Similarly, polymer branching is considered in optimizing these parameters. In general, the higher the molecular weight (or the more branched) the higher the polymer: protein ratio. In general, for pegylation reactions contemplated herein, the average molecular weight is preferably from about 2 kDa to about 100 kDa. A preferred average molecular weight is from about 5 kDa to about 50 kDa, such as 10 kDa.

  In some embodiments, ERFAM is linked to the polymer via a terminal reactive functional group on the polypeptide. Alternatively or in addition, ERFM may be used for side chain amino groups of internal lysine residues, such as, for example, lysine residues introduced into the amino acid sequences of natural subunits utilized in constructing ERCAM molecules. Connected through. Thus, the conjugate can also be branched from a non-terminal reactive functional group. A polymer having this reactive functional group is referred to herein as an “activated polymer”. This reactive functional group selectively reacts with the free amino group of proteins or other reactive functional groups.

  Bind in activated polymer with any available ERCAM amino group, such as alpha amino group or epsilon amino group, of lysine residue or residue introduced into amino acid sequence of ERFAM polypeptide subunit or variant thereof Can happen. ERFAM free carboxyl groups, appropriately activated carbonyl groups, hydroxyl groups, guanidyl groups, imidazole groups, oxidized carbohydrate moieties, and mercapto groups can also be utilized as binding sites (if available).

  Generally, from about 1.0 mole to about 10 moles of activated polymer is used per mole of protein, depending on the protein concentration. The final amount is an amount that balances with the amount that maximizes the extent of reaction while minimizing non-specific modification of the product, which simultaneously defines the chemistry that maintains optimal activity, An amount that optimizes the half-life of the protein if possible. In some embodiments, at least about 50% of the biological activity of the protein is retained, and in other embodiments, approximately 100% is retained.

  The polymer can be conjugated to the ERCAM polypeptide using methods known in the art. For example, in some embodiments, the polyalkylene glycol moiety is attached to a lysine group of ERFAM or modified ERFAM. This attachment to the lysine group is achieved using N-hydroxysuccinimide (NHS) active esters, such as PEG succinimidyl succinate (SS-PEG) and PEG succinimidyl propionate (SPA-PEG). can do. Suitable polyalkylene glycol moieties include, for example, carboxymethyl-NHS, norleucine-NHS, SC-PEG, tresylate, aldehyde, epoxide, carbonylimidazole, and PNP carbonate.

  Yet another amine-reactive PEG linker can be substituted for the succinimidyl moiety. These include, for example, isothiocyanate, nitrophenyl carbonate, epoxide, and benzotriazole carbonate. In some embodiments, the conditions are selected to maximize the selectivity and extent of the reaction.

  If desired, the ERFAM can also contain a tag that can be subsequently released by proteolysis, such as a histidine tag separated by an enterokinase cleavage site (ie, 10 histidine). Thus, a histidine tag variant is first reacted with a low molecular weight linker (eg, trout reagent (Pierce)), which is then reacted with both lysine and the N-terminus, followed by release of the histidine tag. This lysine moiety can be selectively modified. The polypeptide subsequently contains a free SH group, which is a PEG containing a thiol-reactive head functional group, such as a maleimide group, a vinylsulfone group, a haloacetate group, or a free SH or protected SH. Can be selectively modified.

  The trout reagent can be replaced with any linker that will create a specific site for PEG attachment. For example, the trout reagent can be replaced with SPDP, SMPT, SATA, or SATP (all available from Pierce). Similarly, a protein can be coupled to an amine reactive linker that inserts a maleimide group (eg, SMCC, AMAS, BMPS, MBS, EMCS, SMPB, SMPH, KMUS, or GMBS), an amine reactive linker that inserts a haloacetate group (eg, SBAP). , SIA, SIAB), or an amine reactive linker that inserts a vinyl sulfone group, and the resulting product is reacted with PEG containing free SH. The only limitation on the size of the linker employed is that it cannot prevent subsequent N-terminal tag removal.

  Thus, in another embodiment, the polyalkylene glycol moiety is attached to the cysteine group of the ERFAM or modified ERFAM construct. For example, coupling can be accomplished using maleimide groups, vinylsulfone groups, haloacetate groups, and thiol groups.

  In some embodiments, the polymer-bound ERFAM in the composition has a longer serum half-life as compared to the half-life of the modified ERFAM in the absence of polymer. Alternatively or in addition, polymer-bound ERFAM in the composition binds to GFR, activates RET, normalizes neuronal pathological changes, or enhances neuronal survival Or achieve a combination of these physiological functions.

  In some embodiments, the composition is provided as a stable water-soluble polymer-bound ERFAM or modified polymer-bound ERFAM coupled to a polyethylene glycol moiety. If desired, the ERFAM or modified ERCAM construct is attached to the polyethylene glycol moiety by a labile bond. This reactively active bond can be cleaved, for example, by biochemical hydrolysis, proteolysis, or sulfhydryl cleavage. For example, this bond can be cleaved under in vivo (physiological) conditions.

  Other reaction parameters such as solvent, reaction time, temperature, etc., and product purification methods can be determined by one skilled in the art.

(Synthesis and isolation of ERCAM constructs)
The modified ERFAM can be isolated using methods known in the art. Natural ERFAM subunits can be isolated from immune cells, hybridomas, or tissue sources by an appropriate purification procedure using standard protein purification methods. Alternatively, the modified ERFAM can be chemically synthesized using standard peptide synthesis methods. The synthesis of short amino acid sequences is well established in the peptide field. See, for example, Stewart et al., SOLID PHASE PEPTIDE SYNTHESIS (2d ed., 1984).

  In another embodiment, the ERFAM construct is made by recombinant DNA methods. For example, a nucleic acid molecule encoding an ERFAM construct whose linker moiety is a polypeptide linker can be inserted into a vector such as an expression vector and the nucleic acid can be introduced into a cell. Suitable cells include, for example, mammalian cells (such as human cells or Chinese hamster ovary cells), fungal cells, yeast cells, insect cells, and bacterial cells. When expressed in recombinant cells, the cells can be cultured under conditions that allow expression of the ERFAM construct. If desired, the ERFAM construct can be recovered from the cell suspension. As used herein, “recovered” means that the modified polypeptide has been separated from these components of the cell or medium present prior to the recovery procedure. The recovery procedure may include one or more regeneration procedures or purification procedures.

  The ERFAM construct can be constructed using any number of techniques known in the art. One such method is site-directed mutagenesis, in which one amino acid (or a small number of amino acid residues determined in advance, if desired) within the encoded ERFAM construct. To change one specific nucleotide (or a few specific nucleotides, if desired). Those skilled in the art recognize that site-directed mutagenesis is a conventional and widely used technique. In fact, many site-directed mutagenesis kits are commercially available. One such kit is the “Transformer Site Directed Mutagenesis Kit” sold by Clonetech Laboratories (Palo Alto, Calif.).

