JP2008237030A - New apoptosis-inducing protein and gene encoding the same - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a new protein having apoptosis-induction activity, to provide a gene composed of a DNA encoding the new protein, to provide an antibody against the protein, to provide a recombinant vector comprising the gene, to provide a transformant in which the recombinant vector is introduced and to provide an apoptosis inducer, etc. <P>SOLUTION: The protein having a specific amino acid sequence, the gene composed of the DNA encoding the protein, the antibody against the protein, the recombinant vector comprising the gene and the transformant in which the recombinant vector is introduced are utilized. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a novel protein having apoptosis-inducing activity and a gene comprising DNA encoding the same. The present invention also relates to an antibody against the protein, a recombinant vector containing the gene, and a transformant into which the recombinant vector has been introduced. Furthermore, the present invention relates to an apoptosis inducer containing the protein, the gene or the recombinant vector, and a pharmaceutical comprising the protein, the gene or the recombinant vector as an active ingredient.

  Mitochondria are extremely important organs involved in various cellular processes such as energy production, proliferation, and apoptosis (Non-patent Document 1). Mitochondria frequently change their morphology through division and fusion (Non-patent Document 2). Proteins involved in mitochondrial division and fusion are conserved in lower and higher eukaryotes, and this protein controls mitochondrial-dependent apoptosis (Non-patent Document 3). In addition to these proteins, cardiolipin (CL), a mitochondrial-specific phospholipid, apparently functions as a regulator of mitochondrial fission and fusion after migrating from the inside to the outside of the mitochondrial membrane (Non-Patent Documents 4 to 8). Although the mechanism of mitochondrial division and fusion is gradually elucidated, little research has been conducted on the formation of mitochondrial networks in living cells.

On the other hand, apoptosis of cells (cell death) is known as an important phenomenon in keeping living tissue in a normal state. For example, cancer cells can be defined as cells that proliferate indefinitely without the apoptotic mechanism functioning normally.
Apoptosis (cell death) is known to be induced by various substances. Therefore, it is possible to artificially induce apoptosis by giving such a substance to a target cell (for example, a cancer cell or a virus-infected cell) and kill the target cell. As a substance capable of inducing apoptosis, for example, Patent Document 1 describes a protein derived from a dengue virus as a substance capable of inducing apoptosis, and Patent Document 2 describes an inducibility of apoptosis derived from a snake venom gland of the Viperidae. Proteins are described, and Patent Document 3 describes a polypeptide that can enhance apoptosis induction of cells via Fas, which is a cell surface receptor.

International Publication No. WO2001 / 096376 Pamphlet Japanese Patent Laid-Open No. 11-1496 JP 2001-193 A D. D. Newmeyer et al., Cell 112, 481 (2003) M. P. Yaffe et al., Science 283, 1493 (1999) R. J. Youle et al., Nat. Rev. Mol. Cell Biol. 6, 657 (2005) B. Jeanie et al., Biochim. Biophys. Acta. 1585, 97 (2002) M. Garcia-Fernandez et al., Cell Growth Differ. 13, 449 (2002) M. Sorice et al., Cell Death Differ. 11, 1133 (2004) M. D. Esposti et al., Cell Death Differ. 10, 1300 (2003) S. Y. Chioi et al., Nat. Cell Biol. 8, 1255 (2006)

  An object of the present invention is to provide a novel protein having apoptosis-inducing activity, a gene comprising DNA encoding the same, an antibody against the protein, a recombinant vector containing the gene, a transformant into which the recombinant vector is introduced, apoptosis induction It is to provide an agent.

