JP2008253254A - High-efficiency mutation-inducing method - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To reduce time, labor and cost required currently for preparing two or more transgenic organisms having different genome sequences by improving a method for preparing at least two or more homologous recombinant bodies having different genome sequences. <P>SOLUTION: The method for preparing at least two or more homologous recombinant bodies having different genome sequences in plants includes (a) a step for introducing a nucleic acid for homologous recombination into a plant cell, and (b) a step for culturing the plant cell to which the nucleic acid for the homologous recombination is introduced. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a method for preparing a transgenic organism. More specifically, the present invention relates to a method for preparing two or more transgenic organisms utilizing homologous recombination and compositions thereof.

  Homologous recombination refers to genetic exchange between molecules having a homologous base sequence, which is a phenomenon seen in all organisms including E. coli, yeast, plants and animals. Although it is found in the form of chromosome transfer in vivo, it is also used as a means of gene targeting to artificially change specific genes on the genome.

  By causing this homologous recombination in a gene on a specific chromosome, a gene knockout system was first established in yeast that deletes a specific endogenous gene region. The gene knockout system is very inefficient in higher organisms, and it was difficult to obtain the desired recombinant. I was able to do it.

  In recent years, not only a knockout system that simply destroys a gene, but also a point mutation can be introduced to cause amino acid substitution to introduce a desired mutation, or a new gene can be introduced onto a chromosome. A knock-in system was developed. In this knock-in system, DNA fragments having a base sequence homologous to the DNA located on both sides of a specific gene on the genome are introduced into the cell after being connected to both sides of the modified product, and homologous (recombination on both sides) ) Homologous recombination occurs in the region, a specific gene is removed, and a foreign gene is inserted instead. This knock-in system allows gene conversion to be performed in more detail.

  The knock-in system using homologous recombination is a powerful and useful experimental tool for conducting more detailed gene analysis. However, the probability of a homologous recombination event occurring in higher eukaryotes is very low, and in order to introduce a desired nucleic acid of interest, an enormous number of trials are carried out, from which the desired transgenic organism Need to be isolated. This is a very labor and cost intensive operation.

  The knock-in system is a powerful gene function analysis tool, but its occurrence probability is particularly low in higher eukaryotes. For this reason, for example, in order to introduce only one mutation, an enormous number of trials are performed, and a desired transgenic organism is isolated therefrom, which requires a very time-consuming and labor-intensive operation. Has been. Therefore, a great deal of effort has been required to prepare not only one species but also multiple types of transgenic organisms having different mutations. In order to prepare a transgenic organism having a plurality of different mutations, it is necessary to prepare at least two or more homologous recombinants having different genomic sequences and prepare a transgenic organism therefrom. Therefore, the time, effort and cost currently required for the preparation of at least two or more transgenic organisms having different genomic sequences is improved by improving the method of preparing at least two or more homologous recombinants having different genomic sequences. There is a great need to reduce.

  The present inventors have unexpectedly introduced a nucleic acid for homologous recombination into which a plurality of point mutations have been introduced into a plant cell by Agrobacterium to cause homologous recombination, thereby unexpectedly producing a single homologous group. Based on this discovery, it was discovered that at least two types of homologous recombinants having different genomic sequences including a nested genomic region can be obtained from a replacement nucleic acid and a single nucleic acid introduction operation for homologous recombination. The above problems were solved. The method of the present invention increases the probability of homologous recombination by obtaining at least two homologous recombinants with different genomic sequences, including nested genomic regions, in a single Agrobacterium-mediated knock-in trial. The inefficiency of knock-in due to lowness can be drastically improved. Furthermore, the method for introducing a mutation using the method of the present invention has a very high homologous recombinant obtaining efficiency per se as compared with other conventionally known methods. In addition, the mechanism of mutagenesis via conventional double-stranded DNA (see FIG. 1B; F. Paques and JE Haber (1999) Microbiol. Mol. Biol. Rev. 63: 349-404 (partially The efficiency of mutagenesis into the 5 ′ upstream side and 3 ′ downstream side (that is, the regions at both ends) in the homologous recombination nucleic acid, which was understood to be difficult to introduce the mutation in the modification)), is the method of the present invention. Then it rose.

  The present invention is based on a model that has never been expected in the past, in which homologous recombination occurs in a plurality of locations between a target gene and a specific gene on a chromosome, and This brings about a remarkable effect that a person skilled in the art cannot easily conceive of dramatically improving the knock-in efficiency of the point mutation.

In order to solve the above problems, the present invention provides the following items, for example:
(Item 1) A method for preparing at least two or more homologous recombinants having different genomic sequences in a plant, comprising:
(A) introducing a nucleic acid for homologous recombination into a plant cell, and (b) culturing the plant cell into which the nucleic acid for homologous recombination has been introduced,
Including the method.

  (Item 2) The different genome sequences include at least two genome regions derived from the nucleic acid for homologous recombination and at least one genome of the plant cell sandwiched between the genomic regions derived from the at least two nucleic acids for homologous recombination. Item 2. The method according to Item 1, comprising a genomic region consisting of regions.

  (Item 3) The method according to item 1, wherein the nucleic acid for homologous recombination is introduced into the plant cell by Agrobacterium.

(Item 4) A method for preparing at least two or more transgenic plants having different genomic sequences from regenerative plant cells in a plant, comprising:
(A) introducing a nucleic acid for homologous recombination into a plant cell;
(B) culturing a plant cell into which the nucleic acid for homologous recombination has been introduced, and (c) preparing a transgenic plant from the cultured cell,
Including the method.

  (Item 5) The different genome sequences include at least two genome regions derived from the nucleic acid for homologous recombination and at least one genome of the plant cell sandwiched between the genomic regions derived from the at least two nucleic acids for homologous recombination. 4. The method according to item 3, comprising a genomic region consisting of regions.

  (Item 6) The method according to item 3, wherein the nucleic acid for homologous recombination is introduced into the plant cell by Agrobacterium.

(Item 7) The nucleic acid for homologous recombination is as follows:
(1) a first homologous recombination region capable of hybridizing under stringent conditions to the first genomic region or its complementary strand;
(2) a second homologous recombination region capable of hybridizing to the second genomic region or its complementary strand under stringent conditions; and (3) the first region and the second region. A positive selectable marker, sandwiched between, wherein the first region and the second region are the first genomic region or its complementary strand and the second genomic region or its complement Item 7. The method according to any one of Items 1 to 6, which has at least two or more mutations with respect to the chain.

(Item 8) The nucleic acid for homologous recombination is as follows:
(4) a first negative selection marker gene; and (5) a second negative selection marker gene,
8. The method according to item 7, further comprising:

  (Item 9) The method according to Item 8, wherein the first negative selection marker gene and the second negative selection marker gene are the same gene.

  (Item 10) The method according to item 7, wherein the nucleic acid for homologous recombination further comprises (6) a site-specific recombinase (recombinase) recognition sequence upstream and downstream of the positive selection marker gene.

  (Item 11) The method according to item 10, wherein the nucleic acid for homologous recombination further comprises (7) a site-specific recombinase gene capable of inducing expression.

  (Item 12) The method according to item 7, wherein the positive selection marker gene is selected from the group consisting of a hygromycin resistance gene, a kanamycin resistance gene, a neomycin resistance gene and a drug resistance gene.

  (Item 13) The method according to item 8, wherein the negative selection marker gene is selected from the group consisting of diphtheria toxin protein A chain gene (DT-A), codA gene, cytochrome P-450 gene, and barnase gene.

(Item 14)
Item 11. The method according to Item 10, further comprising the step of expressing the site-specific recombinant enzyme to remove the positive selection marker gene from the plant cell.

  (Item 15) A composition for preparing at least two or more homologous recombinants having different genomic sequences in a plant, comprising a nucleic acid for homologous recombination.

  (Item 16) The different genomic sequences include at least two genomic regions derived from the nucleic acid for homologous recombination and at least one plant cell sandwiched between the genomic regions derived from the at least two nucleic acids for homologous recombination. 16. The composition according to item 15, comprising a genomic region consisting of a genomic region.

  (Item 17) The method according to item 15, wherein the nucleic acid for homologous recombination is introduced into the plant by Agrobacterium.

(Item 18) The nucleic acid for homologous recombination is as follows:
(1) a first homologous recombination region capable of hybridizing under stringent conditions to the first genomic region or its complementary strand;
(2) a second homologous recombination region capable of hybridizing to the second genomic region or its complementary strand under stringent conditions; and (3) the first region and the second region. A positive selection marker,
Wherein the first region and the second region are at least two or more relative to the first genomic region or its complementary strand and the second genomic region or its complementary strand. The composition according to item 15, which has a mutation.

(Item 19) The nucleic acid for homologous recombination is as follows:
(4) a first negative selection marker gene; and (5) a second negative selection marker gene,
The composition according to item 18, further comprising:

  (Item 20) The composition according to item 19, wherein the first negative selection marker gene and the second negative selection marker gene are the same gene.

  (Item 21) The composition according to item 18, wherein the nucleic acid for homologous recombination further comprises (6) a site-specific recombinase (recombinase) recognition sequence upstream and downstream of the positive selection marker gene.

  (Item 22) The composition according to item 21, wherein the nucleic acid for homologous recombination further comprises (7) a site-specific recombinase gene capable of inducing expression.

  (Item 23) The composition according to item 18, wherein the positive selection marker gene is selected from the group consisting of a hygromycin resistance gene, a kanamycin resistance gene, a neomycin resistance gene and a drug resistance gene.

  (Item 24) The composition according to item 19, wherein the negative selection marker gene is selected from the group consisting of diphtheria toxin protein A chain gene (DT-A), codA gene, cytochrome P-450 gene and barnase gene.

  The present inventors have unexpectedly introduced a nucleic acid for homologous recombination in which a plurality of point mutations have been introduced into a gene in a plant cell into Agrobacterium to cause homologous recombination, thereby causing a single homologous recombination. It was discovered that at least two types of transgenic plants having different genomic sequences including a nested genomic region can be obtained from a single nucleic acid sequence for homologous recombination using the nucleic acid for homologous recombination, The above problems were solved based on the findings. The method of the present invention obtains at least two transgenic plants with different genomic sequences including nested genomic regions in a single Agrobacterium-mediated knock-in trial (see FIG. 1A), This dramatically improves the inefficiency of knock-in caused by the low probability of homologous recombination. As shown in FIG. 1A, the nucleic acids for homologous recombination of the single-stranded DNA of the present invention introduced into plant cells by Agrobacterium allow multiple types of homology as in (i) and (ii) Recombination occurs, resulting in at least two types of transgenic plants having different genomic sequences including nested genomic regions. The present invention is based on a model that has never been expected in the past, in which homologous recombination occurs in a plurality of locations between a target gene and a specific gene on a chromosome, and This brings about a remarkable effect that a person skilled in the art cannot easily conceive of dramatically improving the knock-in efficiency of the point mutation. Furthermore, the method for introducing a mutation using the method of the present invention has a very high homologous recombinant obtaining efficiency per se as compared with other conventionally known methods.

  Currently, a double-stranded DNA fragment having a base sequence homologous to a DNA located on both sides of a specific gene on the genome is introduced into a cell by connecting it to both sides of the modified body, thereby allowing homology on both sides ( It is believed that homologous recombination occurs in the (recombination) region, a specific gene is removed, and a foreign gene is inserted instead (see FIG. 1B). Therefore, the method of preparing one kind of transgenic plant by performing a single knock-in with a single nucleic acid construct has been practiced (see FIGS. 1B and 2B). In contrast, the present investigators introduced this homologous recombination nucleic acid, which introduced multiple point mutations into a gene in a plant cell, into the plant cell by Agrobacterium and caused this homologous recombination. Different genomes in which at least one nested homologous recombination occurs between a gene derived from a nucleic acid for recombination and a specific gene on a chromosome, and as a result, the target nucleic acid is nested in multiple patterns It was unexpectedly discovered that two or more homologous recombinants having (see FIG. 2A) occur.

The nucleic acid for homologous recombination of the present invention is as follows:
(1) a first homologous recombination region capable of hybridizing under stringent conditions to the first genomic region or its complementary strand;
(2) a second homologous recombination region capable of hybridizing under stringent conditions to the second genomic region or its complementary strand, and (3) the first region and the second region A positive selection marker,
Where the first region and the second region have at least two or more mutations. Homologous recombination occurs in a nested manner upstream and downstream of two or more mutations in the first region and the second region, respectively, and the two or more mutations are transformed into homologous recombinants in a nested pattern. By being introduced, two or more homologous recombinants having different nested genome sequences can be prepared.