  Unless stated otherwise, the practice of the present invention involves cell biology, cell culture, molecular biology, microbiology, recombinant DNA, protein chemistry, and immunology conventional within the skill of the art. Use the technique. Such techniques are described in the literature. For example, Molecular Cloning: A Laboratory Manual, 2nd edition (Sambrook, Fritsch and Maniatis, eds.), Cold Spring Harbor Laboratory Press, 1989; DNA Cloning, Vol. Synthesis, (MJ Gait, ed.), 1984; U.S. Pat. No. 4,683,195 (Mullis et al.); Nucleic Acid Hybridization (BD Haines and S. J. Higgins, eds.), 1984; Transaction and Transl tion, 1984 (B.D.Haines and S.J.Higgins, eds.); Culture of Animal Cells (R.I.Freshney, ed), Alan R. Liss, Inc. , 1987; Immobilized Cells and Enzymes, IRL Press, 1986; A Practical Guide to Molecular Cloning (B. Perbal), 1984; Methods in Enzymology, Vol. Transfer Vectors for Mammalian Cells (JH Miller and MP Palos, eds.), 1987, Cold Spring Harbor Laboratories; Immunochemical Methods in Cells and Cells. y (Mayer and Walker, eds.), Academic Press, London, 1987; Handbook of Experimental Immunology, Volume I to Volume IV, D.M. , Cold Spring Harbor Laboratory Press, 1986.

Polymer-bound ERFAM construct If desired, the polymer-bound ERFAM construct can be provided as a fusion protein. Fusion polypeptide derivatives of proteins also include various structural forms of primary proteins that retain biological activity. As used herein, “fusion” refers to two, via individual peptide backbones, such as through genetic expression of a polynucleotide molecule encoding a protein in the same reading frame (ie, “in frame”). It refers to the co-linear covalent bond of the above protein or fragment thereof. The protein or fragment thereof is preferably different in origin. Thus, some fusion proteins include a modified ERFAM construct or fragment covalently linked to a second portion that is not a modified ERFAM. In some embodiments, this second portion is derived from a polypeptide that is present as a monomer and is sufficient to confer increased solubility and / or bioavailability to the ERFAM construct.

Pharmaceutical Compositions Containing Polymer-Bound ERFAM Also provided are pharmaceutical compositions that include the modified ERFAM constructs of the present invention. As used herein, a “pharmaceutical composition” comprises an ERFAM construct or an ERFMAM conjugate of the invention, dispersed in a physiologically available carrier, and optionally one or more physiologically compatible components. Is defined as containing. Accordingly, when this pharmaceutical composition contains an excipient such as water, one or more inorganic salts, a sugar, a surfactant, and one or more carriers such as an inactive protein (eg, heparin or albumin) There is.

  The ERFAM construct is administered per se and in addition in the form of pharmaceutically available esters, salts, and derivatives thereof with other physiological functions. In such pharmaceutical and pharmaceutical compositions, the modified ERFAM construct is utilized with one or more pharmaceutically available carriers and optionally any other therapeutic ingredients.

  A carrier is compatible with pharmaceutical use in the sense that it is compatible with the other ingredients of the composition and not inappropriately harmful to its recipient. The ERFAM construct is in an amount effective to achieve the desired pharmacological effect or medically beneficial effect as described herein, and the desired in vivo biological utilization. Provided in an amount appropriate to achieve the possible dose or concentration.

  Formulations include those suitable for parenteral administration in addition to those suitable for parenteral administration, and specific modes of administration include oral, rectal, buccal, topical, nasal, ophthalmic. , Subcutaneous, intramuscular, intravenous, transdermal, intrathecal, intraarticular, intraarterial, intrathecal, bronchial, lymphatic, transvaginal, and intrauterine administration. Formulations suitable for aerosol and parenteral administration (both local and systemic administration) are preferred.

  Where the ERFAM construct is utilized in a formulation comprising a liquid solution, the formulation is advantageously administered orally, bronchially, or enterally. When the ERFAM construct is used as a powder in a liquid suspension formulation or in a biocompatible carrier composition, it is advantageous to administer the formulation orally, rectally, or bronchially . Alternatively, the gaseous state of the powder that is administered nasally or via the bronchus via nebulization of the powder in the carrier gas, by which the patient inhales from the breathing circuit containing the appropriate nebulization device A dispersion is formed.

  Formulations containing the protein of the invention may conveniently be present in unit dosage form, which is prepared by any of the methods well known in the pharmaceutical arts. In general, the methods include a procedure for bringing into association the active ingredient with the carrier which constitutes one or more accessory ingredients.

  Typically, this formulation is prepared by associating the active ingredient uniformly and intimately with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, the product To the desired dosage form.

  Formulations of the present invention suitable for oral administration are individual units such as capsules, cachets, tablets, or troches, each containing a predetermined amount of the active ingredient as a powder or granule, or a syrup , Elixirs, emulsions, or suspensions in aqueous or non-aqueous liquids such as a single dose.

  Formulations suitable for parenteral administration conveniently comprise a sterile aqueous preparation of the active conjugate which can be isotonic with the recipient's blood (eg, saline). Such formulations may include suspending agents as well as thickeners or other microparticulate systems designed to direct the compound to blood components or one or more organs. The formulation may exist in unit dosage forms or multiple dosage forms.

  The nasal spray composition comprises a purified aqueous solution containing a preservative as well as an isotonic agent in the active conjugate. The formulation can be adjusted to a pH and osmotic pressure compatible with the nasal mucosa.

  A composition for rectal administration may be present as a suppository with a suitable carrier such as cocoa butter, hardened fat, or hardened fatty carboxylic acid. Ophthalmic formulations such as eye drops are prepared by the same method as nasal spray, but their pH and isotonicity can be adjusted to suit the eye.

  Topical formulations consist of conjugates dissolved or suspended in one or more media, such as mineral oil, mineral oil, polyhydroxy alcohol, or other bases used in topical pharmaceutical formulations. Including.

  In addition to the above components, the formulation of the present invention further includes diluents, buffers, flavoring agents, disintegrants, surfactants, thickeners, lubricants, preservatives (including antioxidants), etc. One or more auxiliary components selected from are included. The foregoing considerations also apply to ERFAM fusion proteins (eg, ERFAM-HSA fusions).

  Accordingly, the present invention includes provision of fusion proteins suitable for in vitro solution stabilization of ERCAM constructs as an illustrative application of the present invention. This fusion protein may be used, for example, to increase resistance to enzymatic degradation of the polypeptide portion of the ERFAM construct, which provides measures to improve expiration date, room temperature stability, and the like. It is understood that the above discussion also applies to the ERFAM construct-serum albumin fusion proteins of the present invention (including human / humanized ERFAM construct-human serum albumin fusion proteins).

Therapeutic Methods Polymer-bound ERFAM constructs and modified polymer-bound ERFAM constructs and truncated polymer-bound ERFAM constructs are used to treat pathological conditions in living animals, preferably mammals, more preferably humans, including primates. May be used to alleviate, and the disorder or disease is responsive to the activity of an immunosuppressive active. A preferred pathological condition is that of an inappropriate allergic reaction within the patient.

Active molecule preparation method:
The production of peptide ligands by phage display (WO 90/02809) and the production of aptamers (WO 92/14843) have been described previously.

  Kits (phages and their respective oligonucleotide libraries) are also commercially available from numerous companies and are currently used extensively for research.