  The present inventors conducted protein phosphorylation signal analysis using a lysate of A431 cells stimulated with epidermal growth factor (EGF), whereby a protein having a binding activity to CL and phosphatidic acid (cardiolipin and phosphatidic acid binding). protein; hereinafter referred to as “CLPABP”), the cDNA of the CLPABP was found to be gi No. 14149786 (Genbank Accession No. NM_032129_1) cloned by the Human Genome Analysis Project, and the CLPABP Overexpression in the cell has been found to induce apoptosis, and the present invention has been completed. The deduced amino acid sequence of the CLPABP is shown in FIG. 1 (SEQ ID NO: 2). In addition, FIG. 2 shows the positions of two plextrin homologous (PH) regions which are considered to be the putative functional regions of the CLPABP.

  That is, the present invention relates to (1) (a) a protein comprising the amino acid sequence represented by SEQ ID NO: 2 or (b) one or several amino acids deleted, substituted or substituted in the amino acid sequence represented by SEQ ID NO: 2. A gene consisting of an added amino acid sequence and a DNA encoding a protein having apoptosis-inducing activity, or (2) the nucleotide sequence of nucleotide numbers 36 to 1868 of the nucleotide sequence shown in SEQ ID NO: 1 or a complementary sequence thereof, or A gene comprising a DNA comprising a sequence containing a part or all of these sequences, or (3) a protein that hybridizes with the DNA described in (2) above under stringent conditions and has apoptosis-inducing activity And (4) a gene comprising any one of (1) to (3), and A recombinant vector capable of expressing a apoptosis-inducing protein, (5) a transformant in which the recombinant vector described in (4) is introduced and expressing an apoptosis-inducing protein, and (6) a transformant The transformant according to (5) above, which is an animal.

  The present invention also relates to (7) a protein comprising the amino acid sequence represented by SEQ ID NO: 2, (8) a protein having a partial amino acid sequence of the amino acid sequence represented by SEQ ID NO: 2 and having apoptosis-inducing activity, (9) a protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2 and having apoptosis-inducing activity, or (10) SEQ ID NO: 2 A protein having an amino acid sequence in which one or several amino acids are deleted, substituted or added in a part of the amino acid sequence shown, and having apoptosis-inducing activity; (11) shown in SEQ ID NO: 2 A part of the amino acid sequence of the amino acid sequence of the amino acid sequence shown in SEQ ID NO: 2 The protein according to (8) or (10), the protein according to any one of (7) to (11), and a marker protein And / or a fusion protein bound with a peptide tag, (13) the protein according to any one of (7) to (11), or the antibody against the fusion protein according to (12), (14) The protein according to any one of (7) to (11) or the apoptosis inducer containing the fusion protein according to (12), or (15) any one of (1) to (3) Or an apoptosis inducer containing the recombinant vector according to (4) above.

  Furthermore, the present invention relates to (16) expressing the protein according to any one of (7) to (11) or the fusion protein according to (12) above in a target cell, thereby causing apoptosis of the cell. (17) The method according to (16), wherein the protein is expressed by introducing the gene according to any one of (1) to (3) into a target cell, (18) A pharmaceutical comprising the protein according to any of (7) to (11) or the fusion protein according to (12) as an active ingredient, and (19) prevention / treatment of inducing apoptosis The medicament according to (18) above, which is a prophylactic / therapeutic agent for diseases, and (20) diseases are cancer, autoimmune disease, viral infection, endocrine disease, blood disease, organ hyperplasia, angioplasty Post-restenosis and Wherein it is selected from the group consisting of cancer resection of postoperative recurrence (19) a pharmaceutical according.

  The protein of the present invention having apoptosis-inducing activity, the gene of the present invention encoding the protein, the recombinant vector containing the gene, the antibody against the protein of the present invention, etc. have a mechanism of mitochondrial network formation and apoptosis at the molecular level. It can be used for elucidation. In addition, apoptosis can be induced by using the protein of the present invention, the gene of the present invention encoding the protein, a recombinant vector containing the gene, etc., so the protein or gene of the present invention is used. By inducing apoptosis in diseased cells, it may be applicable to the prevention and treatment of diseases. In addition, since the protein of the present invention itself has the property of being localized in the mitochondria and aposome (apoptosis execution place) in the cell, it is more effective intracellular targeting than other apoptosis inducers. Is considered possible.

