JP2008504219A - Methods for raising immunity against an antigen - Google Patents

Abstract

  Methods are provided for generating an immune response against an antigen. The method includes priming the individual by administering an expression vector encoding the antigen. The vector includes a transcription unit that encodes a secretable fusion protein, the fusion protein including an antigen and a CD40 ligand. Administration of a fusion protein comprising an antigen and a CD40 ligand is used to enhance the immune response higher than that obtained with vector administration alone. The methods of the present invention may be used to generate an immune response against tumor antigens expressed by cancer (eg, mucin or human papilloma virus tumor antigens) to generate an immune response against infectious agents. Also provided are methods for simultaneously generating an expression vector and a fusion protein.

Description

The present invention relates to a method for establishing immunity to an antigen using an expression vector that expresses a secretable fusion protein comprising an antigen fused to a CD40 ligand. The invention also relates to immunization schemes for priming with expression vectors and boosting with protein antigens. The invention also relates to a method for simultaneously producing a vector and a protein antigen in a producer cell line.

BACKGROUND OF THE INVENTION The following description of the background of the invention is provided to facilitate the reader's understanding of the invention and is not admitted to describe or constitute prior art to the invention. This application claims priority to US Patent Application No. 60 / 529,016, filed December 11, 2003, which is hereby incorporated in its entirety, including any drawings. Applications related to this application are PCT / US03 / 36237 (filed on November 12, 2003) “Adenovirus vector vaccine”, and US provisional application 60 / 524,925 (filed November 24, 2003), 60 / 525,552 (Filed November 25, 2003), and 60 / 529,015 (filed December 11, 2003), all of which are incorporated herein by reference in their entirety, including the drawings.

  Activation of antigen-presenting cells (APC), including dendritic cells (DC), and subsequent loading of equivalent antigens by antigen-presenting cells is an essential step in generating a T cell-dependent immune response against cancer cells. Upon activation and loading with tumor antigens, DCs migrate to regional lymph nodes (LN) and present the antigen to T cells. Very often, these APCs express insufficient amounts of surface activation molecules necessary for optimal activation and growth of T cell clones capable of recognizing tumor antigens. See Shortman, et al., Stem Cells 15: 409-419, 1997.

If the antigen is presented to naive T cells in the absence of co-stimulatory molecules on the surface of the APC, the T cells become anergy. See Steinbrink et al., Blood 99: 2468-2476, 2002. Furthermore, cross-presentation by DC without the help of CD4 ⁺ T cells results in the loss of Ag-specific T cells in peripheral LN in the periphery. See Kusuhara et al., Eur J Immunol 32: 1035-1043, 2002. In contrast, with the help of CD4 ⁺ T cells, DCs acquire the functional ability to cross-prime T cells, thereby causing clonal expansion of effector T cells. See Gunzer et al., Semin Immunol 13: 291-302, 2001. This CD4 ⁺ T cell help can be replaced by CD40-CD40 ligand (CD40L) interaction. See Luft et al., Int Immunol 14: 367-380, 2002. CD40L is a 33 kDa type II membrane protein that is a member of the TNF gene family and is transiently expressed on CD4 ⁺ T cells following TCR engagement. See Skov et al., J Immunol. 164: 3500-3505, 2000.

  The ability of DC to generate an anti-tumor immune response in vivo has been reported in many animal tumor models. See Paglia et al., J Exp Med 183: 317-322, 1996; Zitvogel et al., J Exp Med. 183: 87-97, 1996. However, DC-mediated immune induction has many therapeutic difficulties. It is considered difficult to ensure that antigen-presenting cells express suitable adhesion molecules and chemokine receptors to attract DCs to a second lymphoid organ and cause T cells to prime . Fong et al., J Immunol. 166: 4254-4259, 2001; Markowicz et al., J Clin Invest. 85: 955-961, 1990; Hsu et al., Nat Med. 2: 52-58, 1996; Nestle et al., Nat Med. 4 : 328-332, 1998; Murphy et al., Prostate 38: 73-78, 1999; Dhodapkar et al., J Clin Invest. 104: 173-180, 1999.

SUMMARY OF THE INVENTION In a first aspect, the present invention relates to the use of a fusion protein in establishing an immune response against an antigen. In a preferred embodiment, an immune response to an antigen is obtained by administering an expression vector encoding a secretable fusion protein. The vector includes a transcription unit that encodes a secretable fusion protein comprising an antigen and a CD40 ligand. Administration of the fusion protein occurs before, simultaneously with, or after administration of the vector. Preferably the fusion protein is administered after administration of the vector.

  In some methods, the sequence encoding the antigen in the fusion protein transcription unit is 5 ′ to the sequence encoding the CD40 ligand. In another method, the sequence encoding the CD40 ligand in the fusion protein transcription unit is 5 ′ to the sequence encoding the antigen. In a preferred embodiment, the CD40 ligand lacks all or part of its transmembrane domain.

  The antigen may be any antigen that can generate an immune response in an individual. In a preferred embodiment, the antigen is a tumor antigen; the tumor antigen is a human papillomavirus E6 or E7 protein; the tumor antigen is a mucin antigen, MUC1, MUC2, MUC3A, MUC3B, MUC4, MUC5AC, MUC5B, MUC6, MUC7, MUC8, MUC9, MUC12, MUC13, MUC15, and MUC16 can be selected; the mucin antigen is derived from MUC1; human epidermal growth factor (EGF) -like receptors (eg, HER1, HER2, HER3, And HER4), the antigen is an infectious agent antigen; the infectious agent antigen is a viral antigen; the infectious agent virus antigen is derived from human papilloma virus; the viral antigen is the E6 or E7 protein of human papilloma virus is there.

  In another aspect, the present invention provides a method of treating an individual afflicted with a cancer that expresses a tumor antigen. The method includes administering an expression vector comprising a transcription unit encoding a secretable fusion protein comprising a tumor antigen and a CD40 ligand. The fusion protein is administered before, simultaneously with, or after administration of the vector. Preferably the fusion protein is administered after administration of the vector.

  In a further aspect, the present invention provides a method of generating immunity against an infectious agent in a subject. The method includes administering an expression vector comprising a transcription unit encoding a secretable fusion protein comprising an infectious agent antigen and a CD40 ligand. The fusion protein is administered before, simultaneously with, or after administration of the vector. Preferably the fusion protein is administered after administration of the vector.

  In yet another aspect, the invention relates to a method for producing both a vector and a fusion protein in the same host cell production system. In a preferred embodiment, the fusion protein is expressed from the same vector used to generate immunity by vaccination. In this way, both the vector and the fusion protein can be produced simultaneously in one production system.

In a preferred embodiment, the expression vector may be a viral expression vector or a non-viral expression vector; the expression vector may be an adenoviral vector; the vector may be conveniently administered subcutaneously; The signal sequence may be located upstream of the fusion protein for secretion of the fusion protein; immunity against the antigen persists for a long time and cytotoxic CD8 ⁺ against the antigen-expressing cells May involve the generation of T cells and the production of antibodies to the antigen; the transcription unit may comprise a sequence encoding a linker between the antigen and the CD40 ligand; suitable linker lengths and compositions vary The expression vector is a human cytomegalovirus promoter to control transcription of the transcription unit Enhancers may include; and CD40 ligand may be a human CD40 ligand.

  Abbreviations used herein include: “Ad” (adenovirus); “sig” (signal sequence); and “ecd” (extracellular domain).

  These and other aspects are described in detail below.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a nucleotide sequence encoding human MUC1 (SEQ ID NO: 1).

  FIG. 2 shows the amino acid sequence of human MUC1 (SEQ ID NO: 2).

  FIG. 3 shows the level of interferon gamma obtained in the ELISA spot assay, which is primed with the adenovirus expression vector Ad-K / ecdhMUC1-ΔCtΔTmCD40L and either the expression vector or the mature fusion protein ecdhMUC1-ΔCtΔTmCD40L is subcutaneously applied. Spleen cells derived from boosted MUC-1 transgenic animals (hMUC-1.Tg) were used. The various treatment groups included 7 protein boost doses once weekly vector injections (T1), 2 weekly vector injections 2 weeks later (T2), 1 vector injection 1 week after (T3) and 2 weeks after a single vector injection (T4). In T5, two subcutaneous injections of protein (administered at intervals of 2 weeks) were performed starting 7 days after one vector injection. At T1, two vector injections were made and no protein was injected.

  FIG. 4 shows a MUC-1 transgenic animal (hMUC-1.Tg) primed with the adenovirus expression vector Ad-K / ecdhMUC1-ΔCtΔTmCD40L and boosted subcutaneously with either the expression vector or the mature fusion protein ecdhMUC1-ΔCtΔTmCD40L. The level of T cytotoxicity derived is shown. Various treatment groups are shown in FIG.

  FIG. 5 shows a MUC-1 transgenic animal (hMUC-1.Tg) primed with the adenovirus expression vector Ad-K / ecdhMUC1-ΔCtΔTmCD40L and boosted subcutaneously with either the expression vector or the mature fusion protein ecdhMUC1-ΔCtΔTmCD40L. Shows the level of antibody against the fusion protein ecdhMUC1-ΔCtΔTmCD40L in the serum. The various treatment groups are those described in FIG. Antibodies were detected by ELISA. Microwell plates coated with the fusion protein ecdhMUC1-ΔCtΔTmCD40L were reacted with serum, washed, and bound mouse antibody was detected using rat anti-mouse antibody conjugated with horseradish peroxidase.

  FIG. 6 shows the proliferation level of MUC1-expressing tumor cells (LL2 / LL2hMUC-1) in a MUC-1 transgenic animal (hMUC-1.Tg) administered with the adenovirus expression vector Ad-K / ecdhMUC1-ΔCtΔTmCD40L. Shown in comparison with one or two consecutive doses of ecdhMUC1-ΔCtΔTmCD40L.

  FIG. 7 shows tumor prevention in animals inoculated with Ad-sig-ecdhMUC-1 / ΔCtΔTmCD40L vector and ecdhMUC-1 / ΔCtΔTm CD40L protein. VVV = Ad-sig-ecdhMUC-1 / ΔCtΔTm 3 subcutaneous injections of CD40L vector (administered on days 1, 7 and 21); PPP = ecdhMUC-1 / ΔCtΔTm 3 subcutaneous injections of CD40L protein ( Administered on days 1, 7, and 21); or VPP = Ad-sig-ecdhMUC-1 / ΔCtΔTm ecdhMUC-1 / ΔCtΔTm on days 7 and 21 after one subcutaneous injection of CD40L vector Subcutaneous injection of CD40L protein. One week later (day 28), mice were injected subcutaneously with 500,000 LL2 / LL1hMUC-1 lung cancer cells. Two weeks later (day 42), 500,000 LL2 / LL1hMUC-1 tumor cells were administered intravenously and the mice were tested via the tail vein. Multiple doses of vector (alone or subsequently boosted with protein) were effective in preventing human tumor establishment in mice.

  FIG. 8 shows the level of hMUC-1 specific antibodies in vaccinated mice 63 days after the start of vaccination. VVV = Ad-sig-ecdhMUC-1 / ΔCtΔTm 3 subcutaneous injections of CD40L vector (administered on days 1, 7 and 21); PPP = 3 subcutaneous injections of ecdhMUC-1 / ΔCtΔTm CD40L protein ( Administered on days 1, 7, and 21); or VPP = Ad-sig-ecdhMUC-1 / ΔCtΔTm ecdhMUC-1 / ΔCtΔTm on days 7 and 21 after one subcutaneous injection of CD40L vector Subcutaneous injection of CD40L protein. Scheduled to have the highest level of hMUC-1 specific, with a single subcutaneous injection of Ad-sig-ecdhMUC-1 / ΔCtΔTmCD40L vector followed by two consecutive injections of ecdhMUC-1 / ΔCtΔTmCD40L protein on days 7 and 21 Antibody was induced.

  FIG. 9 shows subcutaneous tumor therapy (after colonization) in animals immunized with Ad-sig-ecdhMUC-1 / ΔCtΔTmCD40L vector and ecdhMUC-1 / ΔCtΔTm CD40L protein. VVV = 3 subcutaneous injections of Ad-sig-ecdhMUC-1 / ΔCtΔTm CD40L vector (administered on days 5, 12, and 26); PPP = 3 subcutaneous injections of ecdhMUC-1 / ΔCtΔTm CD40L protein ( Administered on days 5, 12, and 26); or VPP = Ad-sig-ecdhMUC-1 / ΔCtΔTm ecdhMUC-1 / ΔCtΔTm on days 12 and 26 after a single subcutaneous injection of CD40L vector Subcutaneous injection of CD40L protein. A subcutaneous tumor (500,000 LL2 / LL1hMUC-1) was administered on day 1 and vaccination was performed on day 5. Tumors were administered intravenously on day 40 and tumor development (subcutaneous and lung) was evaluated on day 54.

  FIG. 10 shows pulmonary metastatic tumor nodule therapy (after colonization) in animals treated as described in FIG. Left panel: Results are similar to subcutaneous tumor prevention, with schedules VVV and VPP being most effective. Right panel: A combination of one vector injection followed by two protein injections (VPP) completely suppressed pulmonary nodule growth of established hMUC-1 positive cancer cells.

  FIG. 11 is a comparison of different boost regimes following a single subcutaneous administration of the Ad-sig-ecdhMUC-1 / ecdCD40L vector in terms of the animal's ability to resist the development of MUC1-expressing tumors. EcdhMUC-1 / ecdCD40L protein in bacterial extracts; ecdhMUC-1 bound to keyhole limpet hemocyanin (KLH) (with or without incomplete Floyd adjuvant); PBS (phosphate buffer); and control bacterial extraction (Bacterial host strain not infected with Ad-sig-ecdhMUC-1 / ecdCD40L vector).

DETAILED DESCRIPTION OF THE INVENTION According to one aspect of the present invention, a method for generating an immune response against an antigen using an expression vector is provided. The vector includes a transcription unit that encodes a secretable fusion protein comprising an antigen and a CD40 ligand. In a preferred embodiment, the transcription unit comprises, from the amino terminal side, a secretory signal sequence, an antigen, a linker, and a secretory CD40 ligand. In preferred embodiments, the secreted CD40 ligand lacks all or part of its transmembrane domain.