Method of allergy treatment using ERFAM or IgG4 ERFAM (or allergen-specific IgG4) is used for patients with IgE-mediated allergy during or without allergic reaction due to short-term treatment To be administered. One of ordinary skill in the art can readily determine a therapeutically effective amount, and the ultimate goal is to dramatically reduce or resolve allergic reactions in patients undergoing treatment. After an appropriate period (eg, the next day), the allergic inhibitory effect of ERFAM is determined by a skin prick test against a suspected allergen or by allergen-induced basophil degranulation (using peripheral blood). If the allergic reaction is actually decreasing, the allergen is administered under conditions protected by ERFAM to induce immune tolerance and treat the allergy permanently.

  The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.

  The following examples are illustrated by illustrating various non-limiting aspects of the present invention.

Example 1: ERFAM obtained by binding IgG4 antibody to anti-IgE antibody
Anti-IgE rabbit polyclonal antibody was purchased from Washington Biotechnology Inc (Simpsonville, MD). This is the same as that published in KJ Dorrington and HH Bennich (Structure-function relations in human immunoglobulin E) Immunological Review 1978, 41: 3-26 in sequence 3 in human C3 Obtained by immunizing rabbits with peptide GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1), which is the amino acid at ~ residue 359. This antibody was affinity purified from rabbit serum using a biotinylated target peptide (synthesized by Sigma Genosys) conjugated to AffinityPak ^™ Immobilized Avidin Column (Pierce) and further using a Sartorius concentrator (MWCO 100,000). And concentrated. Antibody concentration was measured using Pierce's BCA protein assay system. Human IgG4 antibody (affinity purified from human myeloma serum) was purchased from Sigma (catalog number I-4683). ERFAM compounds were made by cross-linking the two antibodies using Pierce's Controlled protein-protein cross-linking kit (23456).

  Briefly, 500 microliters of dimethylformamide was added to dissolve 2 mg N-succinimidyl S-acetylthioacetate (SATA), followed by 28 microliters (10-fold molar excess) of 2 ml anti-IgE antibody ( 3 mg / ml PBS-EDTA solution) and incubated for 30 minutes at room temperature to add sulfhydryl groups to the molecule. Next, 5 mg of hydroxyamine HCl was dissolved in 100 microliters of binding buffer (from kit) and SATA modified anti-IgE antibody was added to deprotect potential sulfhydryl groups during a further 2 hour incubation. added. Next, a Sartorius concentrator (MWCO 100,000) was used to remove unreacted compounds. The concentration of sulfhydryl activating antibody was measured using Pierce's BCA protein assay kit and adjusted to 2 mg / ml in PBS.

  Affinity purified human IgG4 antibody was maleimide activated using the reagents from the above kit. 2 mg of sulfo-succinimidyl 4- [N-maleimidomethyl] cyclohexane-1-carboxylate (sulfo-SMCC) is dissolved in 2 ml of PBS followed by 10 microliters (10-fold molar excess) of 500 microliters. Of human IgG4 antibody (1 mg / ml in PBS). After a 30 minute incubation, unreacted sulfo-SMCC was removed using a Sartorius concentrator (MWCO 100,000). The concentration of maleimide activated antibody was measured using Pierce's BCA protein assay kit and adjusted to 2 mg / ml in PBS.

  Equal amounts of 2 mg / ml sulfhydryl-activated anti-IgE antibody and maleimide-activated human IgG4 antibody are mixed and incubated at room temperature for 60 minutes, followed by dilution with PBS to 10 ml and a Sartorius concentrator (MWCO 100, 000). This ERFAM concentrate was evaluated using the BCA protein assay kit and adjusted to a final concentration of 2 mg / ml. Distribute ERFAM in two, add 20 microliters of 0.5 mg / ml PBS solution of GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1) to block the binding site of anti-IgE antibody, and the equivalent to the other PBS was added. ERFAM was stored at 4 ° C. until at least 24 hours before use.

  Peripheral blood mononuclear cells were separated from blood by centrifugation on Histopaque-1077 (Sigma C-8889) layers. In addition, polymorphonuclear basophils (PB) were isolated using magnetic beads (Miltenyi Biotech catalog number 130-053-401, basophil isolation kit). IgE molecules bound to PB are described in Klein et al., Int Arch Allergy Immunol. 2001; 126 (4): 277-85, stripped by incubation with lactate buffer (13.4 mM lactic acid, 140 mM NaCl, 5 mM KCl, pH 3.9) for 3.5 minutes at room temperature. did. Next, Sheffler et al., J Allergy Clin Immunol. 2004; 113 (4): 776-82, in which PB is isolated from AIM V cells in the presence of culture supernatant containing NP-specific chimeric IgE antibody and interleukin 3 (2 ng / ml). Sensitized to NP by incubating in serum medium.

  The peripheral blood mononuclear cells are then resuspended (50,000 in a 0.1 ml AIM V cell culture medium per well in a 96 well plate) and 50 microliters of AIM V dialyzed NP specific chimera. Cell culture supernatant containing IgE antibody (to sensitize them to NP) and 20 microliters of 2 mg / ml ERFAM solution (anti-IgE-IgG4) or an equivalent of a pre-incubated blocking peptide Incubated overnight in the presence of ERFAM solution.

  The next day, 20 microliters of NP- (6) -bovine serum albumin (1 mg / ml) was added to each well and further incubated at 37 ° C. for 15 minutes. The supernatant was collected and frozen at −20 ° C. for later measurement of histamine release, while the cells were transferred to a 5 ml FACS tube and transferred to 4 ml of 1% fetal calf serum and 0.1% azimuth. Washed with phosphate buffered saline containing sodium chloride. Subsequently, PB was stained to measure the activation state. The activation state is described in Boumiza et al., Clin Exp Allergy. 2003; 33 (2): 259-65, measured by assessing the expression on the cell surface of the activation marker CD203c. PB was combined with anti-IgE FITC (Serotec STAR96F), anti-CD203c PE (Immunotech IM3575), streptavidin-peridinin-chlorophyll protein complex (Becton Dickinson 554064), anti-MHCII biotin (Ancell 131-030), and CD45 (A45). Dickinson 555485) and stained for 30 minutes at room temperature. Unbound antibody was subsequently washed and PB was analyzed by flow cytometry using a FACS Calibur instrument.

  The results shown in FIG. 2 show that ERFAM (anti-IgE-IgG4) suppresses basophil activation (expressed as the percentage of IgE + cells expressing CD203c), while the inhibitory effect of ERFAM blocked with peptide Indicates a decrease. A vertical line represents an average value + standard deviation of three measurements. Anti-IgE-IgG4 ERFAM was confirmed to inhibit 93.95% ± 0.61% basophil activation, and when ERFAM was preincubated with the blocking peptide that induced anti-IgE, its inhibitory activity was lost. It was broken.

Example 2: ERFAM obtained by binding an anti-FcγR antibody to an IgE-binding oligonucleotide
IgE-linked oligonucleotide 5'-GGGGCACGTTTATCCGTCCCCTCCTAGTGGCTGGCCCCC-3 '(SEQ ID NO: 2) was purchased from MWG Biotech (Eberberg, Germany). The 5 'end was modified by introducing a thiol group attached to the oligonucleotide by a spacer containing 6 carbon atoms. The IgE binding properties of this oligonucleotide are described in Wiegand TW, Williams PB, Dreskin SC, Jovin MH, Kinet JP, Tasset D. et al. (High-affinity oligomeric ligands to human IgE inhibitor binding to Fc epsilon receptor I), J Immunol. 1996; 157 (1): 221-30.