  Examples of the gene of the present invention include a gene consisting of a DNA encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 2, and one or several amino acids deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2. A nucleotide sequence of nucleotide numbers 36-1868 of the nucleotide sequence shown in SEQ ID NO: 1 or a complementary sequence thereof, or a complementary sequence thereof, From a gene consisting of a DNA comprising a sequence including part or all of the base, a base sequence of base numbers 36 to 1868 of the base sequence shown in SEQ ID NO: 1 or a complementary sequence thereof, or a sequence including part or all of these sequences And DNA under a stringent condition, and It can be exemplified a gene of DNA encoding a protein having a scan inducing activity. The base numbers 36 to 1868 of the base sequence shown in SEQ ID NO: 1 are the coding region of the amino acid sequence shown in SEQ ID NO: 2.

  The origin of the gene of the present invention is not particularly limited. For example, human (gi No. 14149786; Genbank Accession No. NM_032129_1), rhesus monkey (gi No. 108995452; Genbank Accession No. XR_010934), dog (gi No. 73956457; Genbank Accession No. XM_546726), cattle (gi No. 76637790; Genbank Accession No. XM_598312), rats (gi No. 109477818; Genbank Accession No. XM_001078287), mice (gi No. 22749601; Genbank Accession No. BC031374) , Fish such as pufferfish (gi No. 47228599; Genbank Accession No. CAAE01014991), zebrafish (gi No. 125852117; Genbank Accession No. XM_001345356), and Xenopus (gi No. 50415259, 49118112; Genbank Accession No. BC077452, Examples include amphibians such as BC073066). The gene of the present invention can be prepared from a gene library such as a human or a cDNA library by a known method, for example, a RACE method using total RNA, based on such DNA sequence information.

  The above-mentioned “amino acid sequence in which one or several amino acids are deleted, substituted or added” is, for example, 1 to 20, preferably 1 to 15, more preferably 1 to 10, and further preferably 1 Means an amino acid sequence in which any number of amino acids of ~ 5 has been deleted, substituted or added. A protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added can also be prepared by any method known to those skilled in the art, such as chemical synthesis, genetic engineering techniques, and mutagenesis. Specifically, the DNA consisting of the base sequence shown in SEQ ID NO: 1 is mutated into these DNAs by using a method of contacting with a mutagen agent, a method of irradiating with ultraviolet rays, a genetic engineering technique, etc. Mutant DNA can be obtained by introducing. Site-directed mutagenesis, which is one of genetic engineering methods, is useful because it can introduce a specific mutation at a specific position. Molecular cloning 2nd edition, Current Protocols in Molecular Biology, Supplement 1 ~ 38, John Wiley & Sons (1987-1997) and the like. By expressing this mutant DNA using an appropriate expression system, a protein having an amino acid sequence in which one or several amino acids are deleted, substituted or added can be obtained.

  In addition, it hybridizes under stringent conditions with DNA comprising the nucleotide sequence of nucleotide numbers 36 to 1868 of the nucleotide sequence shown in SEQ ID NO: 1 or a complementary sequence thereof, or a sequence containing a part or all of these sequences. “DNA to be used” is a stringent sequence to various DNA libraries using the nucleotide sequence of nucleotide numbers 36 to 1868 of the nucleotide sequence shown in SEQ ID NO: 1 or a complementary sequence thereof and a part or all of these sequences as probes. It can also be obtained by performing hybridization under conditions and isolating DNA that hybridizes to the probe. Examples of hybridization conditions for obtaining such DNA include hybridization at 42 ° C. and washing treatment at 42 ° C. with a buffer containing 1 × SSC and 0.1% SDS. More preferably, hybridization at 65 ° C. and washing treatment at 65 ° C. with a buffer containing 0.1 × SSC and 0.1% SDS can be mentioned. In addition, there are various factors other than the above temperature conditions as factors affecting the stringency of hybridization, and those skilled in the art will be able to combine various components as appropriate to achieve the same stringency of hybridization as exemplified above. Stringency can be realized.