  This nested homologous recombination model via single-stranded DNA (see FIG. 1A) is a model via double-stranded DNA that is currently well known in the art in the knock-in system using homologous recombination (see FIG. 1A). (See FIG. 1B). FIG. 1A shows a model diagram of homologous recombination in the high-efficiency mutagenesis method of the present invention, and (i) SDSA (synthesis-dependent strand-annealing) is a thick arrow. The indicated newly synthesized DNA strands are hybridized (annealing), and further a recombinant is formed by DNA synthesis and ligation. The single-stranded T-DNA for homologous recombination introduced into the nucleus of the plant acts as an intermediate for homologous recombination, and the 3 ′ end of the single-stranded T-DNA becomes the homologous region of the target gene region genomic DNA of the plant. Invasion occurs, and the homologous recombination process proceeds as shown in (i) or (ii). In (i), the genomic DNA of the homologous region of the single-stranded T-DNA derived from the vector forms a heteroduplex DNA by branch migration. This branching point movement stops at the beginning of the non-homologous region of the positive selection marker gene, but the single-stranded T-DNA is cleaved, and its 3 ′ end reenters the genomic DNA to re-branch. This is a pathway in which heteroduplex DNA is formed by migration, and homologous recombination occurs through an SDSA process in which newly synthesized single-stranded DNA fragments associate with each other. In this case, various (two or more) combinations of recombinants are generated in the process of repairing the resulting heteroduplex DNA, and recombinants having frequently nested sequences are also generated. On the other hand, in the case of (ii), since DNA is synthesized using a single-stranded homologous region on T-DNA as a template, not only mutation (substitution, insertion and deletion) of several bases but also about 1 to 2 kb Relatively large substitutions, insertions and deletions can be efficiently transferred from the vector to the genome. Therefore, recombination takes place with high efficiency even with sequences on a vector having a non-homologous region, which is difficult with conventional homologous recombination, and this point is also mediated by T-DNA. This is a feature of this recombination mechanism. FIG. 1B shows a model diagram of homologous recombination in the conventional knock-in method. In this case as well, there is a possibility that heteroduplex DNA is generated at the end, and the end can be a vector-derived sequence or a plant genome-derived sequence by a repair mechanism, but the sequence is not nested.

  The present inventors have completed the present invention based on the discovery of the novel model described above. In the present invention, at least two types of homology including a genome region nested in one knock-in trial are introduced by introducing a nucleic acid for homologous recombination into a plant cell by Agrobacterium and causing homologous recombination in the plant. By obtaining a recombinant, the inefficiency of knock-in due to the low probability of homologous recombination is dramatically improved. Furthermore, the method for introducing a mutation using the method of the present invention has a very high homologous recombinant obtaining efficiency per se as compared with other conventionally known methods. In addition, the mechanism of mutagenesis via conventional double-stranded DNA (see FIG. 1B; F. Paques and JE Haber (1999) Microbiol. Mol. Biol. Rev. 63: 349-404 (partially In the method of the present invention, the efficiency of mutagenesis into the 5 ′ upstream side and 3 ′ downstream side (that is, the end region) in the homologous recombination nucleic acid, which was understood to be difficult to introduce the mutation in the modification)), Rose. These are significant effects that cannot be easily conceived by those skilled in the art.

  The present invention will now be described by way of example, with reference to the accompanying drawings, where appropriate. The present invention will be described below. Throughout this specification, it should be understood that the singular forms also include the plural concept unless specifically stated otherwise. In addition, it is to be understood that the terms used in the present specification are used in the meaning normally used in the art unless otherwise specified. Thus, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present specification, including definitions, will control.

  The embodiments provided below are provided for a better understanding of the present invention, and the scope of the present invention should not be limited to the following description. It will be apparent to those skilled in the art that modifications can be made as appropriate within the scope of the present invention in consideration of the description in the present specification.

(Definition)
Cells having regenerative ability derived from any plant cell can be used.

  As used herein, “plant” is a generic term for organisms belonging to the plant kingdom, characterized by chloroplasts, hard cell walls, the presence of abundant permanent embryonic tissue, and organisms that are not capable of motility. It is done. Plant types are broadly classified in, for example, “Primary Color Makino Botanical Encyclopedia” (Kitatakakan (1982)), and all types of plants described therein can be used in the present invention. Typically, a plant refers to a flowering plant having cell wall formation and anabolism by chloroplasts. “Plant” includes both monocotyledonous and dicotyledonous plants. Monocotyledonous plants include gramineous plants. Preferred monocotyledonous plants include corn, wheat, rice, oat, barley, sorghum, rye and millet, and more preferably, corn, wheat, and rice are not limited thereto. Wheat includes wheat cultivar Norin 61, for which it was difficult to obtain transformants by conventional methods. Examples of dicotyledonous plants include cruciferous plants, legumes, eggplants, cucurbits and convolvulaceae, but are not limited thereto. Brassicaceae plants include but are not limited to Chinese cabbage, rapeseed, cabbage and cauliflower. Preferred cruciferous plants are Chinese cabbage and rapeseed. A particularly preferred cruciferous plant is rapeseed. Leguminous plants include, but are not limited to, soybean, azuki bean, kidney bean, and cowpea. A preferred legume is soybean. Examples of solanaceous plants include, but are not limited to, tomatoes, eggplants, and potatoes. A preferred solanaceous plant is tomato. Cucurbitaceae plants include, but are not limited to, cucumber, cucumber, melon and watermelon. A preferred cucurbitaceae plant is cucumber. Convolvulaceae plants include, but are not limited to, morning glory, sweet potato and convolvulus. A preferred convolvulaceae plant is morning glory. Unless otherwise indicated, a plant means any plant, plant organ, plant tissue, plant cell, and seed. Examples of plant organs include roots, leaves, stems and flowers. Examples of plant cells include callus and suspension culture cells. In certain embodiments, a plant can mean a plant.

  In another embodiment, examples of plant species that can be used in the present invention include solanaceae, gramineous, cruciferous, rosaceae, legumes, cucurbitaceae, perillaceae, liliaceae, red crustaceae, ciliaceae, convolvulaceae Plants such as family and asteraceae are listed. Furthermore, examples of plant species that can be used in the present invention include any tree species, any fruit tree species, mulberry plants (eg, rubber), and mallow (eg, cotton).

  Examples of cruciferous plants include plants belonging to Raphanus, Brassica, Arabidopsis, Wasabia, or Capsella, and include, for example, radish, rape, Arabidopsis thaliana, horseradish, and tuna.

  Examples of gramineous plants include plants belonging to Oryza, Triticum, Hordeum, Secale, Saccharum, Sorghum, or Zea, including, for example, rice, barley, rye, sugarcane, sorghum, corn and the like.

  The methods of the present invention include plant cells (including callus and suspension culture cells) or plant tissues (including dormant tissues (including ripe seeds, immature seeds, winter buds, and tubers), germplasm, growth points, and flower buds). On the other hand, it is carried out by performing transformation via T-DNA using Agrobacterium. The method of the present invention is preferably carried out on plants, but is not limited thereto. Animal cells capable of performing transformation via T-DNA (Kunik T et al. (2001) Proc Natl Acad Sci USA 98: 1871-187; Pelczar P et al. (2004) EMBO REP 5: 632-637) and individual animals.

  As used herein, “animal” is a general term for organisms belonging to the animal kingdom, and is characterized by organisms that require oxygen and organic food and can move arbitrarily unlike plants and minerals. Animals are broadly classified into vertebrates and invertebrates. As the vertebrate, for example, larvae, lampreys, cartilaginous fish, teleosts, amphibians, reptiles, birds, mammals and the like are used, and more preferably mammals (for example, single pores, marsupials, poor Teeth, wings, wings, carnivores, carnivores, long noses, odd hoofs, even hoofs, rodents, scales, sea cattle, cetaceans, primates, rodents, Rabbit eyes, etc.) are used. More preferably, a primate (for example, chimpanzee, Japanese monkey, human) is used. Most preferably, human-derived cells or organs are used. As the invertebrates, for example, crustaceans, millipedes, Edahigemushi, centipedes, komcades, insects and the like are used. More preferably, insects (for example, Lepidoptera (including silkworms)) are used.

  As used herein, the terms “transformation”, “transduction” and “transfection” are used interchangeably unless otherwise stated and refer to the introduction of a nucleic acid into a host cell. In the present invention, a T-DNA-mediated transformation method using Agrobacterium is used.

  “Transformant” refers to all or part of a living organism such as a cell produced by transformation. Examples of the transformant include prokaryotic cells, yeast, plant cells, animal cells, insect cells and the like. A transformant is also referred to as a transformed cell, transformed tissue, transformed host, etc., depending on the subject and encompasses all of these forms herein, but may refer to a particular form in a particular context. .

  As used herein, “transgenic” refers to an organism into which a specific gene is incorporated or an organism (for example, a plant or animal (such as a mouse)) into which such a gene has been incorporated. Among transgenic organisms, one in which a certain gene is deleted or suppressed is called a knockout organism, and one in which a sequence or mutation of a certain gene is inserted is called a knockin organism.

  In the present specification, the “transgenic organism” refers to an organism into which a specific gene has been incorporated, and includes a transgenic plant and a transgenic animal. “Transgenic plant” refers to a plant into which a specific gene has been incorporated, and similarly, “transgenic animal” refers to an animal into which a specific gene has been incorporated. In the present invention, the transgenic organism is preferably a transgenic plant. In the present invention, the transgenic organism is more preferably transgenic rice.

  As used herein, “redifferentiating” means a phenomenon in which an entire individual is restored from a part of the individual. For example, a plant body is formed from cells such as callus and protoplast and tissue pieces such as leaves or roots by redifferentiation.

A method for redifferentiating a transformant into a plant is well known in the art. Such methods include Rogers et al. , Methods in Enzymology 118: 627-640 (1986); Tabata et al. , Plant
Cell Physiol. , 28: 73-82 (1987); Shaw, Plant Molecular Biology: A practical approach. IRL press (1988); Shimamoto et al. , Nature 338: 274 (1989); Maliga et al. , Methods in Plant Molecular Biology: A laboratory course. Cold Spring Harbor Laboratory Press (1995); Hiei et al. , Plant Mol Biol 35: 205 (1997); Toki et al. , Plant J 47: 969 (2006). Therefore, those skilled in the art can regenerate by appropriately using the above-described well-known methods according to the transgenic plant.

  Cells and tissues transfected / transformed by the method of the present invention can be differentiated, grown and / or expanded by any method known in the art. In the case of plant species, the step of differentiating, growing and / or proliferating cells or tissues can be achieved, for example, by cultivating the plant cells or plant tissues or plants containing them. In the present specification, plant cultivation can be performed by any method known in the art. See, for example, supervision Isao Shimamoto and Kiyoshi Okada, “Experimental Protocol for Model Plants—Edited by Rice and Arabidopsis thaliana”: Cell Engineering Separate Volume Plant Cell Engineering Series 4; 28-32, and Niwa Yasuo, Arabidopsis cultivation method, pp. 33-40 and can be easily implemented by those skilled in the art and need not be described in detail herein. For example, Arabidopsis can be cultivated by soil cultivation, rock wool cultivation, or hydroponics. When cultivated under a white fluorescent lamp (about 6000 lux) under constant light conditions, the first flower will bloom about 4 weeks after sowing, and the seed will ripen about 16 days after flowering. About 40 to 50 seeds can be obtained with one pod, and about 10,000 seeds can be obtained in 2 months to 3 months after sowing. In addition, for example, in the cultivation of wheat, it is well known that it does not head and bloom unless it is exposed to low-temperature short-day conditions for a certain period after sowing. Therefore, for example, when cultivating wheat in an artificial environment (for example, a greenhouse or a gross chamber), the wheat seedlings are treated at a low temperature and short day (for example, 20 ° C., 8 hours (about 2000 lux) at the initial stage of growth. ) And 8 ° C. treatment in the dark period of 16 hours). This process is called vernalization. The cultivation conditions required for each plant species are generally well known in the art, and therefore need not be described in detail herein.

  In the case of species other than plants (eg, animal species), cells and tissues that have been transfected / transformed via T-DNA can be differentiated, grown, and / or propagated by any method known in the art. (See, for example, Meiji Izumi, et al., Biochemistry Experiments, 4. Animal and Tissue Experiments, Chemistry Doujin, 1987).

  As used herein, the term “homologous recombinant” refers to any cell in which a nucleic acid derived from a foreign gene (in the present invention, a nucleic acid for homologous recombination) is integrated into the genome by homologous recombination, and An individual.

  As used herein, the phrase “genomic region derived from at least two nucleic acids for homologous recombination and at least one genomic region of the plant cell sandwiched between the genomic regions derived from the at least two nucleic acids for homologous recombination” The “genomic region consisting of” refers to a genomic region in which the genomic region derived from the nucleic acid for homologous recombination of the present invention is nested and integrated into the plant genomic region of the plant cell. “Genomic region comprising at least two genomic regions derived from the nucleic acid for homologous recombination and at least one genomic region of the plant cell sandwiched between the genomic regions derived from the at least two nucleic acids for homologous recombination” and “nesting” "Genomic region" is synonymous and can be used interchangeably.