  Affinity purified goat anti-human CD32-B polyclonal antibody is available from Santa-Cruz Biotechnology Inc. (Sc-13271), as well as the corresponding blocking peptide (catalog no. Sc-13271P, also Santa-Cruz Biotechnology Inc) that prevents anti-human CD-32B antibody from binding to CD-32B did.

  The ERFAM compound was made by cross-linking two oligonucleotides to anti-human CD32-B antibody using Pierce's Controlled protein-protein cross-linking kit (23456). Affinity purified anti-human CD32-B antibody was maleimide activated using the reagents in the kit. 2 mg of sulfo-succinimidyl 4- [N-maleimidomethyl] cyclohexane-1-carboxylate (sulfo-SMCC) was dissolved in 2 ml of PBS followed by 3 microliters (10-fold molar excess) of 150 microliters of anti Human CD32-B antibody (1 mg / ml in PBS) was added. After 30 minutes of incubation, unreacted sulfo-SNCC was removed using a Sartorius concentrator (MWCO 100,000). The concentration of maleimide activated antibody was measured using Pierce's BCA protein assay kit and adjusted to a 2 mg / ml PBS solution.

  An equal volume of 2 mg / ml sulfhydryl-containing IgE-conjugated oligonucleotide and maleimide-activated anti-CD32-B antibody are mixed and incubated for 60 minutes at room temperature, followed by dilution to 10 ml with PBS and a Sartorius concentrator (MWCO). 100,000). This concentration was measured using a BCA protein assay kit and the final concentration was adjusted to 2 mg / ml. The resulting compound was then dispensed into two. To one of the aliquots, 20 microliters of 0.5 mg / ml PBS solution of the peptide in which the anti-CD32-B antibody was raised was added to block the binding site of the anti-CD32-B antibody, and the other was An amount of PBS was added. This ERFAM was stored at 4 ° C. at least 24 hours before use.

  Peripheral blood mononuclear cells were separated from blood by centrifugation on Histopaque-1077 (Sigma C-8889) layers. In addition, polymorphonuclear basophils (PB) were isolated using magnetic beads (Miltenyi Biotech catalog number 130-053-401, basophil isolation kit). IgE molecules bound to PB are described in Klein et al., Int Arch Allergy Immunol. 2001; 126 (4): 277-85 by incubating with lactate buffer (13.4 mM lactic acid, 140 mM NaCl, 5 mM KCl, pH 3.9) for 3.5 minutes at room temperature. It peeled. Next, Sheffler et al., J Allergy Clin Immunol. 2004; 113 (4): 776-82, PB was transformed into AIM V cells in the presence of cell culture supernatant containing NP-specific chimeric IgE antibody and interleukin 3 (2 ng / ml). Sensitization was performed by incubation in serum-free medium.

  The peripheral blood mononuclear cells are then resuspended (50,000 in a 0.1 ml AIM V cell culture medium per well in a 96 well plate) and 50 microliters of AIM V dialyzed NP specific chimera. Cell culture supernatants containing IgE antibodies (to sensitize them to NP) and 20 microliters of 2 mg / ml ERFAM solution (IgE-conjugated oligonucleotide-anti-CD32-B) or an equal amount of pre- Incubated overnight in the presence of ERFAM solution incubated with blocking peptide.

  The next day, 20 microliters of NP- (6) -bovine serum albumin (1 mg / ml) was added to each well and further incubated at 37 ° C. for 15 minutes. The supernatant is collected and frozen at -20 ° C. for later histamine release, while the cells are transferred to a 5 ml FACS tube and transferred to 4 ml of 1% fetal calf serum and 0.1% azide. Washed with phosphate buffered saline containing sodium. Subsequently, PB was stained to measure the activation state. The activation state is as follows: Boumiza R, Monneret G, Forissier MF, Savoye J, Gutowski MC, Powell WS, Bienvenu J. et al. (Marked improvement of the basophil activation test by detecting CD203c installed of CD63), Clin Exp Allergy. 2003; 33 (2): 259-65, measured by assessing the expression on the cell surface of the activation marker CD203c. PB was combined with anti-IgE FITC (Serotec STAR96F), anti-CD203c PE (Immunotech IM3575), streptavidin-peridinin-chlorophyll protein complex (Becton Dickinson 554064), anti-MHCII biotin (Ancell 131-030), and CD45 (A45). Dickinson 555485) and stained for 30 minutes at room temperature. Unbound antibody was subsequently washed and PB was analyzed by flow cytometry using a FACS Calibur instrument.

  The results shown in FIG. 2 show that ERFAM (IgE-conjugated oligonucleotide-anti-CD32-B) suppressed basophil activation (expressed as a percentage of IgE + cells expressing CD203c) while This shows that the inhibitory effect of blocked ERFAM was reduced. A vertical line represents an average value + standard deviation of three measurements. IgE-conjugated oligonucleotide-anti-CD32-B ERFAM was confirmed to inhibit basophil activation of 95.79% ± 0.51%, and ERFAM was combined with a blocking peptide in which an anti-CD32-B antibody was raised. When pre-incubated, its inhibitory activity was reduced to 34.88% ± 1.98%.

Example 3: ERFAM obtained by binding polyethylene glycol to anti-IgE antibody bound with anti-FcγR antibody
Anti-IgE rabbit polyclonal antibody was purchased from Washington Biotechnology Inc (Simpsonville, MD). This is the same as that published in KJ Dorrington and HH Bennich (Structure-function relations in human immunoglobulin E) Immunological Review 1978, 41: 3-26 in sequence 3 in human C3 It was obtained by immunizing rabbits with the peptide GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO :), the amino acid at ~ residue 359. This antibody was affinity purified from rabbit serum using a biotinylated target peptide (synthesized by Sigma Genosys) conjugated to AffinityPak ^™ Immobilized Avidin Column (Pierce) and further using a Sartorius concentrator (MWCO 100,000). And concentrated. Antibody concentration was measured using Pierce's BCA protein assay system. Goat anti-human CD32-B polyclonal antibody is available from Santa-Cruz Biotechnology Inc. (Sc-13271P), and corresponding blocking peptide that also inhibits anti-human CD32-B antibody from binding to CD32-B (also catalog number sc-13271P of Santa-Cruz Biotechnology Inc.) Also purchased.

  ERFAM compounds were made by cross-linking anti-IgE antibodies to anti-human CD32-B antibodies using Pierce's Controlled Protein-Protein Cross-Linking Kit (23456). In order to produce molecules with further biological properties (lower immunogenicity and longer circulation half-life) on this cross-linked antibody, activated polyethylene glycol (molecular weight 20,000 daltons) Was added.

  Initially, affinity purified anti-human CD32-B antibody was maleimide activated using the reagents in the kit. 2 mg of sulfo-succinimidyl 4- [N-maleimidomethyl] cyclohexane-1-carboxylate (sulfo-SMCC) was dissolved in 2 ml of PBS followed by 3 microliters (10-fold molar excess) of 150 microliters of anti Human CD32-B antibody (1 mg / ml in PBS) was added. After 30 minutes of incubation, unreacted sulfo-SNCC was removed using a Sartorius concentrator (MWCO 100,000). The concentration of maleimide activated antibody was measured using Pierce's BCA protein assay kit and adjusted to a 2 mg / ml PBS solution.

