JP2008245628A - Chimera-type fusicoccane synthase and gene thereof - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a novel enzyme and gene thereof which are effectively usable for the large quantity production of cotylenin and 12-deoxyfusicoccin which are promising as an anticancer drug, and fusicocca-2,10(14)-diene which is useful as a raw material for producing derivatives thereof, and also to provide a method for producing fusicocca-2,10(14)-diene by using the enzyme and a vector and transformant which are used for the production of the enzyme. <P>SOLUTION: The chimera-type fusicoccane synthase has in an N-terminal region a terpene cyclase domain comprising an amino acid sequence represented by SEQ ID NO: 1 or a functionally equivalent sequence thereof, and has in a C-terminal region a prenyltransferase domain comprising an amino acid sequence represented by SEQ ID NO: 2 or a functionally equivalent sequence thereof. The enzyme and fusicocca-2,10(14)-diene are produced by culturing a transformant having a gene encoding the enzyme. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to an enzyme involved in the synthesis of fusicocca-2,10 (14) -diene which is an intermediate of fusicoccin biosynthesis (fusicoccan synthesizing chimeric enzyme) and its gene About. The present invention also relates to a method for producing the enzyme, and a vector and a transformant used for the production. Furthermore, the present invention relates to a method for producing Fusicocca-2,10 (14) -diene using the enzyme or the vector or transformant used for producing the enzyme. The enzyme of the present invention is a chimeric enzyme composed of a terpene cyclase domain and a prenyltransferase domain. Therefore, the present invention also relates to each enzyme (terpene cyclase, prenyl transferase) constituting the chimeric enzyme and their genes.

Fusicoccin (Fusicoccin A: FC-A, Fusicoccin J: FC-J) is isolated as the main secondary metabolite of the phytopathogenic fungus [ Phomopsis ( Fusicoccum ) amygdali ] that causes wilt on almonds or peach twigs and leaves Diterpene glycoside (see Non-Patent Document 1 or 2). On the other hand, structurally very similar cotylenin (Cotylenin A: CN-A) has been isolated from a strain of filamentous fungi belonging to the genus Cladosporium (sp. 501-7W) (see Non-Patent Document 3, etc.). These compounds are fusicoccan-type diterpene glycosides in which a 5-8-5-membered ring is condensed as shown by the following formula, and have very similar chemical structures.

  For this reason, fusicoccin and cotylenin are known to have the same physiological activity on higher plants, such as having strong plant hormone-like activity, both of which are widely used as biochemical reagents in plant physiology. Has been.

More recently, cotylenin has been found to have differentiation-inducing activity against human myeloid leukemia cells, and its application as a cancer chemotherapeutic agent is expected (Non-patent Document 4, etc.). However, the cotylenin-producing bacterium (sp.501-7W), which seems to be a new species of the genus Cladosporium , disappears in the process of long-term storage and repeated subculture, so there is no prospect of future supply. Therefore, it is desired to supply cotylenin or a derivative having cotylenin-like activity from fusicoccin that is very similar in chemical structure.

  Further, according to the study by the present inventors, although fusicoccin has no differentiation-inducing activity on animal cells, 12-deoxyfusicoccins from which the hydroxyl group at position 12 has been removed have cell differentiation-inducing activity. Based on this, it has been confirmed that it has anticancer activity (Non-patent Document 5). Therefore, as with cotyrenin, it is desired to establish a method for producing 12-deoxyfusicoccins, which are expected to be used as cancer chemotherapeutic agents, particularly for mass production.

On the other hand, fusicoccine (fusicocin A and J) is an intermediate fusicocca-2,10 (14)-, starting from geranylgeranyl diphosphate (GGDP) in a phytopathogenic fungus [ Phomopsis ( Fusicoccum ) amygdali ]. It is known that biosynthesis is performed via a diene (Fusicocca-2,10 (14) -diene) (indicated by 5 in the following formula) (Non-patent Document 6).

  Such an intermediate fusicocca-2,10 (14) -diene has a fusicoccane-type diterpene skeleton, which is a basic skeleton of cotylenin and 12-deoxyfusicococins, fused with a 5-8-5 membered ring. Therefore, using this as a raw material, there is a possibility that a compound effective as an anticancer agent, such as the above-mentioned cotyrenin and 12-deoxyfusicoccins, can be produced.

At present, however, fusicocca-2,10 (14) -diene is obtained only in a small amount from the phytopathogenic fungus [ Phomopsis ( Fusicoccum ) amygdali ], and it is difficult to create various compounds using this as a raw material. . Moreover, although the method of chemically synthesizing Fusicocca-2,10 (14) -diene is known, its efficiency is not necessarily good (Non-patent Document 7).

For this reason, a method for producing a large amount of fusicocca-2,10 (14) -diene, which can be a raw material for producing cotylenin, 12-deoxyfusicoccins, and the like, is demanded.
A. Ballio, et al., Experimantia, 24, 631 (1968) A. Ballio, et al., Experimantia, 30, 844 (1974) T. Sassa, Agric. Biol. Chem., 35, 1415 (1971) K, Asahi, et al., Biochem. Biophys. Res. Commun, 238, 758 (1997) Shuo Kato, “Anti-cancer activity of fusicoccin-type diterpene glycosides”, Abstracts of the 22nd Combinatorial Chemistry Workshop, April 19, 2006 T. Sassa, et al., Tetrahedron Letters 41 (2000) 2401-2404 J. Chem. Soc., Perkin Trans. 1, 2473-2474 (1998)

  The object of the present invention is to provide a novel compound that can be effectively used for mass production of fucicocca-2,10 (14) -diene useful as a raw material for producing cotylenin and 12-deoxyfusicococins, which are promising as anticancer agents, and derivatives thereof To provide an enzyme and its gene. The present invention also relates to a method for producing the enzyme, and a vector and a transformant used for the production. Furthermore, the present invention relates to a method for producing Fusicocca-2,10 (14) -diene using the enzyme or a vector and a transformant used for the production of the enzyme.

  The enzyme is a chimeric enzyme composed of a terpene cyclase domain and a prenyltransferase domain. Therefore, an object of the present invention is also to provide each enzyme (terpene cyclase, prenyltransferase) constituting the chimeric enzyme and a gene thereof.

  In order to solve the above problems, the present inventors have conducted intensive research for the purpose of obtaining a cyclase gene involved in the biosynthesis of fusicoccin-2,10 (14) -diene, which is a biosynthetic intermediate of fusicoccin. As a result, gene walking and degenerate primers for the gene that synthesizes geranylgeranyl diphosphate (GGDP) (GGDP synthesis gene: GGS), the biosynthetic raw material for fusicocca-2,10 (14) -diene The RT-PCR used succeeded in obtaining a terpene cyclase gene suitable for the above purpose, and cyclizing GGDP into the gene product (enzyme) and converting it to fusicocca-2,10 (14) -diene Confirmed that there is. Furthermore, in addition to the terpene cyclization activity (terpene cyclase activity), the enzyme also has a prenyl chain elongation activity (prenyl transferase activity). And a chimeric enzyme having a terpene cyclase domain and a prenyltransferase domain on the C-terminal side, respectively. In addition, since Fushicocca-2,10 (14) -diene accumulates in large amounts in E. coli overexpressing this enzyme, the enzyme is converted from the isoprene unit present in the living body to Fushicocca-2,10 (14 ) -Diene biosynthetic raw material (substrate) geranylgeranyl diphosphate (GGDP) is synthesized by itself, and it has the function of efficiently synthesizing fusicocca-2,10 (14) -diene. It turned out to be an enzyme.

  The present invention has been completed based on these findings and includes the following aspects.

(I) Fusicoccan synthetic chimeric enzyme (I-1 ) A terpene cyclase domain consisting of the amino acid sequence described in (a) or (b) in the N-terminal region, and (c) or (d) in the C-terminal region Fusicoccan synthesizing chimeric enzyme having a prenyltransferase domain consisting of the described amino acid sequence:
(A) the amino acid sequence shown in SEQ ID NO: 1,
(B) an amino acid sequence obtained by deleting, substituting or adding one or a plurality of amino acid sequences in the amino acid sequence shown in SEQ ID NO: 1, wherein the amino acid sequence encodes a protein having terpene cyclase activity;
(C) the amino acid sequence shown in SEQ ID NO: 2,
(D) an amino acid sequence obtained by deleting, substituting, or adding one or more amino acid sequences in the amino acid sequence shown in SEQ ID NO: 2, and encoding a protein having prenyltransferase activity.

(I-2) Fusicoccane synthetic chimeric enzyme according to (I-1), comprising the amino acid sequence described in (A) or (B) below:
(A) the amino acid sequence shown in SEQ ID NO: 3,
(B) An amino acid sequence obtained by deleting, substituting, or adding one or more amino acid sequences in SEQ ID NO: 3, and encoding a protein having terpene cyclase activity and prenyl transferase activity.

(II) Fusicoccan synthetic chimeric enzyme gene (II-1) In the 5 'region, a base sequence encoding a terpene cyclase domain consisting of the amino acid sequence described in (a) or (b), and in the 3' region A fusicoccan synthetic chimeric enzyme gene having a base sequence encoding a prenyltransferase domain consisting of the amino acid sequence described in (c) or (d):
(A) the amino acid sequence shown in SEQ ID NO: 1,
(B) an amino acid sequence obtained by deleting, substituting or adding one or a plurality of amino acid sequences in the amino acid sequence shown in SEQ ID NO: 1, wherein the amino acid sequence encodes a protein having terpene cyclase activity;
(C) the amino acid sequence shown in SEQ ID NO: 2,
(D) an amino acid sequence obtained by deleting, substituting, or adding one or more amino acid sequences in the amino acid sequence shown in SEQ ID NO: 2, and encoding a protein having prenyltransferase activity.

(II-2) The fusicoccan synthetic chimeric enzyme gene according to claim 3, which has a base sequence encoding the amino acid sequence described in (A) or (B) below:
(A) the amino acid sequence shown in SEQ ID NO: 3,
(B) An amino acid sequence obtained by deleting, substituting, or adding one or more amino acid sequences in SEQ ID NO: 3, and encoding a protein having terpene cyclase activity and prenyl transferase activity.