  In the method of the present invention, a genomic region derived from a nucleic acid for homologous recombination is introduced into the plant cell by homologous recombination between a specific genomic region of the plant cell and a genomic region derived from the nucleic acid for homologous recombination. . Here, the genomic region derived from the introduced nucleic acid for homologous recombination and the region replaced by homologous recombination may have the same sequence or different sequences. Preferably, the genomic region derived from the introduced nucleic acid for homologous recombination and the region replaced by homologous recombination have different sequences. In one embodiment of the present invention, the genomic region derived from a nucleic acid for homologous recombination introduced into a plant cell contains at least one mutation.

  In one embodiment of the present invention, the “genomic region consisting of at least one plant cell genomic region sandwiched between at least two genomic regions derived from nucleic acids for homologous recombination” is performed after the method of the present invention is performed. There are at least one or more. In another embodiment of the present invention, this “genomic region consisting of at least one plant cell genomic region sandwiched between at least two genomic regions derived from nucleic acids for homologous recombination” is performed after performing the method of the present invention. There are at least two or more. In another embodiment of the present invention, this “genomic region consisting of at least one plant cell genomic region sandwiched between at least two genomic regions derived from nucleic acids for homologous recombination” is performed after performing the method of the present invention. There are at least three or more. In another embodiment of the present invention, this “genomic region consisting of at least one plant cell genomic region sandwiched between at least two genomic regions derived from nucleic acids for homologous recombination” is performed after performing the method of the present invention. , At least 4, 5, 6, 7, 8, or 9 or more. More preferably, the “genomic region consisting of at least one genomic region of the plant cell sandwiched between at least two genomic regions derived from nucleic acids for homologous recombination” is 10, 15, 20, 30, There are 40, 50, or 100 or more.

  In one embodiment of the present invention, the “at least one genomic region of the plant cell sandwiched between genomic regions derived from at least two nucleic acids for homologous recombination” has a size of 10 bp or more. In another embodiment of the present invention, the “at least one genome region of the plant cell sandwiched between at least two genome regions derived from nucleic acids for homologous recombination” is 20 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp. 80 bp, 90 bp, 100 bp, 150 bp, 200 bp, 250 bp, 300 bp, 350 bp, 400 bp, 450 bp, 500 bp, 550 bp, 600 bp, 650 bp, 700 bp, 750 bp, 800 bp, 850 bp, 900 bp, 950 bp or 1,000 bp or more in size.

  As used herein, the term “Agrobacterium” refers to a gram-staining negative soil bacterium, Agrobacterium tumefaciens, which is a type of phytopathogenic fungus that infects plants and induces crown gall tumors. The approximately 200,000 base pair Ti plasmid of this Agrobacterium is the causative factor of crown gall tumor. This Ti plasmid has a T-DNA region surrounded by a border sequence consisting of a pair of 25 base pairs oriented in the same direction. This T-DNA region undergoes a single-strand break in the border sequence by a specific Vir protein, and is cut out as a single-stranded DNA. It is believed that this single-stranded DNA moves to the plant and is integrated into the chromosome. The knock-in model of the present invention has been made possible by utilizing this single-stranded T-DNA region.

  It has been reported that transformation using Agrobacterium can be applied not only to plants but also to cells derived from mammals (eg, HeLa cells) (Pawel Pelczar et al., EMBO report, VOL5, NO 6, 2004; Talya Kunik et al., PNAS 98; 1871-1876; 2001, etc., which references are incorporated herein by reference). Therefore, it is understood that the present invention can be used not only for plants but also for introducing mutations into mammals.

  While not intending to be bound by theory, the method of the present invention may be in the use of single stranded DNA as a nucleic acid for homologous recombination. Therefore, in the method of the present invention, Agrobacterium-derived T-DNA is used as a nucleic acid for homologous recombination, but the nucleic acid for homologous recombination is not necessarily limited to T-DNA derived from Agrobacterium, Any single-stranded DNA can be used as the nucleic acid for homologous recombination of the present invention.

  As used herein, “regenerative ability” refers to the ability to regenerate an original individual or organ from a part (eg, a cell) of the individual or organ. In the present invention, “cells having regenerative ability” include, but are not limited to, callus or somatic embryo.

  As used herein, the term “cell” refers to any undifferentiated and young cell derived from any plant or animal and having self-renewal ability and differentiation ability, including callus. .

  As used herein, the term “two or more homologous recombinants” means homologous recombination having an integration pattern of nucleic acids derived from two or more foreign genes (in the present invention, nucleic acids for homologous recombination). Refers to the body. In one embodiment, the method of the invention prepares two or more transformed cells having different genomic sequences. In another embodiment, three or more transformed cells with different genomic sequences are prepared by the methods of the invention. In another embodiment, the method of the invention prepares four or more transformed cells with different genomic sequences. In another embodiment, the method of the present invention prepares five or more transformed cells having different genomic sequences. In another embodiment, six or more transformed cells with different genomic sequences are prepared by the methods of the present invention. In another embodiment, the method of the invention prepares seven or more transformed cells having different genomic sequences. In another embodiment, the method of the invention prepares eight or more transformed cells with different genomic sequences. In another embodiment, nine or more transformed cells with different genomic sequences are prepared by the methods of the present invention. In another embodiment, the method of the invention prepares 10 or more transformed cells with different genomic sequences. In yet another embodiment, the method of the invention prepares 15 or more transformed cells with different genomic sequences. In yet another embodiment, the method of the invention prepares 20 or more transformed cells with different genomic sequences.

  As used herein, “homologous recombination” refers to genetic exchange between molecules having a homologous base sequence. Although it is found in the form of chromosome transfer in vivo, it is also a means of gene targeting that artificially changes a specific gene on the genome. When DNA having a portion homologous to a specific gene on the genome is introduced into a cell, recombination occurs at this homologous portion, and foreign DNA is incorporated into the genome. By utilizing this, it becomes possible to produce a variant (for example, a variant in which a point mutation is introduced into a specific gene). Homologous recombination is a technique originally developed to target genes to induce or correct mutations in transcriptionally active genes (Kucherlapati, Prog. In Nucl. Acid Res. & Mol. Biol., 36: 301, 1989). The basic technique was developed as a method for introducing specific mutations into specific regions of the mammalian genome (Thomas et al., Cell, 44: 419-428, 1986; Thomas and Capecchi, Cell, 51 : 503-512, 1987; Doetschman et al., Proc. Natl. Acad. Sci., 85: 8583-8587, 1988), or developed as a method to correct specific mutations within a defective gene ( Doetschman et al., Nature, 330: 576-578, 1987). Exemplary homologous recombination techniques are described in US Pat. No. 5,272,071 (EP 9193051, EP Publication No. 505500; PCT / US90 / 07642, International Publication WO 91/09955). Homologous recombination is well known and practiced in the art.

  As used herein, “gene targeting” (also referred to as gene targeting or target gene recombination) refers to introducing a targeted mutation only into a specific locus at the cell and individual level. For gene targeting, homologous gene recombination occurs at the cellular level, and then plant gene recombinants are selected.

In the present specification, the “nucleic acid for homologous recombination” is also referred to as an introduction vector or a vector for homologous recombination, and the nucleic acid for homologous recombination of the present invention is as follows:
(1) a first homologous recombination region capable of hybridizing under stringent conditions to the first genomic region or its complementary strand;
(2) a second homologous recombination region capable of hybridizing under stringent conditions to the second genomic region or its complementary strand, and (3) the first region and the second region A positive selection marker,
Where the first region and the second region have at least two or more mutations. Nested homologous recombination occurs upstream and downstream of two or more mutations in the first region and the second region, respectively, and the two or more mutations are introduced into the plant in different patterns, Two or more homologous recombinants having different genomic sequences are prepared. The nucleic acid for homologous recombination of this invention contains the negative selection marker for negative selection as needed. The “nucleic acid for homologous recombination” of the present invention further includes two recombinase (site-specific enzyme) recognition sequences arranged before and after the positive selection marker, if necessary. This recombinase recognition sequence is preferably a loxP sequence. The “nucleic acid for homologous recombination” of the present invention further includes a Cre gene that is a site-specific recombination enzyme, if necessary. See FIG. 2A for an overview of the nucleic acid for homologous recombination of the present invention. The nucleic acid for homologous recombination can be used in combination with other regulatory elements as necessary, and such nucleic acid for homologous recombination is also included in the scope of the present invention.

  As used herein, the terms “protein”, “polypeptide”, “oligopeptide” and “peptide” are used interchangeably herein and refer to a polymer of amino acids of any length.

  As used herein, “homologous recombination region” refers to a site in a nucleic acid for homologous recombination where homologous recombination can occur with a specific genomic region of a stem cell. A homologous recombination region refers to a region where homologous recombination can occur regardless of whether or not homologous recombination actually occurs at that site. Accordingly, those skilled in the art readily recognize that homologous recombination does not necessarily occur in the homologous recombination region.

As used herein, “selection marker” refers to a gene that functions as an index for selecting a host cell containing a nucleic acid construct or vector. Selection markers include, but are not limited to, fluorescent markers, luminescent markers, and drug resistance selection markers. “Fluorescent markers” include genes encoding fluorescent proteins such as green fluorescent protein (GFP), blue fluorescent protein (CFP), yellow fluorescent protein (YFP) and red fluorescent protein (dsRed). It is not limited. “Luminescent markers” include, but are not limited to, genes encoding photoproteins such as luciferase. “Drug resistance selection markers” include hypoxanthine guanine phosphoribosyltransferase (hprt), dihydrofolate reductase gene, glutamine synthetase gene, aspartate transaminase, metallothionein (MT), adenosine deaminase (ADA), adenosine deaminase (AMPD1, 2) ), Xanthine-guanine-phosphoribosyltransferase, UMP synthase, P-glycoprotein, asparagine synthetase, and ornithine decarboxylase. Examples of combinations of these drug selection markers and drugs to be used are as follows: a combination of dihydrofolate reductase gene (DHFR) and methotrexate (MTX), a glutamine synthetase (GS) gene and methionine sulfoxy A combination of min (Msx), a combination of aspartate transaminase (AST) gene and N-phosphonacetyl-L-aspartate (PALA), MT gene and cadmium (Cd ²⁺ ) Adenosine deaminase (ADA) gene and adenosine, alanosine, 2'-deoxycoformycin, adenosine deaminase (AMPD1,2) gene and adenine, azaserine, cophor Combination with isine, combination of xanthine-guanine-phosphoribosyltransferase gene and mycophenolic acid, combination of UMP synthase gene with 6-azauridine, pyrazofuran, P-glycoprotein (P-gp, MDR) gene And combinations of drugs, asparagine synthetase (AS) gene and β-aspartyl hydroxamic acid or albizzinin, ornithine decarboxylase (ODC) gene and α-difluoromethyl-ornithine (DFMO) The gene which codes is mentioned, However It is not limited to these.

  As used herein, in the context of homologous recombination, the term “negative selectable marker” refers to inhibiting and / or suppressing the growth of cells in which the modified nucleic acid has been inserted into a genomic region other than the plant region, A sequence that facilitates selection of cells in which the modified nucleic acid has been inserted into the target region. Typically, a “negative selectable marker” exists as an additional sequence of a modified nucleic acid, and when the modified nucleic acid is inserted into the genome without homologous recombination at the two homologous regions, Along with the inserted sequence, a gene product (RNA and / or protein) that is inserted into the genome and thus inhibits and / or promotes the growth of the host cell from the negative selection sequence is expressed, so that the modified nucleic acid is targeted Growth of cells inserted into genomic regions other than the region is inhibited and / or suppressed. On the other hand, when the modified nucleic acid is inserted into the target region by homologous recombination, the “negative selection sequence” as an additional sequence outside the two homologous regions is not inserted into the genome. Therefore, the growth of the host cell into which the modified nucleic acid is inserted is not inhibited or suppressed. As used herein, selection by a “negative selection marker” is referred to as “negative selection”. Examples of the “negative selection marker” include diphtheria toxin protein A chain gene (DT-A), Exotoxin A gene, Ricin toxin A gene, codA gene, cytochrome P-450 gene, RNase T1 gene and barnase gene. It is not limited to these.

  As used herein in the context of homologous recombination, the term “positive selection marker” refers to and / or promotes proliferation of cells that have a modified nucleic acid inserted into a genomic region. Is an array. As used herein, selection by a “positive selection marker” is referred to as “positive selection”. “Positive selection markers” include hygromycin resistance genes, kanamycin resistance genes, drug resistance genes such as neomycin resistance genes, herbicide resistance genes such as ALS (AHAS) gene and PPO gene (Iida, S and Terada R). (2005) Plant Mol. Biol. 59: 205-219) and the like.

  Transient expression of site-specific recombination enzymes such as Cre enzyme, DNA mapping on chromosomes, etc. used in the method for removing genomes or loci used in the present specification are performed separately in cell engineering experiments. The protocol series “FISH Experimental Protocol From Human Genome Analysis to Chromosome / Gene Diagnosis” is well known in the art as described in Kenichi Matsubara, Hiroshi Yoshikawa, Shujunsha (Tokyo) and the like.