  Equal amounts of 2 mg / ml sulfhydryl-containing anti-IgE antibody and maleimide-activated anti-CD32-B antibody are mixed and incubated at room temperature for 60 minutes, followed by dilution to 10 ml with 10 mM borate buffer pH 8.5. And washed using a Sartorius concentrator (MWCO 100,000). This concentration was evaluated using the BCA protein assay kit and the final concentration was adjusted to 2 mg / ml. Beauchamp CO, Gonias SL, Menapace DP, Pizzo SV. (A new method for synthesizing polyethylene glycol-protein adducts; function, receptor recognition, and effects on clearance of dimystase superoxide, lactoferrin, and 2-macroglobulin) Anal Biochem. 1983; 131 (1): 25-33, polyethylene glycol (PEG, Fluka catalog number 95172) was activated. Briefly, PEG is dissolved in dioxane (Sigma Aldrich, catalog number 27,053-9) to a final concentration of 50 mM by heating to 37 ° C., followed by a final concentration of 0.5M. , 1'-carbonyldiimidazole (Fluka, catalog number 21860) was added. This mixture was incubated in a shaking water bath at 37 ° C. for 2 hours, followed by 2 × 100 ml PBS, followed by 2 using the NBS-Biologicals MicroKros dialysis system (catalog number X-11S-100). This was dialyzed against 100 ml of 10 mM sodium borate buffer pH 8.5. 0.1 ml ERFAM and 0.1 ml activated PEG (both compounds dissolved in 10 mM sodium borate buffer pH 8.5) were then mixed and incubated at 4 ° C. for 48 hours. Displace this buffer by dialysis of PBS (2 × 50 ml, 6 hours of dialysis each time) using Slide-a-Lyser Mini-dialysis unitc (Pierce MWCO 3,500 daltons, catalog number 69550), followed by The PEGylated ERFAM was dispensed in two. In order to block the binding site of the anti-human CD32-B antibody, 20 microliters of 0.5 mg / ml PBS solution of the peptide inducing the anti-human CD32-B antibody was added to one aliquot, An equal volume of PBS was added. ERFAM was stored at 4 ° C. for at least 24 hours before use.

  Peripheral blood mononuclear cells were separated from blood by centrifugation on Histopaque-1077 (Sigma C-8889) layers. In addition, polymorphonuclear basophils (PB) were isolated using magnetic beads (Miltenyi Biotech catalog number 130-053-401, basophil isolation kit).

  The IgE molecule bound to PB is the Klein Budde I, de Heer PG, van der Zee JS, Alberse RC and The Alberse RC. Immunol. 2001; 126 (4): 277-85, stripped by incubation with lactate buffer (13.4 mM lactic acid, 140 mM NaCl, 5 mM KCl, pH 3.9) for 3.5 minutes at room temperature. did. Next, Shuffler WG, Beyer K, Chu TH, Burks AW, Sampson HA. (Microway immunoassay: association of clinical history, in vitro IgE function and heterogeneity of allied peers in J. Ill. 2004; 113 (4): 776-82, PB was isolated from AIM V cells in the presence of culture supernatant containing NP-specific chimeric IgE antibody and interleukin 3 (2 ng / ml). Sensitization was performed by incubation in serum medium.

  Thus, peripheral blood mononuclear cells were resuspended (50,000 in 0.1 ml AIM V cell culture medium per well in a 96 well plate) and 50 microliters of AIM V dialyzed NP-specific chimeric IgE. Antibody-containing cell cultures (to sensitize them to NP) and 20 microliters of 2 mg / ml ERFAM solution (anti-IgE antibody-PEG-anti-CD32-B) or equivalent, pre-blocking peptide Incubated overnight in the presence of ERFAM solution incubated with.

  The next day, 20 microliters of NP- (6) -bovine serum albumin (1 mg / ml) was added to each well and further incubated at 37 ° C. for 15 minutes. The supernatant is collected and frozen at -20 ° C. for later histamine release, while the cells are transferred to a 5 ml FACS tube and transferred to 4 ml of 1% fetal calf serum and 0.1% azide. Washed with phosphate buffered saline containing sodium. Subsequently, PB was stained to measure the activation state. The activation state is as follows: Boumiza R, Monneret G, Forissier MF, Savoye J, Gutowski MC, Powell WS, Bienvenu J. et al. (Marked improvement of the basophil activation test by detecting CD203c installed of CD63), Clin Exp Allergy. 2003; 33 (2): 259-65, measured by assessing the expression on the cell surface of the activation marker CD203c. PB was combined with anti-IgE FITC (Serotec STAR96F), anti-CD203c PE (Immunotech IM3575), streptavidin-peridinin-chlorophyll protein complex (Becton Dickinson 554064), anti-MHCII biotin (Ancell 131-030), and CD45 (A45). Dickinson 555485) and stained for 30 minutes at room temperature. Unbound antibody was subsequently washed and PB was analyzed by flow cytometry using a FACS Calibur instrument.

  The results shown in FIG. 2 show that ERFAM (anti-IgE antibody-PEG-anti-CD32-B) suppressed basophil activation (expressed as a percentage of IgE + cells expressing CD203c) while This shows that the inhibitory effect of blocked ERFAM was reduced. A vertical line represents an average value + standard deviation of three measurements. Anti-IgE-PEG-anti-CD32-B ERFAM was confirmed to inhibit 95.2% ± 0.68% basophil activation, and ERFAM was pre-incubated with blocking peptide that induced anti-CD32-B Then, the inhibitory activity was lost.

Example 4: ERFAM obtained by binding an IgE binding moiety (anti-IgE or a fragment thereof, peptide or oligonucleotide) with an anti-FcγR antibody (or a Fab fragment thereof)
Anti-IgE rabbit polyclonal antibody was purchased from Washington Biotechnology Inc (Simpsonville, MD). This is similar to that published in the sequence of human Ig3 in the domain of human Ig3, as published by KJ Dorrington and HH Bennich (Structure-function relationshipships in human immunoglobulin E) Immunological Review 1978, 41: 3-26. Obtained by immunizing rabbits with peptide GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1), which is the amino acid at ~ residue 359. This antibody was affinity purified from rabbit serum using a biotinylated target peptide (synthesized by Sigma Genosys) conjugated to AffinityPak ^™ Immobilized Avidin Column (Pierce) and further using a Sartorius concentrator (MWCO 100,000). And concentrated. Antibody concentration was measured using Pierce's BCA protein assay system. Affinity purified goat anti-human CD32-B polyclonal antibody is available from Santa-Cruz Biotechnology Inc. (Sc-13271). ERFAM compounds were made by cross-linking the two antibodies using Pierce's Controlled protein-protein cross-linking kit (23456).

  Briefly, 500 microliters of dimethylformamide is added to dissolve 2 mg N-succinimidyl S-acetylthioacetate (SATA), followed by 28 microliters (10-fold molar excess) with 2 ml of anti-IgE. In addition to the antibody (3 mg / ml PBS-EDTA solution), it was incubated for 30 minutes at room temperature to add a sulfhydryl group to this molecule. Next, 5 mg of hydroxyamine HCl was dissolved in 100 microliters of binding buffer (from kit) and SATA modified anti-IgE antibody was added to deprotect potential sulfhydryl groups during a further 2 hour incubation. added. Next, a Sartorius concentrator (MWCO 100,000) was used to remove unreacted compounds. The concentration of sulfhydryl activating antibody was measured using Pierce's BCA protein assay kit and adjusted to 2 mg / ml in PBS.

