JP2008504224A - Polypeptide containing the pleckstrin homology domain of ECT2 and its binding specificity for phosphatidylinositol - Google Patents

Abstract

The present invention relates to the specific lipid binding ability of the Ect2 PH domain. Specifically, the present invention relates to an isolated DH-PH tandem domain derived from the Ect2 sequence and having the sequence shown as DNA sequence 1 (SEQ ID NO: 1) and uses thereof, as well as Ect2 cell cycle activity, and Ect2 PH The present invention relates to a method for screening an agent that modifies the interaction between a domain and PI.
[Selection] Figure 2

Description

  The present invention relates to the specific lipid binding ability of the Ect2 PH domain. Specifically, the present invention relates to the identification of this ability and the use of this domain in assays to identify modulators of Ect2 activity.

  The proliferative growth of normal cells requires regular progression through a process known as the cell cycle, a series of different steps. Progression through the cell cycle is regulated by nutrient availability, cell size, and growth factors through complex signaling pathways involving phosphorylation cascades, and tightly controlled expression and stability of specific proteins Required at each phase of the cell cycle.

  The cell cycle begins in the M phase, where cytoplasm division (cytokinesis) occurs. The M phase is followed by the G1 phase, where cells resume high rates of biosynthesis and growth. The S phase begins with DNA synthesis and ends when the amount of DNA doubles. The cell then enters the G2 phase, which ends when mitosis is signaled by the appearance of condensed chromosomes. Terminally differentiated cells stop at the G1 phase and no longer undergo cell division.

  The order of cell cycle events is tightly adjusted at specific checkpoints to ensure that each distinct phase ends before the next phase begins. Human diseases associated with abnormal cell growth, including cancer, occur when this tight regulation of cell cycle progression is disrupted. Elucidating the signaling pathways involved in the cell cycle and the specific role of that pathway in its regulation will help to prevent, diagnose and treat cancer and other proliferation-related diseases (eg, atherosclerosis) Provides new opportunities.

  On the other hand, increased cell proliferation in a regulated manner may be preferred. For example, cell proliferation is useful when wound healing and tissue growth are desired. Therefore, it is desirable to identify signal transduction pathways and mechanisms along with modulators that promote, enhance or prevent growth inhibition.

  Despite the desirability of identifying cell cycle components and modulators, there is a shortage of such compounds in the field. One approach to identifying new compounds is to elucidate protein signaling interactions and identify compounds that suppress or enhance this interaction.

  The superfamily of small (21 kDa) GTP binding proteins (low molecular weight G proteins) includes five subfamilies: Ras, Rho, ADP ribosylation factor (ARF), Rab, and Ran, which control multiple cellular responses Works as a molecular switch. Members of the Rho family of GTPases include RhoA, RhoB, RhoC, Rac-1, Rac-2, and Cdc42.

  Rho family low molecular weight GTPases can be observed in both GDP and GTP binding states. When bound to GTP, it includes control of gene expression, control of the actin cytoskeleton and cell adhesion, control of smooth muscle contraction, cell morphology, cell motility, neurite regression, cytokinesis, and cell transformation. It interacts with downstream components of the signaling cascade that can ultimately induce changes in diverse cellular processes (Hall, A. Science (1998) 279: 509-514).

  The exchange of the combined state of GTP and GDP is under the control of positive and negative control mechanisms. GTPase activating protein (GAP) enhances GTPase activity, thereby promoting the binding state of GDP, which can be sequestered and stabilized by interaction with GDP dissociation inhibitor (GDI) . Both GAP and GDI act to reduce the level of GTP-bound Rho family proteins, thereby turning off signal transduction. On the other hand, guanine nucleotide exchange factor (GEF) interacts with low molecular weight GTPases and promotes exchange of GDP with GTP, thereby enhancing signaling in the pathway.

  Ect2 is a component of the Rho-GEF family protein and thus promotes exchange of GDP with GTP for the Rho family GTPases (Rho, Rac and cdc42) (Tatsumoto et al, 1999). The ect2 gene is conserved at the sequence and functional level in mammals and insects. The Drosophila pebble gene (GenBank ID # (GI) 5817603) is an ortholog of mouse (GI293331) and human ect2, and is required for the initiation of cytokinesis (Lehner CF, J. Cell Sci. (1992) 103: 1021). -1030; Prokopenko SN, et al., Genes Dev (1999) 13 (17): 2301-2314).

  The protein is 883 amino acids in length and has a molecular weight of about 100 kD. It consists of four functional domains: the BRCT domain (aa 140-229 and 235-323), the Dbl homology (DH) domain (aa 421-610), and the pleckstrin homology domain (aa 644-763). In-line DH-PH domain construction is characteristic of GEF. Data show that the DH domain interacts with the partner GTPase and promotes nucleotide exchange on that GTPase, and that the PH domain is involved in targeting or controlling the exchange activity of DH (Zheng et al. al., 2001).

  Ect2 phosphorylation is required for its exchange activity and occurs between G2 and M phases. Human Ect2 is involved in the control of cytokinesis. The human ect2 gene is located at 3q26 of the long arm of chromosome 3 (Takai S. et al., Genomics (1995) 27 (1): 220-222), which has increased copy number and expression in many cancers. (Bitter MA, et al., Blood (1985) 66 (6): 1362-1370; Kim DH, et al., Int J Cancer. (1995) 60 (6): 812-8 19; Brzoska PM, et al., Cancer Res. (1995) 55 (14): 3055-3059; Balsara BR, et al., Cancer Res. (1997) 57 (1 1): 2116-2120; Heselmeyer K. et al. Genes Chromosomes Cancer (1997) 19 (4): 233-240; Sonoda G, et al., Genes Chromosomes Cancer. (1997) 20 (4): 320-8). Data available from the National Cancer Institute (www.ncbi.nlm.nih..cov / ncicgap) indicate that human ect2 is overexpressed in ovarian, uterine, parathyroid, testicular, brain, and colon cancers. It is suggested that

  Several domains with homology to known functional domains have been identified in Ect2 polypeptides. But its function is still unknown. The role of these domains and the potential to regulate Ect2 activity by regulating these domains remains an important target for regulating cell cycle progression.

  Prior to stimulation by upstream signaling events, a number of GEFs are present either in a partially active state or in an inactive state. Activation can result from phosphorylation events, such as events at Vav, which unfold the α-helix fold that shields the Rac interaction site by phosphorylation at Y174, which Allows the exchange reaction to proceed (Bustelo, 2000). Ect2 itself has been reported to exhibit maximal exchange activity after phosphorylation events during mitosis (Tatsumoto et al, 1999). Protein-protein interactions may also affect GEF activity, as shown by the interaction of APC armadillo domains with Rac-specific GEF Asef (Kawasaki et al., 2000). This interaction resulted in an increase in Asef GEF activity and ultimately a change in cell morphology in MDCK cells.

  Phosphatidylinositol (PtdIns) (shown below) is the central unit of eukaryotic inositol lipids. It consists of D-myo-inositol-1-phosphate linked to diacylglycerol via a phosphodiester bond. The inositol head group has five free hydroxyl groups, of which the 3, 4 and 5 positions have been identified phosphorylated alone or in combination with the cellular environment.