(II-3) a base sequence encoding the terpene cyclase domain described in (i) or (ii) in the 5 ′ side region, and a prenyltransferase domain described in (iii) or (iv) in the 3 ′ side region The fusicoccan synthetic chimeric enzyme gene described in (II-1) or (II-2) having a nucleotide sequence encoding:
(I) the base sequence shown in SEQ ID NO: 4,
(Ii) a base sequence having at least 85% identity with the base sequence shown in SEQ ID NO: 4 and encoding a protein having terpene cyclase activity;
(Iii) the base sequence shown in SEQ ID NO: 5,
(Iv) A nucleotide sequence having at least 85% identity with the nucleotide sequence shown in SEQ ID NO: 5 and encoding a protein having prenyl transferase activity.

(II-4) A fusicoccan synthetic chimeric enzyme gene according to any one of (II-1) to (II-3), which has the base sequence described in (I) or (II) below:
(I) the base sequence shown in SEQ ID NO: 6,
(II) A base sequence having at least 85% identity with the base sequence shown in SEQ ID NO: 6 and encoding a protein having terpene cyclase activity and prenyl transferase activity.

(III) Production of fusicoccan synthetic chimeric enzyme and a material used therefor (III-1) A recombinant vector containing the fusicoccan synthetic chimeric enzyme gene according to any one of (II-1) to (II-4).
(III-2) A transformant obtained by transforming a host cell with the recombinant vector described in (III-1).
(III-3) The transformant according to (III-2), wherein the host cell is E. coli.
(III-4) a step of culturing the transformant described in (III-2) or (III-3) in a medium, and, if necessary, a protein having terpene cyclase activity and prenyltransferase activity from the obtained culture A method for producing a fusicoccan synthetic chimeric enzyme according to (I-1) or (I-2), comprising a step of collecting

(IV) A process for culturing the transformant described in (III-2) or (III-3) in a medium, and, if necessary, a culture obtained from the method for producing Fushicocca-2,10 (14) -diene A method for producing Fusicocca-2,10 (14) -diene, which comprises collecting Fusicocca-2,10 (14) -diene from the base.

(V) Terpene cyclase and its gene (V-1) Terpene cyclase consisting of the amino acid sequence described in (a) or (b) below:
(A) the amino acid sequence shown in SEQ ID NO: 1,
(B) an amino acid sequence obtained by deleting, substituting or adding one or more amino acid sequences in the amino acid sequence shown in SEQ ID NO: 1, and encoding an amino acid sequence having terpene cyclase activity.

(V-2) A terpene cyclase gene comprising a base sequence encoding the amino acid sequence described in (a) or (b):
(A) the amino acid sequence shown in SEQ ID NO: 1,
(B) an amino acid sequence obtained by deleting, substituting or adding one or more amino acid sequences in the amino acid sequence shown in SEQ ID NO: 1, and encoding an amino acid sequence having terpene cyclase activity.

(V-3) The terpene cyclase gene described in (V-2) comprising the base sequence described in (i) or (ii) below:
(I) the base sequence shown in SEQ ID NO: 4,
(Ii) a base sequence having at least 85% identity with the base sequence shown in SEQ ID NO: 4 and encoding a protein having terpene cyclase activity;
(VI) Prenyltransferase and its gene (VI-1) Prenyltransferase comprising the amino acid sequence described in (c) or (d) below:
(C) the amino acid sequence shown in SEQ ID NO: 2,
(D) an amino acid sequence obtained by deleting, substituting, or adding one or more amino acid sequences in the amino acid sequence shown in SEQ ID NO: 2, and encoding a protein having prenyltransferase activity.

(VI-2) A prenyltransferase gene comprising a base sequence encoding the amino acid sequence described in (c) or (d):
(C) the amino acid sequence shown in SEQ ID NO: 2,
(D) an amino acid sequence obtained by deleting, substituting, or adding one or more amino acid sequences in the amino acid sequence shown in SEQ ID NO: 2, and encoding a protein having prenyltransferase activity.

(VI-3) The prenyl transferase gene described in (VI-2) consisting of the base sequence described in (iii) or (iv) below:
(Iii) the base sequence shown in SEQ ID NO: 5,
(Iv) A nucleotide sequence having at least 85% identity with the nucleotide sequence shown in SEQ ID NO: 5 and encoding a protein having prenyl transferase activity.

  In the present invention, “gene” or “DNA” is used to include not only double-stranded DNA but also single-stranded DNA such as a sense strand and an antisense strand constituting the DNA. The length is not particularly limited. Therefore, unless otherwise specified, “gene” or “DNA” as used herein means double-stranded DNA including genomic DNA, single-stranded DNA including cDNA (positive strand) and complementary to the positive strand. Single-stranded DNA having a specific sequence (complementary strand, reverse strand) and synthetic DNA are included, and “gene” also includes RNA. In addition to the coding region (including the signal peptide region), the “gene” or “DNA” can include, for example, an expression control region, a signal region, an exon, and an intron, as long as the effect of the present invention is retained.

  Unless otherwise specified, “gene” or “DNA” in the present invention includes not only “gene” or “DNA” represented by a specific nucleotide sequence, but also proteins encoded by these and physiological functions. Included are “genes” or “DNAs” that encode proteins that are equivalent (eg, homologues, variants or derivatives, also referred to herein as “functional equivalents”). In the present specification, such “gene” or “DNA” is also referred to as “homologue” of “gene” or “DNA” represented by a specific base sequence. Examples of such “homolog” include “gene” or “DNA” having a base sequence that hybridizes under stringent conditions to the complementary strand of “gene” or “DNA” represented by a specific base sequence. be able to.

  Fusicocca-2,10 (14) -diene has a fusicoccane-type diterpene skeleton, which is a basic skeleton of cotylenin and 12-deoxyfusicococins, fused with a 5-8-5 membered ring. As a raw material, there is a possibility that a compound effective as an anticancer agent such as the above-mentioned cotylenin and 12-deoxyfusicoccins can be produced. However, as described above, there is currently no efficient production method, and it is difficult to create various compounds using this as a raw material. The fusicoccan synthesizing chimeric enzyme provided by the present invention is an enzyme that synthesizes fusicocca-2,10 (14) -diene. It is possible to produce a large amount of fusicocca-2,10 (14) -diene, which can be a raw material for the production of shikokucins.

(I) Fusicoccan Synthetic Chimeric Enzyme The fusicoccan synthesizing chimeric enzyme of the present invention is characterized by having two functional domains: (1) a prenyltransferase domain and (2) a terpene cyclase domain. Therefore, the enzyme catalyzes the chain elongation reaction of C5 isoprene units (prenyl transferase activity) and the action of catalyzing the reaction of cyclizing the produced compound based on these two functional domains (terpene). It has two enzymatic actions (cyclase activity).

  Here, (1) an amino acid sequence encoding a prenyltransferase domain (hereinafter also simply referred to as “PT domain”) is preferably an amino acid sequence consisting of 385 amino acid residues shown in SEQ ID NO: 2 Can do. However, the PT domain is not limited to one having such a specific amino acid sequence, and may be a functional equivalent thereof. Here, the functional equivalent consists of an amino acid sequence in which one or a plurality of amino acid sequences are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2, and consists of the amino acid sequence shown in SEQ ID NO: 2 above. Like protein, it has prenyl transferase activity. Preferably, similarly to the protein consisting of the amino acid sequence shown in SEQ ID NO: 2, the chain elongation reaction of the C5 isoprene unit is catalyzed to produce geranylgeranyl diphosphate having a carbon chain length of 20 (hereinafter referred to as “GGDP”). Having a prenyltransferase activity, more preferably 3-isopentenyl pyrophosphate (hereinafter referred to as “IPP”), 3,3-dimethylallyl pyrophosphate (hereinafter referred to as “DMAPP”), geranyl pyrophosphate (hereinafter referred to as “IPP”). It has prenyl transferase activity to produce the above GGDP using “GPP”) or farnesyl pyrophosphate (hereinafter referred to as “FPP”) as a substrate. More preferably, such functional equivalent has 85% or more, preferably 90% or more, more preferably 95% or more, and even more preferably 98% or more identity with the amino acid sequence shown in SEQ ID NO: 2. And a protein having the above-mentioned prenyltransferase activity. Hereinafter, in this specification, the amino acid sequence encoding the functional equivalent of the PT domain represented by SEQ ID NO: 2 is referred to as the “functional equivalent sequence” of the amino acid sequence represented by SEQ ID NO: 2. The sequence identity when comparing two amino acid sequences is indicated by the percentage of the number of amino acids that are identical between the sequences relative to the total number of amino acids (the same applies hereinafter).

  In accordance with the above principle, the sequence identity between two amino acid sequences is determined by the algorithm of Karlin and Altschul [Proc. Natl. Acad. Sci., USA, 87, 2264-2268 (1990) and Proc. Natl. Acad. Sci. , USA, 90, 5873-5877 (1993)]. Programs using such algorithms include the BLAST program [Altschul et al., J. Mol. Biol., 215, 403-410 (1990)], and determining sequence identity with higher sensitivity than BLAST. A possible Gapped BLAST program [Nucleic Acids Res., 25, 3389-3402, (1997)]. These programs are available, for example, on the Internet website of the National Center for Biotechnology Information.

  The prenyltransferase activity can be evaluated by reacting IPP with DMAPP, GPP or FPP in the presence of the protein to be measured, and measuring the carbon chain length of the reaction product.

Specifically, the following method can be exemplified:
As (1) substrate, and labeled IPP (e.g. ^{[1- 14 C] IPP),} DMAPP, the reaction solution containing the GPP or FPP, is reacted by addition of protein (test enzyme) to be measured. The reaction solution may contain a divalent metal ion such as magnesium, a surfactant, an enzyme stabilizer or a buffer as other components.
(2) After the reaction, an equivalent amount of n-hexane is extracted to extract the reaction product.
(3) After concentration of the extraction solvent, acid phosphatase is allowed to act in a solution containing methanol, a buffer solution having a buffer capacity on the acidic side (pH 5-6), and a surfactant to dephosphorylate.
(4) After the reaction, the n-hexane reaction product is extracted, the obtained extract is developed by TLC, and the carbon chain length of the reaction product is determined using a beta ray detector.

  As a result of the determination of the carbon chain length, when production of GGDP having 20 carbon atoms is observed by the reaction (1), it can be determined that the protein to be measured has prenyltransferase activity.