  In a preferred method, an individual is first administered one or more vectors to generate an initial immune response. Following administration of the vector, an effective amount of the fusion protein is administered to boost the immune response to the antigen, which is higher than that obtained with single administration of the vector.

  The term “effective amount” for administration of a fusion protein refers to an amount that results in a higher immune response than that obtained with the expression vector alone. In general, time intervals between doses are required to obtain optimal results. An increase in immune response may be measured as an increase in T cell activity or antibody production (see, eg, FIGS. 3-5). In general, at least one week is effective between vector administration and protein boost administration, although shorter intervals are possible. Effective intervals between doses may be 1 to 12 weeks or longer. Multiple boost doses may be given over a period of 1-12 weeks or longer.

  By using the fusion protein to boost the immune response, the need for sequential administration of the expression vector, which can cause hypersensitivity to multiple injections, is avoided. The antigen portion of the fusion protein is preferably a fusion protein encoded by the transcription unit of the expression vector used for the first administration. However, the antigen portion of the fusion protein may be different from the encoded antigen, as long as it shares at least one antigenic determinant or epitope common to the antigen of the expression vector and the antigen of the fusion protein used for boosting.

  The fusion protein may be prepared in a mammalian cell system, which is complementary to the vector. For example, in the case of adenovirus, the cell line may be 293 cells containing the Early Region 1 (E1) gene and may support the growth of E1-substituted recombinant adenovirus. When an adenoviral vector infects producer cells, the viral vector self-replicates after a viral replication cycle. However, the gene of interest performed by the viral vector in the expression cassette is expressed during the viral growth process. This can be used to prepare a fusion protein encoded by the vector in the same system that produces the vector. The production of the vector and the fusion protein takes place simultaneously in the production system. The vectors and proteins thus generated can be further isolated and purified in different processes.

  The fusion protein may be administered parenterally, for example, intravascularly, intravenously, intraarterially, intramuscularly, subcutaneously, and the like. Administration may be oral, nasal, rectal, transdermal, or inhalation by aerosol. The protein boost may be administered as a bolus or slowly infused. Protein boost is preferably administered subcutaneously.

A fusion protein boost may be prepared with an adjuvant to enhance the resulting immune response. As used herein, the term “adjuvant” means a chemical that, when administered with a vaccine, enhances the immune response to the vaccine. Adjuvants are distinguished from carrier proteins in that the adjuvant does not chemically bind to the immunogen or antigen. Adjuvants are known in the art and include, for example: mineral oil emulsions (US Pat. No. 4,608,251, supra) such as Freud's complete or incomplete adjuvant (Freund, Adv. Tuberc. Res. 7: 130 (1956) Calbiochem, San Diego Calif.), Aluminum salts, particularly aluminum hydroxide or ALLOHYDROGEL (approved for human use by the US Food and Drug Administration), muramyl dipeptide (MDP) and analogs thereof such as [Thr ¹ ] -MDP (Byers and Allison, Vaccine 5: 223 (1987)), monophosphoryl lipid A (Johnson et al., Rev. Infect. Dis. 9: S512 (1987)).

  The fusion protein can be administered in microencapsulated or macroencapsulated form using methods known in the art. The fusion protein is encapsulated in, for example, liposomes (see, eg, Garcon and Six, J. Immunol. 146: 3697 (1991)), bovine rotavirus internal capsid protein (Redmond et al., Mol. Immunol. 28: 269 (1991)), Immunostimulatory molecules composed of saponins such as Quil A (ISCOMS) (Morein et al., Nature 308: 457 (1984); Morein et al., Immunological Adjuvants and Vaccines (edited by G. Gregoriadis et al.)) Pp.153-162, Plenum Press , NY (1987)), or sustained release biodegradable microspheres (eg composed of lactide / glycolide copolymers) (O'Hagan et al., Immunology 73: 239 (1991); O'Hagan et al., Vaccine 11: 149 (1993) )).

  Fusion proteins may be absorbed onto the surface of lipid microspheres containing squalene or squalane emulsions prepared with PLURONIC block copolymers such as L-121 and stabilized with surfactants such as TWEEN 80 (Allison and Byers, Vaccines: New Approaches to Immunological Problems (edited by R. Ellis) pp. 431-449, Butterworth-Hinemann, Stoneman NY (1992)). The microencapsulated or macroencapsulated fusion protein may contain an adjuvant.

  The fusion protein may be conjugated to a carrier or foreign molecule, eg, a carrier protein that is foreign to the individual to whom the protein boost is to be administered. A foreign protein that activates an immune response and can be conjugated to a fusion protein described herein has a molecular weight of at least about 20,000 daltons, preferably at least about 40,000 daltons, more preferably at least about 60,000 daltons or There are other molecules. Carrier proteins useful in the present invention include, for example, GST, hemocyanin (eg, from keyhole limpet), serum albumin or cationized serum albumin, thyroglobulin, ovalbumin, various toxoid proteins (eg, tetanus toxoid or diphtheria toxoid) ), Immunoglobulins and heat shock proteins.

  Methods for chemically conjugating one protein to another (carrier) protein are known in the art and include, for example: water-soluble carbodiimides (eg 1-ethyl-3- (3-dimethylaminopropyl) ) Conjugation by carbodiimide hydrochloride), conjugation by homo-bivalent cross-linking linker (eg with NHS ester group or sulfo-NHS ester analog), eg NHS ester and maleimide group, eg sulfosuccinimidyl-4 Conjugates with heterobivalent crosslinkers (with-(N-maleimidomethyl) cyclohexane-1-carboxylate), and conjugates with glutaraldehyde (eg, Hermanson, Bioconjugate Techniques, Academic Press, San Diego, Calif. (1996) ); See U.S. Pat. Nos. 4,608,251 and 4,161,519).

  As used herein, the term “vector” (also known as an “expression vector”) comprising a transcription unit is a viral and capable of entering a target cell and expressing the encoded protein when administered in vivo. A non-viral expression vector. Viral vectors suitable for in vivo delivery and expression of exogenous proteins are known and include adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, herpes simplex virus vectors, and the like. Viral vectors preferably cause replication defects in normal cells. See U.S. Patent Nos. 6,669,942; 6,566,128; 6,794,188; 6,110,744; 6,133,029.

  As used herein, the term “cell” is used in a broad sense and includes any living cell such as a mammalian cell, a plant cell, a eukaryotic cell, or a prokaryotic cell.

  As used herein, the term “adenovirus expression vector” refers to any vector derived from an adenovirus that contains exogenous DNA inserted into its genome that encodes a polypeptide. The vector must have the ability to replicate and encapsulate when a defective essential gene is provided in trans. Preferably, the adenoviral vector is required to encapsulate the genome in at least a portion of each terminal repeat necessary to support viral DNA replication, preferably at least about 90% of the full-length ITR sequence, and the viral capside. Contains DNA. Many suitable adenoviral vectors have been reported in the art. See US Pat. Nos. 6,440,944 and 6,040,174 (replication defective E1-deficient vectors and specialized packaging cell lines). Preferred adenoviral expression vectors are those that are replication defective in normal cells.

  Adeno-associated virus refers to a class of small single-stranded DNA viruses whose genetic material can be inserted into specific sites on chromosome 19. The preparation and use of adeno-associated viral vectors for gene delivery is described in US Pat. No. 5,658,785.

  Non-viral vectors for gene delivery include various types of expression vectors (in combination with lipids, proteins, and other molecules (or combinations thereof) to protect the vector DNA during delivery) For example, a plasmid). Fusigenic non-viral vector particles can be constructed by combining a viral fusion protein with the described expression vector. Kaneda, Curr Drug Targets (2003) 4 (8): 599-602. The reconstructed HVJ (hemagglutinating virus of Japan) -liposomes can be used to carry the expression vector, or the vectors can be introduced directly into the inactivated HVJ particles without the use of liposomes. See Kaneda, Curr Drug Targets (2003) 4 (8): 599-602. DMRIE / DOPE lipid mixtures are useful as vehicles for non-viral expression vectors. See US Pat. No. 6,147,055. Polycation-DNA complexes may be used as non-viral gene delivery vehicles. See Thomas et al., Appl Microbiol Biotechnol (2003) 62 (1): 27-34.

  The term “transcription unit” as used herein in the context of an expression vector is a stretch of DNA that is transcribed as a single continuous mRNA strand by RNA polymerase for the initiation and termination of transcription. This includes signals. For example, in certain embodiments, a transcription unit of the invention comprises, in the 5 'to 3' direction, a nucleic acid encoding a secretory signal sequence, an antigen, and a CD40 ligand. A transcription unit is operably linked to transcriptional and / or translational expression control elements, such as promoters, and optionally any upstream or downstream enhancer elements. A useful promoter / enhancer is the cytomegalovirus (CMV) IE (immediate-early) promoter / enhancer. See US Pat. Nos. 5,849,522 and 6,218,140.

  As used herein, the term “secretory signal sequence” (also known as “signal sequence”, “signal peptide”, “leader sequence”, or “leader peptide”) is a term that is generally hydrophobic. A short peptide sequence containing 20 to 30 amino acids, which is synthesized at the N-terminus of a polypeptide and directs the polypeptide into the endoplasmic reticulum. Secretory signal sequences are generally cleaved upon translocation of the polypeptide to the endoplasmic reticulum. Eukaryotic secretion signal sequences are preferred for inducing secretion of the exogenous gene product of the expression vector. A variety of such suitable sequences are known in the art, including human growth hormone, the secretory signal sequence of the kappa chain of immunoglobulins, and the like. In certain embodiments, exogenous tumor antigen signal sequences may be used to cause secretion.

  The term “antigen” as used herein broadly refers to any antigen with which an individual can raise an immune response. As used herein, “antigen” refers broadly to molecules that contain at least one antigenic determinant that an immune response can target. The immune response may be cellular, humoral, or both.

  As is known in the art, an antigen may be an in nature protein, a natural hydrocarbon, a natural lipid, or a natural nucleic acid, or a combination of these biomolecules. Antigens may include non-natural molecules, such as polymers. Antigens include self antigens and foreign antigens, such as antigens produced by another animal or antigens derived from infectious agents. Infectious agent antigens may be bacterial, viral, fungal, prokaryotic, and the like.

  As used herein, the term “tumor associated antigen” (TAA) refers to a protein present on tumor cells and normal cells in the fetal stage (carcinoembryonic antigen), which is a selected organ after delivery. Although present on medium or many normal cells, its concentration is significantly lower than on tumor cells. Various TAAs have been reported. Exemplary TAAs are mucins (eg MUC1, described in more detail below) or HER2 (neu) (also described below). In contrast, tumor-specific antigen (TSA) (also called tumor-specific transplant antigen or TSTA) refers to a protein that does not exist in normal cells. TSA usually appears when cells are immortalized by an infecting virus and viral antigens are expressed.

  A typical virus TSA is HPV type 16 E6 or E7 protein. TSAs not induced by viruses include idiotypes associated with B cell lymphomas or the T cell receptor idiotypes associated with B cell lymphomas T cell receptor (TCR) on T cell lymphomas).

  A typical virus TSA is HPV type 16 E6 or E7 protein. HPV can cause various skin and genital tract epithelial lesions. HPV-related genital tract diseases are the second most common cause of cancer death among women worldwide. They include genital warts, cervical intraepithelial neoplasia (CIN), and cervical cancer. The type of HPV most commonly associated with high grade CIN and cervical cancer is HPV16. Most cervical cancers express nonstructural HPV16-derived gene products E6 and E7 oncoproteins. In the HPV-induced cervical cancer model, E6 / E7 oncoproteins are required for the maintenance of malignant phenotypes, and their expression correlates with the potential for transformation of HPV16. In addition to using E6 or E7 as tumor antigens, antigenic fragments of these proteins may be used instead. Antigenic fragments may be determined by examining the immune response with a portion of the molecule as expected to carry the epitope using well-known computer operations (eg, Hopp and Woods hydrophobicity analysis).

  The TSA that is not induced by the virus may be an immunoglobulin of B cell lymphoma or an idiotype of T cell receptor (TCR) of T cell lymphoma. Tumor associated antigen (TAA) is more common than TSA.

  Both TAA and TSA can be immunological targets for expression vector vaccines. Unless otherwise stated, the term “tumor antigen” herein refers collectively to TAA and TSA.

  As used herein, the term "mucin" refers to any class of clustered oligosaccharides that have a high content of clustered oligosaccharides O-glycosidically linked to peptide sequences with threonine, serine, and proline-rich tandem repeat structures. Refers to high molecular weight glycoprotein. Mucins play a role in cell defense, with many sugars exposed on stretch structures, affecting multiple interactions with various types of cells, including leukocytes and infectious agents. Some mucin antigens have been identified as: CD227, tumor-associated epithelial antigen (EMA), polymorphic epithelial mucin (PEM), peanut-reactive urinary mucin (PUM), episialin (Episialin), breast cancer associated antigen DF3, H23 antigen, mucin 1, episialin, tumor associated mucin, cancer associated mucin. There are also CA15-3 antigen, M344 antigen, Sialosyl Lewis antigen (SLA), CA19-9, CA195, and other mucin antigens previously identified by monoclonal antibodies (see, eg, US Pat. No. 5,849,876). The term mucin does not include proteoglycans, which are glycoproteins characterized by glycosaminoglycan chains covalently linked to the protein backbone.