  Phosphatidylinositol and its phosphorylated derivatives are referred to as phosphoinosite or PI. They are present in all membranes and have been shown to be substrates for various cellular enzymes including kinases, lipases and phosphatases.

Phosphatidylinositol is the most abundant inositol lipids found in mammalian cells, are present in 10 to 20 times the concentration of PtdIns4P and PtdIns4,5P ₂ in normal quiescent cells. Nearly 95% of PtdIns phosphorylated by itself exists as PtdIns4P, and the rest consists of PtdIns3P and PtdIns5P. PtdIns4,5P ₂ is the highest abundant doubly phosphorylated species, that species is made such lipids exceeding 99%, PtdIns3,4P ₂ and PtdIns3,5P ₂ form the rest. Phosphorylated PtdIns3,4,5P ₃ levels in triplicate (Stephens et al, 2000;. . Rameh et al, 1997)

Binding of phospholipids to the PH domain of Dbl family GEFs can also result in modulation of GEF activity. Vav and GEF activity Sos is activated by binding of _{PtdIns3,4,5P 3 (Han et al.,} 1998, Nimnual et al., 1998), are inhibited by interaction with PtdIns4,5P ₂ (Das et al., 2000). Protooncogene Dbl reduces the GEF activity has been shown to interact both PtdIns4,5P ₂ both _{PtdIns3,4,5P 3 (Russo et al.,} 2001).

  Phospholipid binding is mediated by the pleckstrin homology domain of Ect2 (aa 644-763). Its small functional domain is present in many proteins involved in signal transduction and was first identified in plectrin, a substrate for protein kinase C. Two perpendicular antiparallel β-sheets with an amphipathic helix at the c-terminus, which is a fold of the domain, are phosphorylated tyrosine-binding fold (PTB), Enabled / VASP homology domain (EVH1) and Ran binding. Although very similar in structure to the domain (RanBD), there is little similarity at the amino acid level.

  Lipid binding by PH domains has been studied by several investigators, thereby classifying PH domains by lipid binding specificity. In general, lipid binding PH domains can be placed in one of the four types shown below (Kavran et al., 1998, Rameh et al., 1997).

  It is not yet clear whether all GEF-derived PH domains are involved in phospholipid binding. The charge distribution in DH-PH pairing indicates that about 50% has a positively charged residue, which is likely to be required for lipid interactions. In fact, in the analysis of negatively charged PH domains around the canonical lipid binding site, 5 out of 7 are paired with the DH domain and are unlikely to bind acidic phospholipids (Blomberg & Nilges, 1997). In support of this idea, Olson et al. Showed that the Rho-specific GEF Lbc-derived negatively charged PH domain plays a role in localizing the protein to actin fibers rather than to any cell membrane. .

Thus, it has been shown that the PH domain of the Dbl family GEF can play a regulatory role on exchange activity, and that this regulation can be regulated by PI binding. Previously, most of the PH domains analysis with specificity for PtdIns4,5P ₂ or PtdIns3,4,5P _3.

Previously, there is little description of the PH domain that binds _{PtdIns3,5-P 2.} The lipid is synthesized by the sequential action of PI3 and PI-3-P5 kinase. Its physiological role remains unclear, but its synthesis is activated in a PI3 kinase-dependent manner in osmotically loaded yeast (Dove et al., 1997). Only β- centaurin which is a component of the arf-GAP family have been shown to bind alone and _{PtdIns3,5-P 2 (Dowler et al} ., 2000). This family consists of 10 PH domain-containing components with different phospholipid binding profiles, but its functional relevance remains unclear.

Furthermore, the lipid binding specificity of the DH-PH tandem domain derived from Ect2 of Rho-GEF has not been demonstrated so far.
Hall, A. Science (1998) 279: 509-514 Lehner CF, J. Cell Sci. (1992) 103: 1021-1030 Prokopenko SN, et al., Genes Dev (1999) 13 (1 7): 2301-2314 Takai S. et al., Genomics (1995) 27 (1): 220-222 Bitter MA, et al., Blood (1985) 66 (6): 1362-1370 Kim DH, et al., Int J Cancer. (1995) 60 (6): 812-8 19 Brzoska PM, et al., Cancer Res. (1995) 55 (14): 3055-3059 Balsara BR, et al., Cancer Res. (1997) 57 (1 1): 2116-2120 Heselmeyer K. et al., Genes Chromosomes Cancer (1997) 19 (4): 233-240 Sonoda G, et al., Genes Chromosomes Cancer. (1997) 20 (4): 320-8 www.ncbi.nlm.nih..cov / ncicgap Stephens et al., 2000 Dove et al., 1997 Dowler et al., 2000

  The present invention describes the identification of a DH-PH tandem domain derived from Ect2 and demonstrates this specificity for various PIs.

  Accordingly, in one aspect of the present invention, there is provided an isolated DH-PH tandem domain having a nucleotide sequence derived from the Ect2 sequence and represented by DNA sequence 1 (SEQ ID NO: 1). Preferably, the DNA sequence encodes the amino acid sequence shown as amino acid sequence 1 (SEQ ID NO: 3). In other embodiments, the isolated DH-PH sequence is of an expression construct such as that represented by DNA sequence 1 (SEQ ID NO: 2) encoding a polypeptide having the amino acid sequence shown as amino acid sequence 2 (SEQ ID NO: 4). It is a part.

  In another aspect of the invention, there is provided a method of screening for an agent that modulates the interaction of Ect2 PH domain with PI, wherein the method comprises a polypeptide of Ect2 PH domain under conditions that direct binding. And incubating said PI with a candidate agent, and determining whether said candidate agent modulates the binding of Ect2 PH domain to PI.

  The “Ect2 PH domain” means a region of Ect2 polypeptide having an amino acid sequence corresponding to the pleckstrin homology domain represented by amino acids 644 to 763 of Ect2 polypeptide, or a fragment, derivative or homologous sequence thereof. Thus, the phrase “Ect2 PH domain” refers to both the sequence of the polypeptide and the nucleotide sequence encoding the sequence of the polypeptide, such as the nucleotide sequence shown in DNA sequence 1 (SEQ ID NO: 1). use. Suitably, the Ect2 PH domain is provided as a folded polypeptide having its native structure. In a preferred embodiment, the Ect2 PH domain is provided as part of the DH-PH tandem domain described herein. Thus, in a particularly preferred embodiment, the PH domain is provided as part of a construct having the sequence shown in DNA sequence 1 (SEQ ID NO: 1).

In one embodiment, PI is PI having a phosphate group at the 3-position and / or 5-position of the inositol ring. Suitably, the PI, is PtdIns3-P, PtdIns5-P and _{PtdIns3,5-P 2.}

  In a preferred embodiment, the agent is an antibody, a small organic molecule or an antisense oligomer.

In another aspect, a method of identifying an agent that modulates the activity of Ect2 is provided, the method comprising:
(A) providing a sample comprising a polypeptide comprising the Ect2 PH domain and a candidate agent;
(B) measuring the binding of a polypeptide comprising the Ect2 PH domain to a candidate agent in a sample;
(C) Ect2 PH domain to a control agent known not to bind the polypeptide comprising the Ect2 PH domain to a candidate agent in the sample to a polypeptide comprising the Ect2 PH domain Comparing with the binding of a polypeptide comprising
From the enhanced binding of the polypeptide comprising the Ect2 PH domain to the candidate agent in the sample compared to the binding of the polypeptide comprising the Ect2 PH domain to the control agent, the candidate agent is a cell of Ect2 It is suggested to regulate periodic function.

