JP2008249439A - Substrate for microarray and usage method therefor - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a substrate for a microarray capable of easy manufacturing, handling and usage of a small-sized microarray. <P>SOLUTION: The substrate for the microarray has characteristics wherein at least one or more array formation parts are arranged on the substrate, and each array formation part can be taken out individually from the substrate. In the substrate for the microarray, preferably, the area of each array formation part is 0.01-4 cm<SP>2</SP>, and a notch which is continuous except a part is formed penetrated through the substrate on the periphery of the array formation parts. In a usage method of the substrate for the microarray, after manufacturing an array on the array formation part by using the substrate for the microarray, the array formation part is separated from the substrate, to thereby manufacture the small-sized microarray. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

The present invention relates to a microarray substrate and a method for using the same.

  In recent years, various gene analysis techniques have been developed, and it has been spurred to elucidate life functions. If a database of gene polymorphisms that dynamically respond to various diseases in medicine can be constructed, it will be possible to identify target disease-related gene groups, and further develop new drugs through custom-made treatments and new drug designs. It is considered possible. Under these circumstances, microarrays that can perform very small-scale extraction, reaction, detection, etc., and the ability to simultaneously measure a large number of genes or a large number of samples, are the most powerful technologies for gene polymorphism analysis, such as microchips like DNA chips Chips are drawing attention.

  In recent years, DNA microarrays targeted at various fields such as medical treatment, food, and agriculture have been actively developed by comprehensive research on comprehensive expression analysis and gene polymorphism analysis. For example, Yast Oligo Chip 6K (manufactured by DNA Chip Laboratory Co., Ltd.) can be used. These targeted microarrays have fewer inspections than a comprehensive one and do not require the size of a conventional slide substrate. In other words, the slide substrate that is generally used at present is suitable for tens of thousands of types of inspections such as exhaustive analysis because of its size, but it is suitable for analysis that targets tens to hundreds of targets. Is inappropriate. Therefore, a microscale microarray that is smaller than the amount used for the comprehensive analysis has been developed. (See Non-Patent Document 1)

  By miniaturizing the microarray substrate, the reaction can be performed in a minute space, and the amount of reaction solution and the amount of sample per time can be suppressed. In addition, the temperature of the reaction solution can be easily controlled, and the temperature of the reaction on the solid surface can be controlled. This suggests that a precise temperature control device in a minute space such as a PCR reaction apparatus can be used, and the possibility of a DNA chip can be further expanded.

However, this small microarray substrate is difficult to handle due to its small shape compared to the shape of a conventional slide-type microarray substrate, etc., and the array positioning and fixing of the substrate in an array device generally used for microarray fabrication Is difficult. For this reason, it is impossible to produce an accurate array at present.
Satoshi Kuhara, Shinichi Sabae, Hiroaki Asaoka, "Technology and Application of DNA Chip Utilization", CMC Publishing, September 2006

  An object of the present invention is to provide a substrate for microarray that can easily produce, handle, and use a small microarray.

The present invention is as follows.
(1) A microarray substrate, wherein at least one array forming portion is arranged on the substrate, and the array forming portion can be individually taken out from the substrate. (2) The microarray substrate according to (1), wherein an area of the array forming portion is 0.01 to ⁴ cm ² .
(3) The microarray substrate according to (1) or (2), wherein perforated cuts are formed around the array forming portion.
(4) The microarray substrate according to (1) or (2), wherein a continuous notch is formed through the substrate leaving a part around the array forming portion.
(5) The microarray substrate according to (1) or (2), wherein a groove is formed around the array forming portion.
(6) The microphone array substrate according to (5), wherein the groove portion has a thickness of 0.05 to 0.5 mm.
(7) The microarray substrate according to any one of (1) to (6), wherein the substrate is made of plastic.
(8) The microarray substrate according to any one of (1) to (7), wherein the substrate is in the form of a slide glass or a film.
(9) Using the microarray substrate according to any one of (1) to (8), producing an array in the array forming unit, and then fabricating the small microarray by separating the array forming unit from the substrate. To use the microarray substrate.
(10) The method for using a microarray substrate according to (9), wherein the array is formed using an array production arrayer on a slide substrate and / or a multiwell plate substrate.
(11) The method for using the microarray substrate according to (9) or (10), wherein the formation of the array includes a step of fixing a substance that specifically captures a physiologically active substance to the array forming part.
(12) The method for using a microarray substrate according to (11), wherein the substance that specifically captures the physiologically active substance is at least one selected from a nucleic acid chain, a protein, a peptide, and a sugar chain.
(13) The method for using a microarray substrate according to (11), wherein the substance that specifically captures the physiologically active substance is a drug candidate substance.
(14) A small microarray produced using the microarray substrate according to any one of (1) to (8).
(15) A small microarray produced by the method of using the microarray substrate according to any one of (9) to (13).