  As used herein, the terms “polynucleotide”, “oligonucleotide”, and “nucleic acid” are used interchangeably herein and refer to a polymer of nucleotides of any length. Unless otherwise indicated, a particular nucleic acid sequence may also be conservatively modified (eg, degenerate codon substitutes) and complementary sequences, as well as those explicitly indicated. Is contemplated. Specifically, a degenerate codon substitute creates a sequence in which the third position of one or more selected (or all) codons is replaced with a mixed base and / or deoxyinosine residue. (Batzer et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsuka et al., J. Biol. Chem. 260: 2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8: 91-). 98 (1994)).

  In the present specification, “gene” refers to a sequence of a certain length of nucleic acid present in a cell, which is a factor that defines a genetic trait. In the present invention, the gene may or may not define a genetic trait. In the present specification, a gene refers to a gene that is usually present in the genome, but is not limited thereto, and it is understood to include an extrachromosomal sequence, a mitochondrial sequence, and the like. Many genes are usually arranged in a certain order on the chromosome. Those that define the primary structure of a protein are called structural genes, and those that influence the expression are called regulatory genes (for example, promoters). As used herein, “gene” may refer to “polynucleotide”, “oligonucleotide” and “nucleic acid” and / or “protein” “polypeptide”, “oligopeptide” and “peptide”. In the present specification, the “open reading frame” or “ORF” of a gene is one of three frameworks when the base sequence of a gene is divided into 3 bases each, and has a start codon and A reading frame that has a certain length without a stop codon and may actually encode a protein. In the present specification, genes include structural genes and regulatory genes unless otherwise specified. Thus, for example, a DNA polymerase gene usually includes both a structural gene for DNA polymerase and a transcriptional and / or translational regulatory sequence such as a promoter for DNA polymerase. In the present invention, it is understood that regulatory sequences such as transcription and / or translation as well as structural genes are also useful as the genes to which the present invention is directed. As used herein, “gene” refers to “polynucleotide”, “oligonucleotide”, “nucleic acid” and “nucleic acid molecule” and / or “protein”, “polypeptide”, “oligopeptide” and “peptide”. Sometimes. Also herein, “gene product” refers to “polynucleotide”, “oligonucleotide”, “nucleic acid” and “nucleic acid molecule” and / or “protein” “polypeptide”, “oligopeptide” expressed by a gene. And “peptide”. A person skilled in the art can understand what a gene product is, depending on the situation.

  As used herein, an “isolated” substance (eg, a biological agent such as a nucleic acid or protein) refers to other substances in the environment in which the substance exists in nature (eg, within the cells of an organism). (Preferably a biological factor) (for example, in the case of a nucleic acid, a nucleic acid comprising a non-nucleic acid factor and a nucleic acid sequence other than the target nucleic acid; A protein substantially separated or purified from a protein containing an amino acid sequence). “Isolated” nucleic acids and proteins include nucleic acids and proteins purified by standard purification methods. Thus, isolated nucleic acids and proteins include chemically synthesized nucleic acids and proteins.

  As used herein, a “purified” substance (eg, a biological factor such as a nucleic acid or protein) refers to a substance from which at least a part of the factor naturally associated with the substance has been removed. Therefore, the purity of the substance in the purified substance is usually higher (ie, concentrated) than the substance normally exists.

  As used herein, “purified” and “isolated” are preferably at least 75% by weight, more preferably at least 85% by weight, even more preferably at least 95% by weight, and most preferably at least 98% by weight. % Of the same type of material is present.

  As used herein, “homology” of genes refers to the degree of identity of two or more gene sequences with respect to each other. Therefore, the higher the homology between two genes, the higher the sequence identity or similarity. Whether two genes have homology can be examined by direct sequence comparison or, in the case of nucleic acids, hybridization methods under stringent conditions. When directly comparing two gene sequences, the DNA sequence between the gene sequences is typically at least 50% identical, preferably at least 70% identical, more preferably at least 80%, 90% , 95%, 96%, 97%, 98% or 99% are identical, the genes are homologous.

  As used herein, “stringent hybridization conditions” refers to well-known conditions commonly used in the art. Such a polynucleotide can be obtained by using a colony hybridization method, a plaque hybridization method, a Southern blot hybridization method, or the like using a polynucleotide selected from among the polynucleotides of the present invention as a probe. Specifically, polynucleotides that hybridize under stringent conditions are hybridized at 65 ° C. in the presence of 0.7 to 1.0 M NaCl using a filter on which colony or plaque-derived DNA is immobilized. Then, using a 0.1- to 2-fold concentrated SSC (saline-sodium citrate) solution (the composition of the 1-fold concentrated SSC solution is 150 mM sodium chloride, 15 mM sodium citrate) at 65 ° C. It means a polynucleotide that can be identified by washing the filter. Hybridization was performed in Molecular Cloning 2nd ed. , Current Protocols in Molecular Biology, Supplement 1-38, DNA Cloning 1: Core Techniques, A Practical Approach, Second Edition, Oxford Universe. Here, the sequence containing only the A sequence or only the T sequence is preferably excluded from the sequences that hybridize under stringent conditions. The “hybridizable polynucleotide” refers to a polynucleotide that can hybridize to another polynucleotide under the above hybridization conditions. Specifically, the hybridizable polynucleotide is a polynucleotide having at least 60% homology with the base sequence of DNA encoding a polypeptide having the amino acid sequence specifically shown in the present invention, preferably 80% The polynucleotide which has the above homology, More preferably, the polynucleotide which has 95% or more of homology can be mentioned.

  In the present specification, comparison of base sequence identity and calculation of homology are calculated using BLAST, which is a sequence analysis tool, using default parameters. The identity search can be performed using, for example, NCBI BLAST 2.2.9 (issued 2004.5.12). In the present specification, the identity value usually refers to a value when the BLAST is used and aligned under default conditions. However, if a higher value is obtained by changing the parameter, the highest value is the identity value. When identity is evaluated in a plurality of areas, the highest value among them is set as the identity value.

  In the present specification, “search” refers to finding another nucleobase sequence having a specific function and / or property using a nucleobase sequence electronically or biologically or by other methods. Say. As an electronic search, BLAST (Altschul et al., J. Mol. Biol. 215: 403-410 (1990)), FASTA (Pearson & Lipman, Proc. Natl. Acad. Sci., USA 85: 2444-). 2448 (1988)), the Smith and Waterman method (Smith and Waterman, J. Mol. Biol. 147: 195-197 (1981)), and the Needleman and Wunsch method (Needleman and Wunsch, J. Mol. Biol. 48:44:44). -453 (1970)) and the like. Biological searches include stringent hybridization, macroarrays with genomic DNA affixed to nylon membranes, microarrays affixed to glass plates (microarray assays), PCR, and in situ hybridization. It is not limited to. In the present specification, it is intended that the promoter used in the present invention should include a corresponding sequence identified by such an electronic search or biological search.

  In the present specification, “expression” of a gene, polynucleotide, polypeptide or the like means that the gene or the like undergoes a certain action in vivo to take another form. Preferably, it means that a gene, polynucleotide or the like is transcribed and translated into a polypeptide form. However, transcription and production of mRNA can also be an aspect of expression. More preferably, such a polypeptide form may be post-translationally processed.

  Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides may also be referred to by the generally accepted single letter code.

The character codes are as follows.
3 letter code of amino acid 1 letter code Meaning Ala A Alanine Cys C Cysteine Asp D Aspartic acid Glu E Glutamic acid Phe F Phenylalanine Gly G Glycine His H Histidine Ile I Isoleucine Lys K Lysine Leu L Leucine Met M N Glutamine Arg R Arginine Ser S Serine Thr T Threonine Val V Valine Trp W Tryptophan Tyr Y Tyrosine Asx Asparagine or Aspartate Glx Glutamine or Glutamate Xaa Unknown or other amino acids.

Base symbol Meaning
a adenine g guanine c cytosine t thymine u uracil r guanine or adenine purine y thymine / uracil or cytosine pyrimidine m adenine or cytosine amino group k guanine or thymine / uracil keto group s guanine or cytosine w adenine or thymine / uracil b guanine or cytosine Thymine / uracil d adenine or guanine or thymine / uracil h adenine or cytosine or thymine / uracil v adenine or guanine or cytosine n adenine or guanine or cytosine or thymine / uracil, unknown or other base.

  In the present specification, the “fragment” refers to a polypeptide or polynucleotide having a sequence length of 1 to n−1 with respect to a full-length polypeptide or polynucleotide (length is n). The length of the fragment can be appropriately changed according to the purpose. For example, the lower limit of the length is 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50 and more amino acids, and lengths expressed in integers not specifically listed here (eg 11 etc.) are also suitable as lower limits obtain. In the case of polynucleotides, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, 200, 300, 400, 500, 600, 600, 700, 800 , 900, 1000 and more nucleotides, and lengths expressed in integers not specifically listed here (eg, 11 etc.) may also be appropriate as lower limits.

  As long as the polypeptide used in the present invention has substantially the same action as the naturally occurring polypeptide, one or more (for example, one or several) amino acids in the amino acid sequence are substituted, added and / or missing. It may be lost, and the sugar chain may be substituted, added and / or deleted.

  It is well known in the art that one amino acid can be substituted with another amino acid having a similar hydrophobicity index and still result in a protein having a similar biological function (eg, an equivalent protein in enzymatic activity). It is. In such amino acid substitution, the hydrophobicity index is preferably within ± 2, more preferably within ± 1, and even more preferably within ± 0.5. It is understood in the art that such amino acid substitutions based on hydrophobicity are efficient. The hydrophilicity index is also considered in the production of variants. As described in US Pat. No. 4,554,101, the following hydrophilicity indices have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartic acid (+3. 0 ± 1); glutamic acid (+ 3.0 ± 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (−0.4); proline ( Alanine (−0.5); histidine (−0.5); cysteine (−1.0); methionine (−1.3); valine (−1.5); leucine (−0.5 ± 1); -1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); and tryptophan (-3.4). It is understood that an amino acid can be substituted with another that has a similar hydrophilicity index and can still provide a biological equivalent. In such amino acid substitution, the hydrophilicity index is preferably within ± 2, more preferably within ± 1, and even more preferably within ± 0.5.

  In the present invention, “conservative substitution” refers to a substitution in which the hydrophilicity index and / or the hydrophobicity index of the amino acid to be replaced with the original amino acid are similar as described above. Examples of conservative substitutions are well known to those skilled in the art and include, for example, substitutions within the following groups: arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine; However, it is not limited to these.

  In the present specification, the “variant” refers to a substance in which a part of the original substance such as a polypeptide or polynucleotide is changed. Such variants include substitutional variants, addition variants, deletion variants, truncated variants, allelic variants, and the like. Alleles refer to genetic variants that belong to the same locus and are distinguished from each other. Therefore, an “allelic variant” refers to a variant that has an allelic relationship with a gene. “Species homologue or homolog” means homology (preferably 60% or more, more preferably 80% or more) with a gene at the amino acid level or nucleotide level in a certain species. 85% or higher, 90% or higher, 95% or higher homology). The method for obtaining such species homologues will be apparent from the description herein. An “ortholog” is also called an orthologous gene and refers to a gene derived from speciation from a common ancestor with two genes. For example, taking the hemoglobin gene family with multiple gene structures as an example, the human and mouse α-hemoglobin genes are orthologs, but the human α- and β-hemoglobin genes are paralogs (genes generated by gene duplication). . Since orthologs are useful for estimating molecular phylogenetic trees, orthologs of the present invention may also be useful in the present invention.

  As used herein, “functional variant” refers to a variant that retains the biological activity of a reference sequence.

  As used herein, “conservative (modified) variants” applies to both amino acid and nucleic acid sequences. Conservatively modified variants with respect to a particular nucleic acid sequence refer to nucleic acids that encode the same or essentially the same amino acid sequence, and are essentially identical if the nucleic acid does not encode an amino acid sequence. An array. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For example, the codons GCA, GCC, GCG, and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are “silent modifications (mutations)” which are one species of conservatively modified mutations. In nucleic acids, conservative substitutions can be confirmed, for example, while measuring promoter activity.

  As used herein, in addition to amino acid substitutions, amino acid additions, deletions, or modifications can also be made to generate genes encoding functionally equivalent polypeptides. Amino acid substitution means that the original peptide is substituted with one or more, for example, 1 to 10, preferably 1 to 5, more preferably 1 to 3 amino acids. The addition of amino acids means that one or more, for example, 1 to 10, preferably 1 to 5, more preferably 1 to 3 amino acids are added to the original peptide chain. Deletion of amino acids means deletion of one or more, for example, 1 to 10, preferably 1 to 5, more preferably 1 to 3 amino acids from the original peptide. Amino acid modifications include, but are not limited to, amidation, carboxylation, sulfation, halogenation, alkylation, glycosylation, phosphorylation, hydroxylation, acylation (eg, acetylation), and the like. The amino acid to be substituted or added may be a natural amino acid, a non-natural amino acid, or an amino acid analog. Natural amino acids are preferred.