  In one embodiment, the activity of Ect2 is lipid binding activity. Suitably, the activity of Ect2 is its cell cycle activity.

  It is demonstrated herein that the Ect2 PH domain has specificity for binding to PI having a phosphate group at the 3 and / or 5 position. The 4-position phosphate group appears to suppress the binding of PI and Ect2 even when the 3-position and / or 5-position is phosphorylated.

  Accordingly, in another aspect of the present invention, phosphates at positions 3 and / or 5 in a screening method for identifying compounds suitable for modulation of signal transduction by PI having a phosphate group at positions 3 and / or 5 There is provided the use of a polypeptide that can bind to a PI having a group but cannot bind to a PI having a phosphate group at the 4-position.

  Suitably, the polypeptide comprises the Ect2 PH domain. In one embodiment, the Ect2 PH domain is in the form of a DH-PH serial domain. Specifically, the Ect2 PH domain is provided as a construct having the sequence set forth herein.

  DNA sequence 1 (SEQ ID NO: 1) is a cDNA molecule encoding the DH-PH domain of Ect2.

  DNA sequence 2 (SEQ ID NO: 2) is an expressed cDNA molecule construct.

  AA sequence 1 (SEQ ID NO: 3) is an amino acid sequence corresponding to DNA sequence 1 (SEQ ID NO: 1).

  AA sequence 2 (SEQ ID NO: 4) is an amino acid sequence corresponding to DNA sequence 2 (SEQ ID NO: 2).

  Unless defined otherwise, all technical and scientific terms used herein are commonly understood by those of skill in the art (eg, in cell culture, molecular genetics, nucleic acid chemistry, hybridization techniques, and biochemistry). Has the same meaning as. Standard techniques are used for molecular, genetic and biochemical methods. Generally, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY and Ausubel et al., Short Protocols in Molecular Biology (1999) 4th Ed, John Wiley & Sons, Inc .; and Guthrie et al., Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Vol. 194, Academic Press, Inc., (1991), PCR Protocols: A Guide to Methods and Applications (Innis 1990, Academic Press, San Diego, Calif.), McPherson et al., PCR Volume 1, Oxford University Press, (1991), Culture of Animal Cells: A Manual of Basic Technique, 2nd Ed. (RI Freshney 1987. Liss, Inc. New York, NY) and Gene Transfer and Expression Protocols, pp. 109-128, ed. EJ Murray, The Humana Press Inc., Clifton, NJ). These documents are incorporated herein by reference.

  In the context of the present invention, the term Ect2 PH domain, as long as it has the necessary ability to bind specifically to the compound to a PI having a phosphate group at the 3 and / or 5 position, Also included within the scope are variants, derivatives and fragments thereof.

  The term “variant” or “derivative” with respect to the Ect2 PH domain polypeptide is any substitution of one (or more) amino acids from or to the sequence of the Ect2 PH domain polypeptide, Includes those in which mutations, modifications, substitutions, deletions or additions have occurred. Preferably, the nucleic acid encoding the Ect2 PH domain is understood to include variants or derivatives thereof.

  Natural variants of the Ect2 PH domain are likely to contain conservative amino acid substitutions. Conservative substitutions can be defined, for example, according to the following table. Amino acids in the same compartment of the second column, preferably in the same row of the third column, can be substituted for each other.

  Suitable fragments of the Ect2 PH domain are at least about 5 amino acids in length, eg 10, 12, 15 or 20 amino acids. The fragment may be less than 100, 75 or 50 amino acids in length. The fragment may contain one or more (eg, 5, 10, 15, or 20) substitutions, deletions or insertions, including conservative substitutions.

  Preferred protein derivatives or fragments of the Ect2 PH domain correspond to a contiguous range of Ect2 PH domains, shown as amino acids 644 to 763 of the full length sequence, and in some cases to amino acids 644 to 763 of the full length sequence. At least 80% sequence identity or similarity with the entire sequence length of the Ect2 PH domain, preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, most preferably Have 97% or 100% sequence identity or similarity. A preferred Ect2 PH domain further comprises an amino acid sequence corresponding to amino acids 450 to 648 of the complete amino acid sequence of Ect2 (RHOGEF domain), or a fragment or derivative thereof. These domains can be identified using the pfam program (Bateman et al., Nucleic Acids Res. (1999) 27: 260-262; http://pfam.wustl.edu/), A detailed description of each domain is also included (RHOGEF domain: PF0062 I; PH domain: PFOO 169).

  A fragment or derivative of the Ect2 PH domain is preferably “functionally active,” which means that it is associated with the full-length wild-type Ect2 PH domain comprising the amino acid sequence of amino acids 644 to 763 or It means to show multiple types of functional activity.

  By way of example, a fragment or derivative may be antigenic so that it can be used in immunoassays, immunization, modulation of Ect2 activity, etc., as discussed further below with respect to the generation of antibodies to Ect2 protein. Can do. Preferably, the functionally active Ect2 PH domain fragment or derivative is one or more such as signaling activity or binding to a PI specific to a phosphate having a phosphate at position 3 or 5. It shows the biological activity of the species.

  The term “Ect2 nucleic acid” refers to a DNA or RNA molecule that encodes an Ect2 polypeptide. Preferably, the Ect2 PH domain polypeptide or nucleic acid or fragment thereof is of human origin (eg, shown herein as DNA sequence 1 (SEQ ID NO: 1)), preferably DNA sequence 1 (SEQ ID NO: 1). It may be an ortholog or derivative thereof having at least 70%, 80%, 85%, 90%, or 95% sequence identity to 1). Orthologs can be identified by BLAST analysis using DNA sequence 1 (SEQ ID NO: 1) using methods known to those skilled in the art (Huynen MA and Fork P, Proc Natl Acad Sci (1998) 95: 5849-5856; Huynen MA et al., Genome Research (2000) 10: 1204-1210).

Isolation, Generation, and Expression of Ect2 Nucleic Acids and Polynucleotides A variety of methods are available for obtaining Ect2 PH domain polypeptides. In general, the details of the method of expression, production, and purification are determined from the intended use of the polypeptide. For example, the production of a polypeptide for use in screening for regulatory agents may require a method to preserve the specific biological activity of the protein, while the production of a polypeptide for antibody production requires a specific The structural integrity of the epitope may be required. Expression of a polypeptide to be purified for screening or antibody production may require the addition of specific tags (ie, production of a fusion protein). Techniques for protein expression, production, and purification are well known to those of skill in the art; any suitable means therefor can be used (eg, Higgins SI and Hames ED (eds.) Protein Expression: A Practical Approach, Oxford University Press Inc., New York 1999; Stanbury PF et al., Principles of Fermentation Technology, 2nd edition, Elsevier Science, New York, 1995; Doonan S (ed3 Protein Purification Protocols, Huinana Press, New Jersey, 1996 Coligan JE et al, Current Protocols in Protein Science (eds.), 1999, John Wiley & Sons, New York; U.S. Patent No. 6,165,992.) Nucleotide sequence encoding the Ect2 PH domain polypeptide; Can be inserted into any suitable vector for expressing the inserted protein coding sequence, and the necessary transcriptional and translational signals including promoter / enhancer elements can be Of ect2 gene and / or may be derived from its neighboring regions, or may be of different kinds.