  The affinity purified anti-human CD32-B antibody was activated with maleimide using the reagent of the kit. 2 mg of sulfo-succinimidyl 4- [N-maleimidomethyl] cyclohexane-1-carboxylate (sulfo-SMCC) was dissolved in 2 ml of PBS, followed by 150 microliters of 3 microliters (10-fold molar excess). Anti-human CD32-B antibody (1 mg / ml in PBS). After a 30 minute incubation, unreacted sulfo-SMCC was removed using a Sartorius concentrator (MWCO 100,000). The concentration of maleimide activated antibody was measured using Pierce's BCA protein assay kit and adjusted to a 2 mg / ml PBS solution.

  Equal amounts of 2 mg / ml sulfhydryl-activated anti-IgE antibody and maleimide-activated anti-CD32-B antibody were mixed and incubated at room temperature for 60 minutes, and the resulting compound was dispensed in two. On the other hand, in order to block the binding site of the anti-IgE antibody, 20 microliters of a 0.5 mg / ml PBS solution of the peptide GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1) was added, and an equal amount of PBS was added to the other. ERFAM was stored at 4 ° C. until at least 24 hours before use.

  Peripheral blood mononuclear cells were separated from blood by centrifugation of Histopaque-1077 (Sigma C-8889) layers. In addition, polymorphonuclear basophils (PB) were isolated using magnetic beads (Miltenyi Biotech catalog number 130-053-401, basophil isolation kit).

  IgE molecules bound to PB were detached by incubating with lactate buffer (13.4 mM lactic acid, 140 mM NaCl, 5 mM KCl, pH 3.9) for 3.5 minutes at room temperature. The peripheral blood mononuclear cells are then resuspended (50,000 in a 0.1 ml AIM V cell culture medium per well in a 96 well plate) and 50 microliters of AIM V dialyzed NP specific chimera. Cell culture supernatants containing IgE antibodies (to sensitize them to NP) and 20 microliters of 2 mg / ml ERFAM solution (anti-IgE * anti-CD32-B) or an equivalent of pre-incubated with blocking peptide Incubated overnight in the presence of the ERCAM solution.

  The next day, 20 microliters of NP- (6) -bovine serum albumin was added to each well and further incubated at 37 ° C. for 15 minutes. The supernatant is collected and frozen at -20 ° C. for later histamine release, while the cells are transferred to a 5 ml FACS tube and transferred to 4 ml of 1% fetal calf serum and 0.1% azide. Washed with phosphate buffered saline containing sodium. Subsequently, PB was combined with anti-IgE FITC (Serotec STAR96F), anti-CD203c PE (Immunotech IM3575), streptavidin-peridinin-chlorophyll protein complex (Becton Dickinson 554064) and anti-MHCII biotin (Ancell 131-030). Stained with APC (Becton Dickinson 555485) for 30 minutes at room temperature. Unbound antibody was subsequently washed and PB was analyzed by flow cytometry using a FACS Calibur instrument.

  The results shown in FIG. 3 show that ERFAM (anti-IgE operably linked with anti-CD32-B) suppressed basophil activation (expressed as the percentage of IgE + cells expressing CD203c), while This shows that the inhibitory effect of ERFAM blocked with peptide was decreased. A vertical line represents an average value + standard deviation of three measurements.

Example 5: RFAM equivalent represented by an allergen-specific IgG4 antibody that also has an allergic inhibitory effect Allergen-specific IgG4 uses an anti-human IgG4 antibody from Sigma-Aldrich (Poole, UK), eg from Amersham Biosciences Separation from plasma with an affinity column such as HiTrap NHS-activated HP column (Little Chalfont, UK, catalog number # 17-0716-01). Subsequently, eluted IgG4 is added to IgE-sensitized basophils, and the IgE-mediated basophil degranulation ability of allergen-specific IgG4 is measured as described above.

Example 6: ERFAM obtained by binding an IgE binding moiety (anti-IgE or a fragment thereof, peptide or oligonucleotide) with an anti-CD31 antibody or a Fab fragment thereof
Anti-IgE rabbit polyclonal antibody was purchased from Washington Biotechnology Inc (Simpsonville, MD). This is the same as the residue in the human chain I as published by KJ Dorrington and HH Bennich (Structure-function relations in human immunoglobulin E) Immunological Chain Review 1978, 41: 3-26. Obtained by immunizing rabbits with peptide GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1), which is the amino acid at ~ residue 359. This antibody was affinity purified from rabbit serum using a biotinylated target peptide (synthesized by Sigma Genosys) conjugated to AffinityPak ^™ Immobilized Avidin Column (Pierce) and further using a Sartorius concentrator (MWCO 100,000). And concentrated. Antibody concentration was measured using Pierce's BCA protein assay system. Affinity purified mouse anti-human CD31 monoclonal antibody was purchased from Serotec (MCA 1738). ERFAM compounds were made by cross-linking the two antibodies using Pierce's Controlled protein-protein cross-linking kit (23456).

  Briefly, 500 microliters of dimethylformamide is added to dissolve 2 mg N-succinimidyl S-acetylthioacetate (SATA), followed by 28 microliters (10-fold molar excess) with 2 ml of anti-IgE. In addition to the antibody (3 mg / ml PBS-EDTA solution), it was incubated for 30 minutes at room temperature to add a sulfhydryl group to this molecule. Next, 5 mg of hydroxyamine HCl was dissolved in 100 microliters of binding buffer (from kit) and SATA modified anti-IgE antibody was added to deprotect potential sulfhydryl groups during a further 2 hour incubation. added. Next, a Sartorius concentrator (MWCO 100,000) was used to remove unreacted compounds. The concentration of sulfhydryl activating antibody was measured using Pierce's BCA protein assay kit and adjusted to 2 mg / ml in PBS.

  The affinity purified anti-human CD31 antibody was activated by maleimide using the reagent of the above kit. 2 mg of sulfo-succinimidyl 4- [N-maleimidomethyl] cyclohexane-1-carboxylate (sulfo-SMCC) was dissolved in 2 ml of PBS followed by 3 microliters (10-fold molar excess) of 150 micron. Added to 1 liter of anti-human CD31 antibody (1 mg / ml PBS solution). After a 30 minute incubation, unreacted sulfo-SMCC was removed using a Sartorius concentrator (MWCO 100,000). The concentration of maleimide activated antibody was measured using Pierce's BCA protein assay kit and adjusted to 2 mg / ml in PBS.

  Equal amounts of 2 mg / ml mercapto-activated anti-IgE antibody and maleimide-activated anti-CD31 antibody were mixed and incubated at room temperature for 60 minutes, and the resulting compound was dispensed in two. On the other hand, in order to block the binding site of the anti-IgE antibody, 20 microliters of a 0.5 mg / ml PBS solution of the peptide GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1) was added, and an equal amount of PBS was added to the other. ERFAM was stored at 4 ° C. until at least 24 hours before use.