  The nucleic acid form of a polypeptide to be expressed herein refers to a nucleic acid molecule that can express the protein form of the polypeptide. As long as the expressed polypeptide has substantially the same activity as the native polypeptide, a part of the nucleic acid sequence is deleted or replaced by another base as described above. Alternatively, other nucleic acid sequences may be partially inserted. Alternatively, another nucleic acid may be bound to the 5 'end and / or the 3' end. Alternatively, it may be a nucleic acid molecule that hybridizes under stringent conditions with a gene encoding a polypeptide and encodes a polypeptide having substantially the same function as the polypeptide. Such genes are known in the art and can be used in the present invention.

  Such a nucleic acid can be obtained by a well-known PCR method, and can also be chemically synthesized. These methods may be combined with, for example, a site-directed mutagenesis method or a hybridization method.

  As used herein, “substitution, addition or deletion” of a polypeptide or polynucleotide is a substitution of an amino acid or a substitute thereof, or a nucleotide or a substitute thereof, respectively, with respect to the original polypeptide or polynucleotide. , Adding or removing. Such substitution, addition, or deletion techniques are well known in the art, and examples of such techniques include site-directed mutagenesis techniques. The number of substitutions, additions or deletions may be any number as long as it is one or more, and the number is increased as long as the desired function is maintained in the variant having the substitution, addition or deletion. be able to. For example, such a number can be one or several, and preferably can be within 20%, within 10%, or less than 100, less than 50, less than 25, etc. of the total length.

  In the present specification, when referring to a gene, a “vector” refers to one that can transfer a target polynucleotide sequence into a target cell. Such vectors can be autonomously replicated in host cells such as prokaryotic cells, yeast, plant cells, animal cells, insect cells, plant individuals and animal individuals, or can be integrated into the chromosome, Examples include those containing a promoter at a position suitable for transcription of the polynucleotide of the present invention. In the present specification, for example, a BAC vector can be used. The BAC vector is a plasmid prepared based on the F plasmid of E. coli, and is a vector that can stably hold and proliferate DNA fragments of a large size of about 300 kb or more in bacteria such as E. coli. is there. The BAC vector contains at least a region essential for replication of the BAC vector. Examples of the region essential for the replication include oriS, which is the replication origin of F plasmid, or a variant thereof.

  As used herein, the term “promoter” (or promoter sequence) refers to a region on DNA that determines the initiation site of gene transcription and directly regulates its frequency. Usually, RNA polymerase binds to transcription. This is the base sequence to start. Therefore, in this specification, a part having a promoter function of a gene is referred to as a “promoter part”. The promoter region can be estimated by predicting the protein coding region in the genomic base sequence using DNA analysis software. The putative promoter region varies for each structural gene, but is usually upstream of the structural gene, but is not limited thereto, and may be downstream of the structural gene.

  In the present specification, an “enhancer” can be used to increase the expression efficiency of a target gene. When used in animal cells, an enhancer region containing an upstream sequence in the SV40 promoter is preferred as the enhancer. A plurality of enhancers may be used, but one may be used or may not be used. Regions in the promoter that enhance promoter activity are also sometimes called enhancers.

  As used herein, “operably linked” refers to the control of transcriptional translational regulatory sequences (eg, promoters, enhancers, etc.) or translational regulatory sequences that have the expression (operation) of the desired sequence. It is arranged below. In order for a promoter to be operably linked to a gene, the promoter is usually placed immediately upstream of the gene, but need not necessarily be adjacent.

  As used herein, an “expression vector” refers to a nucleic acid sequence in which various regulatory elements are operably linked in a host cell in addition to a structural gene and a promoter that regulates its expression. The regulatory element can preferably include a terminator, a selectable marker such as a drug resistance gene (eg, a kanamycin resistance gene, a hygromycin resistance gene, etc.) and an enhancer. It is well known to those skilled in the art that the type of expression vector of an organism (eg, animal) and the type of regulatory element used can vary depending on the host cell.

  As used herein, “introduction vector” refers to a vector capable of transferring a target polynucleotide sequence into a target cell. Such vectors can be autonomously replicated in host cells such as prokaryotic cells, yeast, plant cells, animal cells, insect cells, plant individuals and animal individuals, or can be integrated into chromosomes. Examples include those containing a promoter at a position suitable for nucleotide transcription.

  As used herein, the term “upstream” refers to a position from a particular reference point toward the 5 ′ end of a polynucleotide.

  As used herein, the term “downstream” refers to a position from a particular reference point toward the 3 ′ end of a polynucleotide.

  As a method for introducing a vector, Agrobacterium (Japanese Patent Laid-Open No. 59-140885, Japanese Patent Laid-Open No. 60-70080, WO94 / 00977) is preferable.

  As used herein, “expression level” refers to the amount of polypeptide or mRNA expressed in a target cell or the like. Such expression level is evaluated by any appropriate method including immunoassay methods such as ELISA, RIA, fluorescent antibody, Western blot, and immunohistochemical staining using the antibody of the present invention. Expression level of the polypeptide of the present invention at the protein level, or mRNA of the polypeptide of the present invention evaluated by any suitable method including molecular biological measurement methods such as Northern blotting, dot blotting, and PCR The expression level at the level is mentioned. “Change in expression level” means an increase in the expression level at the protein level or mRNA level of the polypeptide of the present invention evaluated by any appropriate method including the above immunological measurement method or molecular biological measurement method. Or it means to decrease.

  As used herein, a “site-specific recombinase” is a protein that exists in many organisms (eg, viruses and bacteria) and is characterized as having both endonuclease and ligase properties. These recombinases recognize the specific sequence of bases in DNA (along with related proteins in some cases) and replace the DNA segments adjacent to these segments. This recombinase and related proteins are collectively referred to as “recombinant proteins” (see, eg, Landy, A., Current Opinion in Biotechnolog 3: 699-707 (1993)).

  A number of recombinant systems from various organisms have been described. For example, see: Hoess, et al. Nucleic Acids Research 14 (6): 2287 (1986); Abremski, et al. , J .; Biol. Chem. 261 (1): 391 (1986); Campbell, J. et al. Bacteriol. 174 (23): 7495 (1992); Qian, et al. , J .; Biol. Chem. 267 (11): 7794 (1992); Araki, et al. , J .; Mol. Biol. 225 (1): 25 (1992); Maeser and Kahnmann, Mol. Gen. Genet. 230: 170-176) (1991); Esposito, et al. , Nucl. Acids Res. 25 (18): 3605 (1997). Many of these belong to the integrase family of recombinases (Argos, et al., EMBO J. 5: 433-440 (1986); Vozyyanov, et al., Nucl. Acids Res. 27: 930 (1999)). Perhaps the most studied of these is the Cre / loxP system derived from bacteriophage PI (Hoess and Abremski (1990) In Nucleic Acids and Molecular Biology, vol. 4. Eds .: Eckstein and Lillery: Berlinerp: Verlag; pp. 90-109), bacteriophage X-derived integrase / att system (Landy, A. Current Opinions in Genetics and Development. 3: 699-707 (1993)), and Saccharomyces cerevisiae 2μ circular plasmid-derived FLP / FRT system (Broach, et al., ell 29: a 227-234 (1982)).

  Deleting nucleic acid regions once inserted into the genome by homologous recombination by using the Cre-loxP system, which combines cell type-specific expression of Cre recombinase with site-specific recombination of Cre-loxP. Can do. In the mutagenesis method using Cre-loxP, a nucleic acid sequence such as a selection marker (for example, a hygromycin gene) is introduced at a position that does not inhibit the expression of the target gene, and the loxP sequence is inserted so as to sandwich the sequence to be deleted later. The targeting vector is introduced into the cell and then the homologous recombinant is isolated. Next, when the site-specific recombination enzyme Cre derived from Escherichia coli P1 phage is specifically expressed under specific conditions, the gene is deleted only in cells expressing Cre (here, Cre is a loxP sequence). (About 34 bp) is specifically recognized and recombination occurs between the two loxP sequences, and the nucleic acid sequence between them is deleted). This recombination system is typically a Cre / loxP system that uses Cre recombinase as a site-specific recombinase and loxP as a site-specific recombination enzyme recognition sequence, but is not limited thereto. As described above, recombinant systems derived from various organisms can be used. This site-specific recombination enzyme may be contained in the nucleic acid for homologous recombination of the present invention or may not be contained in the nucleic acid for homologous recombination (for example, may be supplied by a plasmid). ).

  In this specification, “recombinase” is also referred to as site-specific recombination enzyme, an enzyme that recognizes a specific sequence on DNA (for example, a sequence called loxP in the case of Cre recombinase) and promotes recombination of that portion. Say. Examples of the recombinase include Cre recombinase. In addition, examples of recombinases that can be used include F1p recombinase and R recombinase (Srivastava, V and Ow, D (2004) Trends Biotechnol 22: 627-629), φC31 (accession number NC_001978; GI : 40807285), but is not limited thereto.

As used herein, “recombinase recognition sequence” refers to a sequence recognized by at least one recombinase, and such a sequence is usually specific for a recombinase. Such a recognition sequence can be determined as follows: Southern hybridization analysis, DNA base sequence of PCR product, and the like. Examples of such recognition sequences include, but are not limited to, loxP sequences, FRT sites, RS sites, attB sequences, attP sequences, and res site sequences. Specific sequences of such recognition sequences are as follows:
The LoxP sequence ATAACTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO: 4).

  Such recombinase recognition sequences may include all of the above sequences, and may include one or more substitutions, additions and / or deletions to these sequences as long as they are recognized by the recombinase. good. Alternatively, another recombinase recognition sequence can be produced by screening with a recombinase and a library of arbitrary sequences under certain conditions.

  In this specification, “reverse direction” means that when a recombinase recognition sequence is used for a recombinase recognition sequence, a recombinase recognition sequence is placed on the other strand when the recombinase recognition sequence is placed on one side of the double-stranded DNA. Say. Preferably, substantially homologous sequences are arranged in 5 'to 3' orientation on one strand and 5 'to 3' orientation on the other strand. More preferably, the same sequence is arranged in the 5 'to 3' direction on one strand and in the 5 'to 3' direction on the other strand.

  As used herein, “expression-inducible recombinase gene” refers to a site-specific recombinant enzyme gene such as Cre that can control expression in various chemical induction systems such as Dexamethasone, Tetracycline, Ecdysone, Estradiol, Ethanol, and Copper. . Instead of a chemical induction promoter (Padidam, M (2003) Curr. Opin. Plant Biol. 6: 169-177), a heat shock promoter or the like is connected to induce expression of a site-specific recombinase gene by heat shock. It is also possible to make it.

  Introducing point mutations herein is the conventional site-directed mutagenesis method (Kunkel, A. (1985) Proc. Natl. Acad. Sci. USA 82: 448-492; Ke, S.-H. and Madison. E.L. (1997) Nucleic Acids Res.25: 3371-3372), a double-stranded oligonucleotide having a homologous base sequence of about 50 bases on both sides of the target point mutation was synthesized. (Muyers, JP, et al., (2001) Trend Biochem. Sci. 26: 325-331).

(General biochemistry / molecular biology)
(General technology)
Molecular biological techniques, biochemical techniques, and microbiological techniques used in this specification are well known and commonly used in the art, and are described in, for example, Sambrook J. et al. et
al. (1989). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor and its 3rd Ed. (2001); Ausubel, F .; M.M. (1987). Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Ausubel, F .; M.M. (1989). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associate ES and Wiley-Interscience; A. (1990). PCR Protocols: A Guide to Methods and Applications, Academic Press; Ausubel, F .; M.M. (1992). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Ausubel, F .; M.M. (1995). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Innis, M .; A. et al. (1995). PCR Strategies, Academic Press; Ausubel, F .; M.M. (1999). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, and annual updates; J. et al. et al. (1999). PCR Applications: Protocols for Functional Genomics, Academic Press, “Experimental Methods for Gene Transfer & Expression Analysis”, Yodosha, 1997, etc., which are related in this specification (may be all) Is incorporated by reference.

  For DNA synthesis technology and nucleic acid chemistry for producing artificially synthesized genes, see, for example, Gait, M. et al. J. et al. (1985). Oligonucleotide Synthesis: A Practical Approach, IRLPpress; Gait, M .; J. et al. (1990). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Eckstein, F .; (1991). Oligonucleotides and Analogues: A Practical Approach, IRL Press; Adams, R .; L. etal. (1992). The Biochemistry of the Nucleic Acids, Chapman &Hall; Shabarova, Z. et al. et al. (1994). Advanced Organic Chemistry of Nucleic Acids, Weinheim; Blackburn, G .; M.M. et al. (1996). Nucleic Acids in Chemistry and Biology, Oxford University Press; Hermanson, G .; T.A. (I996). Bioconjugate Technologies, Academic Press, etc., which are incorporated herein by reference in the relevant part.

  References such as scientific literature, patents and patent applications cited herein are hereby incorporated by reference in their entirety to the same extent as if each was specifically described.

  The present invention has been described with reference to the preferred embodiments for easy understanding. In the following, the present invention will be described based on examples, but the above description and the following examples are provided only for the purpose of illustration, not for the purpose of limiting the present invention. Accordingly, the scope of the present invention is not limited to the embodiments or examples specifically described in this specification, but is limited only by the scope of the claims.