  The ect2 gene can be expressed in prokaryotic or eukaryotic cells, and the method of selection depends on the intended use of the protein. Specifically, eukaryotic systems are particularly useful when natural folding and post-translational modifications are required. Preferred prokaryotic cells include E. coli and Bacillus subtilis. Preferred eukaryotic cells include mammalian cells (such as human, mouse, monkey and Chinese hamster ovary cells), yeast cells (such as Pichia and Saccharomyces species), and insect cells (such as Drosophila and various types). Lepidopteran cell lines, such as Sf9 cells). To isolate the Ect2 polypeptide, cell extracts or supernatants can be purified. Preferred purification techniques include HPLC, size exclusion chromatography, cation and anion exchange chromatography, reverse phase chromatography, affinity chromatography, and other protein purification techniques known to those skilled in the art.

  In some cases, the Ect2 PH domain polypeptide can be expressed as a fusion or chimeric product linked to a heterologous protein sequence via a peptide bond. For example, to facilitate detection and / or purification of Ect2-derived polypeptides, Ect2 expression vector constructs may be one or more at the N-terminus, C-terminus of the Ect2 coding region and / or at any position within the gene sequence. The epitope coding sequence of an individual antibody may be included. Suitable sequences include Myc, HA, FLAG, or polyhistidine epitopes (see, eg, Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory). As another example, the Ect2 PH domain polypeptide can be expressed as a fusion protein bound to a transcriptional reporter such as GFP or luciferase. A chimeric protein can be made by linking together appropriate nucleic acid sequences encoding the desired amino acid sequence in an appropriate coding frame using standard methods and expressing the chimeric product. Chimeric proteins can also be made by protein synthesis techniques, for example by using a peptide synthesizer (Hunkapiller et al., Nature (1984) 310: 105-111).

Ect2 modulatory agent The present invention interacts with the Ect2 and / or p21 pathway by interacting with the PH domain and thus by regulating the binding of PI, in particular with PI having a phosphate at position 3 and / or 5. Methods of identifying agents that act and / or modulate their function are provided. Such agents are also useful for various diagnostic and therapeutic applications related to diseases or abnormalities involving defects in the p21 pathway, cell cycle and inositol signaling, as well as the Ect2 protein and its contribution to the detailed cycle and p21 pathway. It is also useful for further analysis.

  In a preferred embodiment, the Ect2 modulating agent inhibits or enhances Ect2 activity, or in normal Ect2 function, including transcription, protein expression, protein localization, and cellular or extracellular activity. Influence in other ways. In a further preferred embodiment, the candidate inositol signaling pathway modulating agent specifically modulates Ect2 function. Phrases such as “specific modulatory agent” and “specifically modulate” as used herein directly bind to an Ect2 polypeptide or nucleic acid, preferably inhibit, enhance or otherwise inhibit Ect2 function. Is used to refer to regulatory agents that change in the form of The term also refers to regulatory agents that alter the interaction of Ect2 with its binding partner or substrate (eg, by binding to Ect2 binding partner or protein / binding partner complex and inhibiting its function). Include.

  Preferred Ect2 modulating agents include Ect2 interacting proteins including small molecule chemical agents, antibodies and other biological therapeutics, and nucleic acid modulating agents including antisense oligomers and RNA. The modulatory agent can be formulated in a pharmaceutical composition, for example as a composition that may contain other active ingredients and / or suitable carriers or additives, as in combination therapy. Methods for formulating biological therapeutic agents are described in detail in US Pat. No. 6,146,628. Techniques for formulating and administering compounds can be found in "Remington's Pharmaceutical Sciences" Mack Publishing Co., Easton, PA, 19th edition.

Small molecule modulators Small molecule modulators are typically organic non-peptidic having a molecular weight of less than 10,000, preferably less than 5,000, more preferably less than 1,000, and most preferably less than 500. Is a molecule. This type of modulator is a chemically synthesized molecule, such as a compound from a combinatorial chemical library. Small molecule modulators are based on known structural properties, such as the ability to bind PI having a phosphate group at the 3 and / or 5 position, or other properties identified using the methods described above. Can be reasonably designed. The structure of Ect2 in a complex with the partner G protein (RhoA / Rac / CDC42) details the protein-protein interaction required for GEF activity and can be used to It can help rational design of small molecule compounds that regulate the mechanism of interaction and thereby disrupt the function of GEF. From the structure of the Ect2 polypeptide in complex with the small molecule ligand used to modulate GEF activity, it is either directly involved in the catalytic active site or exerts an allosteric effect on that active site, thereby reducing GEF activity. The portion of the Ect2 molecule that regulates is shown. Small molecule modulators can also be identified by screening compound libraries.

  Alternative small molecule modulators include natural products, especially secondary metabolites from organisms such as plants and fungi, to identify them by screening a compound library for Ect2 regulatory activity You can also. Methods for producing and obtaining compounds are well known in the art (Schreiber SL, Science (2000) 151: 1964-1969; Radmann J and Gunther J, Science (2000) 15 1: 1947-1948).

  Small molecule modulators identified from screening assays can be used as lead compounds, as described below, from which candidate clinical compounds can be designed, optimized and synthesized. Such clinical compounds may have utility in the treatment of lesions associated with cell cycle or inositol signaling defects. Repeated secondary functional verification, structure determination, and modification and testing of candidate modulators can increase the activity of candidate small molecule modulators several fold. In addition, candidate clinical compounds are generated with particular consideration of clinical and pharmaceutical properties. For example, reagents can be derivatized in drug development and screened again using in vitro and in vivo assays to optimize activity and minimize toxicity.

Protein Regulators Proteins that interact with the Ect2 PH domain may be endogenous, ie, those that normally interact genetically or biochemically with Ect2. Ect2 modulators include overtly inactive Ect2 interacting proteins and the Ect2 protein itself. Yeast two-hybrid and mutant screening provides a preferred method for identifying endogenous Ect2 interacting proteins (Finley, RL et al. (1996), DNA Cloning-Expression Systems: A Practical Approach, eds. Glover D. & Hames B. D (Oxford University Press, Oxford, England), pp. 169-203; Fashema SF et al., Gene (2000) 250: 1-14; Drees BL Curr Opin Chem Biol (1999 3: 64-70: Vidal M and Legrain P Nucleic Acids Res (1999) 27: 919-29; and US Pat. No. 5,928,868). Mass spectrometry provides an alternative and preferred method for elucidating protein complexes (eg, Pandley A and Mann M, Nature (2000) 405: 837-846; Yates JR, Trends Genet (2000) 16 : 5-8 has a review).

  The Ect2 interacting protein may be an exogenous protein such as an Ect2 specific antibody or a T cell antigen receptor (see, eg, Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory). Ect2 antibodies are further discussed below.