  For example, DNA that can hybridize under the above stringent conditions can include DNA having a certain degree of homology with the base sequence of the DNA used as a probe, for example, 60% or more, preferably 70 %, More preferably 80% or more, still more preferably 90% or more, particularly preferably 95% or more, and most preferably 98% or more of DNA.

  The “part of the sequence” is not particularly limited as long as the partial sequence or a sequence complementary to the sequence encodes a protein having apoptosis-inducing activity, and the base sequence represented by SEQ ID NO: 1 The base sequence of base numbers 216-989 (corresponding to the amino acid sequence of amino acid numbers 61-318 of the amino acid sequence shown in SEQ ID NO: 2) or the base sequence of base numbers 288-989 of the base sequence shown in SEQ ID NO: 1 ( (Corresponding to the amino acid sequence of amino acid numbers 85 to 318 of the amino acid sequence shown in SEQ ID NO: 2). In the case of human-derived CLPABP, amino acid numbers 85-192 and 211-318 of the amino acid sequence shown in SEQ ID NO: 2 are known as plextrin homologous regions (PH1 region and PH2 region, respectively). The presence or absence of a PH region in CLPABP derived from other organisms has not yet been confirmed, but it is expected that a region having high homology with the PH region of human CLPABP exists.

  Examples of the protein of the present invention include a protein consisting of the amino acid sequence shown in SEQ ID NO: 2, a protein having a partial amino acid sequence of the amino acid sequence shown in SEQ ID NO: 2 and having apoptosis-inducing activity, SEQ ID NO: 2 A protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added, and having apoptosis-inducing activity, or a partial amino acid sequence of the amino acid sequence shown in SEQ ID NO: 2 Examples thereof include proteins having an amino acid sequence in which one or several amino acids are deleted, substituted or added, and having apoptosis-inducing activity. Here, the “amino acid sequence in which one or several amino acids are deleted, substituted or added” is, for example, 1 to 20, preferably 1 to 15, more preferably 1 to 10, and still more preferably. It means an amino acid sequence in which any number of 1 to 5 amino acids are deleted, substituted or added. Moreover, as a partial amino acid sequence of the amino acid sequence shown by said sequence number 2, the amino acid sequence of amino acid numbers 61-318 of the amino acid sequence shown by sequence number 2, and the amino acid sequence of amino acid numbers 85-318 are illustrated preferably. be able to. The protein of the present invention can be prepared by a known method based on the DNA sequence information and the like. The origin of the protein of the present invention is not particularly limited, but examples include mammals such as humans, rhesus monkeys, dogs, cows, rats and mice, fishes such as puffer fish and zebrafish, and amphibians such as Xenopus. can do.

  Whether or not a protein has apoptosis-inducing activity is determined by treatment with the protein or expression of the protein in the cell, when such treatment is not performed, or expression in the cell. This can be confirmed by whether or not the proportion of cells in which apoptosis occurs is improved as compared with the case where there is no cell. The proportion of cells in which apoptosis occurs can be easily determined by a known detection method using DNA fragmentation associated with apoptosis, cell membrane structural change, mitochondrial membrane potential loss, and apoptosis-related enzyme activity as an index.

  The fusion protein of the present invention may be any protein as long as the present protein is bound to the marker protein and / or peptide tag, and the marker protein may be any conventionally known marker protein. It is not particularly limited, and specific examples include alkaline phosphatase, antibody Fc region, HRP, GFP and the like, and peptide tags in the present invention include Myc tag, His tag, FLAG tag, GST, etc. Conventionally known peptide tags such as tags can be specifically exemplified. Such a fusion protein can be prepared by a conventional method. Purification of the protein of the present invention using the affinity between Ni-NTA and His tag, detection of a protein that interacts with the protein of the present invention, and the present invention It is also useful for quantifying antibodies against other proteins.