  The amino acid sequence encoding (2) terpene cyclase domain (hereinafter also simply referred to as “TC domain”) is preferably an amino acid sequence consisting of 334 amino acid residues shown in SEQ ID NO: 1. be able to. However, the TC domain is not limited to those consisting of such a specific amino acid sequence, and may be a functional equivalent thereof. Here, the functional equivalent consists of an amino acid sequence in which one or a plurality of amino acid sequences are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 1, and consists of the amino acid sequence shown in SEQ ID NO: 1 above. Similar to protein, it has terpene cyclase activity. More preferably, it has terpene cyclase activity to produce fusicocca-2,10 (14) -diene using GGDP as a raw material, like the protein consisting of the amino acid sequence represented by SEQ ID NO: 1 above. More preferably, the functional equivalent has 85% or more, preferably 90% or more, more preferably 95% or more, and still more preferably 98% or more identity with the amino acid sequence shown in SEQ ID NO: 1. And a protein having the above-mentioned terpene cyclase activity. Hereinafter, in this specification, the amino acid sequence encoding the functional equivalent of the TC domain represented by SEQ ID NO: 1 is referred to as the “functional equivalent sequence” of the amino acid sequence represented by SEQ ID NO: 1.

  The terpene cyclase activity can be evaluated by reacting a protein to be measured with GGDP and confirming the presence or absence of fusicocca-2,10 (14) -diene.

Specifically, the following method can be exemplified:
(1) A protein (test enzyme) to be measured is added to the reaction solution containing GGDP and reacted. The reaction solution may contain a divalent metal ion such as magnesium, a surfactant, an enzyme stabilizer or a buffer as other components.
(2) After the reaction, the n-hexane reaction product is extracted.
(3) After concentrating the eluate, it is subjected to analysis such as gas chromatography mass spectrometry (GC-MS) or liquid chromatography mass spectrometry (LC-MS) to identify the product.

  As a result of the analysis, when the above reaction (1) shows the production of fusicocca-2,10 (14) -diene, it can be determined that the protein to be measured has terpene cyclase activity.

  The fusicoccan synthetic chimeric enzyme of the present invention is characterized by having the TC domain in the N-terminal region and the PT domain in the C-terminal region. Preferable examples include those obtained by tandemly bonding a PT domain to the C-terminal side of the TC domain in the N-terminal region. Note that fusicoccan synthesizing chimera enzyme has one or a plurality of N-terminal TC domain and C-terminal PT domain as long as prenyltransferase activity based on PT domain and terpene cyclase activity based on TC domain are not hindered. It may have any amino acid residue.

  As the fusicoccane synthetic chimeric enzyme of the present invention, a protein having an amino acid sequence consisting of the amino acid residue of 719 represented by SEQ ID NO: 3 is preferably exemplified. However, the enzyme of the present invention is not limited to a protein comprising such a specific amino acid sequence, and may be a functional equivalent thereof. Here, the functional equivalent consists of an amino acid sequence in which one or a plurality of amino acid sequences are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 3, and consists of the amino acid sequence shown in SEQ ID NO: 3 above. Like protein, it has prenyltransferase activity and terpene cyclase activity. More preferably, as in the protein represented by SEQ ID NO: 3, prenyltransferase activity (preferably using IPP and DMAPP, GPP or FPP as a substrate) that catalyzes the chain extension reaction of the C5 isoprene unit to produce GGDP. And prenyltransferase activity for producing GGDP) and terpene cyclase activity for producing fusicocca-2,10 (14) -diene using GGDP as a raw material. More preferably, such a functional equivalent has 85% or more, preferably 90% or more, more preferably 95% or more, and still more preferably 98% or more identity with the amino acid sequence shown in SEQ ID NO: 3. And a protein having the above-mentioned prenyltransferase activity and terpene cyclase activity. Hereinafter, in this specification, the amino acid sequence encoding the functional equivalent of the fusicoccan synthetic chimeric enzyme represented by SEQ ID NO: 3 is referred to as the “functional equivalent sequence” of the amino acid sequence represented by SEQ ID NO: 3.

  The fusicoccan synthetic chimeric enzyme of the present invention can be produced by chemical or genetic engineering techniques based on the amino acid sequence disclosed in the present invention. Details of the production method by genetic engineering will be described later. Further, the amino acid sequence can be modified by a method already known in the art, for example, site-directed mutagenesis [Current Protocols I molecular Biology, edit. Ausubel et al., John Wily & Sons, Section 8.1-8.5 (1987 )], Etc., can be used by appropriately introducing mutations such as substitution, deletion, insertion, addition and inversion into the amino acid sequence to be modified.

(II) Fusicoccan Synthetic Chimeric Enzyme Gene The present invention also provides a gene for the above fusicoccan synthesizing chimeric enzyme. The gene referred to here includes genomic DNA, cDNA, synthetic DNA (recombinant DNA), and RNA as described above.

  The gene may be any gene as long as it has a base sequence encoding the fusicoccane synthetic chimeric enzyme described above. Specifically, (3) a base sequence encoding a prenyltransferase domain (PT domain) consisting of the amino acid sequence shown in SEQ ID NO: 2 or a functional equivalent sequence thereof, and (4) an amino acid sequence shown in SEQ ID NO: 1 or a functional equivalent thereof It has a base sequence encoding a terpene cyclase domain (TC domain) consisting of a sequence.

  Here, the base sequence encoding (3) PT domain is preferably the base sequence shown in SEQ ID NO: 5 in the sequence listing. The base sequence shown in SEQ ID NO: 5 is a base sequence encoding the amino acid sequence shown in SEQ ID NO: 2.

However, the base sequence encoding the PT domain is not limited to such a specific base sequence, and may be a base sequence encoding a functionally equivalent sequence of the amino acid sequence shown in SEQ ID NO: 2 described above. Specific examples of such a base sequence include a base sequence that hybridizes with a complementary sequence of the base sequence represented by SEQ ID NO: 5 under stringent conditions. Stringent conditions include binding of complex or probe as taught by Berger and Kimmel (Guide to Molecular Cloning Techniques Methods in Enzymology, Vol. 152, Academic Press, San Diego, CA, USA, 1987). It can be determined based on the melting temperature (Tm) of the nucleic acid. For example, 6 x ssc (composition of 1 x ssc; 0.15 M NaCl, 0.015 M sodium citrate, pH 7.0), 0.5% SDS, 5X as washing conditions after hybridization (so-called “stringent conditions”) Denhardt's and 100 mg / ml pro herring sperm DNA) solution containing - with 8 to 16 hours a constant temperature at 65 ° C. with blanking, conditions for hybridizing the like (Sambrook et al., Molecular Cloning-a Loboratory Mannual, 2 nd ed. (The same applies hereinafter).

  Preferably, it is a base sequence having the identity of 85% or more, preferably 90% or more, more preferably 95% or more, and still more preferably 98% or more in the base sequence shown in SEQ ID NO: 5. Hereinafter, such a base sequence is also referred to as “homologue sequence” of SEQ ID NO: 5 in the present specification.

  As the base sequence encoding (4) TC domain, the base sequence shown in SEQ ID NO: 4 can be preferably exemplified. The base sequence shown in SEQ ID NO: 4 is a base sequence encoding the amino acid sequence shown in SEQ ID NO: 1.

  However, the base sequence encoding the TC domain is not limited to such a specific base sequence, and may be a base sequence encoding a functionally equivalent sequence of the amino acid sequence shown in SEQ ID NO: 1 described above. Specific examples of such a base sequence include a base sequence that hybridizes with a complementary sequence of the base sequence represented by SEQ ID NO: 4 under stringent conditions. Stringent conditions are as described above. Preferably, it is a base sequence having the identity of 85% or more, preferably 90% or more, more preferably 95% or more, and still more preferably 98% or more in the base sequence shown in SEQ ID NO: 4. Hereinafter, this base sequence is also referred to as “homologue sequence” of SEQ ID NO: 4 in the present specification.

  The fusicoccan synthetic chimeric enzyme gene of the present invention has a base sequence encoding the above (3) TC domain in the 5 ′ side region, and a base sequence encoding the above (4) PT domain in the 3 ′ side region. Have. Preferably, a base sequence encoding a TC domain in the 5'-side region, followed by tandem binding of a base sequence encoding a PT domain at its 3 'end can be mentioned. In addition, as long as the expression product has a prenyl transferase activity based on the PT domain and a terpene cyclase activity based on the TC domain, the fusicoccan synthetic chimeric enzyme gene encodes the base sequence encoding the PT domain and the TC domain. It may have an arbitrary plurality of bases between the base sequences.

  The fusicoccan synthetic chimeric enzyme gene of the present invention is preferably a gene comprising a base sequence having 2157 bases shown in SEQ ID NO: 6 in the sequence listing.

  However, the enzyme of the present invention is not limited to a gene having such a specific base sequence, and may be a base sequence that encodes a functionally equivalent sequence of the amino acid sequence represented by SEQ ID NO: 3 described above. Specific examples of such a base sequence include a base sequence that hybridizes with a complementary sequence of the base sequence represented by SEQ ID NO: 6 under stringent conditions. Stringent conditions are as described above. Preferably, it is a nucleotide sequence having 85% or more, preferably 90% or more, more preferably 95% or more, and still more preferably 98% or more of the nucleotide sequence shown in SEQ ID NO: 6 in the nucleotide sequence. Hereinafter, in the present specification, such a base sequence is referred to as “homologue” of SEQ ID NO: 6.

The fusicoccane synthetic chimeric enzyme gene of the present invention can also be isolated and obtained from the phytopathogenic fungus “ Phomopsis ( Fusicoccum ) amygdali ” using RT-PCT or the like, as shown in the Examples. As another method, it can also be produced by a chemical or genetic engineering technique based on the nucleotide sequence disclosed in the present invention. Details of the production method by genetic engineering will be described later. Further, the modification of the nucleotide sequence may be performed by a method already known in the art, for example, site-directed mutagenesis [Current Protocols I molecular Biology, edit. Ausubel et al., John Wily & Sons, Section 8.1-8.5 (1987 )], Etc., can be carried out by appropriately introducing mutations such as substitution, deletion, insertion, addition and inversion into the base sequence to be modified.

(III) Recombinant Vector The present invention provides a recombinant vector containing a gene encoding the above fusicoccane synthetic chimeric enzyme. The recombinant vector contains a gene encoding a fusicoccane synthetic chimeric enzyme in a state capable of being expressed in a desired host cell, and is used for transforming the host cell. Therefore, the recombinant vector of the present invention may be any vector as long as it has such a form that transformation of such host cells can be achieved, for example, a plasmid, bacteriophage, or retrotransposon.