  The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to the following examples.

(General example)
In the following description, the case of targeting the Adh2 gene is described, but the target of the method of the present invention is not limited to the Adh2 gene. In the case of targeting other genes, those skilled in the art can easily carry out the method of the present invention by appropriately modifying the conditions described below.

(Preparation of nucleic acid)
General nucleic acid preparation methods, including plasmid preparation, plant DNA and RNA preparation, PCR and RT-PCR amplification, and Southern blot and DNA sequencing analysis are described in Terada R et al. (2002) Nature Biotechnol 20: 1030-1034; R et al. (2004) Plant Cell Rep 22: 653-659; and Morita Y et al. (2005) Plant J 42: 353-363. To detect an approximately 1.5 kb Adh gene transcript that retains the complete coding region, SuperScript III reverse transcriptase (Invitrogen) was used to synthesize the first cDNA strand and RT2-F / RT2- Adh2 was PCR amplified with Ex Taq polymerase (Takara Biomedicals) using R (SEQ ID NOs: 16 and 17, respectively). Ubiquitin (D12629), a constitutively expressed gene, was used as an internal control for RT-PCR along with Ubiq-F / Ubiq-R. The primers used for PCR and RT-PCR are shown in Table 1 below.

To construct the pJHYAAd2 vector for targeting Adh2, a 6.2 kb fragment containing the Adh2 promoter was cultivated by PCR amplification using primers F1 and R1 using LA Taq polymerase (Takara Biomedicals) (Nipponbare) genome (Morita Y et al. (2005) Plant J 42: 353-363; Terada R et al. (2002) Nature Biotechnol 20: 1030-1034). PCR conditions were as follows:
First denaturation (94 ° C. for 1 minute);
Denaturation (98 ° C for 10 seconds), annealing and extension (58 ° C for 15 minutes), 16 cycles; then denaturation (98 ° C for 10 seconds), annealing and extension (58 ° C for 15 minutes, 15 seconds per cycle) Automatically add), 19 cycles;
Final extension (10 min at 72 ° C).
Similarly, a 6.0 kb fragment containing the coding region of Adh2 was also amplified by PCR using primers F2 and R2. PCR conditions were as follows:
First denaturation (94 ° C. for 1 minute);
Denaturation (98 ° C. for 10 seconds), annealing and extension (62 ° C. for 15 minutes), 16 cycles; then denaturation (98 ° C. for 10 seconds), annealing and extension (62 ° C. for 15 minutes, 15 seconds per cycle Automatically add), 19 cycles;
Final extension (10 min at 72 ° C).
The resulting fragments were first cloned individually into the vector pCR-XL-TOPO (Invitrogen) and then re-cloned into the targeting backbone vector pINA134 (Terada R et al. (2002) Nature Biotechnol 20: 1030-1034). PJHYAd2 was obtained. A 7.0 kb fragment containing the Adh2 promoter was also amplified with LA Taq polymerase using primers F3 and R1. PCR conditions were as follows:
First denaturation (94 ° C. for 1 minute);
Denaturation (98 ° C. for 10 seconds), annealing and extension (68.1 ° C. for 15 minutes), 16 cycles; then denaturation (98 ° C. for 10 seconds), annealing and extension (68.1 ° C. for 15 minutes, 1 cycle) Automatically add 15 seconds per) 19 cycles; final extension (10 minutes at 72 ° C.).
This fragment was cloned into pCR-XL-TOPO and then cloned back into pINA134 to generate pJHYAd2Ct5. This was used with primers F4 and R4 to generate a reliable 5 'ligation fragment in PCR screening.

(Plant transformation)
The Agrobacterium-mediated rice (Oryza sativa) transformation method is the same as previously described (Terada R et al. (2002) Nature Biotechnol).
20: 1030-1034) with the following modifications. Embryogenic callus for transformation was obtained from rice, Oriza sativa L. et al. Subspecies, japonica cv. Prepared from about 1000 to 2000 mature seeds of Nipponbare. After co-culture with Agrobacterium, vancomycin (200 mg / L) was used for washing to remove Agrobacterium (Sallaud C et al. (2003) Theor Appl Gene 106: 1396-1408). Cephatoxim (400 mg / L) and vancomycin (100 mg / L) were continuously used in 2N6-CH medium selection with hygromycin B (50 mg / L) (Terada R et al. (2002) Nature.
Biotechnol 20: 1030-1034).

To detect a 6.4 kb 5 ′ ligation fragment containing the Adh2 promoter, PCR amplification was performed with primers F4 and R4 using LA Taq polymerase and equimolar pJHYAd2Ct5 mimicking the heterozygous state. Nipponbare DNA was used as a control DNA sample. The cycle of this PCR reaction was as follows:
First denaturation (94 ° C. for 1 minute);
Denaturation (98 ° C for 10 seconds), annealing and elongation (63.5 ° C for 15 minutes), 15 cycles; then denaturation (98 ° C for 10 seconds), annealing and elongation (63.5 ° C for 15 minutes, 1 cycle) Automatically add 15 seconds per), 19 cycles;
Final extension (10 min at 72 ° C).
PCR analysis was performed using primers F5 and R5 for detection of the 6.8 kb 3 ′ ligation fragment containing the Adh2 coding region. The PCR conditions were as follows:
First denaturation (94 ° C. for 1 minute);
Denaturation (98 ° C. for 10 seconds), annealing and extension (66.5 ° C. for 15 minutes), 16 cycles; then denaturation (98 ° C. for 10 seconds), annealing and extension (66.5 ° C. for 15 minutes, 1 cycle) Automatically add 15 seconds per), 19 cycles;
Final extension (10 min at 72 ° C).
In order to confirm that these 6.4 kb and 6.8 kb fragments correspond to the expected 5 'and 3' ligated fragments, respectively, both ends of these PCR amplified fragments were directly sequenced.

  Contains MS medium basic salts and vitamins, sucrose (30 g / L), sorbitol (30 g / L), NAA (1 mg / L), BAP (2 mg / L), and 0.8% agarose type I (Sigma) MSRE medium was routinely used to regenerate large numbers of shoots from callus (Terada R et al. (2002) Nature Biotechnol 20: 1030-1034). A modified MSRE medium containing a small amount (1/4 of normal MSRE medium) of inorganic salts and vitamins, plus IAA (1 mg / L) and Zeatin (0.5 mg / L) in order to gently regenerate callus It was used. From the targeted callus, more than 20 transgenic plants are routinely regenerated from a large number of shoots (Terada R et al. (2002) Nature Biotechnol 20: 1030-1034), and this regenerant regenerates the adh2 :: hpt allele. To confirm inclusion, it was subjected to PCR analysis to detect 5 'and 3' linked fragments. As expected, most regenerants harbored the adh2 :: hpt allele, from which transgenic plants were selected for further analysis. To test the Adh2 genotype in T1 isolates, 1.3 kb and 5.0 kb fragments for the Adh2 and adh2 :: hpt alleles, respectively, were confirmed by PCR amplification with primers F6 and R6.

(Example 1: Design of nucleic acid for homologous recombination)
An outline of the nucleic acid for homologous recombination of the present invention is shown in FIG. 2A. The present inventors selected the rice Adh2 gene as a target gene into which mutations were introduced in this study. The adh2 mutation has not been reported so far. There is a highly repetitive copier-like sequence 1.0 kb downstream of Adh2. The Adh2 gene is located between the Adh1 gene and the Adh3 gene in the genome, and all Adh genes are remarkably expressed in rice callus. In this example, the method of the present invention was applied to the rice Adh2 gene. However, the targeted gene is not limited to the rice Adh2 gene, and any gene of any organism can be targeted. Those skilled in the art will readily recognize. The nucleic acid used in this example was prepared as described above.

  The Adh2 gene into which a plurality of point mutations was introduced was prepared by PCR amplification. When amplifying DNA by PCR, it is known that Taq polymerase used often causes amplification errors (hereinafter referred to as PCR errors) of base sequences (several places per 1 kb). Since the 6.2 kb fragment containing the Adh2 promoter and the 6.0 kb fragment containing the coding region of Adh2 are each PCR amplified using genomic DNA as a template, there may be PCR errors in each fragment. Each amplified fragment was cloned into pCR-XL-TOPO, and then its nucleotide sequence was determined. As a result, it was found that 12 base substitutions were introduced into the 6.2 kb fragment containing the Adh2 promoter, and 7 base substitutions were introduced into the 6.0 kb fragment containing the Adh2 coding region. Using these fragments, a target vector pJHYAd2 (nucleic acid for homologous recombination) was prepared as follows.

The positive selection marker gene hpt for hygromycin B resistance (Hm ^r ) contains a 6.2 kb Adh2 promoter containing a 0.1 kb 5 ′ untranslated region and a 2.0 kb 3 ′ portion of the adjacent copier-like sequence. It was placed between the 4.0 kb Adh2 gene. The diphtheria toxin protein A chain gene (DT-A), which is a negative selection marker, was placed next to the border sequence at both ends of the T-DNA in order to efficiently eliminate random insertion at the border (negative selection). . See FIG. 2A for the nucleic acid for homologous recombination.

(Example 2 Production and Isolation of Homologous Recombinant)
Using the nucleic acid pJHYAd2 for homologous recombination prepared in Example 1, rice was transformed as described above (Plant transformation). Using pJHYAd2, 9 viable callus could be obtained by positive-negative selection.

  First, in order to screen for homologous recombination callus in which Adh2 has not been modified by homologous recombination, it is first determined whether or not a 6.4 kb 5 ′ ligation fragment containing the Adh2 promoter can be detected using primers F4 and R4. PCR using primers F5 and R5 to determine if there is also a 6.8 kb 3 'ligation fragment containing the Adh2 coding region in the callus that was tested by PCR analysis used and then confirmed to be 5' ligation fragment Tested by analysis (see Figure 3). All nine calli in which 5 'linked fragments were detected were confirmed to contain 3' linked fragments. In order to confirm that these 6.4 kb and 6.8 kb fragments correspond to the predicted 5 'and 3' ligated fragments, respectively, both ends of these PCR amplified fragments were sequenced. All sequenced PCR amplified fragments were shown to be predicted ligation fragments, confirming that the expected homologous recombination occurred in all nine calli. We further analyzed by PCR whether 3 'linked fragments could be detected in the remaining 459 viable callus and confirmed that they all did not produce a 6.8 kb fragment. From the above, nine calli in which the desired homologous recombination occurred were isolated.

(Example 3) Identification of base substitution introduced by homologous recombination
A PCR-amplified 6.4 kb 5 ′ ligation fragment containing the Adh2 promoter and a 6.8 kb 3 ′ ligation fragment containing the Adh2 coding region were obtained from each callus isolated in Example 2 under the conditions described above. The entire base sequence of the fragments was determined.

  The result is shown in FIG. As shown in FIG. 4, in nine calli, homologous recombinants of group A in which all point mutations of three groups: S1 to S19 have been introduced; Remaining (no base substitution introduced downstream from S15), group B homologous recombinants; and S1-S19 have wild-type sequences and base substitutions nested (S1- Group C homologous recombinants were observed, in which base substitutions were introduced at various points in S19). Here, in groups A, B, and C in FIG. 4, V indicates that the mutation is inserted, and G indicates that the mutation is not inserted and the plant cell genomic region remains. As is apparent from the results of FIG. 4, eight types of homologous recombinants were obtained by the method of the present invention using a single nucleic acid pJHYAd2 for homologous recombination.

(Example 4) Construction of nucleic acid for homologous recombination incorporating an inducible Cre gene
Nucleic acid for homologous recombination incorporating an inducible Cre gene that allows recombinase Cre to be expressed and eliminates the step of removing a positive selection marker, enabling more efficient mutagenesis (see FIG. 5) Was built.

  Specifically, a nucleic acid for homologous recombination (hereinafter referred to as pKIN7) incorporating the inducible Cre gene was prepared as follows. The underlying vector is pINA134. pKIN7 has a DNA fragment (pAct-XVE-tE9) for chemically inducing Cre gene using pBIMFN-derived Estradiol to pINA134, a DNA fragment (OLexA- Cre-tNos) is incorporated. The construction method is the λRed system (M.-K. Chaveroche et al., (2000) A rapid method for efficient gene replacement in the filamentous fungus Aspergillus. al., (2001) Technologies: Recombinative engineering-new options for cloning and manipulating DNA. See Trend Biochem. Sci., 26: 325-331).

(Step 1)
Unnecessary parts (pNOS-hpt-tNos) were removed from pBIMFN using the λRed system. Primer ZeoF (having homology to tE9) and ZeoR (homologous to OLexA) having a homology of 50 bp respectively to tE9 and OLexA on pBIMFN using pCR-BluntII-TOPO (Invitrogen) having a zeocin resistance gene (ZeocinR) as a template The DNA fragment having 50 bp homology with tE9 and OLexA on both sides of the zeocin resistance gene was prepared. In FIG. 6, the hatched portion indicates a 50 bp homologous region. Using the λRed system, recombination was carried out in E. coli between this fragment and pBIMFN, and an unnecessary part (pNOS-hpt-tNos) was replaced with a zeocin resistance gene and deleted to prepare a pBIMFN / hpt deleted plasmid.