  The antibody of the present invention is not particularly limited as long as it is an antibody that specifically binds to the protein of the present invention (an antibody against the protein of the present invention), and includes a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a single chain antibody, Specific examples include immunospecific antibodies such as humanized antibodies, and these can be prepared by conventional methods using the protein of the present invention such as CLPABP or a part thereof as an antigen. Antibodies are more preferred in terms of their specificity. Such an antibody such as a monoclonal antibody can be used for, for example, quantifying the expression of the protein of the present invention in a cell, detecting the presence or absence of expression of the protein in the cell, and at the molecular level of mitochondrial network formation. It is also useful in elucidating the mechanism of.

  The above-described antibody of the present invention is produced by administering an animal (preferably a non-human) animal or a fragment thereof containing the epitope of the present invention or a cell expressing the protein on the membrane surface using a conventional protocol. For example, for the preparation of monoclonal antibodies, the hybridoma method (Nature 256, 495-497, 1975), the trioma method, the human B cell hybridoma method (Immunology Today 4, 72, 1983) and the EBV-hybridoma method (MONOCLONAL ANTIBODIES AND CANCER THERAPY, pp. 77-96, Alan R. Liss, Inc., 1985) can be used.

  In order to produce a single chain antibody against the protein of the present invention, a method for preparing a single chain antibody (US Pat. No. 4,946,778) can be applied. In order to express humanized antibodies, transgenic mice or other mammals can be used, clones expressing the protein of the present invention can be isolated and identified using the above antibodies, affinity chromatography The polypeptide can also be purified.

  Examples of the monoclonal antibody include fluorescent substances such as FITC (fluorescein isocyanate) or tetramethylrhodamine isocyanate, radioisotopes such as 125I, 32P, 14C, 35S or 3H, alkaline phosphatase, peroxidase, β-galactosidase. Alternatively, the functional analysis of the protein of the present invention can be performed by using a fusion protein that is labeled with an enzyme such as phycoerythrin or a fluorescent protein such as green fluorescent protein (GFP). Examples of the immunological measurement method using the antibody of the present invention include RIA method, ELISA method, fluorescent antibody method, plaque method, spot method, hemagglutination method, octalony method and the like.

  The recombinant vector of the present invention is not particularly limited as long as it is a recombinant vector containing the gene of the present invention and capable of expressing the protein of the present invention having apoptosis-inducing activity, and the recombinant vector of the present invention. Can be constructed by appropriately integrating the gene of the present invention into an expression vector. For example, a construct in which the cDNA of the ORF portion excluding both the 5 ′ and 3 ′ untranslated regions of the gene of the present invention (base numbers 36 to 1868 of SEQ ID NO: 1) is connected downstream of an appropriate promoter is preferably exemplified. can do. The expression vector is preferably one that can replicate autonomously in the host cell, or one that can be integrated into the host cell chromosome, and controls a promoter, enhancer, terminator, etc. at a position where the gene of the present invention can be expressed. Those containing the sequence can be preferably used. As an expression vector, an animal cell expression vector, a yeast expression vector, a bacterial expression vector, or the like can be used, and a recombinant vector using an animal cell expression vector is preferred.

  Examples of expression vectors for animal cells include pcDNA3 (manufactured by Stratagene), pCMV-FLAG6a (manufactured by Sigma), pEGFP-C3 (manufactured by Clontech), pcDM8 (commercially available from Funakoshi), pAGE107 (Japanese Patent Laid-Open No. 3-22979). Cytotechnology, 3, 133, (1990)], pAS3-3 (JP-A-2-27075), pCDM8 [Nature, 329, 840, (1987)], pcDNAI / Amp (Invitrogen), pREP4 (Invitrogen) ), PAGE103 [J. Blochem., 101, 1307 (1987)], pAGE210, and the like. Examples of promoters for animal cells include cytomegalovirus (human CMV) IE (immediate early) gene promoter, SV40 early promoter, retrovirus promoter, metallothionein promoter, heat shock promoter, SRα promoter, etc. Can do.