  At least 15 different mucins have been reported, including MUC1, MUC2, MUC3A, MUC3B, MUC4, MUC5AC, MUC5B, MUC6, MUC7, MUC8, MUC9, MUC12, MUC13, MUC15, and MUC16 You may also indicate a hyphen between “MUC” and the number). The nucleotide and amino acid sequences of these mucins are known. The NCBI and Swiss Prot accession numbers for these mucins are: MUC1 (NCBI NM002456, Swiss Prot P15941), MUC2 (NCBI NM002457, Swiss Prot Q02817), MUC3A (NCBI AF113616, Swiss Prot Q02505), MUC3B (NCBI AJ291390, Swiss Prot Q9H195), MUC4 (NCBI NM138299, Swiss Prot Q99102), MUC5AC (NCBI AF043909, Swiss Prot Q8WWQ5), MUC5B (Swiss Prot Q9HC84), MUC6 (NCBI U97698, Swiss Prot Q8N8I1), 429 MUC7NC Prot Q8TAX7), MUC8 (NCBI U14383, Swiss Prot Q12964), MUC9 (NCBI U09550, Swiss Prot Q12889), MUC12 (Swiss Prot Q9UKN1), MUC13 (NCBI NM017648, Swiss Prot Q9H3R2), MUC15 (NCBI NM1458WW, Swiss Prot) , And MUC16 (also referred to as NCBI AF361486, Swiss Prot Q8WXI7; CA125).

  There are two structurally and functionally distinct mucins: secreted gel-forming mucins (MUC2, MUC5AC, MUC5B, and MUC6) and transmembrane mucins (MUC1, MUC3A, MUC3B, MUC4, MUC12, MUC17). Some MUC gene products do not fall into any class (MUC7, MUC8, MUC9, MUC13, MUC15, MUC16).

  The characteristics of certain mucins as TAAs in certain cancers are confirmed by changes in expression and structure associated with preneoplastic and neoplastic lesions (Filipe MI: Invest Cell Pathol 1979, 2: 195-216; Filipe MI Acta Med Port 1979, 1: 351-365). For example, normal gastric mucosa is characterized by the expression of MUC1, MUC5A / C, MUC6 mRNA, and the encoded immunoreactive protein. Also, high levels of MUC2, MUC3 mucin mRNA, and encoded immunoreactive protein are involved in intestinal metaplasia. Gastric cancer exhibits markedly altered secretory mucin mRNA levels compared to adjacent normal mucosa, MUC5 and MUC6 mRNA levels are decreased, and MUC3 and MUC4 mRNA levels are increased. High levels of MUC2 and MUC3 mRNA and protein are detectable in the small intestine, and MUC2 is the most abundant colonic mucin.

  Mucin is a diagnostic marker for early detection of pancreatic cancer and other cell types. Studies have shown that ductal adenocarcinomas (DACs) and tumor cell lines usually overexpress MUC1 mucins. See Andrianifahanana et al., Clin Cancer Res 2001, 7: 4033-4040. This mucin is only detected at low levels in most chronic pancreatitis and normal pancreatic tissue, but is overexpressed at all stages of pancreatic cancer. De novo expression of MUC4 in pancreatic cancer and cell lines has been reported (Hollingsworth et al., Int J Cancer 1994, 57: 198-203). MUC4 mRNA expression has been observed in most pancreatic cancers and established pancreatic cancer cell lines, but not in normal pancreas or chronic pancreatitis tissue. MUC4 expression has also been found to be associated with lung cancer (see Nguyen et al., 1996 Tumor Biol. 17: 176-192). MUC5 is associated with metastasis in non-small cell lung cancer (see Yu et al., 1996 Int. J. Cancer 69: 457-465). In gastric and invasive DAC, MUC6 is overexpressed and MUC5AC is de novo expressed (Kim et al., Gastroenterology 2002, 123: 1052-1060). MUC7 has been reported as a marker for invasive bladder cancer (Retz et al., 1998 Cancer Res. 58: 5662-5666).

  Expression of MUC2 secretory gel-forming mucins is generally reduced in colorectal adenocarcinoma and conserved in myxoma (a different subtype of colorectal cancer with microsatellite instability). MUC2 is elevated in pharyngeal cancer (Jeannon et al., 2001 Otolaryngol Head Neck Surg. 124: 199-202). Another secreted gel-forming mucin, MUC5AC (a product of normal gastric mucosa), is not present in the normal colon, but is frequently present in colorectal adenocarcinoma and colon cancer.

  MUC1 (also known as episialin), polymorphic epithelial mucin (PEM), mucin-like cancer-associated antigen (MCA), CA27.29, peanut-reactive urine mucin (PUM), tumor-associated epithelial mucin, epithelial membrane antigen (EMA) ), Human milk fat globule (HMFG) antigen, MUC1 / REP, MUC1 / SEC, MUC1 / Y, and CD227 are the most well-known mucins. The gene encoding MUC1 is mapped to lq21-q24. The MUC1 gene contains 7 exons and produces 7 different splice variants. Tandem repeat domains are highly O-glycosylated and glycosylation changes have been revealed in epithelial cancer cells.

  MUC1 mRNA is a size polymorphism. Currently, there are nine MUC1 isoforms based on splicing changes (isoform number: NCBI accession number; 1: ID P15941-1, 2: ID P15941-2, 3: ID P15941-3, 4 : ID P15941-4, 5: P15941-5, 6: ID P15941-6, 7: ID P15941-7, 8: ID P15941-8, 9: ID P15941-9).

  MUC1 isoform 1 (also known as MUC1 / REP) is a polymorphic type I transmembrane protein, including: 1) Mainly 20-amino acid (aa) repeat motif (variable number (30-100) tandem repeat ( A large extracellular domain consisting of a region known as Variable Number of tandem repeats-VNTR); 2) a transmembrane domain; and 3) a 72-aa cytoplasmic tail. During biosynthesis, the MUC1 / REP protein is significantly modified and a significant number of O-linked sugar moieties give mucin-like features on the mature protein. Shortly after translation, MUC1 / REP is cleaved into two products that form a tightly bound heterodimeric complex, which is much smaller than that whose large extracellular domain contains the cytoplasmic and transmembrane domains. Consists of non-covalent bonds to proteins. The extracellular domain can be detached from the cell. Using Swiss Prot P15941 as a reference (see Figure 1), the extracellular domain (ecm) of MUC1 isoform 1 is amino acids 24 to 1158, the transmembrane domain is 1159-1181, and the cytoplasmic domain is 1182-1255 is there. The SEA domain is 1034-1151, a C-terminal part called the extracellular domain. The mucin SEA domain is generally a target for proteolytic cleavage, producing two subunits, the smaller one that binds to the cell membrane.

  MUC1 isoform 5 (also referred to as MUC1 / SEC) is a type of MUC1 that is secreted by cells. It has the same extracellular domain as isoform 1 (MUC1 / REP) but does not have a transmembrane domain for tethering proteins to the cell membrane. MUC1 isoform 7 (also referred to as MUC1 / Y) contains the cytoplasmic and transmembrane domains observed in isoform 1 (MUC1 / REP) and 5 (MUC1 / SEC), but has an extracellular domain smaller than MUC1, Has no repeat motif and its flanking regions (see Baruch A. et al., 1999 Cancer Res. 59, 1552-1561). Isoform 7 acts as a receptor and binds to secreted isoform 5. Binding induces phosphorylation of isoform 7, changes cellular morphology, and initiates cell signaling through a second messenger protein such as GRB2 (Zrihan-Licht S. et al., 1995 FEBS Lett 356, 130-136). β-catenin has been shown to react with the cytoplasmic domain of MUC1 (Yamamoto M. et al., 1997 J. Biol. Chem. 272, 12492-12494).

  MUC1 is expressed at low levels locally on the normal epithelial cell surface. See 15. Greenlee et al., Cancer Statistics CA Cancer J. 50, 7-33 (2000); Ren et al., J. Biol. Chem. 277, 17616-17622 (2002); Kontani et al., Br. J. Cancer 84, 1258-1264 ( 2001); Rowse et al., Cancer Res. 58, 315 (1998). MUC1 is overexpressed in breast, ovarian, pancreatic, and other cancers (see also Gendler S.J. et al., 1990 J. Biol. Chem. 265, 15286-15293). There was a correlation between acquisition of additional copies of the MUC1 gene and high mRNA levels (p <0.0001), revealing the genetic mechanism responsible for MUC1 gene overexpression and the pathogenesis of breast cancer (See Bieche I. et al., 1997 Cancer Genet. Cytogenet. 98, 75-80) MUC1 mucins, according to immunological detection, have been found in colon cancer (this Is associated with poor prognosis) and increased expression in ovarian cancer.

  High level expression of the MUC1 antigen plays a role in the growth of neoplastic epithelial mucosal cells by disrupting the regulation of anchorage-dependent growth (disrupting E-cadherin function), which results in metastasis. See Greenlee et al., Cancer Statistics CA Cancer J. 50, 7-33 (2000); Ren et al., J. Biol. Chem. 277, 17616-17622 (2002). Non-MHC restricted cytotoxic T cell responses to MUC1 have been reported in breast cancer patients. See Kontani et al., Br. J. Cancer 84, 1258-1264 (2001). It has been reported that human MUC1 transgenic mice (“MUC1.Tg”) do not respond to stimulation with human MUC1 antigen. See Rowse et al., Cancer Res. 58, 315 (1998). Human MUC1 transgenic mice are useful for assessing the establishment of immunity against MUC1 as a self-antigen.

  MUC1 protein and mRNA have been observed in ER positive MCF-7 and BT-474 cells, and ER negative MDA-MB-231 and SK-BR-3 BCC cells. mRNA transcription levels are higher in the ER + cell line than in ER-. MUC1 reacts with intracellular adhesion molecule-1 (ICAM-1). At least six tandem repeats of MUC1 are required (Regimbald et al., 1996 Cancer Res. 56, 4244-4249). The tandem repeat peptide of MUC1 from T-47D BCC is highly O-glycosylated, with 4.8 sites per repeat compared to 2.6 glycosylation sites per repeat of milk-derived mucins.

  As used herein, the term “mucin antigen” is an epitope characterized in that it can induce cellular immunity using full-length mucin or an MUC-CD40L expression vector administered in vivo as described herein A part of mucin containing A “mucin antigen” includes one or more epitopes from the extracellular domain of mucin, eg, one or more tandem repeat motifs or SEA regions associated with VNTR. Mucin antigens may include the entire extracellular domain. The term “mucin antigen” also includes sequence variants that do not alter the ability of the antigen to induce an immune response that cross-reacts with the natural mucin sequence, such as conservative amino acid changes.

VNTR consists of a variable number of tandem repeat peptide sequences of varying length (and composition) according to genetic polymorphism and mucin properties. The VNTR may also include 5 ′ and 3 ′ regions containing modified tandem repeats. For example, in MUC1, the number of repeats varies from 21 to 125 in the Nordic population. In the United States, the least frequent alleles contain 41 and 85 repeats, with the more common alleles having 60-84 repeats. The MUC1 repeat has the general repeat peptide sequence P DT RPAPGSTAP P AHGVTSA (SEQ ID NO: 3). The underlying MUC1 tandem repeat is a gene sequence polymorphism at three positions (positions 2, 3, and 13) indicated by bold and underline. Concerted replacement DT → ES (sequence variant 1) and single substitution P → Q (sequence variant 2), P → A (sequence variant 3), and P → T (sequence variant 4) have been identified The position in the domain varies (see Engelmann et al., 2001 J. Biol. Chem. 276: 27764-27769). The most frequent substitution DT → ES occurs with up to 50% repeats. Table 1 shows typical tandem repeat sequences.

  As used herein, a mucin antigen may contain only one tandem repeat sequence motif, but if the vector contains multiple such repeats, the generally generated immune response is stronger and more effective. Should be understood. The vectors of the present invention are preferably 2-4, more preferably 5-9, more preferably 10-19, more preferably 20-29, even more preferably 30-39, and even more preferably 40-50 mucin tandem. Code a repeat. Tandem repeats greater than 50 are possible and may include the number of repeats found in natural mucins.

  As used herein, the term mucin antigen may include tandem repeats derived from various types of mucins. For example, the expression vector may encode tandem repeats from two different mucins (eg, MUC1 and MUC2). These vectors may encode multiple types of SEA domains as well, or may contain a combination of tandem repeats and one or more SEA domains.

  A secreted antigen is one in which all or substantially all of its transmembrane domain (if present in the mature protein) is deleted. For example, in the case of mucins, the transmembrane domain, if present, is generally about 24 amino acids long and serves to anchor mucins or fragments of mucins to the cell membrane. A secreted MUC1 from which all transmembrane domains have been deleted is MUC1 from which residues 1159-1181 have been deleted. Mucins (or antigens) in which substantially all of the transmembrane domain has been deleted have a domain having 6 or fewer residues of the sequence at one end of the transmembrane domain, more preferably less than about 4 of the sequence at one end of the transmembrane domain. Residues, more preferably those containing less than about 2 residues of the sequence at one end of the transmembrane domain, and most preferably no more than 1 residue at one end of the transmembrane domain. In a preferred embodiment, the transcription unit of the vaccine vector encodes a secreted mucin (or antigen) that lacks the entire transmembrane domain. Mucins that are capable of being secreted upon deletion of substantially all of the transmembrane domain contain no more than 6 residues of the sequence at one end of the domain. In this specification, the extracellular domain of human mucin such as MUC1 is referred to as “ecdhMUC1”.

  It should be understood that mucins lacking a functional transmembrane domain may still contain all or part of the cytoplasmic domain (if present) and all or part of SEA.

  DNA sources encoding various mucins and mucin antigens may be obtained from mucin expressing cell lines using commercially available cDNA synthesis kits and amplification (using suitable PCR primer pairs that can be designed from established mucin DNA sequences). . For example, nucleic acids encoding MUC1 or MUC2 may be obtained from CRL-1500 cells available from the American Type Culture Collection. DNA encoding mucin may be obtained by amplification from RNA or cDNA collected or prepared from human or other animal tissue. For DNA segments that are not very large, the DNA may be synthesized using an automated oligonucleotide synthesizer.