  According to the microarray substrate of the present invention, a small microphone array can be easily produced, handled, and used.

Hereinafter, embodiments of the present invention will be described in detail.
FIG. 1 is an explanatory diagram of a microarray substrate according to an embodiment of the present invention. The microarray substrate 2 is a slide-type substrate, and a small microarray substrate 1 which is an array forming portion is arranged inside to form one slide.

At this time, one or more small microarray substrates 1 can be inserted into the microarray substrate 2, and in the embodiment of the present invention, the array forming portion shape dimension is 2 mm wide × 20 mm long, An example will be described in which nine slide substrates are set to be able to be taken. The area of the array forming part is preferably 0.01 to ⁴ cm ² .

  In addition, one side or both sides of the array forming unit 1 has a function of fixing DNA. Specifically, an aldehyde group can be chemically arranged on the surface and immobilized by reaction with an amino group of DNA. Further, PMBN (Japanese Patent Laid-Open No. 2006-187270, a first monomer having a 2-methacryloyloxyethyl phosphorylcholine (MPC) group and a second monomer having a p-nitrophenyloxycarbonyl polyethylene glycol methacrylate (NPMA) group And poly (MPC-co-BMA-co-NPMA)), which is a copolymer of a third monomer having a butyl metallate (BMA) group, on the surface of the substrate, the surface is activated. It can be immobilized by active ester groups. In addition to DNA, it may have a function capable of immobilizing physiologically active substances such as proteins, peptides, sugar chains, and lipids. Further, a substance that specifically captures these physiologically active substances may be immobilized.

The slide substrate 2 in FIG. 1 has a standard slide shape represented by a slide glass or the like, and has a width of 25.4 mm, a length of 75.1 mm, and a thickness of 1 mm.
The present invention is not limited to the dimensions of the microarray substrate, and can be carried out using a film, a microtiter plate, or the like in addition to the slide shape.

  The material for the microarray substrate of the present invention is preferably a plastic material from the viewpoint of ensuring flexibility in changing the shape and size and providing it at a lower cost than that of a glass carrier. As such a plastic material, a thermoplastic resin can be used from the viewpoint of easy surface treatment and mass productivity.

  As a thermoplastic resin, a thing with little fluorescence generation amount can be used. By using a resin with a small amount of fluorescence generation, the background in the detection reaction of the DNA strand can be lowered, and therefore the detection sensitivity can be further improved. Examples of the thermoplastic resin that generates a small amount of fluorescence include linear polyolefins such as polystyrene, polyethylene, and polypropylene, cyclic polyolefins, fluorine-containing resins, and the like. Among these, saturated cyclic polyolefin is particularly excellent in heat resistance, chemical resistance, low fluorescence, transparency, and moldability, and is therefore suitable for optical analysis and is preferably used as a carrier material.

  FIG. 2 is an explanatory diagram showing a manufacturing process of the small microarray 8 according to the embodiment of the present invention. FIG. 2A is a diagram showing a state in which the array forming unit 1 is arranged on a slide-like substrate 2 that is a microarray substrate, and an enlarged view of the array forming unit. FIG. 2B is a diagram showing processing in an array apparatus for producing a microarray. FIG. 2C is a view showing a state in which a physiologically active substance or the like is bonded to the substrate surface by spotting on the array forming portion 1 and an enlarged view of the array forming portion. FIG. 2D is a diagram and an enlarged view showing a state in which each small microarray is punched out.

  In FIG. 2A, the individual array forming portions 1 in the slide substrate 2 are held so as to remain on the slide substrate 2 in accordance with the shape of width 2 mm × length 20 mm. This shows a state in which the penetrating part 4 is formed over the entire circumference with a width of about 1 mm from the outer shape of the array forming part 1, leaving the gate part 3 for this purpose.

  The perimeter of the array forming portion is not limited to the shape described above, and may be a perforated cut that can be easily cut into the outer shape of the small microarray substrate 1. Moreover, the process of the groove | channel is given, The part which is easy to cut off and may form a thin part may be formed. The thickness of the groove portion is preferably 0.05 to 0.5 mm.

  The cutting for cutting or the processing of the groove can be produced by cutting the slide substrate 2 with a drill or the like. It can also be produced by a molding method such as injection molding using a plastic mold.