(Step 2)
Only the necessary part (from pAct to tNos) from pBIMFN was cloned into pBluescript II (Stratagene). PCR was performed using pBluescript II as a template and primers pBl-F and pBl-R. In pBl-F, a 60 bp region having homology with pAct on pBIMFN (indicated by a gray square in FIG. 6) and a 40 bp region having homology with the lox region of pINA134 described later (in FIG. 6). Are represented by diagonal lines and triangles). In addition, pB1-R has a 60 bp region having homology with tNos on pBIMFN (indicated by a gray square in FIG. 6) and a 40 bp region having homology with pACT of pINA134 described later (in FIG. 6). Is represented by diagonal lines and pA). In the DNA fragment prepared by PCR, a region having homology with pBIMFN (gray region in FIG. 6) is first present on both sides of the pBluescript II sequence, and further, a region having homology with pINA134 (FIG. 6). The hatched portion in FIG. Using this DNA fragment and the pBIMFN / hpt deleted plasmid prepared in Step 1, recombination was caused in Escherichia coli using the λRed system to prepare a pBluescript II / hpt deleted plasmid.

(Step 3)
Induction type Cre was introduced into pINA134. The pBluescript II / hpt deleted plasmid obtained in Step 2 was digested with restriction enzymes SpeI and NotI to obtain a DNA fragment shown in FIG. Using this fragment and pINA134, recombination was caused in E. coli by the λRed system to prepare a pKIN6 plasmid.

(Step 4)
An unnecessary zeocin resistance gene was removed from pKIN6. The DNA fragment used was a 120-mer artificially synthesized oligonucleotide, and two oligonucleotides designed to continuously connect tE9 and OLexA, a sense strand and an antisense strand, were prepared. These two types of oligonucleotides were annealed to form double-stranded DNA (indicated by the hatched portion in FIG. 6), and recombination was caused in E. coli using the λRed system together with pKIN6 to prepare pKIN7. The following are the primer sequences used in the process of making pKIN7:
ZeoF 5 ′ TGAAACTGAAGGCGGGAAACGACAATCTGATCATAGAGCGGAGAATTAAGGATTATTACAGCTTACAATTTT 3 ′ (SEQ ID NO: 20)
ZeoR 5'TGTACAGTACGTCGAGGGGATGATAATGCGATTAGTTTTTTAGCCTCGACGATCTTCACCTAGATCCCTTT 3 '(SEQ ID NO: 21)
pB1-F 5'GTTTATTTTTGGAACTATCCCCGAACTCTCTTCTCAGAGCATATGAATGACCTCGATCGAGAACTACTCGTATAGCATACATTATACGAAGTATGCCCCGGGCAAGCACTAGTGGATCCCCCGG 3 '(SEQ ID NO: 22)
pBl-R 5'GCCGCGCAAATACTAGGATAAAATTATCGCGCGCGGTGTTCATCTATGTTACTAGATCCGTACAATTGGTCAAAAGTGAAAACATCATGTTAAAAGGTGGTAAAAGTGCGGCCGCCACCGCGGG
Sense strand oligonucleotide 5'CAAACAAGCTTTGAAACTGAAGGCGGGAAACGACAATCTGATCATGAGCGGAGAATTAAGGGTCGAGGCTAAAAAAACTATACGCATTATCATCCCCCTCGACGTACTGTTACATAACCACT 3 '(SEQ ID NO: 24)
Antisense Strand Oligonucleotide 5'AGTGGTTATATGTACAGTACCGTCGAGGGGGATGATAATGCGATTTAGTTTTTAGCTCTCGACCCTTAATTTCCCGCCTCATGTCCAGATTGTTCGTTCTCGTTTCAAGCTTGTTTG No. 3

(Production of homologous recombinants using pKIN7)
A first homology region and a second homology region having homology with the target gene are introduced into pKIN7. Subsequently, a plurality of arbitrary point mutations are introduced into the first homologous region and the second homologous region to complete a mutation introducing vector (pKIN8) which is a nucleic acid for homologous recombination in the present invention. Gene targeting is performed using pKIN8 to obtain at least two homologous recombinants having different genomic sequences. Thereafter, in the step of regenerating an individual from the recombinant, expression of the Cre gene is induced by estradiol, and site-specific recombination is caused at two Lox sites to produce an individual having only the mutation in the genome.

(Example 5) Removal of positive marker by Cre enzyme from homologous recombinant introduced with point mutation Plant in which expression of Cre as recombinase was induced and base substitution was introduced into Adh2 gene obtained in Example 3 The vector pCre-Km for removing the positive selection marker was constructed as follows: As shown in Fig. 7, the ORF part of the HPT gene of the pBIMFN vector was obtained using the λRed system (see Example 4). (See) and replaced with the NPTII gene.

  From the progeny progeny of the plant in which base substitution was introduced into the Adh2 gene obtained in Example 3, the next generation in which the Adh2 gene was modified homozygously was obtained. Among these, a pCre-Km vector for expressing an inducible Cre gene that can induce callus from seeds that were further propagated from the # 6 line and adding estradiol to the medium. Introduced by Agrobacterium. The structure of the pCre-Km vector is shown in FIGS. In order to isolate transformed calli, selection was performed for about 1 month in a selection medium supplemented with paromomycin (40 mg / l), and transformed callus exhibiting paromomycin resistance was isolated. Further, the obtained callus was placed in a plant regeneration medium containing 2.0 μM and 4.0 μM estradiol for 14 days to induce Cre gene expression, and then the callus was transferred to a regeneration medium not containing estradiol. Analyzed by PCR. By a Cre enzyme induced by addition of estradiol, a positive selection marker (HPT gene) sandwiched between lox sequences in the Adh2 gene region and a sequence (induction) sandwiched between lox sequences in the pCre-Km region introduced into the genome Type Cre gene and NPTII gene) should be deleted from the genome. Transformed plants in which removal of the two regions occurred were selected by PCR as follows.

Removal of HPT gene from Adh2 region (PCR-Adh2)
First denaturation (94 ° C. for 1 minute);
30 cycles of denaturation (94 ° C. for 30 seconds), annealing (61.4 ° C. for 30 seconds), extension (72 ° C. for 2 minutes);
Final extension (10 min at 72 ° C).
Primer; Adh2F: 5′-GAGAGAAGAAAAAGGCCATCCATCC-3 ′ (SEQ ID NO: 26)
Adh2R: 5′-TGCACAATTGGGACACTTGGGTAGATTTTCTTT-3 ′ (SEQ ID NO: 27)
Removal of NPTII gene and inducible Cre gene from pCre-Km region (PCR-Cre)
First denaturation (94 ° C. for 1 minute);
30 cycles of denaturation (94 ° C for 30 seconds), annealing (55 ° C for 30 seconds), extension (72 ° C for 1 minute);
Final extension (10 min at 72 ° C).
Primer; Cre-F: 5′-AACTGACAACCGCCAACGTTGAAGGATCC-3 ′ (SEQ ID NO: 28)
Cre-R: 5′-TAACACATTGCGGACGTTTTTAAGTTACTG-3 ′ (SEQ ID NO: 29)

  Genomic DNA was extracted from the plant where it was revealed that the sequence between the lox sequences was removed from both regions by the above two types of PCR, and the structure of the Adh2 gene region was analyzed by the Southern method. It was confirmed that removal of the HPT gene occurred from both Adh2 regions of the two chromosomes (FIG. 9). Further, when the nucleotide sequences of the Adh2 regions of these plants were determined, it was also revealed that point mutations as shown in FIGS. 8 and 4 were introduced. That is, in this example, the present inventors removed the positive marker (HPT gene) when selecting a homologous recombinant by inducing the expression of the Cre gene, and efficiently introduced it by homologous recombination. It was shown that point mutations could be left in the plant genome. Furthermore, from this result, it was constructed not only in the case of multiple homologous recombination as in the prior art but also in the present example without performing the transformation twice as in Example 3 or Example 6. By using a vector, it is clear that the original purpose can be achieved more easily by one transformation.

(Example 6: Introduction of mutation using variety Kinnan style)
Whether rice varieties other than the cultivar Nipponbare could obtain the same results was examined using the cultivar Kinnamaze. The base substitution pattern shown in FIG. 4 is the result obtained by introducing the nucleic acid pJHYAd2 for homologous recombination into the cultivar Nipponbare whose detailed genome sequence was analyzed. The procedure described in Example 2 and Example 3 was repeated using the cultivar Kinnan style instead of the cultivar Nipponbare, and the result of FIG. 10 was obtained. From this result, it is clear that the present invention has universality across species.

(Example 7) Production of marker-free rice from which the introduced pCre-Km vector was isolated
The plant obtained in Example 5 in which a point mutation is introduced into the Adh2 gene region and the hygromycin resistance gene, which is a positive marker for gene targeting, has been removed by Cre / lox site-specific recombination, There is a possibility that the T-DNA fragment of the pCre-Km vector introduced later and the sequence of the T-DNA region remain (FIG. 11). The remaining T-DNA sequence inserted into the genome randomly was not only the two border sequences and lox sequences (FIG. 11B) shown in the PCR fragment of Example 6, but also because NPTII did not cause site-specific recombination. It is considered that there is a T-DNA region (FIG. 11C) having a gene region and the like. Therefore, the next generation of the plant from which the positive marker was removed from within the Adh2 gene region was obtained, and an attempt was made to obtain a plant in which the sequences of all T-DNA fragments of pCre-Km introduced by separation did not remain at all ( FIG. 11). As shown in FIG. 12, the next generation obtained by the Southern method using the NPTII gene as a selection marker in the T-DNA region of pCre-Km and the MCS site near the border sequence of T-DNA as a probe ( The genome of (T1 generation) was analyzed. In # 1 and # 14 of FIG. 12, the signal of the Southern method cannot be obtained by using either NPTII or MCS probe, so it is clear that no extra T-DNA fragment is contained. Furthermore, it was confirmed by determining the base sequence that a point mutation was introduced into the Adh2 gene in the genome of these individuals as shown in FIG. That is, a complete marker-free rice was produced in which the genomic region other than the point mutation and lox sequence in the Adh2 gene was the same as the wild type, and did not contain any T-DNA-derived sequences or selected marker gene sequences. As a result, the target point mutation can be introduced into any genome very efficiently, and the extra marker genes can be removed. As a result, only the target point mutation can be introduced into any gene. It showed that.

(Example 8) Expression analysis of Adh2 gene introduced with point mutation in marker-free plant
Using the complete marker-free plant obtained in Example 7, expression analysis of the Adh2 gene into which a point mutation was introduced was performed. RNA was extracted from the roots and leaves of plants 2 weeks after sowing, and the expression of the Adh2 gene was analyzed by RT-PCR using primers (Adh2cd-F and Adh2cd-R) that specifically amplified the Adh2 transcript. As shown in FIG. 13, even in an individual into which a point mutation was introduced, expression of the Adh2 gene almost identical to that of the wild type was confirmed in the root. In addition, transcripts slightly longer than the wild type were obtained in the individuals into which the mutation was introduced. When the nucleotide sequence of the obtained transcript was determined, this difference was because one lox sequence remained in the Adh2 gene region, and the lox sequence was also transcribed, and the other regions were not different from the wild type. There was found. Furthermore, almost no Adh2 transcript was detected in the leaves as in the wild type, and it was found that even if the lox sequence was inserted, it did not significantly affect the tissue-specific expression of the Adh2 gene. Therefore, when a point mutation was introduced by gene targeting, the positive marker gene was removed by site-specific recombination from a plant that was a knockout mutation in which no expression of the target gene was observed, and the lox sequence was then transcribed. Even if it remains in the region, it was shown that transcription equivalent to that of the wild type can be recovered, and that the introduced point mutations can be utilized and functional analysis is possible.

Detection of Adh2 transcript (RT-PCR)
First denaturation (94 ° C. for 1 minute);
32 cycles of denaturation (94 ° C. for 30 seconds), annealing (55 ° C. for 30 seconds), extension (72 ° C. for 2 minutes);
Final extension (10 min at 72 ° C)
Primer; Adh2cd-F: 5′-GCAACGAACTGCCGAGTGATTC-3 ′ (SEQ ID NO: 30)
Adh2cd-R: 5′-TCTCATCCATTTTTGCTTTCA-3 ′ (SEQ ID NO: 31)
Detection of ubiquitin gene transcripts (control experiment)
First denaturation (94 ° C. for 1 minute);
27 cycles of denaturation (94 ° C. for 30 seconds), annealing (55 ° C. for 30 seconds), extension (72 ° C. for 2 minutes);
Final extension (10 min at 72 ° C)
Primer; Ubi-F: 5′-CCAGGACAAGATGATCTGCC-3 ′ (SEQ ID NO: 32)
Ubi-R: 5′-AAGAAGCTGAAGCATCCAGC-3 ′ (SEQ ID NO: 33)

  As mentioned above, although this invention has been illustrated using preferable embodiment of this invention, this invention should not be limited and limited to this embodiment. It is understood that the scope of the present invention should be construed only by the claims. It is understood that those skilled in the art can implement an equivalent range based on the description of the present invention and the common general technical knowledge from the description of specific preferred embodiments of the present invention.