  The term “linker” as used herein with respect to the transcription unit of an expression vector refers to one or more amino acid residues between the carboxy terminus of the antigen and the amino terminus of the CD40 ligand. The composition and length of the linker may be determined according to methods known in the art and may be tested for efficacy. See, for example, Arai et al., “Design of the linkers which effectively separate domains of a bifunctional fusion protein” Protein Engineering, Vol. 14, No. 8, 529-532, August 2001. The linker is generally about 3 to about 15 amino acids long, more preferably about 5 to about 10 amino acids long, although longer or shorter linkers may be used, or no linker at all. Longer linkers may extend up to about 50 amino acids, or up to about 100 amino acids. When the mucin antigen is on the N-terminal side of the CD40 ligand, a short linker of less than 10 residues is preferred.

  As used herein, the term “CD40 ligand” (CD40L) refers to the full length or a portion of a molecule also known as CD154 or TNF5. CD40L is a type II membrane polypeptide having a cytoplasmic domain, a transmembrane region at the N-terminus, and an extracellular domain at the C-terminus. Unless otherwise noted, full-length CD40L is described herein as “CD40L”, “wtCD40L”, or “wtTmCD40L”. The type of CD40L in which the cytoplasmic domain is deleted is referred to herein as “ΔCtCD40L”. The type of CD40L in which the transmembrane domain is deleted is referred to as “ΔTmCD40L” in the present specification. A form of CD40L in which both the cytoplasmic domain and transmembrane domain are deleted is referred to herein as “ΔCtΔTmCD40L”. The nucleotide and amino acid sequences of mouse and human derived CD40L are known in the art and are reported, for example, in US Pat. No. 5,962,406 (Armitage et al.). In the context of the fusion proteins of the present invention, sequence variants including conservative amino acid changes that do not alter the ligand's ability to induce an immune response against mucin are also included within the meaning of CD40 ligand.

  Mouse CD40L (mCD40L) is 260 amino acids long. The cytoplasmic (Ct) domain of mCD40L spans approximately 1-22, the transmembrane domain approximately 23-46, and the extracellular domain approximately 47-260.

  Human CD40L (hCD40L) is 261 amino acids long. The cytoplasmic domain of hCD40L spans approximately positions 1-22, the transmembrane domain approximately positions 23-46, and the extracellular domain approximately positions 47-261.

  As used herein, the phrase “CD40 ligand is capable of being secreted by deleting all or substantially all of the transmembrane domain” refers to a recombinant CD40 that can be secreted from a cell. Refers to the ligand. The CD40L transmembrane domain, which contains about 24 amino acids in length, functions to anchor the CD40 ligand in the cell membrane. CD40L from which all of the transmembrane domain has been deleted is a CD40 ligand from which residues 23-46 have been deleted. A CD40 ligand lacking substantially all of the transmembrane domain is 6 residues or less of the sequence at one end of the transmembrane domain, more preferably less than about 4 residues of the sequence at one end of the transmembrane domain, more preferably the membrane. It possesses less than about 2 residues of the sequence at one end of the transmembrane domain, and most preferably no more than 1 residue at one end of the transmembrane domain. Therefore, CD40L, which can be secreted after deletion of substantially all of the transmembrane domain, has no more than 6 residues in the sequence at one end of the domain. As such, CD40L contains amino acids no more than amino acids 41-46 or 23-28 located in the transmembrane domain of CD40L in addition to the extracellular domain and optionally the cytoplasmic domain (Such as CD40L would contain, in addition to the extracellular domain and optionally the cytoplasmic domain, and no more than amino acids 41-46 or 23-28 located in the transmembrane domain of CD40L.). In a preferred embodiment, the vaccine vector transcription unit encodes a secreted CD40 that contains less than 10% of the transmembrane domain. More preferably, CD40L does not contain a transmembrane domain.

  It should be understood that CD40L lacking a functional transmembrane domain may still contain all or part of the cytoplasmic domain. Similarly, CD40L lacking a functional transmembrane domain can include all or substantially a portion of the extracellular domain.

  For use herein, the expression vector and fusion protein boost are administered as a vaccine to induce immunity against tumor antigens. Expression vectors and fusion protein boosts may be prepared with a suitable pharmaceutically acceptable carrier, if desired. Thus, vectors or protein boosts may be used in the manufacture of a drug or pharmaceutical composition. Expression vectors and fusion proteins may be prepared as solutions or lyophilized powders for parenteral administration. Prior to use, the powder may be reconstituted with the addition of a suitable diluent or other pharmaceutically acceptable carrier. The liquid formulation may be a buffered isotonic aqueous solution. The powder may be sprayed in the dry state. Examples of suitable diluents are normal isotonic saline, standard 5% dextrose in water, or sodium acetate or ammonium buffer. These formulations are particularly suitable for parenteral administration but may be used for oral administration or contained in a metered dose inhaler or nebulizer for inhalation. Addition of excipients such as polyvinylpyrrolidone, gelatin, hydroxycellulose, acacia gum, polyethylene glycol, mannitol, sodium chloride, sodium citrate and the like may be desired.

  Alternatively, expression vectors and fusion proteins may be prepared for oral administration. Pharmaceutically acceptable solid or liquid carriers may be added to enhance or stabilize the composition, or facilitate vector preparation. Solid carriers include starch, lactose, calcium sulfate dihydrate, terra alba, magnesium or stearate, talc, pectin, acacia gum, agar, or gelatin. Liquid carriers include syrup, peanut oil, olive oil, saline, and water. The carrier may contain a sustained release material, such as glyceryl monostearate or glyceryl distearate, alone or with a wax. The amount of solid carrier will vary, but preferably will be between about 20 mg to about 1 g per dosage unit. When a liquid carrier is used, the formulation may be in the form of a syrup, elixir, emulsion, or an aqueous or non-aqueous suspension.

  Expression vectors and fusion proteins may be prepared containing other pharmaceutically useful agents or biological materials. The vector may be administered in conjunction with administration of other drugs or biological agents useful for the disease or condition for which the compounds of the invention are intended.

As used herein, the phrase “effective amount” refers to a dose that results in a concentration that is high enough to produce (or participate in) an immune response in the recipient. The specific effective amount for a particular subject depends on a variety of factors, including the disorder to be treated, the severity of the disorder, the activity of the particular compound, the route of administration, the clearance rate of the viral vector, the duration of treatment, There are agents well known in the fields of medicine, age, weight, sex, diet, and general health of a subject, and medical and scientific fields to be used in conjunction with or used with a viral vector. Various commonly considered points for determining a “therapeutically effective amount” are well known in the art and are described, for example, in: Gilman et al., Goodman And Gilman's: The Pharmacological Bases of Therapeutics, 8th edition, Pergamon Press, 1990; and Remington's Pharmaceutical Sciences, 17th edition, Mack Publishing Co., Easton, Pa., 1990. For vector administration, the range of particles per dose is generally about 1 × 10 ⁷ to 1 × 10 ¹¹ , more preferably 1 × 10 ⁸ to 5 × ^{10 10} , and even more preferably 5 × ^{10 8} to 2 × ^{10 10} . The vector may be administered parenterally, for example, intravascularly, intravenously, intraarterially, intramuscularly, subcutaneously and the like. Administration may be oral, nasal, rectal, transdermal, or inhalation via aerosol. The vector may be administered as a bolus or slowly infused. Preferably the vector is administered subcutaneously.

As shown herein, vectors encoding tumor associated antigens induce protective cells and humoral immunity against those antigens, including those already established for tolerance. Without wishing to be bound by any theory, it is believed that administration of the vaccine of the present invention will result in continuous local release of a fusion protein composed of a secreted antigen bound to a secreted CD40 ligand. . As shown herein, this promotes DC maturation and promotes the generation of effective antigen-specific immunity. Also, as shown herein, a secretable fusion protein encoding the extracellular domain of human MUC1 and mouse CD40L (ie, sighMUC1-ΔCtΔTmCD40L) lacking the transmembrane and cytoplasmic domains generated from adenoviral vectors Dramatically enhanced the effectiveness of cellular immune responses against MUC1-expressing tumor cells. Without wishing to be bound by any theory, a subcutaneous injection of the Ad-K-ecdhMUC1-ΔCtΔTmCD40L vector induced strong MUC1-specific CD8 ⁺ T cell-mediated immunity, thereby expressing a MUC1 tumor-associated antigen It is thought that cell engraftment is prevented.

  Immunity raised against antigens using the methods of the invention is sustained over time. As used herein, the term long-lasting refers to immunity induced by a vector-encoded antigen for up to 6 months, preferably up to 8 months, more preferably up to 1 year, more preferably up to 1.5 years from the last dose. , And more preferably means indicated for at least 2 years.

In certain embodiments, a fusion protein comprising the extracellular domain of MUC1 fused to the amino terminus of a CD40 ligand lacking the transmembrane and cytoplasmic domains may be generated to generate immunity against mucin TAA. The construction of these vectors is disclosed in the examples. As observed herein, subcutaneous administration of this adenoviral vector mucin vaccine induces a very potent long-lasting CD8 ⁺ cytotoxic T cell-dependent systemic immunity against cancer cells bearing the MUC1 antigen It was done. Mucin vaccines induced the generation of memory cells that underlie long-lasting immunity.

  When mice were vaccinated with the adenoviral vector Ad-sig-ecdhMUC1 / ecdmCD40L, 100% of the hMUC1 transgenic mice (ie, these mice were invisible to the hMUC1 antigen prior to vector injection) in human MUC1 (hMUC1 ) An immune response was induced that suppressed the growth of antigen positive tumor cells. See Rowse et al., Cancer Res. 58, 315 (1998). The immune response to the Ad-sig-ecdhMUC1 / ecdmCD40L vector persisted for up to 1 year, indicating antigen specificity. These results indicate that the Ad-sig-ecdhMUC1-ecd / ecdCD40L vector can be used for the treatment of epithelial malignant lesions expressing MUC1.

  Subcutaneous injection of the adenovirus MUC1 expression vector increased the level of hMUC1-specific T cells in the spleen of injected hMUC1 transgenic mice by a factor of 250. Transgenic mice were invisible to hMUC1 antigen prior to vector injection. Thus, vector injection overcomes the invisibility and induces a CD8 + T cell-dependent systemic Th1 immune response that is antigen specific and HLA restricted. The ability to overcome the obscurity as observed with inoculation with the adenovirus MUC1 expression vector was not observed when transgenic mice were inoculated with purified ecdhMUC1 / ecdCD40L-HIS protein.

  While not wishing to be bound by any theory, infected cells near the site of subcutaneous injection of the vector release tumor antigen / CD40 ligand secretion, which is an antigen-displaying cell in the vicinity of the infected cell (eg, DC) It is thought that it is taken in. Internalized tumor antigens are digested with the proteosome and the resulting mucin antigen peptides migrate to the endoplasmic reticulum where they bind to MHC class I molecules. Finally, DC presents tumor antigens on the surface in MHC class I molecules. Antigen presenting cells carrying activated tumor antigens migrate to a second organ carrying lymphocytes, such as regional lymph nodes or spleen. CD8 cytotoxic T cells capable of recognizing and killing cells carrying tumor-associated antigens during two weeks of continuous release of tumor antigen / CD40 fusion protein are activated, antigen-bearing dendritic cells Proliferates in lymph nodes and spleen due to the presence of. Due to the continuous stimulation of tumor antigen-specific cytotoxic T cells by continuous release from cells infected with the vector and the continuity of proliferation, it can be obtained using vectors that carry tumor antigen / CD40 ligand that is non-secretory A strong immune response is thought to occur.

Thus, the methods of the invention can be used to raise immunity against an antigen that is a self-antigen in an individual. For example, a vector encoding a MUC1-derived mucin antigen can be used to generate CD8 ⁺ immunity in a human where the MUC1 mucin antigen is a self-antigen. The methods of the present invention can also be used to overcome an immunological subclinical state against an antigen that is a self antigen.

The following examples are intended to illustrate the present invention. These examples are not intended to limit the scope of the invention.
1． Construction of adenovirus expression vector Adenovirus vector transcription unit sig-ecdhMUC1-ΔCtΔTmCD40L encodes the signal sequence (derived from Ig kappa chain) and then the extracellular domain of human MUC1, which has no transmembrane or cytoplasmic domain It is linked via a linker to a fragment of CD40 ligand (human or mouse) containing the extracellular domain. A kappa chain signal sequence was added to the amino terminus of the fusion protein to engineer the fusion protein to be secreted from vector-infected cells.

  The amino acid sequence of human MUC1 and the encoding nucleotide sequence are shown in FIGS. 2 and 1, respectively. The encoded MUC1 protein corresponds to 1255 amino acids encoded by nucleotides 74 to 3,841 of SEQ ID NO: 1. The first 23 amino acids (encoded from 74 to 142 of SEQ ID NO: 1) are the MUC1 signal sequence and are removed from the mature mucin. The extracellular domain is approximately 1135 amino acids (encoded from nucleotides 143 to 3547) from positions 24 to 1158. The tandem repeat region corresponds to about 900 amino acids. Amino acids 74 to 126 (encoded from 229 to 451 in SEQ ID NO: 1) are 5 'modified tandem repeat regions, and amino acids 127 to 945 are tandem repeat regions (encoded from 452 to 2,908 in SEQ ID NO: 1) And amino acids 946 to 962 correspond to the 3 ′ denatured tandem repeat region (encoded from 2809 to 2959 of SEQ ID NO: 1). The SEA domain is amino acids 1034 to 1151, the transmembrane domain is 1159 to 1181, and the cytoplasmic domain is 1181 to 1255 (see SEQ ID NO: 2).

  The transcription unit was introduced into the E1 gene region of the adenovirus vector backbone. After generating adenovirus vector particles in HEK293 cells, the vector DNA was purified by cesium chloride density gradient centrifugation. The presence of the signal peptide in the adenoviral vector was confirmed by restriction enzyme analysis and DNA sequencing.