In a preferred embodiment, the Ect2 interacting protein specifically binds to the Ect2 PH domain. In an alternative preferred embodiment, the Ect2 modulating agent binds to an Ect2 substrate, binding partner, or cofactor. For certain applications, when Ect2 interacting proteins are used in screening to identify small molecule modulators, various known methods can be used to determine the equilibrium constant of binding (usually at least about 10 ⁷ M) and immunogenic properties. In addition, assays can be performed for the binding specificity of the interacting protein with the Ect2 protein. Enzymes and receptors can be assayed for binding, respectively, by substrate and ligand processing.

Specific Antibodies In a preferred embodiment, the Ect2 interacting protein is an antibody. Antibodies that specifically bind to an Ect2 polypeptide can be generated using known methods. Preferably, the antibody is specific for a mammalian Ect2 polypeptide, more preferably for human Ect2. In a particularly preferred embodiment, the antibody specifically binds to the Ect2 PH domain.

Antibodies include polyclonal, monoclonal (mAb), humanized or chimeric antibodies, single chain antibodies, Fab fragments, F (ab ′) ₂ fragments, fragments generated by Fab expression libraries, anti-idiotype (anti-Id) antibodies, And any of the above epitope-binding fragments. As described, monoclonal antibodies can be made by standard procedures with an affinity of 10 ⁸ M ⁻¹ , preferably 10 ⁹ M ⁻¹ to 10 ¹⁰ M ⁻¹ or stronger. (Harlow and Lane, Antibodies: A Laboratory Manual, CSH Laboratory (1988); Goding (1986) Monoclonal Antibodies: Principles and Practice (2d ed) Academic Press, New York; and US Pat. No. 4,381,292; 4,451,570; and 4,618,577). Antibodies can be generated against extracts of cells that express Ect2, or from substantially purified Ect2 or fragments thereof. When using a fragment of Ect2, the fragment preferably comprises at least 10 and more preferably at least 20 consecutive amino acids of the Ect2 protein. Suitably, the Ect2 fragment comprises a PH domain. In certain embodiments, the Ect2-specific antigen and / or immunogen is conjugated to a carrier protein that stimulates the immune response. For example, the polypeptide of interest is covalently bound to a mussel hemocyanin (KLH) carrier and the conjugate is emulsified in Freund's complete adjuvant that enhances the immune response. An appropriate immune system, such as a laboratory rabbit or mouse, is immunized according to conventional protocols.

  The assay is performed for the presence of Ect2-specific antibodies by a suitable assay, such as a solid phase enzyme-linked immunosorbent assay (ELISA) using an immobilized corresponding Ect2 polypeptide. Other assays such as radioimmunoassay and fluorescence assay can also be used.

  Chimeric antibodies specific to Ect2 polypeptides can be made that contain different portions from different animal species. For example, the constant region of a human immunoglobulin can be combined with the variable region of a murine mAb so that the biological activity of the antibody is derived from a human antibody and the binding specificity is derived from a murine fragment. Chimeric antibodies are generated by splicing together genes encoding appropriate regions from each species (Morrison et al., Proc. Natl. Acad. Sci. (1984) 81: 6851-6855; Neuberger et al. , Nature (1984) 312: 604-608; Takeda et al., Nature (1985) 31: 452-454). Transplant mouse antibody complementarity-determining regions (CDR) (Carlos, TM, 3. M. Harlan., Blood (1994) 84: 2068-2101) into human framework and constant regions by recombinant DNA technology This can produce humanized antibodies in the form of chimeric antibodies (Riechmann LM, et al, Nature (1988) 323: 323-327). Humanized antibodies contain about 10% murine sequences and about 90% human sequences, thus further reducing or eliminating immunogenicity while retaining antibody specificity (Co MS, and Queen C. , Nature (1991) 35 1: 501-501; Morrison SL., Ann. Rev. Immun. (1992) 10: 239-265). Humanized antibodies and methods for their production are well known in the art (US Pat. Nos. 5,530,101; 5,585,089; 5,693,762, and 6,180,370). ).

  Recombinant Ect2-specific single chain antibody, can generate single chain polypeptides formed by linking heavy and light chain fragments of Fv region via amino acid bridge (US Patent) No. 4,946,778; Bird, Science (1988) 242: 423-426; Huston et al., Proc. Natl. Acad. Sci. USA (1988) 85: 5879-5883; and Ward et al., Nature (1989) 334: 544-546).

  Other techniques suitable for antibody production include exposing lymphocytes to antigenic polypeptides or selected from antibody libraries of phage or similar vectors in vitro (Ruse et al., Science (1989) 246: 1275-1281).

  The polypeptides and antibodies of the present invention can be used with or without modification. Often, polypeptides and antibodies are labeled by covalently or non-covalently binding substances that provide a detectable signal or that are toxic to cells expressing the target protein (Menard S, et al., Int J. Biol Markers (1989) 4: 131-134). A variety of labels and their conjugation techniques are known and have been extensively reported in scientific and patent literature. Suitable labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent moieties, fluorescent radioactive lanthanide metals, chemiluminescent moieties, bioluminescent moieties, magnetic particles, etc. (US Pat. No. 3,817,837). 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241) . Recombinant immunoglobulin can also be produced (US Pat. No. 4,816,567). By binding to a transmembrane toxin protein, an antibody against the cytoplasmic protein can be delivered and reach its target (US Pat. No. 6,086,900).

  When used therapeutically in a patient, the antibodies of the invention are usually administered parenterally, possibly at the target site, or intravenously. The therapeutically effective dose and method of administration will be determined by clinical trials. Usually, the amount of antibody administered is from about 0.1 mg / kg to about 10 mg / kg of the patient's body weight. For parenteral administration, the antibody is formulated in an injectable form (eg, solution, suspension, emulsion) in combination with a pharmaceutically acceptable excipient. Such excipients are essentially non-toxic and non-therapeutic. Examples are water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. Non-aqueous excipients such as non-volatile oils, ethyl oleate and liposomal carriers can also be used. Excipients may contain minor amounts of additives such as buffers and preservatives that enhance isotonicity and chemical stability, or otherwise increase therapeutic potential. The concentration of antibody in such excipients is usually about 1 mg / ml to about 10 mg / ml. Methods of immunotherapy are further described in the literature (US Pat. No. 5,859,206; WO0073469).

Nucleic Acid Modulators Other preferred Ect2 modulators include nucleic acid molecules that generally inhibit Ect2 activity, such as antisense oligomers and double stranded RNA (dsRNA).

  Preferred antisense oligomers interfere with the function of Ect2 nucleic acids, such as DNA replication, transcription, Ect2 RNA translocation, protein translation from Ect2 RNA, RNA splicing and any catalytic activity of Ect2 RNA.

  An alternative preferred Ect2 modulating agent is a double stranded RNA species that mediates RNA interference (RNAi). RNAi is a sequence-specific method of suppressing gene expression after translation in animals and plants, and is initiated by double-stranded RNA (dsRNA) whose sequence is homologous to the gene whose expression is to be suppressed. Methods relating to the use of RNAi to suppress gene expression in C. elegans, Drosophila, plants and mammals are known in the art (Fire A, et al., 1998 Nature 391: 806-811; Fire, A. Trends Genet. 15, 358-363 (1999); Sharp, PA RNA interference 2001. Genes Dev. 15, 485-490 (2001); Hammond, SM, et al., Nature Rev. Genet. 2, 110-1119 (2001); Tuschl, T. Chem. Biochem. 2, 239-245 (2001); Hamilton, A. et al., Science 286, 950-952 (1999); Hammond, SM, et al., Nature 404, 293-296 (2000); Zamore, PD, et al., Cell 101, 25-33 (2000); Bernstein, E., etal., Nature 409, 363-366 (2001); Elbashir, SM, et al., Genes Dev. 15, 188-200 (2001); WO0129058; WO9932619, and Elbashir SM, et al., 2001 Nature 4 11: 494-498).