  Peripheral blood mononuclear cells were separated from blood by centrifugation on Histopaque-1077 (Sigma C-8889) layers. In addition, polymorphonuclear basophils (PB) were isolated using magnetic beads (Miltenyi Biotech catalog number 130-053-401, basophil isolation kit).

  IgE molecules bound to PB were detached by incubating with lactate buffer (13.4 mM lactic acid, 140 mM NaCl, 5 mM KCl, pH 3.9) for 3.5 minutes at room temperature. The peripheral blood mononuclear cells are then resuspended (50,000 in a 0.1 ml AIM V cell culture medium per well in a 96 well plate) and 50 microliters of AIM V dialyzed NP specific chimera. Cell culture supernatants containing IgE antibodies (to sensitize them to NP) and 20 microliters of 2 mg / ml ERFAM solution (anti-IgE anti-CD31) or ERFAM previously incubated with blocking peptide Incubated overnight in the presence of solution.

  The next day, 20 microliters of NP- (6) -bovine serum albumin (1 mg / ml PBS solution) was added to each well and further incubated at 37 ° C. for 15 minutes. The supernatant is collected and frozen at -20 ° C. for later histamine release, while the cells are transferred to a 5 ml FACS tube and transferred to 4 ml of 1% fetal calf serum and 0.1% azide. Washed with phosphate buffered saline containing sodium. Subsequently, PB was combined with anti-IgE FITC (Serotec STAR96F), anti-CD203c PE (Immunotech IM3575), streptavidin-peridinin-chlorophyll protein complex (Becton Dickinson 554064) and anti-MHCII biotin (Ancell 131-030). Stained with APC (Becton Dickinson 555485) for 30 minutes at room temperature. Unbound antibody was subsequently washed and PB was analyzed by flow cytometry using a FACS Calibur instrument.

  The results shown in FIG. 3 indicate that ERFAM (anti-IgE-anti-CD31) inhibits basophil activation (expressed as the percentage of IgE + cells expressing CD203c), while inhibiting ERFAM blocked with peptide. The effect is decreasing. A vertical line represents an average value + standard deviation of three measurements.

Example 7: ERFAM obtained by binding an IgE binding moiety (anti-IgE or a fragment thereof, peptide or oligonucleotide) with an anti-anti-FcγR antibody or a Fab fragment thereof, and an IgE binding moiety (anti-IgE or a fragment or peptide thereof) Or the effect of a mixture with another ERFAM obtained by binding an oligonucleotide) to an anti-CD31 antibody or its Fab fragment. Two ERCAM molecules, anti-IgE-anti-CD32B and anti-IgE-anti-CD31 are described above. As prepared. To test these, each of these was added to 20 microliters of PB as described and the resulting inhibitory effect was evaluated.

Example 8: Anti-IgE antibodies, obtained by coupling the _{F ab} fragments of anti-FcγR antibody ERFAM
Anti-IgE rabbit polyclonal antibody was purchased from Washington Biotechnology Inc (Simpsonville, MD). This is the same as that published by KJ Dorrington and HH Bennich (Structure-function relations in human immunoglobulin E) Immunological Review 1978, 41: 3-26 in sequence 3 of human C in Human C3. It was obtained by immunizing rabbits with peptide GVSAYLSRPSPFDLFIRKSPTITCL which is the amino acid at ~ residue 359. This antibody was affinity purified from rabbit serum using a biotinylated target peptide (synthesized by Sigma Genosys) conjugated to AffinityPak ^™ Immobilized Avidin Column (Pierce) and further using a Sartorius concentrator (MWCO 100,000). And concentrated. Antibody concentration was measured using Pierce's BCA protein assay system. Affinity purified goat anti-human CD32-B polyclonal antibody is available from Santa-Cruz Biotechnology Inc. (Sc-13271). The antibody was digested with papain using Pierce's ImmunoPure Fab preparation kit (Cat. No. 44885). Briefly, 42 mg cysteine HCl was dissolved in 12 ml phosphate buffer pH 10 (both reagents are from kit) to prepare 12 ml degradation buffer. 0.2 ml of papain slurry was transferred to a 1.5 ml Eppendorf tube and washed three times with 1 ml of lysis buffer (centrifugation at 1000 g for 30 seconds). Subsequently, the buffer was removed and 100 microliters of anti-CD32-B and 100 microliters of buffer were added. The eppendorf was incubated in a shaking water bath at 37 ° C. for 16 hours, and then centrifuged again to recover the supernatant containing the degraded antibody. The supernatant is then transferred to another 1.5 ml Eppendorf tube, mixed with 0.2 ml immobilized protein A (from Pierce's Immunopure Protein A antibody purification kit, catalog number 44667) and further incubated at room temperature for 30 minutes. did. The supernatant containing the Fab fragment was recovered by centrifugation and dialysis against 2 × 50 ml PBS using Pierce's Slide-a-Lyser MicroDialysis unit (Cat. No. 69550). The resulting Fab solution was concentrated using a Slide-a-Lyzer concentrate (Pierce catalog number 66528). The final Fab concentration was measured using Pierce's BCA protein assay kit (catalog number 23225) and adjusted to 0.5 mg / ml in PBS pH 7.4.

  The ERFAM compound was made by crosslinking this Fab fragment to the antibody using Pierce's Controlled protein-protein cross-linking kit (23456).

  Briefly, 500 microliters of dimethylformamide is added to dissolve 2 mg N-succinimidyl S-acetylthioacetate (SATA), followed by 28 microliters (10-fold molar excess) with 2 ml of anti-IgE. In addition to the antibody (3 mg / ml PBS-EDTA solution), it was incubated for 30 minutes at room temperature to add sulfhydryl groups to the molecule. Next, 5 mg of hydroxyamine HCl was dissolved in 100 microliters of binding buffer (from kit) and SATA modified anti-IgE antibody was added to deprotect potential sulfhydryl groups during a further 2 hour incubation. added. Next, a Sartorius concentrator (MWCO 100,000) was used to remove unreacted compounds. The concentration of mercapto-activated antibody was measured using Pierce's BCA protein assay kit and adjusted to 2 mg / ml in PBS.

  The Fab fragment of the anti-human CD32-B antibody was activated with maleimide using the reagent of the above kit. 2 mg of sulfo-succinimidyl 4- [N-maleimidomethyl] cyclohexane-1-carboxylate (sulfo-SMCC) was dissolved in 2 ml of PBS, followed by 2 microliters (10-fold molar excess). Added to 1 liter of anti-human CD32-B antibody (0.5 mg / ml PBS solution). After a 30 minute incubation, unreacted sulfo-SMCC was removed using Pierce's Slide-a-Lyser MicroDialysis unit (Cat. No. 69550).

  Equal amounts of 0.5 mg / ml sulfhydryl-activated anti-IgE antibody and maleimide-activated anti-human CD32-B antibody Fab fragment were mixed and incubated for 60 minutes at room temperature, followed by 2 Dispensed into one. To one aliquot, 20 microliters of a 0.5 mg / ml PBS solution of peptide GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1) was added to block the binding site of the anti-IgE antibody, and an equal amount of PBS was added to the other aliquot. . ERFAM was stored at 4 ° C. until at least 24 hours before use.

  Peripheral blood mononuclear cells were separated from blood by centrifugation on Histopaque-1077 (Sigma C-8889) layers. In addition, polymorphonuclear basophils (PB) were isolated using magnetic beads (Miltenyi Biotech basophil isolation kit, catalog number 130-053-401).