A transcription unit (“sig-ecdhMUC-1”) containing DNA encoding the signal sequence of the mouse IgG kappa chain gene upstream of the DNA encoding human MUC-1 was generated by PCR, including the plasmid pcDNA3-hMUC. -1 (Finn OJ, donated by University of Pittsburgh School of Medicine) and the following primers: DNA encoding mouse IgG kappa chain METDTLLLWVLLLWVPGSTGD (single letter amino acid code) (SEQ ID NO: 11) prepared by PCR amplification (SEQ ID NO: 12, 13, and 14), a full-length 21 amino acid mouse IgG kappa chain signal sequence was generated (in SEQ ID NO: 12, the start codon “ATG” is shown in bold (underlined)).
5'-CCACC ATG GAG ACAGAC ACA CTC CTG CTA TGG GTA CTG CTG-3 '
(SEQ ID NO: 12)
5'- TC CTG CTA TGG GTA CTG CTG CTC TGG GTT CCAGGT TC-3 '
(SEQ ID NO: 13)
5'- TG CTC TGG GTT CCAGGT TCC ACT GGT GAC GAT G -3 '
(SEQ ID NO: 14)
5'- GGT TCC ACT GGT GAC GAT GTC ACC TCG GTC CCAGTC-3 '
(SEQ ID NO: 15) (forward primer for MUC-1 repeat region)
5'- GAG CTCGAG ATT GTG GAC TGG AGG GGC GGT G-3 '
(SEQ ID NO: 16) (reverse primer for MUC-1 repeat region)

A sig-ecdhMUC-1 having an upstream kappa signal sequence was generated by four rounds of PCR amplification (first round: primer SEQ ID NO: 15 and 16; second round: primer SEQ ID NO: 14 and 16; third Round: primer SEQ ID NO: 13 and 16; fourth round: primer SEQ ID NO: 12 and 16). The DNA encoding sig-ecdhMUC-1 was cloned into pcDNA ^™ 3.1 TOPO vector (Invitrogen, San Diego, Calif.) to construct pcDNA-sig-ecdhMUC-1.

pShuttle-ΔCtΔTmCD40L (without signal sequence and containing mouse CD40L) was prepared as follows: Plasmid pDC406-mCD40L was purchased from the American Type Culture Collection. A set of PCR primers (SEQ ID NOs: 17 and 18) are used to amplify mouse CD40 ligand positions 52 to 260 (ie, without the cytoplasmic and transmembrane domains) and a linker at the 5 'end of the amplicon It was designed to include the coding sequence (labeled “+ spacer”).
Mouse ΔCtΔTmCD40L + spacer forward primer (MCD40LSPF) (CD40L sequence is italicized (lower case); cloning sites are underlined and bold):
5'- CCG CTCGAG AACGACGCACAAGCACCAAAATCAAAGGTCGAAGAGGAAGTA -3 '
(SEQ ID NO: 17)
Mouse CD40L reverse primer (MCD40LR; cloning site is underlined):
5'-GCGGGCC CGCGGCCGCCGCTAG TCTAGAG AG TTT GAG TAAGCC AAAAGA TGAG-3 '
(SEQ ID NO: 18)

  The forward primer MCD40LSPF encodes a 10-residue spacer (LENDAQAPKS; single letter code; SEQ ID NO: 19) located between the transcription unit mucin and the CD40L ligand (mCD40L). PCR was performed using forward and reverse primers (SEQ ID NOs: 17 and 18) and plasmid pDC406-mCD40L as template and the PCR fragment “Space + ΔCtΔTMCD40L” was obtained, which was expressed as XbaI (TCTAGA) and Xho I (CTCGAG ) And then inserted into the plasmid pcDNA-sig-ecdhMUC1. This vector is digested with pcDNA-sig-ecdhMUC1 / ΔCtΔTmCD40L. A vector was constructed that was identical except that it encoded full-length CD40L rather than a truncated version. This vector was generated using a CD40 forward primer and annealed to the start codon of mouse CD40L. This vector is described as pShuttlsig40L (no signal sequence).

  DNA encoding sig-ecdhMUC1 / ΔCtΔTmCD40L was excised from the pCDNA3TOPO vector using HindIII-XbaI restriction and inserted downstream of the CMV promoter in pShuttle-CMV (see Murphy et al., Prostate 38: 73-78, 1999). This plasmid is described as pShuttle-sig-ecdhMUC1-ΔCtΔTmCD40L. The transcription unit sig-ecdhMUC1-ΔCtΔTmCD40L thus encodes the mouse IgG kappa chain secretion signal, then the extracellular domain of human MUC1, then the 10 amino acid linker (NDAQAPK; SEQ ID NO: 19), and then mouse CD40 ligand residues 52-260 .

In one vector, a mouse HSF1 trimer domain was added between the DNA encoding ecdhMUC1 and ΔCtΔTm CD40L, which was performed by PCR using plasmid pcDNA-sig-ecdhMUC1 / ΔCtΔTmCD40L and the following primers:
5'-AAC AAG CTC ATT CAG TTC CTG ATC TCA CTG GTG GGATCC AAC GAC GCA CAAGCA CCAAAA TC-3 '
(SEQ ID NO: 20)
5'- AGC CTT CGG CAG AAG CAT GCC CAG CAA CAG AAAGTC GTC AAC AAG CTC ATT CAG TTC CTG-3 '
(SEQ ID NO: 22)
5'GAT ATC CTC AGG CTC GAG aac gac gca caagca ccaaaagAG AAT GAG GCT CTG TGG CGG G-3 '
(SEQ ID NO: 23)
5'-GCGGGCC CGCGGCCGCCGCTAG TCTAGA GAG TTT GAG TAAGCC AAAAGA TGAG-3 '
(SEQ ID NO: 18)

HSF1 / ΔCtΔTm CD40L with a trimeric domain sequence was generated by 4 rounds of PCR amplification (1st round: primer SEQ ID NO: 23 and 18; 2nd round: primer SEQ ID NO: 22 and 18; 3rd round) : Primers 21 and 18; Round 4: Primers SEQ ID NO: 20 and 18). DNA encoding HSF1 / ΔCtΔTm CD40L was cloned into pcDNA-sig-hMUC-1 restriction sites XbaI (TCTAGA) and Xho I (CTCGAG). The sequence between MUC1 and mCD40L is:
LENDAQAPK ENEALWREVASFRQKHAQQQK VVNKLIQFLISLVGS NDAQAPKS (SEQ ID NO: 24)
Here, the underlined segment is a trimer sequence that binds to the linkers LENDAQAPK (SEQ ID NO: 25) and NDAQAPKS (SEQ ID NO: 26).

In one vector, a sequence encoding a His tag was added to the end of ΔCtΔTm CD40L and generated by PCR using plasmid pDC406-mCD40L (purchased from the American Type Culture Collection) and the following primers:
5'-CCG CTCGAG AACGACGCACAAGCACCAAAATCAAaggtcgaagaggaagta -3 '(SEQ ID NO: 27) (forward primer)
5'- ATG GTG ATG ATG ACC GGT ACG GAG TTT GAG TAA GCC AAA AGA TGA GAA GCC-3 '(SEQ ID NO: 28) (reverse primer)
5′-GTGC tctaga TCA gaattc < ATG GTG ATG GTG ATG ATG> ACC GGT ACG GAG -3 ′ (SEQ ID NO: 29) (poly-His region is encoded by nucleotide in box (in parentheses)).

  Vector / ΔCtΔTm CD40L / His with His tag sequence was generated by two rounds of PCR amplification (1st round: primer 1 + 2; 2nd round: primer 1 + 3). The DNA encoding / ΔCtΔTmCD40L / His was cloned into pcDNA-sig-ecdhMUC-1 restriction sites XbaI (TCTAGA) and Xho I (CTCGAG).

Recombinant adenoviral vectors were generated using the AdEasy vector system (Stratagene, San Diego, CA). Briefly, the resulting plasmid pShuttle-sig-ecdhMUC1-ΔCtΔTmCD40L and other control adenoviral vectors were linearized with Pme I and co-transformed with the viral DNA plasmid padEasy-1 into E. coli strain BJ5183. Recombinants were selected with kanamycin and screened by restriction enzyme analysis. The recombinant adenovirus construct was then cleaved with Pac I to expose its inverted terminal repeat (ITR) and transfected into 293A cells to generate virus particles. The titer of recombinant adenovirus was measured by the tissue culture infectivity titer (TCID ₅₀ ) method.

Primers for amplification of the human ΔCtΔTmCD40L + spacer using the human CD40 ligand cDNA template are described below.
Human ΔCtΔTmCD40L + spacer forward primer (HCD40LSPF) (italics (lower case) is CD40L sequence):
5'- CCG CTCGAG AACGACGCACAAGCACCAAAATCAGTGTATCTTcatagaaggttggacaag-3 '
(SEQ ID NO: 30)
Human CD40L reverse primer (HCD40LR)
5'-CCCTCTAGA TCAGAGTTTGAGTAAGCCAAAGGAC-3 '(SEQ ID NO: 31)

  These primers amplify the ΔCtΔTmCD40L + spacer encoding human CD40L 47-261. The forward primer HCD40LSPF encodes a 10 residue spacer (LENDAQAPKS; 1 letter code; SEQ ID NO: 19) located between the tumor antigen of the transcription unit and the CD40 ligand (hCD40L). PCR was performed using forward and reverse primers (SEQ ID NOs: 30 and 31) and plasmid pDC406-hCD40L as a template to obtain a PCR fragment “space + ΔCtΔTmCD40L (human)”, which was expressed as XbaI (TCTAGA And after restriction endonuclease digestion with Xho I (CTCGAG), it was inserted into the plasmid pcDNA-sig-ecdhMUC1. DNA encoding sig-ecdhMUC1 / ΔCtΔTmCD40L (human) was excised from pCDNA3TOPO using HindIII-XbaI restriction and inserted downstream of the CMV promoter in pShuttle-CMV (Murphy et al., Prostate 38: 73-78, 1999) . This vector is described as pShuttle sig-ecdhMUC1 / ΔCtΔTmCD40L (human). Modification of pShuttle sig-ecdhMUC1 / ΔCtΔTmCD40L (human) to contain ecdhMUC1 upstream of the human CD40 ligand sequence was performed as described above for vectors encoding essentially mouse CD40 ligand. Thus, the transcription unit sig-ecdhMUC1-ΔCtΔTmCD40L (human) encodes the kappa secretion signal, then the extracellular domain of human MUC1, then the 10 amino acid linker (NDAQAPK; SEQ ID NO: 19), and then human CD40 ligand residues 47-261 .

  Alternatively, DNA encoding the human growth hormone signal sequence MATGSRTSLLLAFGLLCLPWLQEGSA (single letter amino acid code) (SEQ ID NO: 32) may be used in place of the kappa chain signal sequence.

2. Overcoming the invisibility of MUC1 in MUC1 transgenic mice
a) Cytokine generation of adenovirus-infected DCs DCs from bone marrow were harvested from hMUC-.Tg transgenic mice 48 hours after exposure to adenovirus vectors. Cells were exposed to vector with MOI 100 and seeded at 2 × 10 ⁵ cells / ml in 24-well plates. After incubation at 37 ° C. for 24 hours, the supernatant (1 ml) was collected and centrifuged to remove debris. Assessment of the level of mouse IL-12 or IFN-gamma released into the culture was performed by enzyme-linked immunosorbent assay (ELISA) using mouse IL-12 p70 or IFN-gamma R & D system kit.

  Bone marrow derived DC contacted with Ad-sig-ecdmMUC1-ΔCtΔTCD40L (mouse) vector allows interferon gamma and IL-12 cytokines from DC recovered from hMUC-.Tg transgenic mice 48 hours after exposure to the vector Levels increased significantly. In contrast, virtually no cytokines were detected from restimulated DCs from animals immunized with an adenoviral vector encoding the extracellular domain of cMUC1 but not fused to secreted CD40L. These results indicate that the ecdhMUC1 / ecdmCD40L (mouse) fusion protein forms a functional trimer and binds to the CD40 receptor on DC.

b) Evaluation of trimer formation by ecdhMUC1-HSF1-ΔCtΔTmCD40L fusion protein expressed from Ad-sig-ecdhMUC1-HSF1-ΔCtΔTmCD40L-HIS
Trimerization of the ecdhMUC1-HSF1-ΔCtΔTmCD40L-HIS fusion protein was assessed following release from cells transformed with the Ad-sig-ecdhMUC1-HSF1-ΔCtΔTmCD40L-HIS vector. The expressed fusion protein was purified from the supernatant of 293 cells exposed to the vector using a His tag purification kit. Non-denaturing gel electrophoresis showed that the molecular weight is consistent with the formation of trimers.

c) Effect of Ad-sig-ecdhMUC1-ΔCtΔTmCD40L vector injection on the establishment of MUC1-expressing cancer cells
HMUC1.Tg mice injected subcutaneously with Ad-sig-ecdhMUC1-ΔCtΔTmCD40L (mouse) vector were resistant to transplantation by hMUC1-positive LL2 / LL1hMUC1 mouse cancer cells. Control animals that were not injected with the vector were not resistant to the same cell growth. In addition, hMUC1.Tg mice injected with the Ad-sig-ecdhMUC1 / ecdCD40L (mouse) vector did not show resistance to transplantation by the parent cell line (LL2 / LL1) that does not express MUC1.

  hMUC1.Tg mice injected intravenously with ecdhMUC1-ΔCtΔTmCD40L (mouse) protein did not show resistance to transplantation by hMUC1-positive LL2 / LL1hMUC1 mouse cancer cells. Furthermore, hMUC1.Tg mice injected with Ad-sig-ecdhMUC1-ΔCtΔTmCD40L (mouse) vector survived longer than mice injected with control vector and then administered LL2 / LL1hMUC1 cell line.