The recombinant vector of the present invention (expression vectors), when using E. coli (E. coli) and Bacillus subtilis (B subtilis.) Bacteria such as hosts, in general, at least a promoter - operator region (promoter, operator and ribosome binding region (Including the SD region), a start codon, DNA encoding the fusicoccane synthetic chimeric enzyme of the present invention, a stop codon, a terminator region, and a replicable unit. In addition, when a fungal cell such as yeast or an animal cell is used as a host cell, it generally has at least a promoter, an initiation codon, a signal peptide and DNA encoding the fusicoccane synthetic chimeric enzyme of the present invention, and a termination codon. In addition, the recombinant vector (expression vector) of the present invention may contain a cis element such as an enhancer, an untranslated region on the 5 ′ side or 3 ′ side of the DNA encoding the fusicoccane synthetic chimeric enzyme of the present invention, and splicing as necessary. Junctions, polyadenylation sites, replicable units, homologous regions, selectable markers can be included. These elements are not particularly limited as long as they correspond to the host used for the expression of the gene encoding the fusicoccane synthetic chimeric enzyme of the present invention, and can be selected based on common technical knowledge in the art.

  The selection marker is not particularly limited. For example, when the host used for gene expression is a bacterium, a drug resistance gene (for example, ampicillin resistance gene, neomycin resistance gene, cycloheximide resistance gene, tetramycin resistance gene, etc.) ) When the host is other than bacteria, such as yeast, various known selection markers including auxotrophic genes (for example, HIS4, URA3, LEU2, ARG4, etc.) can be used.

  The recombinant vector (expression vector) of the present invention is simply a DNA encoding the fusicoccane synthetic chimeric enzyme of the present invention described above in a state in which the target fusicoccan synthetic chimeric enzyme can be expressed in a known expression vector. Specifically, it can be created by introducing it downstream of the promoter. Such introduction can be performed according to a general method of DNA recombination, for example, a method described in Molecular Cloning (1989) (Cold Spring Harbor Lab.).

Examples of expression vectors include plasmid vectors such as pRS413, pRS415, pRS416, YCp50, pAUR112, and pAUR123. YCp-type E. coli- yeast shuttle vectors; pRS403, pRS404, pRS405, pRS406, pAUR101, and pAUR135 YIp type E. coli- yeast shuttle vector; plasmids derived from E. coli (for example, pBR322, pBR325, pUC18, pUC19, pUC119, pTV118N, pTV119N, pBluescript, pHSG298, pHSG396, or pTrc99A) P1A-based plasmids such as pACYC177 or pACYC184; pSC101-based plasmids such as pMW118, pMW119, pMW218 or pMW219; plasmids derived from B. subtilis (eg pUB110, pTP5 etc.); E. coli such as pHSP64 ( E. coli ) -B . subtilis shuttle vector. Examples of phage vectors include λ phage (Charon 4A, Charon21A, EMBL4, λgt100, gt11, zap), ψX174, M13mp18, and M13mp19. Examples of retrotransposons include Ty factor. In addition, an expression vector expressed as a fusion protein, for example, pGEX series (manufactured by Amersham Pharmacia), pMAL series (manufactured by Biolabs) can also be used.

  In an example of the present invention, a gene encoding a fusicoccane synthetic chimeric enzyme is introduced into a multiple cloning site of a glutathione S-transferase (GST) fusion protein expression vector (pGEX-4T-3) (Amersham Pharmacia), Fushikokkan synthetic chimera type enzyme expression vector has been created. Thus, the fusicoccan synthetic chimeric enzyme of the present invention is expressed as a fusion protein having glutathione S-transferase (GST) at its N-terminus. It should be noted that the entire base sequences of vectors of pGEX series including pGEX-4T-3 are registered in Genbank and publicly known (for example, the Genbank accession number of the entire base sequence of pGEX-4T-3 is No. U13855) is there).

  A GST fusion protein expression system using such a GST fusion protein expression vector is that GST can be used as a carrier to obtain a high expression level, can be easily detected using antibodies against GST activity and GST, This is an expression system that is widely used because it has the advantage that it can be easily purified by affinity chromatography using its affinity with certain glutathione. Moreover, the target protein (in the present invention, fusicoccan synthetic chimeric enzyme) can be easily recovered and purified by protease digestion.

(IV) Transformant The present invention also provides a transformant obtained by transforming a host cell by introducing the above recombinant vector.

  The method of introducing (transforming) the recombinant vector into the host cell is not particularly limited, and it depends on the type of host cell to be introduced and the form of the recombinant vector, such as transformation method, transfection method, competent cell method, and electroporation. Depending on the situation, it can be appropriately selected.

Host cells include in vivo cells that have the ability to produce IPP as a substrate for GGDP and DMAPP, FPP, or GPP, specifically cells that have a mevalonate pathway or MEP pathway (non-mevalonate pathway). is not particularly limited as long as, for example, E. coli (E coli.) or B. subtilis (B subtilis.) bacteria such as; Saccharomyces cerevisiae (Saccharomyces cerevisiae), Saccharomyces pombe (Saccharomycespombe), Pichia pastoris (Pichia pastoris), etc. Yeast cells; insect cells such as sf9 and sf21; animal cells such as COS cells and Chinese hamster ovary cells (CHO cells); plant cells such as tobacco. Bacteria such as Escherichia coli and Bacillus subtilis, and yeast are preferable. More preferred are bacteria such as Escherichia coli.

  The mode of presence of the expression vector in the host cell is not particularly limited, and the expression vector may be inserted into the chromosome, replaced or integrated, or may exist in the form of a plasmid.

(V) Method for Producing Fusicoccane Synthetic Chimeric Enzyme The transformant thus obtained can be cultured in a suitable medium according to the host to produce the fusicoccane synthetic chimeric enzyme of the present invention. it can. The present invention provides a method for producing a fusicoccan synthetic chimeric enzyme using such a transformant. This method can be carried out by culturing the above transformant in a medium.

  The medium contains a carbon source, a nitrogen source, an inorganic salt, a vitamin, a drug and the like essential for the growth of the transformant. Carbon sources include mannan components, arabinose, cellobiose, fructose, galactose, glucose, glycerol, inositol, lactose, mannitol, mannose, raffinose, rhamnose, sucrose, trehalose and xylose; nitrogen sources include inorganic nitrogen such as ammonium sulfate and ammonium chloride And organic nitrogen sources such as casein degradation product, yeast extract, polypeptone, bactotryptone and beef extract; inorganic salts such as sodium diphosphate or potassium diphosphate, dipotassium hydrogen phosphate, magnesium chloride, sulfuric acid Magnesium, calcium chloride, etc .; various vitamins such as vitamin B1 as vitamins; various drugs such as ampicillin, neomycin, cycloheximide, tetramycin Mention may be made of the raw material. These are merely examples, and are not limited thereto.

  As an example of the medium, when the host is a gram-negative bacterium such as Escherichia coli or a gram-positive bacterium such as Bacillus subtilis, LB medium (Nissui Pharmaceutical), M9 medium (J. Exp. Mol. Genet., Cold Spring Harbor Laboratory, New York, p.431, 1972); and when the host is yeast, YPD medium (1% Bacto yeast extract, 2% Bacto peptone, 2% glycerol), YPG medium (1% Bacto yeast extract) , 2% Bacto peptone, 2% glycerol), YP medium (1% Bacto yeast extract, 2% Bacto peptone, YPD medium (1% Bacto yeast extract, 2% Bacto peptone, 2% glucose), 0.7% Yeast Nitrogen Examples include Base (Difco), YP medium [1% Bacto yeast extract (Difco), 2% Polypeptone S (Nippon Pharmaceutical)], and the like.

  The culture is usually carried out in the temperature range of 10 to 40 ° C. for about several to 80 hours, and aeration and agitation can be added as necessary. The culture temperature can be set according to the host, and is not particularly limited. However, the culture temperature is preferably about 18 to 42 ° C, more preferably about 25 to 38 ° C.

  Thus, the fusicoccane synthetic chimeric enzyme of the present invention can be produced in the host cell, and if necessary, a step of collecting fusicoccane synthetic chimeric enzyme from the culture obtained by the above culture is performed. You can also.

  For the collection of the fusicoccan synthetic chimeric enzyme, after cultivation, the fusicoccan synthetic chimeric enzyme accumulated in the culture supernatant or in the transformant (bacteria) is extracted by a known method, and purified if necessary. Can be done. Separation and purification can be performed by, for example, salting out, solvent precipitation, dialysis, ultrafiltration, gel electrophoresis, or gel filtration chromatography, ion exchange chromatography, reverse phase chromatography, affinity chromatography, etc. Can be combined. In this case, the molecular weight (about 81 kDa) of the fusicoccan synthetic chimeric enzyme, and the prenyl transferase activity and terpene cyclase activity of the enzyme can be used as indicators.

(VI) Method for producing fusicoccane-2,10 (14) diene The above transformant can also be used for producing fusicoccane-2,10 (14) diene. That is, the desired fusicoccane-2,10 (14) diene can be produced by culturing the transformant in an appropriate medium according to the host. Therefore, the present invention also provides a method for producing fusicoccane-2,10 (14) diene using such a transformant. This method can be carried out by culturing the above transformant in a medium.

  As the medium, the same medium as in the production of the fusicoccane synthetic chimeric enzyme of (V) above can be used, and the above description can also be used here.

  The culture is usually carried out in the temperature range of 10 to 40 ° C. for about several to 80 hours, as in (V) above, and aeration and agitation can be added as necessary. The culture temperature can be set according to the host, and is not particularly limited. However, the culture temperature is preferably about 18 to 42 ° C, more preferably about 25 to 38 ° C.

  Thus, the fusicoccane-2,10 (14) diene targeted by the present invention can be produced in the host cell, and if necessary, fusicoccane-2, A step of collecting 10 (14) diene can also be performed.

  To collect fusicoccane-2,10 (14) diene, after cultivation, extract fusicoccane-2,10 (14) diene accumulated in the culture supernatant or transformant (bacteria) by a known method. Moreover, it can carry out by refine | purifying as needed. Separation and purification can be performed by, for example, salting out, solvent precipitation, dialysis, ultrafiltration, gel electrophoresis, or gel filtration chromatography, ion exchange chromatography, reverse phase chromatography, affinity chromatography, etc. Can be combined. In this case, fusicoccane-2,10 (14) diene can be identified using gas chromatograph mass spectrometry (GC-MS) or liquid chromatograph mass spectrometry (LC-MS) with the molecular weight as an index. it can.

(VII) Prenyltransferase and its gene The present invention also provides one enzyme constituting the fusicoccan synthesizing chimeric enzyme described above, that is, prenyltransferase and its gene.