  IgE molecules bound to PB were detached by incubating with lactate buffer (13.4 mM lactic acid, 140 mM NaCl, 5 mM KCl, pH 3.9) for 3.5 minutes at room temperature. The peripheral blood mononuclear cells are then resuspended (50,000 in a 0.1 ml AIM V cell culture medium per well in a 96 well plate) and 50 microliters of AIM V dialyzed NP specific chimera. Cell culture supernatant containing IgE antibody (to sensitize them to NP) and 20 microliters of 2 mg / ml ERFAM solution (anti-IgE conjugated with Fab fragment of anti-human C32-B antibody) or Incubated overnight in the presence of an equivalent amount of ERFAM solution previously incubated with blocking peptide.

  The next day, 20 microliters of NP- (6) -bovine serum albumin (1 mg / ml) was added to each well and further incubated at 37 ° C. for 15 minutes. The supernatant is collected and frozen at -20 ° C. for later histamine release, while the cells are transferred to a 5 ml FACS tube and transferred to 4 ml of 1% fetal calf serum and 0.1% azide. Washed with phosphate buffered saline containing sodium. Subsequently, PB was combined with anti-IgE FITC (Serotec STAR96F), anti-CD203c PE (Immunotech IM3575), streptavidin-peridinin-chlorophyll protein complex (Becton Dickinson 554064) and anti-MHCII biotin (Ancell 131-030). Stained with APC (Becton Dickinson 555485) for 30 minutes at room temperature. Unbound antibody was subsequently washed and PB was analyzed by flow cytometry using a FACS Calibur instrument.

  The results shown in FIG. 4 indicate that ERFAM (anti-IgE conjugated with the anti-human C32-B antibody Fab fragment) suppressed basophil activation (expressed as a percentage of IgE + cells expressing CD203c), On the other hand, it shows that the inhibitory effect of ERFAM blocked with peptide was decreased. A vertical line represents an average value + standard deviation of three measurements. Anti-IgE ERFAM conjugated with the anti-human C32-B antibody Fab fragment was confirmed to suppress basophil activation of 87.38% ± 1.55%. Pre-incubation with anti-IgE-initiated blocking peptide decreased to 30.89% ± 2.42%.

Equivalents Although specific embodiments have been disclosed herein in detail, this has been done by way of example only for the purpose of illustration and is intended to be the correct form of the disclosed invention or the appended claims. It is not intended to limit the scope of In particular, the inventors contemplate that various substitutions, changes, and modifications may be made to the present invention without departing from the spirit and scope of the invention as defined by the claims. Various changes or modifications will be considered routine for those skilled in the art having knowledge of the embodiments described herein. Other aspects, advantages, and modifications are considered to be within the scope of the appended claims.

FIG. 1 represents the design and mode of action of an IgE retargeting function-modifying molecule (ERFAM). Such molecules bind to IgE in their Fc region and consequently inhibit IgE binding to IgE receptors (FcεRI and FcεRII). At the same time, ERFAM provides different binding sites specific for receptors with different functions, thereby converting IgE into an allergic inhibitory antibody. When ERFAM-dependent retargeting causes the antigen to reach immune effector cells (eg, mast cells or B cells) that have both FcεRI-bound IgE and IgE bound to an inhibitory receptor (eg, FcγRIIb), FcεRI and FcγRIIb And cross-linking leads to suppression of allergic effector activation. FIG. 2 is a bar graph showing inhibition of basophil activation using an exemplary ERFAM of the present invention. FIG. 3 is a bar graph showing inhibition of basophil activation using an exemplary ERFAM of the present invention. FIG. 4 is a bar graph showing inhibition of basophil activation using an exemplary ERFAM of the present invention.

Claims (24)

A composition comprising an IgE retargeting function-modifying molecule (ERFAM) comprising the formula A′-B ′, wherein:
A ′ represents a moiety that binds to IgE; and B ′ represents a moiety that binds to an inhibitory receptor;
A 'and B' are operatively linked compositions. The composition of claim 1, further comprising a linker moiety operably linked to A 'and B'. 2. The composition of claim 1, wherein the composition is present in a multimeric complex comprising the IgE, the ERFAM, and the inhibitory receptor. 2. The composition of claim 1, wherein the B 'binds to an antigen that is bound by the Fc portion of an IgG4 antibody. 2. The composition of claim 1, wherein B 'is an IgG4 isotype antibody. The composition of claim 1, wherein the composition does not crosslink to cell-bound IgE. The composition of claim 2, wherein the linker comprises a polyethylene glycol linker. 3. The composition of claim 2, wherein the ERFAM has an increased circulatory half-life or reduced immunogenicity as compared to the ERFAM without the linker. 2. The composition of claim 1, wherein B 'binds to a receptor selected from the group consisting of an immunoreceptor tyrosine inhibitory motif (ITIM) containing receptor and an apoptosis inducing receptor. 10. The composition of claim 9, wherein the (ITIM) containing receptor is present on the surface of a cell selected from the group consisting of basophils, mast cells, B cells, platelets and antigen presenting cells. 10. The composition of claim 9, wherein the (ITIM) containing receptor is CD31 or CD32B. 2. The composition of claim 1, wherein A 'or B' comprises a cyclic peptide that becomes linear upon binding to IgE. The composition of claim 1 further comprising a pharmaceutical carrier. A kit comprising the composition of claim 1. A composition comprising the formula A′-B ′, wherein:
A ′ comprises an anti-IgE antibody or anti-IgE binding fragment thereof; and B ′ comprises an antibody that binds to an (ITIM) containing receptor;
A 'and B' are operatively linked compositions. 16. The composition of claim 15, further comprising a linker moiety operably linked to A 'and B'. 16. The composition of claim 15, wherein the (ITIM) containing receptor is CD31 or CD32B. A method of treating a subject suffering from an allergy, the method comprising administering to the subject an ERCAM molecule comprising a therapeutically effective dose of formula A′-B ′, wherein :
A ′ includes a moiety that binds IgE; and B ′ includes a moiety that binds to an inhibitory receptor;
A 'and B' are operably linked,
A method thereby treating the subject suffering from the allergy. 19. The method of claim 18, wherein A 'comprises an anti-IgE antibody or an anti-IgE binding fragment thereof and B' comprises an antibody that binds to an (ITIM) containing receptor. 19. The method of claim 18, wherein the ERFAM molecule comprises an allergen specific IgG4 antibody. 19. The method of claim 18, further comprising a linker moiety operably linked to A 'and B'. A method of preventing or reducing an allergic reaction in a subject, said method comprising subjecting said subject to a therapeutically effective dose of formula A′-B ′ prior to or simultaneously with exposure of said subject to an allergen. Administering an ERCAM comprising an ERCAM molecule comprising: wherein:
A ′ includes a moiety that binds IgE; and B ′ includes a moiety that binds to an inhibitory receptor;
A ′ and B ′ are operably linked,
A method thereby preventing or reducing an allergic reaction in the subject. 23. The method of claim 22, wherein A 'comprises an anti-IgE antibody or anti-IgE binding fragment thereof and B' comprises an antibody that binds to an (ITIM) containing receptor. 24. The composition of claim 22, further comprising a linker moiety operably linked to A 'and B'.

Images