3． Cellular mechanisms underlying subclinical collapse
a) Cytokine-releasing splenic CD8 ⁺ T lymphocyte populations from vaccinated mice vs non-vaccinated mice , 7 days after Ad-sig-ecdhMUC1-ΔCtΔTmCD40L (mouse) vector administration, using CD4 ⁺ antibody coated beads Obtained by depleting CD4 ⁺ T lymphocytes. Isolated CD8 ⁺ T lymphocytes released 2,000 times higher levels of interferon gamma than CD8 ⁺ T cells from MUC1.Tg mice administered with a control vector (without MUC1).

b) Cytotoxicity assay
Spleen T cells collected from hMUC1.Tg mice 7 days after administration of Ad-sig-ecdhMUC1-ΔCtΔTmCD40L (mouse) vector were cultured in vitro with hMUC1 antigen-positive LL2 / LL1hMUC1 cancer cells for 7 days. Stimulated pancreatic T cells were mixed with various ratios of hMUC1 positive LL2 / LL1 hMUC1 cancer cells or hMUC1 negative LL2 / LL1 cancer cells. The results showed that T cells from mice inoculated with Ad-sig-ecdhMUC1-ΔCtΔTmCD40L (mouse) vector were cytotoxic only to cancer cells expressing hMUC1.

c) Ad-sig-ecdhMUC1-ΔCtΔTmCD40L vector injection overcomes resistance to proliferation of hMUC1-specific T cells DCs obtained from bone marrow cells in vitro were exposed to Ad-sig-ecdhMUC1-ΔCtΔTmCD40L (mouse) vector for 48 hours. . Spleen CD8 ⁺ T cells (collected from hMUC1.Tg transgenic mice 7 days after subcutaneous injection of vector-free or Ad-sig-ecdhMUC1-ΔCtΔTmCD40L (mouse) vector) at a ratio of 1/1 Ad-sig- Mixed with ecdhMUC1 / ecdCD40L (mouse) vector infected DC. ERK1 / EK2 protein (endpoint of Ras / MAPK signaling pathway) is found in Ad-sig-ecdhMUC1-ΔCtΔTmCD40L vector injected hMUC1.Tg after 45 minutes in vitro exposure to Ad-sig-ecdhMUC1-ΔCtΔTmCD40L (mouse) vector-infected DC Phosphorylated in CD8 + T cells isolated from transgenic mice. In contrast, no increase in phosphorylation of ERK1 and ERK2 proteins was observed in CD8 positive T cells derived from uninoculated hMUC1.Tg mice. These results indicate that CD8 positive T cells derived from MUC1.Tg transgenic mice inoculated with Ad-sig-ecdhMUC1-ΔCtΔTmCD40L (mouse) vector are no longer invisible to MUC1.

4). Generation of fusion proteins and vectors Tumor antigen fusion proteins were generated directly from adenoviral vectors carrying expression cassettes for fusion genes encoding fusion proteins. Producing cells (eg, 293 cell line) with a cell density of 80% in growth medium were infected with viral vectors at a rate of 10-100 viral particles per cell. Infected cells were cultured for an additional 48-72 hours, at which point the viral vector grew in the cells and the tumor antigen fusion protein was expressed in the cells and secreted into the culture. They were harvested when 70-90% of the infected cells showed cytopathic effect (CPE). Cell culture medium was separated and collected. Cell lysates were processed for 3 freeze / thaw cycles. Viral particles were isolated by standard methods (19). The tumor antigen fusion protein was purified from the collected cell culture medium by affinity chromatography.

5. Amplification of immune response by protein boost administration Relative values of tumor antigen fusion protein boost administration and adenovirus expression vector boost administration were evaluated.

  As described, hMUC-1.Tg animals were primed with the Ad-K / ecdhMUC1-ΔCtΔTmCD40L vector administered subcutaneously. A protein boost composed of 10 micrograms of ecdhMUC-1 / ecdCD40L fusion protein was injected subcutaneously. The timing of protein boost administration and comparison with vectors were evaluated in the various treatment groups shown in Table 2.

  Spleen cells from different groups were isolated and assessed by ELISPOT assay for interferon gamma positivity. As seen in FIG. 3, if the protein was injected subcutaneously twice at 14-day intervals starting one week after the first vector injection, the vector was injected one or two times without treatment or without protein boost administration. The frequency of positive T cells was greatly increased compared to the case of injection. The next highest frequency of interferon gamma positive T cells was in the T3 group (injected once with protein 7 days after the first vector injection).

  The establishment of cytotoxic T cells in various immunization groups was evaluated (FIG. 4). Spleen cells from the various treatment groups were stimulated in vitro with the hMUC-1 positive cell line (LL1 / LL2hMUC-1) for 5 days. CD8 T cells were isolated and mixed with target cells (LL1 / LL2hMUC-1) at a ratio of 50/1. The cytotoxicity generally follows the result of the ELISPOT assay, and the T5 group showed the highest elevated level of LL1 / LL2hMUC-1 specific cytotoxic T cell activity. The level of cytotoxicity observed with T cells from the T5 group was 9 times that observed with the negative control group.

  Sera from animals in various treatment groups were evaluated for anti-ecdhMUC1-ΔCtΔTmCD40L specific antibodies by ELISA. Briefly, ecdhMUC1-ΔCtΔTmCD40L protein-coated microwells were incubated with test mouse serum, washed and bound mouse antibodies were identified using a rat anti-mouse secondary antibody conjugated to horseradish peroxidase. .

  FIG. 5 shows that the levels of antibodies to the ecdhMUC1-ΔCtΔTmCD40L fusion protein resulting from treatment with one vector injection and two protein injections (14 day intervals) are dramatically increased. The increase of anti-ecdhMUC1-ΔCtΔTmCD40L antibody after T5 treatment was 2 times higher than that of any other treatment group.

  Results from these assays indicate that protein boost administration is superior to vector boost administration in generating cytotoxic T cell activity against tumor antigen-expressing cells and in response to antibodies against tumor antigens. Overall best results for protein boosting are achieved with one injection of the adenovirus expression vector, one week after the protein boosted subcutaneously, and two weeks after the protein boost repeated once more Was the case.

  Antibodies in sera from vaccinated hMUC-1.Tg mice were evaluated for binding to cancer biopsy tissue specimens. A tissue microarray containing normal breast tissue sections and breast cancer tissue sections was purchased. The tissues were contacted with sera from transgenic mice immunized with the Ad-K / ecdhMUC-1 // ΔCtΔTm CD40L vector and then boosted with the ecdhMUC-1 // ΔCtΔTm CD40L protein. After washing the array, it was exposed to a horseradish peroxidase (HRP) secondary antibody that recognizes the mouse IgG antibody. As a control, serum was first exposed to hMUC-1 peptide from an antigenic repeat of the hMUC-1 domain (same as used for protein boost).

  Sera from vaccinated mice bound to mammary epithelial cells from a biopsy specimen of cancerous epithelial cells. No binding to intervening fibroblasts or stromal cells was observed. Serum from normal mice showed no response.

  Sera from hMUC-1.Tg mice that were immunized with Ad-sig-hMUC-1 / ecdCD40L and then subcutaneously administered twice in succession with the protein sc-hMUC-1 / ecdCD40L were derived from human prostate cancer on tissue microarray slides Reacted with biopsy specimens.

  In order to confirm the specificity of antibodies produced from sera against hMUC-1 repeats, peptides containing amino acid sequences from hMUC-1 repeats were gradually increased in quantity and sera from the above vaccinated animals Mixed with. The mixture was then applied to the microarray slide and the reactivity was evaluated. As a control, a peptide having the same amino acid as the hMUC-1 repeat but with a different sequence order (“scrambled peptide”) was added to the sera from the vaccinated animals. hMUC-1 peptide inhibited the binding of antibodies in vaccinated animal sera to breast cancer epithelial cells. No inhibition was observed with the scrambled peptide. These indicate that vector prime / protein boost vaccination induced an hMUC-1 specific humoral response reactive with MUC-1 expressed by biopsy specimens of human breast cancer epithelial cells .

  Tumor immunity was evaluated in mice that received protein boost. As described, hMUC-1.Tg animals were primed by subcutaneous administration of the Ad-K / ecdhMUC1-ΔCtΔTmCD40L vector, or ecdhMUC1-ΔCtΔTmCD40L fusion protein was administered once or twice for immunization. The animals were then challenged with LL2 / LL1hMUC-1 tumor cells.

  As shown in FIG. 6, mice inoculated with the Ad-K / ecdhMUC1-ΔCtΔTmCD40L vector survived longer than 120 days (solid line), but all mice not inoculated with the Ad-sig-ecdhMUC-1 / ecdCD40L vector had 50 Died by day (dashed line). These results indicate that vector injection induced the suppression of LL2 / LL1hMUC-1 cell line proliferation in hMUC-1.Tg mice.

  To evaluate the specificity of tumor growth inhibition with respect to hMUC-1 antigen, rejection of LL2 / LL1hMUC-1 cell line (hMUC-1 antigen positive) except LL2 / LL1 cell line (with no hMUC-1 antigen present) The same). The results showed that subcutaneous injection of adenovirus vector completely suppressed the growth of LL2 / LL1hMUC-1 cell line, but the same cells that did not express MUC-1 were not.

  Tumor growth inhibition was assessed by a combination of vector and protein administration. Ad-sig-ecdhMUC-1 / ecdCD40L vector and ecdhMUC-1 / ecdCD40L protein were administered to hMUC-1.Tg mice in three combinations and then challenged with LL2 / LL1hMUC-1 tumor cells. VVV = Ad-sig-ecdhMUC-1 / ΔCtΔTm CD40L vector subcutaneously injected 3 times, 1, 7, and 21 days; PPP = ecdhMUC-1 / ΔCtΔTm CD40L protein 3 times, 1, 7, and 21 days Or subcutaneous injection of ecdhMUC-1 / ΔCtΔTm CD40L protein on days 7 and 21 after one subcutaneous injection of VPP = Ad-sig-ecdhMUC-1 / ΔCtΔTm CD40L vector. See FIG. 7 for further details. One week later, mice were challenged with 500,000 LL2 / LL1hMUC-1 lung cancer cells subcutaneously, and two weeks later, 500,000 LL2 / LL1hMUC-1 tumor cells were intravenously injected. Caliper was used to measure the size of the subcutaneous tumor nodule for the day at multiple time points, and the effect of various vaccine schedules on the growth of LL2 / LL1hMUC-1 cells was measured as a subcutaneous nodule. After sacrifice, metastasis was measured by total lung weight.

  As shown in Fig. 7, when the fusion protein was injected three times without prior injection of Ad-sig-ecdhMUC-1 / ecdCD40L vector (PPP), complete resistance to the development of subcutaneous LL2 / LL1hMUC-1 tumor was induced Was not. In contrast, the schedule of 3 consecutive injections of vector (VVV) or 2 injections of protein after 1 injection of vector (VPP) completely suppressed the development of subcutaneous LL2 / LL1hMUC-1 tumors .

  The levels of hMUC-1 specific antibodies in these mice were measured 63 days after the start of vaccination (FIG. 8). A schedule of two boost injections of the fusion protein (VPP) after a single vector injection induces the highest levels of hMUC-1 specific antibodies, moderate with schedule VVV, and substantially effective with VPP There wasn't. Therefore, cancer treatment in these animals is somewhat inversely related to antibody response.

  Tumor treatment protocols (after establishment) were also evaluated. In this schedule, subcutaneous tumors (500,000 LL2 / LL1hMUC-1) were administered on day 1. Three schedules (PPP, VPP, and VVV) were performed on days 5, 12, and 26. Tumors were administered intravenously on day 35 and tumor development (subcutaneous and lung) was evaluated on day 49. Further details are described in the legend of FIG.

  As shown in FIG. 9, the combination of one vector injection followed by two protein injections (VPP) completely suppressed the growth of subcutaneous hMUC-1 positive cancer cell tumors after establishment. Three consecutive vector doses (VVV) showed little therapeutic effect, but three consecutive protein injections (PPP) had little or no effect.

  The growth of lung metastatic nodules in the pre-treatment and post-treatment (pre-fixation) cancer models is shown in FIG. The results of the pretreatment in FIG. 10 (left panel) indicate that three consecutive fusion protein injections (PPP) are believed not to inhibit lung nodule growth. In contrast, Schedule VVV and Schedule VPP were considered to completely suppress lung cancer colonization in the lungs of vaccinated animals.

  The results of the post-treatment in Fig. 10 (right panel) show that the combination of one vector injection followed by two protein injections (VPP) completely suppressed the growth of lung nodules of established hMUC-1 positive cancer cells. It shows that. In contrast, three consecutive vector doses (VVV) and three consecutive protein injections (PPP) showed some therapeutic effect but were smaller than the VPP protocol.

  These results collectively indicate that the best treatment schedule is the VPP schedule, which is a single Ad-sig-ecdhMUC-1 / ecdCD40L vector injection, followed by 2 consecutive one week sessions The ecdhMUC-1 / ecdCD40L protein is injected subcutaneously at intervals of 2 weeks. This protocol is characterized by induction of antibodies to mucin antigens (humoral immunity) and T cell immunity (cellular immunity).

  To compare boosting after initial administration of an adenoviral expression vector encoding the same protein with the ecdMUC-1 / ecdCD40L soluble protein versus other soluble proteins, a MUC-1-expressing tumor (LL2 / LL1hMUC-1 cell line) was challenged with hMUC-1.Tg animals. Animals were boosted with bacterial extracts containing: ecdMUC-1 / ecdCD40 (from bacterial host strain infected with Ad-sig-ecdMUC-1 / ecdCD40L vector); binds keyhole limpet hemocyanin (KLH) EcdMUC-1 (with or without incomplete Floyd adjuvant); PBS; and control bacterial extracts (from bacterial host strains not infected with Ad-sig-ecdMUC-1 / ecdCD40L vector). Tumor cells were administered 7 days after completion of the second protein boost administration. The results shown in FIG. 12 indicate that boosting with the ecdMUC-1 / ecdCD40L soluble protein is superior to all other methods.

6). Construction of an adenoviral vector encoding the HPV E7-CD40 ligand fusion protein Recently, a method for generating immunity by administering an adenoviral vector expressing a transcription unit fusion protein composed of E7 bound to a secreted CD40 ligand has been reported. (Methods of generating immunity by expressing and adenoviral vector expressing a transcription unit fusion protein according to E7 linked to a secretable form of CD40 ligand was recently reported). Ziang et al., “An adenoviral vector cancer vaccine that delivers a tumor-associated antigen / CD40-ligand fusion protein to dendritic cells” Proc. Natl. Acad. Sci (USA) (issued 25 November 2003), 10.1073 / pnas. 2135379100 (vol. 100 (25): 15101).