Assay System The present invention provides an assay system for identifying specific modulators of Ect2 activity. In general, primary assays are used to identify or confirm the specific biochemical or molecular effects of modulators on Ect2 nucleic acids or proteins or the Ect2 PH domain. In general, in a secondary assay, the activity of an Ect2 modulating agent identified by the primary assay may be further evaluated to confirm that the modulating agent affects Ect2 in a manner that is relevant to cell cycle control. it can.

The pleckstrin homology (PH) domain contains two vertical antiparallel beta sheets and a C-terminal amphipathic helix. It has been reported that the variability in the binding loop is large. The reported functions of the PH domain, the binding of beta / gamma subunits of the heteromeric G proteins, the binding of PtdIns4,5P _2, there is binding of phospho-Ser / Thr, and membrane interactions.

  The RhoGEF domain (DH or Dbl domain) contains 11 α-helices folded into a bundle of α-helices stretched flat. Its role is thought to be to promote the dissociation of GDP bound to Rho family low molecular weight GTPases, promote GTP binding and thereby activate signaling.

In an assay suitable for detecting the ability of small molecules to inhibit GEF activity, polypeptides derived from Ect2 are incubated with RhoA in the presence of ³ H GDP and the retention of ³ H in the presence or absence of candidate small molecules. Is detected.

Primary Assay Generally, the type of primary assay is determined by the type of modulator being tested.

  For small molecule modulators, screening assays are used to identify candidate modulators. Screening assays may be cell-based or may use a cell-free system that reproduces or retains important biochemical reactions of the target protein (Sittampalam OS et al., Curr Opin Chem Biol (1997) 1 : 384-91 and accompanying references are reviewed). As used herein, the term “cell-based” refers to assays that use live cells, dead cells, or specific cell fractions such as membranes, endoplasmic reticulum and mitochondrial fractions. Cell-based screening assays usually require a system for recombinant expression of the Ect2 PH domain and any auxiliary proteins required in the particular assay. The term “cell-free” encompasses assays that use substantially purified proteins (endogenous or recombinantly produced), partially purified cell extracts, or crude cell extracts. In screening assays, protein-DNA interactions, protein-protein interactions (eg, receptor-ligand binding), transcriptional activity (eg, using reporter genes), enzyme activity (eg, via substrate properties) A variety of molecular events, including second messenger activity, immunogenicity, and changes in cell morphology or other cellular characteristics. Suitable screening assays include fluorescence methods (Klebe C, et al., Biochemistry (1995) 34: 12543-12552), radioactivity methods (Hart M, et al., Nature (1991) 354: 311-314), ratios Using a wide range of detection methods, including color, spectrophotometry, and amperometry, often in the form of high-throughput screening (HTS) (eg, Hertzberg RP, and Pope AJ, Current Opinion in Chemical Biology (2000 ) 4: 445-451), and the specific molecular events detected can be read out.

  Binding agent assays include screening for compounds that modulate the interaction of Ect2 with a natural Ect2 binding target. Ect2 polypeptides used in such assays can be fused to other polypeptides such as peptide tags for detection or anchoring. In certain embodiments, the binding target is RhoA, RhoC, Rac, or Cdc42, or a portion thereof, which binds to a subject Ect2 polypeptide that can be conveniently measured in an assay. And preferably resembles complete RhoA, RhoC, Rae, or Cdc42. In the absence of a candidate modulating agent, Ect2 and the binding target can be combined with a candidate Ect2 modulating agent under conditions that allow the Ect2 polypeptide to specifically bind to a cellular binding target, part or analog thereof with a reference binding affinity. Incubate in the presence and absence of (ie under control). After incubation, the binding between the Ect2 polypeptide and one or more binding targets biased by the agent is via optical density or electron density, radioactive release, non-radioactive energy transfer, etc., antibodies Detection is by any of a variety of methods depending on the nature of the product and other assay components, such as indirect detection with a conjugate. The difference in binding affinity of Ect2 with the target in the absence of the agent compared to the binding affinity in the presence of the agent indicates that the agent modulates Ect2 binding to the Ect2 binding target. It is suggested. As used herein, the difference is statistically significant, preferably 50%, preferably 60%, more preferably 75%, most preferably 90%.

  Other preferred assay formats are those that use fluorescence techniques including fluorescence polarization, time-resolved fluorescence, and fluorescence resonance energy transfer. These systems provide a means of monitoring protein-protein or DNA-protein interactions where the intensity of the signal emitted from the dye-labeled molecule depends on its interaction with the partner molecule (e.g., Selvin PR, Nat Struct Biol (2000) 7: 730-4; Fernandes PB, Curr Opin Chem Biol (1998) 2: 597-603; Hertzberg RP and Pope AJ, Curr Opin Chem Biol (2000) 4: 445-451) .

  For antibody modulators, a suitable primary assay is one that tests the specificity and affinity of the antibody for the Ect2 PH domain protein. Methods for testing antibody specificity and affinity are well known in the art. Alternatively, or in addition, the primary assay for antibody modulators may include the screening assays described above, which are used to detect Ect2 modulator-specific activity.

  Secondary validation can use essentially the same assay used to functionally validate the involvement of the ect2 PH domain in inositol signaling-related pathways. Secondary validation assays generally compare populations of cells (eg, two pools of wild type cells) in the presence and absence of candidate modulators.

  In other embodiments, secondary validation can use the same assay used for high throughput screening. This method can also confirm the activity of modulators not identified by high throughput screening, such as antibodies or antisense oligonucleotide modulators, or of small molecule modulators identified using different high throughput screening assays. The activity can also be confirmed. This assay can also be used to confirm the specificity of a candidate agent.

  In addition, modulators are assayed for their effectiveness against Ect2 in a manner related to the cell cycle. Such assays include, among others, the cell cycle, apoptosis, proliferation, and hypoxia induction assays described above.

Therapeutic and Diagnostic Applications When used for anti-tumor therapy in a patient, the Ect2 modulatory agent is administered to the patient in a therapeutically effective amount that eliminates or reduces the patient's tumor burden. The agent is usually administered parenterally, possibly at the target cell site, or intravenously. Dosage and method of administration will work in combination with the nature of the cancer (primary or metastatic), its population, target site, characteristics of the particular immunotoxin (when used), eg, its therapeutic index, other therapeutic agents Depends on whether the substance is administered and the patient's medical history. The amount of agent administered is usually from about 0.1 mg / kg to about 10 mg / kg of the patient's body weight.

  For parenteral administration, a unit dose is injectable or inhalable, usually in a concentration of about 1 mg / ml to 10 mg / ml, in combination with a pharmaceutically acceptable excipient (eg, solution, suspension) , Emulsion).