  The prenyltransferase provided by the present invention is a prenyltransferase activity, preferably a prenyltransferase activity that catalyzes a chain extension reaction of a C5 isoprene unit to produce GGDP, more preferably IPP and DMAPP, GPP or FPP as a substrate. As having prenyltransferase activity to produce GGDP. The activity can be measured by the method described in (I).

  The prenyltransferase of the present invention is preferably a protein having an amino acid sequence consisting of 385 amino acid residues represented by SEQ ID NO: 2. However, the prenyltransferase of the present invention is not limited to a protein comprising such a specific amino acid sequence, and may be a functional equivalent thereof. Here, the functional equivalent consists of an amino acid sequence in which one or a plurality of amino acid sequences are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2, and consists of the amino acid sequence shown in SEQ ID NO: 2 above. Similar to protein, it is a protein having prenyltransferase activity. More preferably, as with the protein consisting of the amino acid sequence shown in SEQ ID NO: 2, the prenyltransferase activity (preferably IPP and DMAPP, GPP or CPP) that catalyzes the chain elongation reaction of the C5 isoprene unit to produce GGDP. It is a protein having prenyl transferase activity that produces GGDP using FPP as a substrate. More preferably, such functional equivalent has 85% or more, preferably 90% or more, more preferably 95% or more, and even more preferably 98% or more identity with the amino acid sequence shown in SEQ ID NO: 2. And a protein having the above-mentioned prenyltransferase activity.

  The present invention also provides a gene for the above prenyl transferase. Here, the gene includes genomic DNA, cDNA, synthetic DNA (recombinant DNA), and RNA.

  The said gene should just have a base sequence which codes the prenyl transferase mentioned above. Preferred examples of the prenyltransferase gene of the present invention include a gene consisting of the base sequence shown in SEQ ID NO: 5. The base sequence shown in SEQ ID NO: 5 is a base sequence encoding the amino acid sequence shown in SEQ ID NO: 2.

  However, the prenyl transferase gene of the present invention is not limited to one having such a specific base sequence, and has a base sequence encoding a functional equivalent of a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 described above. (This is also referred to as “homolog”). Specific examples of such a homolog include a gene comprising a base sequence that hybridizes under stringent conditions with DNA comprising a complementary sequence of the base sequence represented by SEQ ID NO: 5. Preferably, a gene comprising a base sequence represented by SEQ ID NO: 5 and a base sequence having an identity of 85% or more, preferably 90% or more, more preferably 95% or more, and further preferably 98% or more in the base sequence. is there.

  The prenyltransferase and the gene thereof of the present invention can be produced by chemical or genetic engineering techniques based on the amino acid sequence and base sequence disclosed in the present invention. For details of the production method by a genetic engineering technique, the description of the examples can be referred to. Further, the amino acid sequence can be modified by a method already known in the art, for example, site-directed mutagenesis [Current Protocols I molecular Biology, edit. Ausubel et al., John Wily & Sons, Section 8.1-8.5 (1987 )], Etc., can be used by appropriately introducing mutations such as substitution, deletion, insertion, addition and inversion into the amino acid sequence to be modified.

(VIII) Terpene Cyclase and Its Gene The present invention also provides another enzyme constituting the fusicoccane synthetic chimeric enzyme described above, that is, a terpene cyclase and its gene.

  The terpene cyclase provided by the present invention has terpene cyclase activity, preferably terpene cyclase activity that produces fusicocca-2,10 (14) -diene using GGDP as a raw material. The activity can be measured by the method described in (I).

  The terpene cyclase of the present invention is preferably a protein having an amino acid sequence consisting of 334 amino acid residues represented by SEQ ID NO: 1. However, the terpene cyclase of the present invention is not limited to a protein having such a specific amino acid sequence, and may be a functional equivalent thereof. Here, the functional equivalent consists of an amino acid sequence in which one or a plurality of amino acid sequences are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 1, and consists of the amino acid sequence shown in SEQ ID NO: 1 above. Similar to protein, it is a protein having terpene cyclase activity. More preferably, it is a protein having an activity of producing fusicoccane-2,10 (14) diene from GGDP, like the protein consisting of the amino acid sequence represented by SEQ ID NO: 1. More preferably, the functional equivalent has 85% or more, preferably 90% or more, more preferably 95% or more, and still more preferably 98% or more identity with the amino acid sequence shown in SEQ ID NO: 1. And a protein having the above-mentioned terpene cyclase activity.

  The present invention also provides the gene for the above-mentioned terpene cyclase. Here, the gene includes genomic DNA, cDNA, synthetic DNA (recombinant DNA), and RNA.

  The said gene should just have a base sequence which codes the terpene cyclase mentioned above. Preferred examples of the terpene cyclase gene of the present invention include a gene consisting of the base sequence shown in SEQ ID NO: 4. The base sequence shown in SEQ ID NO: 4 is a base sequence encoding the amino acid sequence shown in SEQ ID NO: 1.

  However, the terpene cyclase gene of the present invention is not limited to the one consisting of such a specific base sequence, but consists of a base sequence encoding a functional equivalent of a protein consisting of the amino acid sequence shown in SEQ ID NO: 1 described above (This is also referred to as “homolog”). Specific examples of such a homolog include a gene comprising a base sequence that hybridizes under stringent conditions with DNA comprising a complementary sequence of the base sequence represented by SEQ ID NO: 4. Preferably, a gene comprising a base sequence represented by SEQ ID NO: 4 and a base sequence having 85% or more, preferably 90% or more, more preferably 95% or more, and still more preferably 98% or more in the base sequence. is there.

  The terpene cyclase and the gene thereof of the present invention can be produced by chemical or genetic engineering techniques based on the amino acid sequence and base sequence disclosed in the present invention. For details of the production method by a genetic engineering technique, the description of the examples can be referred to. Further, the amino acid sequence can be modified by a method already known in the art, for example, site-directed mutagenesis [Current Protocols I molecular Biology, edit. Ausubel et al., John Wily & Sons, Section 8.1-8.5 (1987 )], Etc., can be used by appropriately introducing mutations such as substitution, deletion, insertion, addition and inversion into the amino acid sequence to be modified.

  EXAMPLES Hereinafter, although an Example is given and this invention is demonstrated further in detail, this invention is not limited to these Examples. The genetic engineering technique and molecular biological experimentation used in the present invention are generally performed by methods widely used, for example, molecular cloning by J., Sambrook, E., F., Frisch, T., Maniatis. Second edition (Molecular Cloning 2nd edition), published by Cold Spring Harbor Laboratory press, 1989, by D., M., Glover, DNA cloning, IRL published, 1985, etc. Can be done according to the method.

The meanings of the following abbreviations appearing in the examples below are as follows:
DTT: dithiothreitol
IPP: Isopentenyl pyrophosphate
FPP: Farnesyl pyrophosphate
GPP: Geranyl pyrophosphate
DMAPP: Dimethylallyl pyrophosphate
GGDP: Geranylgeranyl diphosphate
GGS: GGDP synthase
TES: N-Tris (hydroxymethyl) methyl-2-aminoethanesulfonic acid
IPTG: isopropyl-β-Diothiogalactoside.

  The measurement of (1) terpene cyclase activity and (2) prenyltransferase activity used in the following examples was performed according to the following procedure.

(1) Measurement of terpene cyclase activity Reaction solution (100 mM Tris-HCl, pH7.) Containing protein (30-50 μg), substrate, and proteinase inhibitor cockatail tablets 1/200 tablets (Complete, Roche Diagnostics). Prepare 500 μL of 4, 2 mM DTT, 0.5 mM EDTA 10% (w / w) glycerol, 6.8% pepstatin A) and incubate at 30 ° C. for 1-2 hours. As substrates, GGDP (Sigma Aldrich), FPP (Sigma Aldrich), GPP (Sigma Aldrich), and DMAPP (Sigma Aldrich) are each used (20 μg). When 10 μg of IPP (Sigma Aldrich) is added, the above FPP, GPP, and DMAPP are used at 10 μg each. After the reaction, the obtained reaction solution is extracted with n-hexane (about 3 times).

  After dehydration with anhydrous sodium sulfate treatment, concentrate under reduced pressure to about 80 μL with an evaporator, and use 2 μL for gas chromatography / mass spectrometry (GC-MS) under the following conditions to confirm the formation of fusicocan-2,10 (14) diene.

<Gas chromatograph mass spectrometry>
GC: Agilent 6890N GC system
MS: Agilent 5973N MSD
Data processing: Agilent ChemStation Carrier gas: Helium, flow rate 1 mL / min Injector: Splitless, 250 ° C
Column: HP-5MS, 30 m x ID 0.25 mm
Temperature rising program: 60 ° C, 2 minutes → 30 ° C / min (60-150 ° C) → 10 ° C / min (150-180 ° C)
→ 2 ℃ / min (180-210 ℃) → 30 ℃ / min (210-300 ℃) 300 ℃, 10 minutes Sample introduction part: 300 ℃.

(2) Measurement of prenyltransferase activity
50 mM TES buffer (pH8.0), 5 mM 2- mercaptoethanol, 5 mM MgCl 2, 50μM [1- 14 C] IPP (GE Healthcare Bioscience, CFA476, 2.15GBq / mmol), DMAPP of 50 [mu] M (SIGMA), GPP (SIGMA), or FPP (SIGMA) is added to the reaction solution containing the purified test protein so that the final concentration is 20 μg / ml, and the reaction is performed at 30 ° C. for about 1 to 12 hours. After the reaction, extraction with an equal amount of water-saturated 1-butanol is performed about 3 times to extract the reaction product. Concentrate the l-butanol layer to 50 μl, then add 100 μl methanol, 25 μl 1 M acetate buffer (pH 5.6), 25 μl 1% TritonX-100, 50 μl Acid phosphatase (SIGMA Acid phosphatase 37 Add 0.1 M acetic acid buffer solution (pH 5.6) so that the concentration is mg / ml), and react at 37 ° C overnight to perform dephosphorylation. Extract the reaction solution with 250 μl of pentane about twice, then wash the pentane layer with 500 μl of distilled water and collect the pentane layer by centrifugation (15,000 rpm, 30 minutes, 4 ° C.).

After concentrating these, 20 μl of hexane is added and dissolved, and developed with TLC [plate HPTLC plates RP-18F (SIGMA), developing solvent Aceton: H ₂ O = 9: 1]. The developed TLC is used to determine the carbon chain length of the reaction product by using BAS-2500 (Fujifilm) or the like. Under this condition, a dephosphorylation product corresponding to GGDP having 20 carbon atoms is detected with an Rf value of around 0.6, and a shorter one is detected with a larger Rf value.