The transcription unit contains DNA encoding the full-length HPV type 16 E7 protein upstream of ΔCtΔTmCD40L and DNA encoding a signal peptide derived from the HGH gene upstream thereof. To prepare DNA encoding the human growth hormone signal sequence MATGSRTSLLLAFGLLCLPWLQEGSA (1-letter amino acid code) (SEQ ID NO: 32), phosphorylated oligonucleotides (SEQ ID NO: 33 and 34) are annealed, Bgl II and A full length 26 amino acid HGH sequence with a Not1 overhang was generated.
Growth hormone signal upstream chain (italic (lower case) coding sequence):
5'-GATCT CCACC atg gct aca ggc tcc cgg acg tcc ctg ctc ctg gct ttt ggc ctg ctc tgc ctg ccc tgg ctt caa gag ggc agt gcc GGC -3 '(SEQ ID NO: 33)
Growth hormone signal downstream chain:
3'-A GGTGG TAC CGA TGT CCG AGG GCC TGC AGG GAC GAG GAC CGA AAA CCG GAC GAG ACG GAC GGG ACC GAA GTT CTC CCG TCA CGG CCGCCGG -5 '(SEQ ID NO: 34)

The above upstream and downstream oligo chains were annealed to prepare a synthetic HGH signal sequence. The oligo chain was dissolved in 50 μl of H ₂ O (about 3 mg / ml). Add 1 μl from each oligo strand (upstream and downstream strands) to 48 μl annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, and 2 mM Mg-acetic acid), 95 ° C. for 4 minutes, 70 ° C. for 10 minutes Incubate and slowly cool to about 4 ° C. The annealed DNA was phosphorylated using T4 PNK (polynucleotide kinase) under standard conditions.

The HGH signal sequence with Bgl II and Not I overhangs was inserted into pShuttle-E7-ΔCtΔTmCD40L (without signal sequence) via Bgl II and Not I to obtain pshuttle-HGH / E7-ΔCtΔTmCD40L. HPV-16 E7 was inserted upstream of the CD40 ligand sequence to prepare pShuttle-E7-ΔCtΔTmCD40L (without signal sequence) as follows: The sequence encoding the full-length HPV-16 E7 protein was Obtained by PCR amplification from the HPV viral genome with primers:
HPV 16 E7 forward primer (SEQ ID NO: 35)
5'-ATTT GCGGCCGC TGTAATCATGCATGGAGA-3 '
HPV E7 reverse primer (SEQ ID NO: 36)
5-CC CTCGAG TTATGGTTTCTGAGAACAGAT-3 '

  The obtained amplifier was DNA encoding HPV 16 E7 having Not I at the 5 ′ end and an Xho I restriction site at the 3 ′ end. Using Not I (GCGGCCGC) and Xho I (CTCGAG), E7 DNA was inserted between the CMV promoter of pShuttleΔCtΔTmCD40L and the 5 ′ side of the spacer of the ΔCtΔTMCD40L sequence. The plasmid was described as pShuttle-E7-ΔCtΔTmCD40L (no signal sequence) and was used to insert an HGH signal sequence upstream of E7 to generate HGH / E7-ΔCtΔTmCD40L as previously described. The transcription unit HGH / E7-ΔCtΔTmCD40L thus encodes the HGH secretion signal, followed by the full-length HPV type 16 E7, then the 10 amino acid linker (FENDAQAPKS; SEQ ID NO: 37), and then the mouse CD40 ligand residues 52-260.

A transcription unit (“K / E7”) containing DNA encoding the signal sequence of the mouse IgG kappa chain gene upstream of the DNA encoding the full-length HPV16 type E7 protein was subjected to PCR using the HPV16 plasmid and the following primers. Generated:
(Primer 1) 5'-ACG ATG GAG ACA GAC ACA Ctc ctg cta tgg gta ctg ctg-3 '(SEQ ID NO: 38);
(Primer 2) 5′-TC CTG CTA TGG GTA CTG CTG CTC tgg gtt cca ggt tc-3 ′ (SEQ ID NO: 39);
(Primer 3) 5'-TG CTC TGG GTT CCA ggt tcc act ggt gac atg cat g-3 '
(SEQ ID NO: 40);
(Primer 4) 5'-TCG GTT CCA GGT TCC ACT GGT GAC ATG CAT GGA G AT ACA CCT AC-3 '(SEQ ID NO: 41); and (Primer 5) 5'- CCG CTC GAG TGG TTT CTG AGA ACA GAT GGG GCA C -3. '(SEQ ID NO: 42)

K / E7 with upstream kappa signal sequence was generated by 4 rounds of PCR amplification (1st round: primer 4 + 5; 2nd round: primer 3 added; 3rd round: primer 2 added; 4th round: Add primer 1). The DNA encoding K / E7 was cloned into pcDNA ^™ 3.1 TOPO vector (Invitrogen, San Diego, Calif.) To generate pcDNA-K / E7.

A DNA fragment containing mouse CD40 ligand lacking the transmembrane and cytoplasmic domains (ΔCtΔTmCD40L) was generated from the mouse CD40 ligand cDNA plasmid (pDC406-mCD40L; ATCC) using the following PCR primers:
5'-CCG CTCGAG aac gac gca caa gca cca aaa agc AAG GTC GAA GAG GAA GTA AAC CTT C-3 '(SEQ ID NO: 43); and
5'-CGCGCCGCGCGCTAG tctaga GAGTTTGAGTAAGCCAAAAGATGAG-3 '(SEQ ID NO: 44) (high fidelity PCR kit, Roche)
Fragment ΔCtΔTmCD40L was digested with Xba I and Xho I restriction endonucleases and ligated into pcDNA-E7. The K / E7-ΔCtΔTmCD40L fragment was excised from the pcDNA vector and inserted into the pShuttle plasmid using the Hind III and Xba I sites (pShuttle K / E7-ΔCtΔTmCD40L). Thus, the K / E7-ΔCtΔTmCD40L fragment contains a kappa chain secretion signal, followed by the full-length HPV type 16 E7, then a 10 amino acid linker (LQNDAQAPKS; SEQ ID NO: 31), and then mouse CD40 ligand residues 52-260.

  To prepare a vector encoding E7 fused to a human CD40 ligand lacking the transmembrane domain, “space + ΔCtΔTmCD40L (human)” (prepared as described above) was added to plasmid pShuttle-CMV (13), Hind It was inserted after restriction endonuclease digestion with III (AAGCTT) and Xho I (CTCGAG). This vector is described as pShuttleΔCtΔTmCD40L (human). pShuttleΔCtΔTmCD40L (human) was modified to contain HPV-16 E7 upstream of the human CD40 ligand sequence, essentially as described above for the vector encoding mouse CD40 ligand. The obtained plasmid is described as pShuttle-E7-ΔCtΔTmCD40L (human) (without signal sequence), and this is used to insert an HGH signal sequence upstream of E7 to generate HGH / E7-ΔCtΔTmCD40L (human). Thus, the transcription unit HGH / E7-ΔCtΔTmCD40L (human) encodes the HGH secretion signal, followed by the full-length HPV16 type E7, then the 10 amino acid linker (FENDAQAPKS; SEQ ID NO: 19), followed by human CD40 ligand residues 47-261 .

7). Construction of an adenoviral vector encoding rat HER2 (Neu) / CD40L Overexpression of Her-2-Neu (H2N) growth factor receptor increases postoperative recurrence frequency and shortens survival in 30% of breast cancers Related. Mice that are transgenic for the rat equivalent of the HER2 (“H2N” or “rH2N”) gene and are therefore tolerant to this gene (Muller et al., Cell 54: 105-115, (1998); Gut et al. Proc. Natl. Acad. Sci. USA 89: 10578-10582, (1992)) was used as an experimental host to evaluate immunity with the Ad-sig-rH2N / ecdCD40L vector. In this model, mice were transgenic for a normal inactivated rat Her-2-Neu gene under the control of a milk-specific transcription promoter (eg, MMTV promoter). The MMTV promoter causes overexpression of the non-mutated rat Her-2-Neu receptor, which is similar to that occurring in human breast cancer. In this model, palpable tumor nodules occur in the primary tissue (milk) in 24 weeks and lung metastases in 32 weeks. Breast cancer occurs naturally. Cancer is initiated locally through a gradual process in breast epithelial tissue as a clonal event (Id.). Dysplasia can be detected at 12 weeks of age. Palpable tumors in the mammary gland can be detected at 25 weeks and lung metastases of breast cancer are confirmed in 70% of mice by 32 weeks (Id.).

  The Ad-sig-rH2N / ecdCD40L vector was administered subcutaneously to the transgenic animals once or twice (at 7-day intervals) to test whether an immune response was induced against the rat Her-2-Neu antigen. Two subcutaneous injections of Ad-sig-rH2N / ecdCD40L vector induced complete resistance to growth of N202 (rH2N positive) mouse breast cancer cell line, whereas a single subcutaneous injection of the same vector gave rH2N positive N202 cell line Not enough immune response was induced to completely suppress the growth of. In the ELISPOT assay, rH2N-specific T cells induced after a single injection of Ad-sig-rH2N / ecdCD40L vector in mice by subcutaneous injection of Ad-sig-rH2N / ecdCD40L vector twice at 7-day intervals It was revealed that 10 times higher levels of rH2N-specific T cells were induced in the spleen of vaccinated mice. Finally, immune resistance induced against NT2 cells by prime immunization with Ad-sig-rH2N / ecdCD40L vector is the result of mitomycin treatment of irradiated cytokine-positive tumor cells (NTW cells transfected with GMCSF transcription unit) Better than the response obtained with transgenic animals inoculated with

  RH2N-specific antibody levels were also measured in mice that received one or two subcutaneous injections of the Ad-sig-rH2N / ecdCD40L vector. As shown in FIG. 11 below, the level of rH2N-specific antibody was higher after two subcutaneous injections of Ad-sig-rH2N / ecdCD40L vector than after one subcutaneous injection.

8). Construction of adenoviral vector encoding huHER2 / CD40L
An adenoviral vector encoding sig ecdhuHER2 / CD40L was prepared as follows. Mouse IgG kappa chain METDTLLLWVLLLWVPGSTGD (single letter amino acid code) (SEQ ID NO: 11) was prepared by PCR amplification (SEQ ID NO: 12, 13, and 45) to generate a full-length 21 amino acid mouse IgG kappa chain signal sequence (In SEQ ID NO: 12, the start codon “ATG” is shown in bold (underlined)).
5'-CCACC ATG GAG ACA GAC ACA CTC CTG CTA TGG GTA CTG CTG-3 '
(SEQ ID NO: 12)
5'- TC CTG CTA TGG GTA CTG CTG CTC TGG GTT CCA GGT TC-3 '
(SEQ ID NO: 13)
Forward primer
5'-5'- TG CTC TGG GTT CCA GGT TCC ACT GGT GAC GAA CTC -3 '
(SEQ ID NO: 45)
Human HER2 extracellular domain forward primer
5'- TCC ACT GGT GAC GAACTCACCTACCTGCCCACCAATGC-3 '
(SEQ ID NO: 46)
Reverse primer for human HER2 extracellular domain
5'- GGAG CTCGAG GGCTGGGTCCCCATCAAAGCTCTC-3 '
(SEQ ID NO: 47)

Generate sig-ecdhHER2 with upstream kappa signal sequence by 4 rounds of PCR amplification (1st round: primer SEQ ID NO: 46 and 47; 2nd round: primer SEQ ID NO: 45 and 47; 3rd round SEQ ID NO: 13 and 47; fourth round: primer SEQ ID NO: 12 and 47). DNA encoding sig-ecdhHER2 can be cloned into pcDNA ^™ 3.1 TOPO vector (Invitrogen, San Diego, Calif.) to generate pcDNA-sig-ecdhHER2. The additional cloning steps described for the MUC-1 / CD40 ligand expression vector also apply to the HER2 / CD40 ligand expression vector.

  This region, the HER2 extracellular domain to be fused to the CD40 ligand, contains two CTL epitopes; one is the HLA-A2 peptide, K I F G S L A F L (SEQ ID NO: 48), corresponding to amino acids 369-377. This peptide caused transient peptide-specific immunity in HER2-expressing cancer patients. See Knutson et al., Immunization of cancer patients with a HER-2 / neu, HLA-A2 peptide, Clin Cancer Res. 2002 May; 8 (5): 1014-8p369-377. The second epitope was ELTRYLPTNAS (SEQ ID NO: 49) (HER2 residues 63-71) and was also useful for generating immunity against HER2-expressing tumor cells. See Wang et al., Essential roles of tumor-derived helper T cell epitopes for an effective peptide-based tumor vaccine, Cancer Immun. 2003 Nov 21; 3:16. The region of HER2 ecd also contains a B cell epitope, P L H N Q E VTA E DG TQ R C E K C S K P C (SEQ ID NO: 50) (positions 316-339 of HER2). See Dakappagari et al., Chimeric multi-human epidermal growth factor receptor-2 B cell epitope peptide vaccine mediates superior antitumor responses, J Immunol. 2003 Apr 15; 170 (8): 4242-53.

  All patents and publications mentioned in this specification are indicative of the level of skill of those skilled in the art to which this invention pertains. All patents and documents are hereby incorporated by reference to the same extent as if each individual document was shown to be specifically and individually incorporated by reference.

  The invention described herein by way of example may be suitably practiced without any element (s) or limitation (s), which are not specifically disclosed herein. Thus, for example, in each case herein, any of the terms “comprising”, “consisting essentially of”, and “consisting of” may be replaced with any of the other two. Good. The terms and expressions used are intended to be illustrative rather than restrictive, and exclude any equivalents or parts of the features explicitly and described when using those terms and expressions. Although not intended, as will be appreciated, various modifications are possible within the scope of the claimed invention. Thus, while preferred embodiments and specific features of the invention have been disclosed by way of optional features, those skilled in the art may make modifications and variations to the concepts disclosed herein, and those modifications and It should be understood that modifications are considered within the scope of the invention as defined in the appended claims.

  Other embodiments are within the scope of the appended claims.