  Antibodies that specifically bind Ect2 can be used in the diagnosis of conditions or diseases characterized by Ect2 expression, or in assays that monitor patients being treated with Ect2 modulating agents. Ect2 diagnostic assays include the use of antibodies and labels to detect Ect2 in human body fluids or cell or tissue extracts. The antibody can be used with or without modification, and can be labeled by covalently or non-covalently linking it to a reporter molecule.

  Diagnosis of a condition characterized by Ect2 expression can also be made by any of a variety of methods, such as Northern analysis or TaqMan® analysis (discussed above) that measure Ect2 expression in patient samples. .

  The invention will now be described with reference to the following non-limiting examples.

Methods Cloning and expression of Ect2 cDNA encoding the DH-PH domain (DNA sequence 1 (SEQ ID NO: 1)), the corresponding amino acid sequence of which is shown as AA sequence 1 (SEQ ID NO: 3) of Ect2, was obtained as pENTR-3c It was cloned into the EcoR1 site in the vector (GIBCO). Subsequently, this sequence was transferred to pDEST10 (GIBCO) using a recombination reaction, and the molecular weight was estimated to be 49.8 kD. Ect2-derived DH domain (aa39-235) and PH domain (aa269-388) and purification A construct was obtained that expresses a 434aa protein containing the N-terminal his tag (aa5-10) for use. The sequence of the final expression construct is shown in DNA sequence 2 (SEQ ID NO: 2).

DNA sequence 1 (SEQ ID NO: 1)
ccagttccttcaaagcagtcagcaaggtggcaagttgcaaaagagctttatcaaactgaaagtaattatgttaatatattggcaacaattattcagttatttcaagtaccattggaagaggaaggacaacgtggtggacctatccttgcaccagaggagattaagactatttttggtagcatcccagatatctttgatgtacacactaagataaaggatgatcttgaagaccttatagttaattgggatgagagcaaaagcattggtgacatttttctgaaatattcaaaagatttggtaaaaacctaccctccctttgtaaacttctttgaaatgagcaaggaaacaattattaaatgtgaaaaacagaaaccaagatttcatgcttttctcaagataaaccaagcaaaaccagaatgtggacggcagagccttgttgaacttcttatccgaccagtacagaggttacccagtgttgcattacttttaaatgatcttaagaagcatacagctgatgaaaatccagacaaaagcactttagaaaaagctattggatcactgaaggaagtaatgacgcatattaatgaggataagagaaaaacagaagctcaaaagcaaatttttgatgttgtttatgaagtagatggatgcccagctaatcttttatcttctcaccgaagcttagtacagcgggttgaaacaatttctctaggtgagcacccctgtgacagaggagaacaagtaactctcttcctcttcaatgattgcctagagatagcaagaaaacggcacaaggttattggcacttttaggagtcctcatggccaaacccgacccccagcttctcttaagcatattcacctaatgcctctttctcagattaagaaggtattggacataagagagacagaagattgccataatgcttttgccttgcttgtgaggccaccaacagagcaggcaaatgtgctactcagtttccagatgacatcagatgaac ttccaaaagaaaactggctaaagatgctgtgtcgacatgtagctaacaccatttgtaaa

DNA sequence 2 (SEQ ID NO: 2)
atgtcgtactaccatcaccatcaccatcacctcgaatcaacaagtttgtacaaaaaagcaggctctttaaaggaaccaattcagtcgactggatccggtaccgaattcgcccttccagttccttcaaagcagtcagcaaggtggcaagttgcaaaagagctttatcaaactgaaagtaattatgttaatatattggcaacaattattcagttatttcaagtaccattggaagaggaaggacaacgtggtggacctatccttgcaccagaggagattaagactatttttggtagcatcccagatatctttgatgtacacactaagataaaggatgatcttgaagaccttatagttaattgggatgagagcaaaagcattggtgacatttttctgaaatattcaaaagatttggtaaaaacctaccctccctttgtaaacttctttgaaatgagcaaggaaacaattattaaatgtgaaaaacagaaaccaagatttcatgcttttctcaagataaaccaagcaaaaccagaatgtggacggcagagccttgttgaacttcttatccgaccagtacagaggttacccagtgttgcattacttttaaatgatcttaagaagcatacagctgatgaaaatccagacaaaagcactttagaaaaagctattggatcactgaaggaagtaatgacgcatattaatgaggataagagaaaaacagaagctcaaaagcaaatttttgatgttgtttatgaagtagatggatgcccagctaatcttttatcttctcaccgaagcttagtacagcgggttgaaacaatttctctaggtgagcacccctgtgacagaggagaacaagtaactctcttcctcttcaatgattgcctagagatagcaagaaaacggcacaaggttattggcacttttaggagtcctcatggccaaacccgacccccagcttctcttaagcatattcacctaatgcctctttctcagattaaga aggtattggacataagagagacagaagattgccataatgcttttgccttgcttgtgaggccaccaacagagcaggcaaatgtgctactcagtttccagatgacatcagatgaacttccaaaagaaaactggctaaagatgctgtgtcgacatgtagctaacaccatttgtaaagcaagggcgaattcgcggccgcactcgagatatctagacccagctttcttgtacaaagtggttgattcgaggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactag

AA sequence 1 (SEQ ID NO: 3)
pvpskqsarwqvakelyqtesnyvnilatiiqlfqvpleeegqrggpilapeeiktifgsipdifdvhtkikddledlivnwdesksigdiflkyskdlvktyppfvnffemsketiikcekqkprfhaflkinqakpecgrqslvellirpvqrlpsvalllndlkkhtadenpdkstlekaigslkevmthinedkrkteaqkqifdvvyevdgcpanllsshrslvqrvetislgehpcdrgeqvtlflfndcleiarkrhkvigtfrsphgqtrppaslkhihlmplsqikkvldiretedchnafallvrppteqanvllsfqmtsdelpkenwlkmlcrhvantick

AA sequence 2 (SEQ ID NO: 4)
msyyhhhhhhlestslykkagslkepiqstgsgtefalpvpskqsarwqvakelyqtesnyvnilatiiqlfqvpleeegqrggpilapeeiktifgsipdifdvhtkikddledlivnwdesksigdiflkyskdlvktyppfvnffemsketiikcekqkprfhaflkinqakpecgrqslvellirpvqrlpsvalllndlkkhtadenpdkstlekaigslkevmthinedkrkteaqkqifdvvyevdgcpanllsshrslvqrvetislgehpcdrgeqvtlflfndcleiarkrhkvigtfrsphgqtrppaslkhihlmplsqikkvldiretedchnafallvrppteqanvllsfqmtsdelpkenwlkmlcrhvantickaransrphsryldpaflykvvdsrlltkperklswllpplsnn

  Ect2-DH-PH was expressed in Rosetta (DE3) pLysS cells. Cells were grown at 37 ° C. and harvested 3 hours after induction with 1 mM IPTG. The inclusion body fraction was isolated by treating the cell pellet with BugBuster HT protein extraction reagent (Novagen) according to the manufacturer's instructions.