  In addition, the gate unit 3 holding the small microarray substrate 1 has sufficient strength, so that the gate unit 3 can withstand the transport pressure during the array processing by the arrayer 6, the pressing pressure during the positioning, and the array processing pressure. The width and its arrangement are designed as appropriate.

  In this state, the slide substrate 2 is set in the microarrayer 6, and an array 7 is prepared by spotting a physiologically active substance or the like on the surface of each array forming unit 1. The array 7 can also be applied to the back surface of each array forming unit 1 by turning the slide-like substrate 2 upside down and setting it again according to the purpose of use. Further, by using a print issuing machine or the like other than the microarrayer device 6, characters, barcodes, and the like can be printed on the array forming unit 1.

  FIG. 2 (c) shows the slide substrate 2 for which the fabrication of the array 7 on the surface of the small microarray substrate 1 has been completed. Each small microarray substrate 1 can be used as this small microarray 8 as shown in FIG. 2D by means of cutting, punching or the like from the slide substrate 2.

  According to the present invention, a plurality of array forming portions are embedded in a slide-shaped substrate, and one or both surfaces thereof have a function of immobilizing a physiologically active substance such as DNA, protein, peptide, sugar chain, Since the gates for preventing the dropout are left in accordance with the shape of the small microarray substrate, the existing microarrayer can be used as it is or with minimal modification, and the microarray can be easily fabricated on the surface of the small microarray substrate. In addition, information can be printed. In addition, the production of the array can be performed as it is with the slide substrate for transporting, storing, and the like, and the productivity is improved, and the reliability of the produced array is improved because it can be easily extracted and used at the time of use.

  Therefore, in the production of a small microarray, there is provided a small microarray and a method for producing the same, which can be easily produced with an existing microarrayer on the surface of a small microarray substrate, and can be easily transported and stored as a slide substrate. Can be provided.

(Production of a substrate having a plurality of array forming portions)
A plastic slide substrate molded with a saturated cyclic polyolefin resin was subjected to surface processing like a slide substrate 2 shown in FIG. For each array forming portion 1 inside the slide-shaped substrate 2, a gate portion 3 for holding the individual array forming portion 1 so as to remain on the slide-shaped substrate 2 is left in accordance with the shape of width 2 mm × length 20 mm. Thus, the penetrating portion 4 is formed over the entire circumference with a width of about 1 mm from the outer shape of the array forming portion 1.

(Preparation of PMBN coated substrate)
After the processed slide-like substrate 2 is washed with ethanol, the surface has a PMBN (first monomer having 2-methacryloyloxyethyl phosphorylcholine (MPC) group and p-nitrophenyloxycarbonyl polyethylene glycol methacrylate (NPMA) group). A PMBN coated substrate was prepared by immersing in a 0.5 wt% ethanol solution of two monomers and a third monomer having a butyl metallate (BMA) group.

(Primer fixation)
Each microbe 23S ribosomal DNA sequence-specific oligo DNA strand modified with an amino group at the 5 ′ end was dissolved using 0.25 M carbonate buffer (pH 9.0) to prepare a 10 μM oligo DNA solution. These solutions were spotted on the surface of the array forming part with a 100 μm diameter cross-cut pin using a microarrayer (Marks-I manufactured by Hitachi Software Engineering). The substrate on which the oligo DNA was spotted was heated at 80 ° C. for 1 hour to immobilize the oligo DNA (primer). It is difficult and difficult to position a primer on a small microarray substrate by using a normal microarrayer because of its small shape. With respect to this problem, alignment can be easily performed by using the slide-shaped substrate of the present invention, and the primer can be immobilized on the surface of the small microarray arranged in the substrate. In this embodiment, a slide substrate on which nine small microarrays are arranged is used. Since a plurality of microarrays can be arranged in the slide shape of the present invention, a plurality of small microarrays can be produced by a single spot process, and the productivity of the spot process can be improved. Moreover, since it is a slide substrate, handling such as transportation, inspection and storage is easy. The chain sequences of the spot and immobilized E. coli detection primers are shown below.
Staphylococcus aureus (SA): agtaggataggcgaagcgtgcgatt
E. coli (ECO): ctgatatgtaggtgaagcgacttgctcg
Green bacterium (PA): gttaatcgacgcagggttagtcggtt
Salmonella (SAL): tgtgtgttccaggtaaatccggttc
Positive control (POS): gacagccaggatgttggcttagaagcagc
Each small microarray substrate 1 was separated from the slide substrate 2 by punching.