Example 1 Isolation of cDNA Encoding Chimeric Enzyme (1) Plant pathogenic fungi ( P ) by gene walking based on GGDP synthase (GGS) gene and RT-PCR using degenerate primers amygdali ), two terpene cyclase-like genes, PaDC3 and PaDC4, were obtained.

  RT-PCR and gene walking were performed according to the following methods.

(1-1) RT-PCR
A phytopathogenic fungus ( Phosmobrachia ) ( Phomopsis amygdali Niigata) was used as a fusicoccin-producing bacterium. This was cultured with stirring and shaking at 25 ° C. for 3 days in a 500 ml flask (Biosci Biotechnol Biochem 68: 1608-1610, 2004). The formed mycelium was then collected and frozen with liquid nitrogen. Poly (A) ⁺ RNA was extracted from the frozen sample, and cDNA was prepared according to a conventional method (Plant Physiol 118: 1517-1523, 1998). Using the prepared cDNA pool as a template, RT-PCR was performed using the Advantage 2 PCR system (Clontech).

The degenerate primers and PCR conditions used in the isolation of the GGDP synthase (GGS) gene and the isolation of the terpene cyclase-like gene are as follows:
<Primer>
(a) isolation of the GGDP synthase (GGS) gene;
Sense primer: 5'-AAYAARACNGGNGGNYTNTT-3 '(SEQ ID NO: 7)
Antisense primer: 5'-CANARRTTCTARTARTCRTC-3 '(SEQ ID NO: 8)
(b) Isolation of terpene cyclase-like gene Sense primer: 5'-GCNATGGSNYTNACNATHCC-3 '(SEQ ID NO: 9)
Antisense primer: 5'-TARTCRTCNCKDATYTGRAA-3 '(SEQ ID NO: 10)
(In the above primer sequences, Y is T or C, R is G or A, N is A or G or C or T, S is G or C, H is A or C or T, K is G or T, D means A or G or T)
<PCR conditions>
Repeat 40 cycles of the following denaturation, annealing and extension reactions Denaturation: 94 ° C for 1 minute Annealing: 48 ° C for 1 minute (GGS gene) or 50 ° C for 1 minute (chimeric gene)
Elongation: 1 minute at 72 ° C.

  RACE was performed using specific primers according to the genomic DNA sequence according to the method described in Toyomasu et al. (Plant Physiol 118: 1517-1523, 1998).

(1-2) Genome Walking
Gene walking was performed using a Universal Genome Walker kit (Clontech). Using Nucleon PhytoPure Kit (manufactured by Amersham Pharmacia), genomic DNA was extracted from the mycelium prepared above to construct a gene walking library, and according to the instructions attached to the kit. This was used for nested PCR. Four restriction enzymes, Fsp I, Nru I, Sca I, and Ssp I were used in addition to Dra I, Eco RV, Pvu II, and Stu I attached to the kit.

  (2) Two types of terpene cyclase-like genes (PaDC3, PaDC4) were obtained by the above method. Specifically, PaDC3 was first obtained by gene walking (GGS was obtained with the above-mentioned GGDP synthase (GGS) gene primer and then walked), and degenerate primer (the terpene cyclase-like gene described above) based on the sequence. For PaDC4. Subsequently, the full-length sequence of the PaDC4 cDNA was sequenced.

  As a result, it was confirmed that the GGDP synthase gene (GGS gene) was fused to the 3 ′ end (hereinafter referred to as “PaDC4: GGS gene”). This cDNA was an 81 kDa gene (SEQ ID NO: 3) encoding 719 amino acid residues, and was judged to contain 8 intron insertion sites as judged from the corresponding chromosomal DNA sequence. The predicted primary structure (SEQ ID NO: 6) of this translation product (peptide) is unique, with a terpene cyclase domain (region 1-334) (SEQ ID NO: 4) on the N-terminal side and a prenyl transferase domain (SEQ ID NO: 4) on the C-terminal side. 335-719 region) (SEQ ID NO: 5) (FIG. 1). Among these, the terpene cyclase domain was approximately 20% identical to the aristolochene synthase, which is a filamentous fungus sesquiterpene cyclase, and similar at a rate of approximately 40%. On the other hand, the amino acid sequence of the prenyl transferase domain had high homology with GGS present in other filamentous fungi (about 40% identity and about 60% similarity).

In addition, it was confirmed that each domain has a common “DDxxD” motif. Specifically, it was confirmed that a “DDVTD” sequence was present in the 92-96 region in the terpene cyclase domain, and a “DDFQD” sequence was present in the 474-478 region in the prenyltransferase domain (FIG. 1B). The “DDxxD” motif is considered to be an Mg ²⁺ ion coordination region (Hohn ™ (1999) in Comprehensive Natural Products Chemistry vol 2, ed Cane D (Elsevier Science, Oxford), pp 201-21529).

When the BLAST homology search (http://www.ncbi.nlm.nih.gov/BLAST/) was performed on the registered database for the amino acid sequence of the peptide having such two domains, the fungus Coccidioides. 39% identical to the amino acid sequence of the peptide from Coccidioides immitis (EAS27885), 36% identical to the amino acid sequence of the peptide from Gibberella zeae (EAA68264), and the amino acid of the peptide from Chaetomium globosum (EAQ85668) It was found to be 35% identical to the sequence. From this, it was found that this chimeric terpene cyclase-like gene (PaDC4: GGS gene) is a novel gene that has not been known so far.

Example 2 Functional analysis of chimeric enzyme (PaDC4: GGS) In order to examine the function of the chimeric enzyme (PaDC4: GGS) obtained in Example 1, a fusion in which glutatin S-transferase (GST) was bound to the N-terminus A terpene cyclase assay was performed according to the method described above using protein (GST-PaDC4: GGS) and GPP, FPP, and GGDP as substrates.

  As a result, it was confirmed that GGDP was converted to a substance having a peak at a retention time of 13.2 minutes in GC-MS under the following conditions (peak 1 in FIG. 2A).

  This substance is fusicocca-2,10 (14) -diene from its retention time on GC-MS (Figure 2A) and mass spectrum (Figure 2C). Identified. 2B and C show the GC-MS (peak 2) and mass spectrum of the fusicocca-2,10 (14) -diene standard (Sassa T, et al., Biosci Biotechnol Biochem 68: 1608-1610, respectively). , 2004).

From this result, it was determined that the chimeric enzyme PaDC4: GGS obtained in Example 1 was a fusicocca-2,10 (14) -diene synthase. Therefore, the chimeric enzyme PaDC4: the GGS, was named "P a mygdali f usicoccadiene s ynthase ( PaFS). ". Hereinafter, it is referred to as “PaFS”.

  As described above, the PaFS has two domains, namely a terpene cyclase domain (1-334 region) on the N-terminal side and a prenyltransferase domain (335-719 region) on the C-terminal side ( FIG. 1B).

  Therefore, using a fusion protein (GST-PaFS) in which glutatin S-transferase (GST) is bound to the N-terminus, using IPP as a substrate and DMAPP, GPP, or FPP, a terpene in the same manner as described above. A cyclase assay was performed.

  As a result, when DMAPP, GPP, or FPP was used as the substrate, Fusicocca-2,10 (14) -diene was obtained as the main product, as was the case when GGDP was used as the substrate. From the results of this experiment, the chimeric enzyme PaFS is an enzyme having the activity of converting isoprene units into GGDP sequentially and further converting the generated GGDP into fusicocca-2,10 (14) -diene, in other words, It was found to be a multifunctional diterpene synthase having both prenyl transferase activity (prenyl chain extension activity) and terpene cyclase activity (terpene cyclization activity).

Example 3 Construction of a transformant expressing PaFS and production of PaFS using the same (1) Plasmid construction
(1-1) ORF cDNA amplification and subcloning
BD AdvantageII Polymerase Mix (Clontech), BD Advantage HF2 PCR Kit (Clontech), and primers (PaDC4 ORF F / EcoRI for ORF amplification: GAATTC TATGGAGTTCAAATACTCGGA (SEQ ID NO: 11), PaDC4 ORF R / NotI: GCGGCCGC ACAACCGTCAGAGTTACGAG (SEQ ID NO: 12) Underlined with each restriction enzyme site), RT-PCR was performed (cycle number: 25-35) to amplify PaFS ORF cDNA. The obtained PCR product was analyzed by 1% TAE agarose gel electrophoresis, and subcloned using the pGEM-T easy vector (Promega) and Ligation kit ver. 1 (Takara Bio) according to the following method.

(1-2) Preparation of expression plasmids From the plasmid in which the PaFS ORF cDNA prepared in this way was incorporated into pGEM, using restriction enzymes EcoRI (Toyobo) and NotI (Toyobo) with sites added to the ends, respectively. ORF-cDNA was excised. The restriction enzyme reaction solution was prepared in 20 μL containing plasmid (200 ng), 10 × H buffer (2 μL), EcoRI (10 units) and NotI (9 units). Similarly, the expression vector pGEX-4T-3 (GE Healthcare Bioscience) (2 μg) was digested with EcoRI (30 units) and NotI (27 units) at 37 ° C. for 12 hours. These reaction solutions were stopped by phenol / chloroform extraction and concentrated and purified by ethanol precipitation.

  The purified product was subjected to 0.7% agarose gel electrophoresis and cut out according to the manual using Sephagras band prep kit (GE Healthcare Bioscience). Using DNA Ligation Kit Ver.2.1 (Takara Bio), the excised ORF-cDNA was ligated to expression vector pGEX (GE Healthcare Bioscience) at a molar ratio of 1: 1 and transformed into E. coli (XL1-Blue). did. Sequence analysis was performed using the plasmid extracted and purified from the obtained Escherichia coli, and the sequence of the junction between the vector and the insert was confirmed.

(2) Expression and purification of recombinant PaFS The above E. coli was cultured at 37 ° C. in LB / amp liquid medium until OD ₆₀₀ was 0.6-1.0. After adding IPTG to a final concentration of 0.1 mM, the cells were cultured at 17 ° C. for 20 hours to induce expression of the recombinant protein. After collection by centrifugation at 8400 g for 5 minutes at 4 ° C, PBS buffer (137 mM NaCl, 8.1 mM Na ₂ HPO ₄ , 2.68 mM KCl, 1.47 mM KH ₂ PO _4, pH 7.4 ), And ultrasonically disrupted with an ice bath (Ultrasonic Processor). After centrifugation at 8400 g, 4 ° C. for 5 minutes, the supernatant was used as a soluble protein fraction. From this soluble fraction, recombinant GST-fused PaFS was purified according to the manual using Sepharose 4B glutathione affinity resin (GE Healthcare Bioscience). SDS-PAGE was performed according to the method of Laemmli (1970). The concentration of the obtained protein was measured using Bio Rad protein assay system (Japan Bio-Rad Lab Series).