FIG. 1A shows a model diagram of homologous recombination in the high-efficiency mutagenesis method of the present invention, and (i) SDSA (synthesis-dependent strand-annealing) is a thick arrow. The indicated newly synthesized DNA strands are hybridized (annealing), and a recombinant is formed by DNA synthesis and ligation. The single-stranded T-DNA for homologous recombination introduced into the nucleus of the plant acts as an intermediate for homologous recombination, and the 3 ′ end of the single-stranded T-DNA becomes the homologous region of the target gene region genomic DNA of the plant. Invasion occurs, and the homologous recombination process proceeds as shown in (i) or (ii). In (i), the genomic DNA in the homologous region of the single-stranded T-DNA derived from the vector forms a heteroduplex DNA by branch migration. This branch point movement stops at the beginning of the non-homologous region of the positive selection marker gene, but the single-stranded T-DNA is cleaved, and its 3 ′ end re-enters the genomic DNA to re-branch the branch point. This is a pathway in which heteroduplex DNA is formed by migration, and homologous recombination occurs through an SDSA process in which newly synthesized single-stranded DNA fragments associate with each other. In this case, various (two or more) combinations of recombinants are generated in the process of repairing the resulting heteroduplex DNA, and recombinants having frequently nested sequences are also generated. On the other hand, in the case of (ii), since DNA is synthesized using a single-stranded homologous region on T-DNA as a template, not only mutation (substitution, insertion, and deletion) of several bases but also about 1 to 2 kb Relatively large substitutions, insertions, and deletions can be efficiently transferred from the vector to the genome. Therefore, recombination takes place with high efficiency even with sequences on a vector having a non-homologous region, which is difficult with conventional homologous recombination, and this point is also mediated by T-DNA. This is a feature of this recombination mechanism. FIG. 1B shows a model diagram of homologous recombination in the conventional knock-in method. In this case as well, there is a possibility that heteroduplex DNA is generated at the end, and the end can be a vector-derived sequence or a plant genome-derived sequence by a repair mechanism, but the sequence is not nested. FIG. 2A shows an outline of the highly efficient mutagenesis method of the present invention. The description of each part is described in the lower part of the figure. FIG. 2B shows an outline of the conventional knock-in method. The description of each part is described in the lower part of the figure. FIG. 3A shows the genomic structure of the Adh locus. FIG. 3B shows the structure of homologous recombination nucleic acid pJHYAd2 used in one embodiment of the present invention. FIG. 3C shows the structure of the Adh2 gene modified by the method of the present invention. The horizontal line below the map and the small arrow adjacent to it indicate PCR fragments and primers, respectively. Copier-like indicates a copier-like sequence. FIG. 4 shows the pattern of base substitution introduced in each callus isolated in Example 2. In groups A, B and C, V indicates that the mutation is inserted, and G indicates that the mutation is not inserted and the plant cell genomic region remains. FIG. 5 shows an outline of a nucleic acid for homologous recombination incorporating inducible Cre. Using the nucleic acid for homologous recombination, the method of the present invention is carried out, and then expression of the Cre gene is induced to introduce base substitution. Explanation of each site in the nucleic acid for homologous recombination is described in the lower part of the figure. FIG. 6 shows the construction and structure of pKIN7, a nucleic acid for homologous recombination that incorporates inducible Cre. FIG. 7 shows the construction and structure of a pCre-Km vector for supplying Cre enzyme to trans. FIG. 8 shows an outline of the fifth embodiment. The structure of the pCre-Km vector is shown on the right side of the downward arrow. On the left side, a region that is sandwiched between the lox sequences and can be removed by the action of the Cre gene is schematically shown. A black circle in the map of the Adh2 gene region indicates that a vector-derived base substitution has occurred, and a white circle indicates that the plant genome sequence is retained. The horizontal line below the map and the adjacent arrow indicate the PCR fragment and primer, respectively. FIG. 9 shows the results of the Southern method (A). The plants used were two individuals regenerated from calli obtained independently, indicated by 1 and 2, respectively. WT indicates a non-transformed Nipponbare individual, and GT indicates an individual in which the Adh2 gene region is homozygous and has been modified by homologous recombination (targeting), which is not transformed with pCre-Km. All genomes were treated with restriction enzymes with KpnI. The probe used is 3'U in the downstream region of the Adh2 gene (see FIG. 9B). The size of the band obtained by the Southern method is shown in B. Type a indicates a wild type allele and a 15 kb band is obtained. Type i indicates a target type allele, and a band of 7.6 kb is obtained. Type W indicates an allele from which the target HPT gene has been deleted, and a band of 11 kb is obtained. K * represents a new KpnI site created by a point mutation introduced by homologous recombination. FIG. 10 shows the pattern of base substitution introduced in callus isolated using cultivar Kinnankaze. Vector-derived point mutations are indicated by black circles (●), and genomic sequences are indicated by white circles (○). It should be noted that one more polymorphism (PK) was found in the Adh2 gene region in the cultivar Kinnankaze compared to the cultivar Nipponbare. A strategy for obtaining a complete marker-free individual is schematically shown. The genome of an individual obtained by site-specific recombination is not only recombined in addition to the Adh2 gene (A) having a point mutation but also a fragment (B) in which site-specific recombination has occurred in T-DNA. There may be a fragment (C) where no occurrence occurred. In order to obtain an individual that does not contain the T-DNA fragment of pCre-Km introduced later, the obtained recombinant was self-bred to obtain the T1 next generation. Three examples of genome structures that are considered to be separated are shown. The individual shown in the center is the complete marker-free individual of interest. Marker free individuals were detected by Southern method. The regions where NPTII and MCS probe can hybridize are shown as “NPTII probe” and “MCS probe”, respectively. The MCS probe can detect both a fragment as shown in FIG. 11-B and a fragment as shown in FIG. 11C. Wild type Nipponbare (non-transformant) was used as the wild type. The individuals of # 1 and # 14 were found to be completely marker-free individuals because no signal was obtained using either probe. Using the # 1 and # 14 individuals shown in FIG. 12, the expression of the Adh2 gene was detected by RT-PCR. RNA was extracted from the roots and leaves of plants 2 weeks after sowing. Since the transcription product was observed in the same tissue as wild type Nipponbare (wild type), the expression of the Adh2 gene in the completely marker-free individual was eliminated by removing the HPT gene by site-specific recombination. Indicates recovery.

SEQ ID NO: 1 = nucleic acid sequence of Adh2 SEQ ID NO: 2 = amino acid sequence of Adh2 SEQ ID NO: 3 = plasmid pINA134
Sequence number 4 = loxP
SEQ ID NO: 5 = F1 primer SEQ ID NO: 6 = R1 primer SEQ ID NO: 7 = F2 primer SEQ ID NO: 8 = R2 primer SEQ ID NO: 9 = F3 primer SEQ ID NO: 10 = F4 primer SEQ ID NO: 11 = R4 primer SEQ ID NO: 12 = F5 primer SEQ ID NO 13 = R5 primer SEQ ID NO: 14 = F6 primer SEQ ID NO: 15 = R6 primer SEQ ID NO: 16 = RT2-F primer SEQ ID NO: 17 = RT2-R primer SEQ ID NO: 18 = Ubiq-F primer SEQ ID NO: 19 = Ubiq-R primer SEQ ID NO 20 = ZeoF primer SEQ ID NO: 21 = ZeoR primer SEQ ID NO: 22 = pB1-F primer SEQ ID NO: 23 = pB1-R primer SEQ ID NO: 24 = sense strand oligonucleotide SEQ ID NO: 25 = antisense strand oligonucleotide SEQ ID NO: 2 = Adh2F primer SEQ ID NO: 27 = Adh2R primer SEQ ID NO: 28 = Cre-F primer SEQ ID NO: 29 = Cre-R primer SEQ ID NO: 30 = Adh2cd-F primer SEQ ID NO: 31 = Adh2cd-R primer SEQ ID NO: 32 = Ubi-F primer sequence Number 33 = Ubi-R primer

Claims (24)

A method for preparing at least two or more homologous recombinants having different genomic sequences in a plant, comprising:
(A) introducing a nucleic acid for homologous recombination into a plant cell, and (b) culturing the plant cell into which the nucleic acid for homologous recombination has been introduced,
Including the method. The different genome sequence is a genome comprising at least two genomic regions derived from the nucleic acid for homologous recombination and at least one genomic region of the plant cell sandwiched between the genomic regions derived from the at least two nucleic acids for homologous recombination. The method of claim 1, comprising a region. The method according to claim 1, wherein the nucleic acid for homologous recombination is introduced into the plant cell by Agrobacterium. In a plant, a method for preparing at least two or more transgenic plants having different genomic sequences from regenerative plant cells, comprising:
(A) introducing a nucleic acid for homologous recombination into a plant cell;
(B) culturing the plant cell into which the nucleic acid for homologous recombination has been introduced, and (c) preparing a transgenic plant from the cultured cell,
Including the method. The different genome sequence is a genome comprising at least two genomic regions derived from the nucleic acid for homologous recombination and at least one genomic region of the plant cell sandwiched between the genomic regions derived from the at least two nucleic acids for homologous recombination. 4. The method of claim 3, comprising a region. The method according to claim 3, wherein the nucleic acid for homologous recombination is introduced into the plant cell by Agrobacterium. The nucleic acid for homologous recombination is as follows:
(1) a first homologous recombination region capable of hybridizing under stringent conditions to the first genomic region or its complementary strand;
(2) a second homologous recombination region capable of hybridizing under stringent conditions to the second genomic region or its complementary strand, and (3) the first region and the second region A positive selection marker,
Wherein the first region and the second region are at least two or more of the first genomic region or its complementary strand and the second genomic region or its complementary strand. The method according to claim 1, which has a mutation. The nucleic acid for homologous recombination is as follows:
(4) a first negative selection marker gene; and (5) a second negative selection marker gene,
The method according to claim 7, further comprising: 9. The method according to claim 8, wherein the first negative selection marker gene and the second negative selection marker gene are the same gene. The method according to claim 7, wherein the nucleic acid for homologous recombination further comprises (6) a site-specific recombinase (recombinase) recognition sequence upstream and downstream of the positive selection marker gene. The method according to claim 10, wherein the nucleic acid for homologous recombination further comprises (7) a site-specific recombinase (recombinase) gene capable of inducing expression. The method according to claim 7, wherein the positive selection marker gene is selected from the group consisting of a hygromycin resistance gene, a kanamycin resistance gene, a neomycin resistance gene and a drug resistance gene. 9. The method according to claim 8, wherein the negative selection marker gene is selected from the group consisting of diphtheria toxin protein A chain gene (DT-A), codA gene, cytochrome P-450 gene and barnase gene. The method according to claim 10, further comprising the step of expressing the site-specific recombinase to remove the positive selection marker gene from the plant cell. A composition for preparing at least two or more homologous recombinants having different genome sequences in a plant, comprising a nucleic acid for homologous recombination. The different genomic sequences are composed of at least two genomic regions derived from the nucleic acid for homologous recombination and at least one genomic region of the plant cell sandwiched between the genomic regions derived from the at least two nucleic acids for homologous recombination. 16. A composition according to claim 15, comprising a genomic region. The method according to claim 15, wherein the nucleic acid for homologous recombination is introduced into the plant by Agrobacterium. The nucleic acid for homologous recombination is as follows:
(1) a first homologous recombination region capable of hybridizing under stringent conditions to the first genomic region or its complementary strand;
(2) a second homologous recombination region capable of hybridizing under stringent conditions to the second genomic region or its complementary strand, and (3) the first region and the second region A positive selection marker,
Wherein the first region and the second region are at least two or more relative to the first genomic region or its complementary strand and the second genomic region or its complementary strand. 16. A composition according to claim 15 having a mutation. The nucleic acid for homologous recombination is as follows:
(4) a first negative selection marker gene; and (5) a second negative selection marker gene,
The composition according to claim 18, further comprising: 20. The composition according to claim 19, wherein the first negative selection marker gene and the second negative selection marker gene are the same gene. The composition according to claim 18, wherein the nucleic acid for homologous recombination further comprises (6) a site-specific recombinase (recombinase) recognition sequence upstream and downstream of the positive selection marker gene. The composition according to claim 21, wherein the nucleic acid for homologous recombination further comprises (7) a site-specific recombinase (recombinase) gene capable of inducing expression. The composition according to claim 18, wherein the positive selection marker gene is selected from the group consisting of a hygromycin resistance gene, a kanamycin resistance gene, a neomycin resistance gene and a drug resistance gene. 20. The composition according to claim 19, wherein the negative selection marker gene is selected from the group consisting of diphtheria toxin protein A chain gene (DT-A), codA gene, cytochrome P-450 gene and barnase gene.