  Inclusion body pellets were resolubilized at a protein concentration of 0.38 mg / ml in 50 mM Tris HCl pH 8.0 / 1 mM DTT / 6M GuHCl. The protein was then centrifuged at 15000 rpm for 15 minutes to remove potential nucleation sites. Protein refolding was initiated by rapid dilution (1:11) of the soluble fraction in “refolding buffer” 50 mM Tris HCl pH 8.0 / 1 mM DTT / 10% glycerol / 100 mM NaCl. The sample was then filtered through a 0.2 μm filter and then extensively dialyzed against “refolding buffer” at 4 ° C. overnight to remove any remaining traces of GdnHCl. The protein was filtered again through a 0.2 μm filter and then concentrated using an Amicon Centriprep blocking at 10 kDa. The protein at this stage was judged to be> 80% pure by SDS-PAGE analysis.

Phospholipid binding assay To assess the phospholipid binding specificity of the Ect2 DH-PH domain (Ect2-DH-PH), a lipid overlay assay was performed. A lipid solution (1 μl) containing 250 pmol of phospholipid dissolved in a mixture of chloroform / methanol / water (1: 2: 0.8) was spotted onto Hybond-C extra membrane and dried at room temperature. The membrane was blocked by incubation for 60 minutes in TBST (10 mM Tris / Hcl, pH 8.0, 150 mM NaCl, 0.1% Tween-20) containing 3% (w: v) BSA without fatty acids. . The membrane was then incubated overnight at 4 ° C. in the same solution containing 0.5 mg / ml Ect2-DH-PH. The membrane was then washed extensively with TBST and incubated for 60 minutes with TBST containing an anti-6 ^* his antibody (Sigma) diluted 1: 1000. After washing the membrane with TBST as before, it was incubated for 60 minutes in TBST containing anti-mouse HRP conjugate diluted 1: 5000. The membrane is then washed as before, the membrane is immersed in ECL reagent (Amersham Pharmacia), and the presence of Ect2-DH-PH is detected by exposing the membrane to photographic film (Kodak). did.

Results FIG. 1 shows the expression of Ect2DH-PH.
Ect2DH-PH was expressed as an insoluble protein in E. Coli (DE3) pLysS. Inclusion body fractions were prepared and defolded into a buffer containing 6M GdnHCl, followed by rapid dilution and dialysis to remove the denaturant to refold the protein. Samples were separated by SDS-PAGE and visualized by Coomassie staining (left figure) or Western blot (right figure). FIG. 1 (a) shows the expression of Ect2DH. Lane 1: IPTG induction t = 0, Lane 2: IPTG induction t = + 1 hour, Lane 3: IPTG induction t = + 2 hours, Lane 4: IPTG induction t = + 3 hours It is. FIG. 1 (b) shows Ect2DH that has been refolded, and lanes 1-4 show different amounts of Ect2DH that have been refolded.

FIG. 2 shows the specificity of Ect2 PIP binding.
1 Phosphatidylcholine 2 Phosphatidylethanolamine 3 Phosphatidylinositol 4 Phosphatidylinositol-3-phosphate (PtdIns3P)
5 Phosphatidylinositol-4-phosphate (PtdIns4P)
6 Phosphatidylinositol-5-phosphate (PtdIns5P)
7 phosphatidylinositol 3,4-phosphate (PtdIns3,4P ₂₎
8 Phosphatidylinositol-3,5-phosphate (PtdIns3,5P ₂ )
9 phosphatidylinositol 4,5-phosphate (PtdIns4,5P ₂₎

From these results, PO ₃ ^{− at} the 3rd and / or 5th position promotes binding, but PO ₃ ^{− at} the 4th position suppresses binding even when the 3rd or 5th position is phosphorylated. Is suggested.

[References]
Blomberg, N. & Nilges, M., Folding & Design, 2, 343-355, 1997.

Bustelo, XR, Mol.Cell Biol., 20, 1461-1477, 2000.

Das et al., J. Biol. Chem., 275, 15074-15081, 2000.

Han et al., Science, 279, 558-560, 1998.

Kavran et al., J. Bio. Che., 273, 30497-30508, 1998.

Kawasaki et al., Science, 289, 1194-1197, 2000.

Nimnual et al., Science, 279, 560-563.

Rameh et al., J. Biol. Chem., 272, 22059-22066, 1997.

Russo et al., J. Biol. Chem., 276, 19524-19531, 2001.

Tatsumoto et al., J. Cell Biol., 147 (5), 921-927, 1999.

Zheng, Y., TIBS, 26 (12), 724-732, 2001.

  All patents, patent applications, and published references cited herein are hereby incorporated by reference in their entirety. Although the invention has been particularly shown and described with reference to preferred embodiments thereof, various changes can be made in form and detail herein without departing from the scope of the invention as encompassed by the appended claims. Those skilled in the art will appreciate that can be added.

It is a figure which shows SDS-PAGE, and was visualized by Coomassie staining (left figure) or Western blotting (right figure). (A) shows the expression of Ect2DH, lane 1: IPTG induction t = 0, lane 2: IPTG induction t = + 1 hour, lane 3: IPTG induction t = + 2 hours, lane 4: IPTG induction t = + 3 hours. ; (B) shows Ect2DH that has undergone refolding, and lanes 1-4 show different amounts of Ect2DH that have undergone refolding. It is a figure which shows the result of a phospholipid binding assay.

Claims (9)

  An isolated DH-PH tandem domain derived from the Ect2 sequence and having the sequence shown as DNA sequence 1 (SEQ ID NO: 1). PtdIns3P, with specificity for PtdIns5P or PtdIns3,5P _2, isolated domains of claim 1.   A method of screening for an agent that modulates the interaction between the Ect2 PH domain and PI, comprising incubating the Ect2 PH domain polypeptide and the PI with a candidate agent under conditions that induce binding; Determining whether the agent modulates the binding of the Ect2 PH domain to the PI.   The method according to claim 3, wherein the PI is a PI having a phosphate group at the 3-position and / or the 5-position.   The method according to claim 3 or 4, wherein the agent is an antibody, a small organic molecule or a nucleic acid molecule.   6. The method according to any one of claims 3 to 5, wherein the PH domain is provided as part of a construct having the sequence shown in DNA sequence 1 (SEQ ID NO: 1). A method of identifying an agent that modulates Ect2 cell cycle activity comprising:
(A) providing a sample comprising a polypeptide comprising the Ect2 PH domain and a candidate agent;
(B) measuring the binding of a polypeptide comprising the Ect2 PH domain to a candidate agent in a sample;
(C) The binding of a polypeptide comprising an Ect2 PH domain to a candidate agent in a sample is reduced by the Ect2 PH to a control agent known not to bind to a polypeptide comprising an Ect2 PH domain. Comparing with the binding of a polypeptide comprising a domain,
From the enhanced binding of the polypeptide comprising the Ect2 PH domain to the candidate agent in the sample compared to the binding of the polypeptide comprising the Ect2 PH domain to the control agent, the candidate agent is a cell of Ect2 Methods suggested to modulate periodic function.   In a screening method for identifying a compound suitable for modulation of signal transduction by PI having a phosphate group at the 3-position and / or 5-position, it can bind to PI having a phosphate group at the 3-position and / or 5-position. Use of a polypeptide that cannot bind to PI having a phosphate group at the position.   9. Use according to claim 8, wherein the polypeptide comprises the Ect2 PH domain.