Example 4 Identification of Terpene Cyclase Domain and Prenyltransferase Domain
(1) Preparation of deletion mutants and evaluation of their activity
In order to examine the function of each PaFS domain (terpene cyclase domain and prenyltransferase domain), a plurality of mutants with N-terminal or C-terminal cleavage were prepared (see FIG. 3). Specifically, as shown in FIG. 3A, N334 (fragment having a 1-334 region: 38 kDa), N390 (fragment having a 1-390 region: 44 kDa), N436 (fragment having a 1-436 region: 49 kDa), N493 (fragment with 1-493 region: 56 kDa), and C385 (fragment with 335-719 region: 43 kDa). The full-length PaFS consisting of 719 amino acid residues has a molecular weight of 81 kDa.

  The above mutants were prepared as follows.

  The cDNA subjected to RT-PCR was amplified using the cDNA pool prepared from the fusicoccin-producing bacterium in Example 1 as a template. The primers used in RT-PCR are as follows: The underlined part is the restriction enzyme site described in parentheses.

F1, sense: 5'- GAATTC TATGGAGTTCAAATACTCGGA-3 '( Eco RI) (SEQ ID NO: 13)
F2, sense: 5'- GAATTC GACACAATTGGAATGGATGC-3 '( Eco RI) (SEQ ID NO: 14)
R1, antisense: 5'- GCGGCCGC ACAACCGTCAGAGTTACGAG-3 '( Not I) (SEQ ID NO: 15)
R2, antisense: 5'- GCGGCCGC TCAAAAGATGTTATGCGTCGAC-3 '( Not I) (SEQ ID NO: 16)
R3, antisense: 5'- GCGGCCGC TCATCCTTTAGATGGCATGGAA-3 '( Not I) (SEQ ID NO: 17)
R4, antisense: 5'- GCGGCCGC TCACAGCGAAGAATCCTGCCTA-3 '( Not I) (SEQ ID NO: 18)
R5, antisense: 5′- GCGGCCGC TCACTTGTTGAATGAAACATCT-3 ′ ( Not I) (SEQ ID NO: 19).

  To amplify cDNAs encoding PaFS and its mutants (deletion mutants) N493, N436, N390, N334 and C385, the above primers were used as F1-R1, F1-R2, F1-R3, F1- Used in combination with R4, F1-R5, and F2-R1.

(1-1) Preparation of plasmid In order to digest a subcloned PCR product with Eco RI and Not I, and then express a fusion protein having GST at the N-terminus, an expression vector (pGEX-4T-3) (GE Health (Care Bioscience). Subsequently, after transforming E. coli XL1-Blue (stratagene), the transformant was applied to an LB agar medium containing 50 μg / ml of ampicillin and cultured at 37 ° C. overnight. Several colonies of ampicillin resistant transformants that had grown were cultured with shaking in 5 ml of LB liquid medium containing 50 μg / ml of ampicillin at 37 ° C. for 16 hours. Bacterial cells were obtained by centrifuging the obtained culture solution. A plasmid was isolated from the cells according to a conventional method. The plasmid isolated by this method was cleaved with various restriction enzymes, the structure was examined, and the nucleotide sequence was determined to confirm that the plasmid had the target DNA fragment inserted (hereinafter referred to as “ This plasmid ").

(1-2) Evaluation of terpene cyclase activity and prenyl transferase activity Regarding terpene cyclase activity, enzyme preparation and activity were measured according to the method described above. The terpene cyclase activity was performed using GGDP (20 μg each) as a substrate. In addition, the prenyltransferase activity was prepared as follows. After transforming E. coli BL21 for expression with this plasmid (GE Healthcare Biosciences), cultivate LB / Ampicillin (100 μg / ml) /0.2% glucose at 37 ° C. until OD600 reaches 0.5 to 0.8. Chilled on ice. IPTG was added to the rapidly cooled culture solution to a final concentration of 0.1 mM, and the cultured cells were further cultured at 18 ° C., and then collected and suspended in Column buffer. The suspension was crushed with an ultrasonic crusher (strength 8, 1 min × 10, interval 1 min TOMY), centrifuged (15,000 rpm, 30 min, 4 ° C HITACHI himac CR 20E), and the soluble fraction was added to Glutathion Sepharose. The target GST-fusion protein was purified using 4B (GE Healthcare Bioscience Co., Ltd.). In addition, the size and purity of the purified recombinant protein were confirmed by SDS-PAGE (10%). About each obtained enzyme, prenyl transferase activity was measured according to the method mentioned above. As the substrate, FPP and labeled IPP were used.

(1-3) Results As a result, the deletion mutants N390, N436 and N493 showed cyclase activity that catalyzes the reaction from GGDP to fusicocca-2,10 (14) -diene, similar to full-length PaFS. . In particular, N390 and N436 had terpene cyclase activity even though they did not contain the “DDFQD” motif present in the prenyltransferase domain. On the other hand, N334 and C385 did not show the terpene cyclase activity (indicated by “CA” in FIG. 3A). C385 showed activity to catalyze the production of GGDP from IPP and FPP (prenyltransferase activity), but none of the other deletion mutants lacking the C-terminal region showed prenyltransferase activity. (Indicated as “PA” in FIG. 3A).

(2) Preparation of point mutants and evaluation of their activity In order to investigate the role of the “DDxxD” motif in each domain, two point mutants, D92A and D474A (FIG. 3B) were prepared. The displacement bodies (D92A and D474A) are obtained by replacing the first aspartic acid with nonpolar alanine as shown in FIG. 3B.

  The point mutant was prepared according to a conventional site-directed mutagenesis method. Specifically, the RT-PCR described above was performed by overlap extension PCR (Nucleic Acids Res 16: 7351-7367, 1988) using the following primer set.

D92A
Sense primer: 5'-TCTGCACG C TGATGTTACCGAC-3 '(underlined portion is the mutation site) (SEQ ID NO: 20)
Antisense primer: 5'-CGGTAACATCA G CGTGCAGAAAGG-3 '( underlined mutation site) (SEQ ID NO: 21).

D474A
Sense primer: 5'-GCTGCTCG C CGACTTCCAAGACA-3 '(underlined part is the mutation site) (SEQ ID NO: 22)
Antisense primer: 5'-TCTTGGAAGTCG G CGAGCAGCAG-3 '(underlined portion is the mutation site) (SEQ ID NO: 23).

The subcloned PCR product is digested with Eco RI and Not I, and then expressed in the expression vector (pGEX-4T-3) (GE Healthcare Bioscience) to express a fusion protein (GST-PaFS) with GST at the N-terminus. ) Using the obtained plasmid, terpene cyclase activity and prenyltransferase activity were measured in the same manner as described above.

  As a result, D474A in which only the “DDFQD” motif in the prenyltransferase domain was mutated to “ADFQD” had the activity of converting GGDP to fusicocca-2,10 (14) -diene (terpene cyclase). Activity), D92A obtained by mutating the “DDVTD” motif of the terpene cyclase domain with “ADVTD” did not show the activity (indicated by “CA” in FIG. 3B). On the other hand, prenyl transferase activity showed the opposite, D92A, which mutated the terpene cyclase domain “DDVTD” motif to “ADVTD”, showed prenyl transferase activity, but the “DDFQD” motif present in the prenyl transferase domain. D474A in which was mutated to “ADFQD” did not show its activity (indicated as “PA” in FIG. 3B).

  From these results, a 44-kDa peptide located in the N-terminal region of PaFS exhibits terpene cyclase activity and catalyzes the cyclization reaction of GGDP, while a 43-kDa peptide located in the C-terminal region exhibits prenyltransferase activity. And was confirmed to be involved in the synthesis of GGDP.

Example 5 Production of Fusicocca-2,10 (14) -diene using a transformant expressing PaFS.
The transformant (E. coli) expressing PaFS prepared in Example 3 was cultured at 37 ° C. in an LB / amp liquid medium until the OD ₆₀₀ became 0.6 to 1.0. After adding IPTG to a final concentration of 0.1 mM, the cells were cultured at 17 ° C. for 20 hours. This was collected by centrifugation at 8400 xg, 4 ° C for 5 minutes, and the resulting pellet was suspended in an appropriate amount of demineralized water, and then 2 to 3 times the total amount of acetone was added, and 40 ° C, 5 minutes. Extracted. After filtration with absorbent cotton, the solution was concentrated under reduced pressure. The water-soluble residue was extracted with n-hexane, dehydrated with anhydrous sodium sulfate, concentrated under reduced pressure, and purified by adsorbing impurities with a silica gel column (BM-820MH, Fuji Silysia Chemical, Aichi, Japan).

This was subjected to gas chromatograph mass spectrometry (GC-MS) under the following conditions.
<Gas chromatograph mass spectrometry>
GC: Agilent 6890N GC system
MS: Agilent 5973N MSD
Data processing: Agilent ChemStation Carrier gas: Helium, flow rate 1 mL / min Injector: Splitless, 250 ° C
Column: HP-5MS, 30 m x ID 0.25 mm
Temperature rising program: 60 ° C, 2 minutes → 30 ° C / min (60-150 ° C) → 10 ° C / min (150-180 ° C)
→ 2 ℃ / min (180-210 ℃) → 30 ℃ / min (210-300 ℃) 300 ℃, 10 minutes Sample introduction part: 300 ℃.

  As a result, a large amount of Fushicoca-2,10 (14) -diene was detected (FIG. 4B, peak 3), and Fushicocca-2, It was confirmed that 10 (14) -diene was produced and accumulated.