Brief Description of Drawings
FIG. 1 is a nucleotide sequence encoding human MUC1 (SEQ ID NO: 1). FIG. 1 is a nucleotide sequence encoding human MUC1 (SEQ ID NO: 1). FIG. 2 shows the amino acid sequence of human MUC1 (SEQ ID NO: 2). FIG. 3 shows the level of interferon gamma obtained in the ELISA spot assay. FIG. 4 shows a MUC-1 transgenic animal (hMUC-1.Tg) primed with the adenovirus expression vector Ad-K / ecdhMUC1-ΔCtΔTmCD40L and boosted subcutaneously with either the expression vector or the mature fusion protein ecdhMUC1-ΔCtΔTmCD40L. The level of T cytotoxicity derived is shown. FIG. 5 shows a MUC-1 transgenic animal (hMUC-1.Tg) primed with the adenovirus expression vector Ad-K / ecdhMUC1-ΔCtΔTmCD40L and boosted subcutaneously with either the expression vector or the mature fusion protein ecdhMUC1-ΔCtΔTmCD40L. Shows the level of antibody against the fusion protein ecdhMUC1-ΔCtΔTmCD40L in the serum. FIG. 6 shows the proliferation level of MUC1-expressing tumor cells (LL2 / LL2hMUC-1) in MUC-1 transgenic animals (hMUC-1.Tg) administered with the adenovirus expression vector Ad-K / ecdhMUC1-ΔCtΔTmCD40L. FIG. 7 shows tumor prevention in animals inoculated with Ad-sig-ecdhMUC-1 / ΔCtΔTmCD40L vector and ecdhMUC-1 / ΔCtΔTm CD40L protein. FIG. 8 shows the level of hMUC-1 specific antibodies in vaccinated mice 63 days after the start of vaccination. FIG. 9 shows subcutaneous tumor therapy (after colonization) in animals immunized with Ad-sig-ecdhMUC-1 / ΔCtΔTmCD40L vector and ecdhMUC-1 / ΔCtΔTm CD40L protein. FIG. 10 shows pulmonary metastatic tumor nodule therapy (after colonization) in animals treated as described in FIG. FIG. 11 is a comparison of different boost regimes following a single subcutaneous administration of the Ad-sig-ecdhMUC-1 / ecdCD40L vector in terms of the animal's ability to resist the development of MUC1-expressing tumors.

Claims (114)

A method of generating an immune response against an antigen in an individual comprising:
a) administering an effective amount of an expression vector to an individual, wherein the vector comprises a transcription unit encoding a secretable fusion protein, the fusion protein comprising an antigen and a CD40 ligand; and b) an antigen and a CD40 ligand Administering an effective amount of a fusion protein comprising
Including the above method.   The method of claim 1, wherein the protein is administered after administration of the vector.   2. The method of claim 1, wherein the antigen is a polypeptide antigen.   2. The method of claim 1, wherein the antigen is an infectious agent antigen.   2. The method of claim 1, wherein the immune response is against cells that express the antigen.   2. The method of claim 1, wherein the immune response is against a microorganism that expresses the antigen.   2. The method of claim 1, wherein the antigen is a tumor antigen.   2. The method of claim 1, wherein the tumor antigen is derived from HER-2.   2. The method of claim 1, wherein the tumor antigen is a mucin.   6. The tumor antigen is derived from a mucin selected from the group consisting of MUC1, MUC2, MUC3A, MUC3B, MUC4, MUC5AC, MUC5B, MUC6, MUC7, MUC8, MUC9, MUC12, MUC13, MUC15, and MUC16. the method of.   10. The method of claim 9, wherein the mucin antigen is derived from MUC1.   10. The method of claim 9, wherein the mucin antigen comprises a mucin extracellular domain.   10. The method of claim 9, wherein the mucin antigen comprises at least one tandem repeat of mucin.   10. The method of claim 9, wherein the mucin antigen comprises the extracellular domain of MUC1.   2. The method of claim 1, wherein the antigen is an autoantigen in an individual.   2. The method of claim 1, wherein the antigen is E7 protein of human papilloma virus.   2. The method of claim 1, wherein the antigen is derived from an epithelial cancer cell.   2. The method of claim 1, wherein the transcription unit encodes a linker between the antigen and the CD40 ligand.   2. The method of claim 1, wherein the vector comprises a human cytomegalovirus promoter / enhancer for controlling transcription of a transcription unit.   2. The method of claim 1, wherein the vector is a viral vector.   21. The method of claim 20, wherein the viral vector is an adenoviral vector.   2. The method of claim 1, wherein the CD40 ligand is a human CD40 ligand.   2. The method of claim 1, wherein the CD40 ligand lacks a cytoplasmic domain.   2. The method of claim 1, wherein the vector encodes CD40L comprising 6 or fewer residues from either end of the transmembrane domain.   2. The method of claim 1, wherein the vector does not encode the transmembrane domain of CD40 ligand.   2. The method of claim 1, wherein the CD40 ligand lacks all or substantially all of its transmembrane domain.   2. The method of claim 1, wherein the CD40 ligand comprises residues 47-261.   2. The method of claim 1, wherein the CD40 ligand comprises residues 1-23 and 47-261.   2. The method of claim 1, wherein the vector is non-replicating in normal human cells.   The method of claim 1 comprising step c), which is a repetition of step b) at a later time. 2. The method of claim 1, wherein the immune response comprises the generation of cytotoxic CD8 ⁺ T cells against the antigen.   2. The method of claim 1, wherein the immune response comprises production of antibodies against the antigen.   2. The method of claim 1, wherein the fusion protein is administered with an adjuvant.   2. The method of claim 1, wherein the fusion protein is administered subcutaneously.   The method according to claim 1, wherein the sequence of CD40 ligand encoded by the vector is different from the sequence of CD40 ligand administered as a fusion protein.   2. The method according to claim 1, wherein the sequence of the antigen encoded by the vector is different from the sequence of the antigen administered as a fusion protein.   2. The method of claim 1, wherein the transcription unit encodes a secretory signal sequence.   2. The method of claim 1, wherein the antigen is not derived from a CD40 ligand. A method of treating an individual afflicted with a cancer that expresses a tumor antigen, comprising:
a) administering an effective amount of an expression vector to an individual, wherein the vector comprises a transcription unit encoding a secretable fusion protein, the fusion protein comprising a tumor antigen and a CD40 ligand; and b) a tumor antigen and Administering an effective amount of a fusion protein comprising a CD40 ligand;
Including the above method.   40. The method of claim 39, wherein the protein is administered after administration of the vector.   40. The method of claim 39, wherein the tumor antigen is a mucin antigen.   42. The tumor antigen is derived from a mucin selected from the group consisting of MUC1, MUC2, MUC3A, MUC3B, MUC4, MUC5AC, MUC5B, MUC6, MUC7, MUC8, MUC9, MUC12, MUC13, MUC15, and MUC16. the method of.   42. The method of claim 41, wherein the mucin antigen is derived from MUC1.   42. The method of claim 41, wherein the mucin antigen comprises the extracellular domain of mucin.   42. The method of claim 41, wherein the mucin antigen comprises at least one tandem repeat of mucin.   42. The method of claim 41, wherein the mucin antigen comprises the extracellular domain of MUC1.   40. The method of claim 39, wherein the tumor antigen is E7 protein of human papilloma virus.   40. The method of claim 39, wherein the cancer cell is an epithelial cancer cell.   42. The method of claim 41, wherein the cancer cell is a cervical cancer cell.   42. The method of claim 41, wherein the vector comprises a human cytomegalovirus promoter / enhancer for controlling transcription of a transcription unit.   42. The method of claim 41, wherein the vector is a viral vector.   52. The method of claim 51, wherein the viral vector is an adenoviral vector.   40. The method of claim 39, wherein the CD40 ligand is a human CD40 ligand.   40. The method of claim 39, wherein the CD40 ligand lacks a cytoplasmic domain.   40. The method of claim 39, wherein the vector encodes CD40L comprising 6 or fewer residues from either end of the transmembrane domain.   40. The method of claim 39, wherein the vector does not encode the transmembrane domain of CD40 ligand.   40. The method of claim 39, wherein the CD40 ligand lacks all or substantially all of its transmembrane domain.   40. The method of claim 39, wherein the CD40 ligand comprises residues 47-261.   40. The method of claim 39, wherein the CD40 ligand comprises residues 1-23 and 47-261.   40. The method of claim 39, wherein the vector is rendered non-replicating in normal human cells.   40. The method of claim 39, comprising, at a later time, step c) which is an iteration of step b). 40. The method of claim 39, wherein the immune response comprises the generation of cytotoxic CD8 ⁺ T cells against the tumor antigen.   40. The method of claim 39, wherein the immune response comprises production of antibodies against the tumor antigen.   40. The method of claim 39, wherein the fusion protein is administered with an adjuvant.   40. The method of claim 39, wherein the fusion protein is administered subcutaneously.   40. The method of claim 39, wherein the sequence of the CD40 ligand encoded by the vector differs from the sequence of the CD40 ligand administered as a fusion protein.   40. The method of claim 39, wherein the sequence of the tumor antigen encoded by the vector is different from the sequence of the tumor antigen administered as a fusion protein.   42. The method of claim 41, wherein the transcription unit encodes a secretory signal sequence.   42. The method of claim 41, wherein the antigen is not derived from a CD40 ligand. A method of generating immunity to an infectious agent in a subject comprising:
a) administering an effective amount of an expression vector to an individual, wherein the vector comprises a transcription unit encoding a secretable fusion protein, the fusion protein comprising an infectious agent antigen and a CD40 ligand; and b) infection Administering an effective amount of a fusion protein comprising a sex agent antigen and a CD40 ligand;
Including the above method.   72. The method of claim 70, wherein the protein is administered after administration of the vector.   71. The method of claim 70, wherein the infectious agent antigen is selected from the group consisting of a viral antigen, a bacterial antigen, a fungal antigen, and a protozoan antigen.   72. The method of claim 70, wherein the infectious agent antigen is a viral antigen.   74. The method of claim 73, wherein the viral antigen is human papillomavirus E6 or E7 protein.   72. The method of claim 70, wherein said vector comprises a human cytomegalovirus promoter / enhancer for controlling transcription of a transcription unit.   72. The method of claim 70, wherein the vector is a viral vector.   72. The method of claim 70, wherein the viral vector is an adenoviral vector.   72. The method of claim 70, wherein the CD40 ligand is a human CD40 ligand.   72. The method of claim 70, wherein the CD40 ligand lacks a cytoplasmic domain.   72. The method of claim 70, wherein the vector comprises no more than 6 residues from either end of the transmembrane domain.   72. The method of claim 70, wherein the vector does not encode the transmembrane domain of CD40 ligand.   71. The method of claim 70, wherein the CD40 ligand lacks all or substantially all of its transmembrane domain.   71. The method of claim 70, wherein the CD40 ligand comprises residues 47-261.   71. The method of claim 70, wherein the CD40 ligand comprises residues 1-23 and 47-261.   72. The method of claim 70, wherein the vector is rendered non-replicating in normal human cells.   71. The method according to claim 70, comprising at a later time point c), which is an iteration of step b). 71. The method of claim 70, wherein the immune response comprises the generation of cytotoxic CD8 ⁺ T cells against the tumor antigen.   72. The method of claim 70, wherein the immune response comprises production of antibodies against the tumor antigen.   72. The method of claim 70, wherein the fusion protein is administered with an adjuvant.   72. The method of claim 70, wherein the fusion protein is administered subcutaneously.   72. The method of claim 70, wherein the sequence of CD40 ligand encoded by the vector differs from the sequence of CD40 ligand administered as a fusion protein.   72. The method of claim 70, wherein the sequence of the infectious agent antigen encoded by the vector is different from the sequence of the infectious agent antigen administered as a fusion protein.   72. The method of claim 70, wherein the transcription unit encodes a secretory signal sequence.   72. The method of claim 70, wherein the antigen is not derived from a CD40 ligand.   A method of simultaneously producing an expression vector encoding a fusion protein and a fusion protein, comprising culturing cells containing the expression vector in a culture medium, wherein the cells replicate the vector and during propagation A method for producing a protein expressed from a vector in a culture solution.   96. The method of claim 95, wherein the vector is an adenoviral vector.   96. The method of claim 95, wherein the expressed fusion protein is purified from the culture medium.   A protein comprising a transcription unit encoding a secretable fusion protein, wherein the fusion protein comprises an antigen and a CD40 ligand.   99. The protein of claim 98, wherein the antigen is a tumor antigen.   99. The protein of claim 98, wherein the antigen is an infectious agent antigen.   99. The protein of claim 98, wherein the infectious disease antigen is human papillomavirus E7 protein.   99. The protein of claim 98, wherein the antigen is derived from HER2.   99. The protein of claim 98, wherein the tumor antigen is a mucin antigen.   99. The tumor antigen is derived from a mucin selected from the group consisting of MUC1, MUC2, MUC3A, MUC3B, MUC4, MUC5AC, MUC5B, MUC6, MUC7, MUC8, MUC9, MUC12, MUC13, MUC15, and MUC16. Protein.   99. The protein of claim 98, wherein the mucin antigen is derived from MUC1.   99. The protein of claim 98, wherein the mucin antigen comprises the extracellular domain of mucin.   99. The protein of claim 98, wherein the antigen is an autoantigen in an individual.   99. The protein of claim 98, wherein the CD40 ligand is a human CD40 ligand.   99. The protein of claim 98, wherein the CD40 ligand lacks a cytoplasmic domain.   99. The protein of claim 98, wherein the vector encodes CD40L comprising 6 or fewer residues from either end of the transmembrane domain.   99. The protein of claim 98, wherein the vector does not encode the transmembrane domain of CD40 ligand.   99. The protein of claim 98, wherein the CD40 ligand lacks all or substantially all of a transmembrane domain.   99. The protein of claim 98, wherein the CD40 ligand comprises residues 47-261. 99. The protein of claim 98, wherein the CD40 ligand comprises residues 1-23 and 47-261.

Images