(Bacteria culture)
The following strains were cultured.
Strain name Staphylococcus aureus used: Staphylococcus aureus ATCC 25923
Escherichia coli ATCC 25922
Pseudomonas aeruginosa: Pseudomonas aeruginosa ATCC 27853
Salmonella:
Salmonella enterica subsp. Enterica serovar Typhimurium ATCC 14028
Salmonella enterica subsp.enterica serovar Enteritidis IID 604
Using an agar medium, it was performed at 37 ° C. for a whole day and night (14-18 hours). The medium used was "Normal Bouillon Eiken" which is an instant medium, the liquid medium was dissolved in the designated amount of "Normal Bouillon Eiken" in demineralized water, and 1.6% agar was added to the agar medium, which was used after autoclaving. .

(Extraction of 23S ribosomal DNA)
One colony in the above bacterial culture was dispersed in 200 μl of PBS (−), and 3 μl of DNA extract was obtained using a DNA extraction kit (Invitrogen).
(23S ribosomal DNA chain amplification reaction by PCR)
23S ribosomal DNA was amplified by PCR reaction using a universal primer of 23S ribosomal DNA.
The primer sequences used for PCR amplification are shown below.
Primer sequence:
Sense: 5'-gacagccaggatgttggcttagaagcagc
Antisense: The same amount of the following was used.
5'-ggaatttcgctaccttaggaccgttatagttacg
5'-ggaatttcgctaccttaggatggttatagttacc
12.5 pmol, 200 μM dATP, dCTP, dGTP, dTTP, Cy3-labeled dUTP, 0.5 U DNA polymerase (Ex Taq manufactured by Takara Bio Inc.) were dissolved in 25 μL of PCR buffer, Ten cycles of heat denaturation at 95 ° C. for 1 minute, annealing at 75 ° C. for 2 minutes, and DNA chain extension reaction at 72 ° C. for 5 minutes were performed to obtain a PCR product.

(Hybridization)
The small microarray substrate on which the above-mentioned primers were immobilized was placed in the PCR tube in which the PCR reaction was performed, and hybridization was performed with the primers on the substrate surface under conditions of 95 ° C. for 1 minute and 65 ° C. for 60 minutes. The substrate was removed from the tube and washed 3 times with PBST.

  The fluorescence intensity of the spots was measured with a fluorescence scanner (ScanArray Perkin Elmer). The DNA solution extracted from each bacterium was compared with respect to the spot fluorescence intensity of each of the primers immobilized on the substrate.

A comparison of the fluorescence intensity of the spots is shown in Table 1.

Schematic plan view of an embodiment of a microarray substrate of the present invention ((a) microarray substrate, (b) small microarray) Schematic showing the manufacturing process of a small microarray by the substrate for microarray of the present invention

Explanation of symbols

1 Array formation part (Small microarray substrate)
2 Microarray substrate (slide substrate)
3 Gate portion 4 Through portion 6 Microarray device 7 Array 8 Small microarray

Claims (15)

A substrate for microarray, wherein at least one array forming portion is arranged on the substrate, and the array forming portion can be individually taken out from the substrate. The microarray substrate according to claim 1, wherein an area of the array forming portion is 0.01 to ⁴ cm ² . The microarray substrate according to claim 1, wherein perforations are formed around the array forming portion. 3. The microarray substrate according to claim 1 or 2, wherein a continuous cut is formed through the substrate leaving a part around the array forming portion. The microarray substrate according to claim 1, wherein a groove is formed around the array forming portion. 6. The microphone array substrate according to claim 5, wherein the groove portion has a thickness of 0.05 to 0.5 mm. The microarray substrate according to claim 1, wherein the substrate is made of plastic. The substrate for microarrays according to any one of claims 1 to 7, wherein the substrate is in the form of a slide glass or a film. A microarray substrate comprising: a microarray substrate according to any one of claims 1 to 8, wherein an array is formed in an array forming unit, and then a small microarray is manufactured by separating the array forming unit from the substrate. how to use. 10. The method for using a microarray substrate according to claim 9, wherein the array is formed using an array-forming arrayer on a slide-like substrate and / or a multi-well plate-like substrate. The method of using a microarray substrate according to claim 9 or 10, wherein the formation of the array includes a step of fixing a substance that specifically captures a physiologically active substance to the array forming part. The method for using a microarray substrate according to claim 11, wherein the substance that specifically captures the physiologically active substance is at least one selected from nucleic acid chains, proteins, peptides, and sugar chains. 12. The method for using a microarray substrate according to claim 11, wherein the substance that specifically captures the physiologically active substance is a drug candidate substance. A small-sized microarray produced using the microarray substrate according to claim 1. A small-sized microarray produced by the method of using the microarray substrate according to claim 9.

Images