(A) A chromosome map around PaFS is shown. In the figure, ▼ indicates the starting point of gene walking. "C" in the figure, notation "D", "E", "F", "P" and "S", restriction enzyme Sca I were used in gene walking, Dra I, Eco RV, Fsp I, Pvu II and Stu I are shown respectively. The direction and area of transcription are indicated by arrows. In the figure, “orf1,” “orf2,” “orf3,” “orf4,” and “orf5” are “2-oxo-glutarate-dependent dioxygenase-like gene”, “P450 monooxygenase-like gene”, “short-chain dehydrogenase”, respectively. / reductase-like gene ”,“ alpha-mannosidase-like gene ”and“ Nop14-like gene ”. (B) A schematic diagram of the two main domains of PaFS. The black region on the N-terminal side indicates the terpene cyclase domain, and the gray region on the C-terminal side indicates the prenyltotransferase domain. In the figure, ▽ indicates the “DDxxD” motif region of each domain. The GC-MS result of the reaction produced | generated from GGDP in the terpene cyclase assay (Example 2) using a GST-PaFS fusion protein is shown. (A) A total ion chromatogram of a reaction product generated by incubation of GST-PaFS fusion protein and GGDP. (B) The total ion chromatogram of the hydrocarbon fraction of the mycelium of Phomopsis amygdali N2. (C) Full-scan mass spectrum of peak 1 in FIG. (D) Full-scan mass spectrum of Fusicocca-2,10 (14) -diene (peak 2 in Fig. B), which is a standard product. The cyclase activity (CA) and prenyl transferase activity (PA) of the mutant protein are shown. The black area of each bar represents the terpene cyclase domain, and the gray area represents the phenylene transferase domain. ▽ indicates the “DDxxD” motif region of each domain. It is the result of evaluating the accumulation of Fusicocca-2,10 (14) -diene in E. coli introduced with GST-PaFS. (A) The result of having confirmed the presence or absence of expression of recombinant protein (GST-PaFS) with the CBB-stained SDS-PAGE gel is shown. Lane 1: GST (vector control), Lane 2: GST-GfCPS / KS (Gibberella fujikuroi-derived ent-kaurene synthase, about 130 kDa), Lane 3: GST-PaFS (about 110 kDa). In the figure, Δ indicates the band of each recombinant protein. (B) Chromatogram of hydrocarbon fraction obtained from E. coli expressing GST-PaFS. The mass spectrum of peak 3 matched the mass spectrum shown in FIGS. 2C and D (results shown). A schematic diagram of a synthesis scheme of fusicocca-2,10 (14) -diene catalyzed by PaFS is shown. First, GGDP is generated from the isoprene unit by the prenyl transferase activity of the prenyltransferase domain of PaFS, and then fusicocca-2,10 (14) -diene is generated from GGDP by the terpene cyclization activity of the terpene cyclase domain of PaFS. PaFS is a novel diterpene hydrocarbon synthase that has both prenyltransferase activity and terpene cyclization activity.

SEQ ID NO: 7 shows the base sequence of the sense primer used for the isolation of the GGDP synthase (GGS) gene.
SEQ ID NO: 8 shows the base sequence of the antisense primer used for the isolation of the GGDP synthase (GGS) gene.
SEQ ID NO: 9 shows the base sequence of the sense primer used for isolation of the terpene cyclase-like gene.
SEQ ID NO: 10 shows the salt sequence of the antisense primer used for isolation of the terpene cyclase-like gene.
SEQ ID NO: 11 shows the salt sequence of a primer used for the amplification of PaFS ORF cDNA.
SEQ ID NO: 12 shows the salt sequence of a primer used for amplification of PaFS ORF cDNA.
SEQ ID NO: 13 shows the salt sequence of the F1 sense primer used to prepare the PaFS deletion mutant.
SEQ ID NO: 14 shows the salt sequence of the F2 sense primer used to prepare the PaFS deletion mutant.
SEQ ID NO: 15 shows the salt sequence of the R1 antisense primer used to prepare the PaFS deletion mutant.
SEQ ID NO: 16 shows the salt sequence of the R2 antisense primer used for the preparation of the PaFS deletion mutant.
SEQ ID NO: 17 shows the salt sequence of the R3 antisense primer used to prepare the PaFS deletion mutant.
SEQ ID NO: 18 shows the salt sequence of the R4 antisense primer used to prepare the PaFS deletion mutant.
SEQ ID NO: 19 shows the salt sequence of the R5 antisense primer used to prepare the PaFS deletion mutant.
SEQ ID NO: 20 shows the salt sequence of the sense primer used for the preparation of the PaFS point mutant (D92A).
SEQ ID NO: 21 shows the salt sequence of the antisense primer used for the preparation of the PaFS point mutant (D92A).
SEQ ID NO: 22 shows the salt sequence of the sense primer used for the preparation of the PaFS point mutant (D474A).
SEQ ID NO: 23 shows the salt sequence of the antisense primer used for the preparation of the PaFS point mutant (D474A).

Claims (17)

Fusicoccan synthesis having a terpene cyclase domain consisting of the amino acid sequence described in (a) or (b) in the N-terminal region and a prenyltransferase domain consisting of the amino acid sequence described in (c) or (d) in the C-terminal region Chimeric enzyme:
(A) the amino acid sequence shown in SEQ ID NO: 1,
(B) an amino acid sequence obtained by deleting, substituting or adding one or a plurality of amino acid sequences in the amino acid sequence shown in SEQ ID NO: 1, wherein the amino acid sequence encodes a protein having terpene cyclase activity;
(C) the amino acid sequence shown in SEQ ID NO: 2,
(D) an amino acid sequence obtained by deleting, substituting, or adding one or more amino acid sequences in the amino acid sequence shown in SEQ ID NO: 2, and encoding a protein having prenyltransferase activity. The fusicoccan synthesizing chimeric enzyme according to claim 1, comprising the amino acid sequence described in (A) or (B) below:
(A) the amino acid sequence shown in SEQ ID NO: 3,
(B) An amino acid sequence obtained by deleting, substituting, or adding one or more amino acid sequences in SEQ ID NO: 3, and encoding a protein having terpene cyclase activity and prenyl transferase activity. It consists of a base sequence encoding a terpene cyclase domain consisting of the amino acid sequence described in (a) or (b) in the 5 ′ side region, and an amino acid sequence described in (c) or (d) in the 3 ′ side region. Fusicoccan synthetic chimeric enzyme gene having a base sequence encoding a prenyltransferase domain:
(A) the amino acid sequence shown in SEQ ID NO: 1,
(B) an amino acid sequence obtained by deleting, substituting or adding one or a plurality of amino acid sequences in the amino acid sequence shown in SEQ ID NO: 1, wherein the amino acid sequence encodes a protein having terpene cyclase activity;
(C) the amino acid sequence shown in SEQ ID NO: 2,
(D) an amino acid sequence obtained by deleting, substituting, or adding one or more amino acid sequences in the amino acid sequence shown in SEQ ID NO: 2, and encoding a protein having prenyltransferase activity. The fusicoccan synthetic chimeric enzyme gene according to claim 3, which has a base sequence encoding the amino acid sequence described in (A) or (B) below:
(A) the amino acid sequence shown in SEQ ID NO: 3,
(B) An amino acid sequence obtained by deleting, substituting, or adding one or more amino acid sequences in SEQ ID NO: 3, and encoding a protein having terpene cyclase activity and prenyl transferase activity. A base sequence encoding the terpene cyclase domain described in (i) or (ii) in the 5 ′ side region, and a base sequence encoding the prenyltransferase domain described in (iii) or (iv) in the 3 ′ side region The fusicoccan synthetic chimeric enzyme gene according to claim 3 or 4, which has
(I) the base sequence shown in SEQ ID NO: 4,
(Ii) a base sequence having at least 85% identity with the base sequence shown in SEQ ID NO: 4 and encoding a protein having terpene cyclase activity;
(Iii) the base sequence shown in SEQ ID NO: 5,
(Iv) A nucleotide sequence having at least 85% identity with the nucleotide sequence shown in SEQ ID NO: 5 and encoding a protein having prenyl transferase activity. The fusicoccan synthetic chimeric enzyme gene according to any one of claims 3 to 5, which has the base sequence described in (I) or (II) below:
(I) the base sequence shown in SEQ ID NO: 6,
(II) A base sequence having at least 85% identity with the base sequence shown in SEQ ID NO: 6 and encoding a protein having terpene cyclase activity and prenyl transferase activity.   A recombinant vector containing the fusicoccan synthetic chimeric enzyme gene according to any one of claims 3 to 6.   A transformant obtained by transforming a host cell with the recombinant vector according to claim 7.   The transformant according to claim 8, wherein the host cell is Escherichia coli.   The method comprising culturing the transformant according to claim 8 or 9 in a medium, and, if necessary, collecting a protein having terpene cyclase activity and prenyl transferase activity from the obtained culture. 2. A method for producing a fusicoccan synthetic chimeric enzyme described in 2.   A step of culturing the transformant according to claim 8 or 9 in a medium, and if necessary, collecting Fusicocca-2,10 (14) -diene from the obtained culture, A process for producing 2,10 (14) -diene. Terpene cyclizing enzyme consisting of the amino acid sequence described in the following (a) or (b):
(A) the amino acid sequence shown in SEQ ID NO: 1,
(B) an amino acid sequence obtained by deleting, substituting or adding one or more amino acid sequences in the amino acid sequence shown in SEQ ID NO: 1, and encoding an amino acid sequence having terpene cyclase activity. A terpene cyclase gene comprising a base sequence encoding the amino acid sequence described in (a) or (b):
(A) the amino acid sequence shown in SEQ ID NO: 1,
(B) an amino acid sequence obtained by deleting, substituting or adding one or more amino acid sequences in the amino acid sequence shown in SEQ ID NO: 1, and encoding an amino acid sequence having terpene cyclase activity. The 2-terpene cyclase gene according to claim 13, which comprises the base sequence described in (i) or (ii) below:
(I) the base sequence shown in SEQ ID NO: 4,
(Ii) a base sequence having at least 85% identity with the base sequence shown in SEQ ID NO: 4 and encoding a protein having terpene cyclase activity; A prenyltransferase comprising the amino acid sequence described in (c) or (d) below:
(C) the amino acid sequence shown in SEQ ID NO: 2,
(D) an amino acid sequence obtained by deleting, substituting, or adding one or more amino acid sequences in the amino acid sequence shown in SEQ ID NO: 2, and encoding a protein having prenyltransferase activity. A prenyltransferase gene comprising a base sequence encoding the amino acid sequence described in (c) or (d):
(C) the amino acid sequence shown in SEQ ID NO: 2,
(D) an amino acid sequence obtained by deleting, substituting, or adding one or more amino acid sequences in the amino acid sequence shown in SEQ ID NO: 2, and encoding a protein having prenyltransferase activity. The prenyltransferase gene according to claim 16, which comprises the base sequence described in the following (iii) or (iv):
(Iii) the base sequence shown in SEQ ID NO: 5,
(Iv) A nucleotide sequence having at least 85% identity with the nucleotide sequence shown in SEQ ID NO: 5 and encoding a protein having prenyl transferase activity.

Images