  Examples of expression vectors for yeast include YEp13 (ATCC37115), YEp24 (ATCC37051), Ycp5O (ATCC37419), pHS19, pHS15 and the like. Examples of the promoter for yeast include promoters such as PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, gal1 promoter, gal10 promoter, heat shock protein promoter, MFα1 promoter, and CUP1 promoter.

  Examples of bacterial expression vectors include pBTrp2, pBTac1, pBTac2 (all commercially available from Boehringer Mannheim), pGEX4T (Amersham Bioscience), pKK233-2 (Pharmacia), pSE280 (Invitrogen) PGEMEX-1 (Promega), pQE-8 (QIAGEN), pQE-30 (QIAGEN), pKYP10 (JP 58-110600), pKYP200 (Agrc. Biol. Chem., 48, 669) (1984)], PLSA1 (Agrc.Blo1. Chem., 53, 277 (1989)), pGEL1 (Proc. Natl. Acad. Sci. USA, 82, 4306 (1985)), pBluescriptII SK (+), pBluescriptII SK (-) (Stratagene), pTrS30 (FERMBP-5407), pTrS32 (FERM BP-5408), pGEX (Pharmacia), pET-3 (Novagen), pTerm2 (US4686191, US4939094, US5160735), pSupex PUB110, pTP5, pC194, pUC18 (Gene, 33, 103 (1985)), pUC19 (Gene, 33, 103 (1985)), pSTV28 (Takara Shuzo), pSTV29 (Takara Shuzo), pUC118 (Takara Shuzo) ), PQE-30 (manufactured by QIAGEN) and the like. Examples of the promoter for bacteria include promoters derived from Escherichia coli and phage, such as trp promoter (P trp), lac promoter (P lac), PL promoter, PR promoter, PSE promoter, SP01 promoter, SP02 promoter, penP A promoter etc. can be mentioned.

  The transformant of the present invention is not particularly limited as long as it is a transformant into which the recombinant vector of the present invention has been introduced and expresses the protein of the present invention having apoptosis-inducing activity. , Individuals), transformed yeast, and transformed bacteria, but transformed animals (cells, tissues, individuals) are preferred. More specifically, as a host cell in the transformant of the present invention, an L cell, a CHO cell, a COS cell, a HeLa cell, a C127 cell, a BALB / c3T3 cell (a mutant strain lacking dihydrofolate reductase, thymidine kinase, etc.) Animal cells such as BHK21 cells, HEK293 cells, Bowes malignant melanoma cells, fungal cells such as yeast and Aspergillus, prokaryotic bacterial cells such as Escherichia coli, Streptomyces, Bacillus subtilis, Streptococcus, Staphylococcus, and Drosophila Insect cells such as S2 and Spodoptera Sf9, plant cells such as Arabidopsis thaliana and the like can be mentioned.

  In addition, as a method for introducing the recombinant vector of the present invention into a host cell, an appropriate method can be used depending on the type of the host cell. As the introduction method, specifically, Davis et al. (BASIC METHODS IN MOLECULAR BIOLOGY, 1986) and Sambrook et al. (MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) Methods described in many standard laboratory manuals such as calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid mediated transfection, electroporation, trait Examples include introduction and infection.

  The protein (and fusion protein) of the present invention may have a high apoptosis-inducing activity against at least one cell. Accordingly, the gene of the present invention encoding the protein of the present invention, including the protein of the present invention (and fusion protein), and the recombinant vector of the present invention capable of expressing the protein of the present invention induce apoptosis. It can be suitably used as the main component of the agent. Therefore, the apoptosis-inducing agent of the present invention contains one or more selected from the group consisting of the protein of the present invention, the fusion protein of the present invention, the gene of the present invention, and the recombinant vector of the present invention.

  The apoptosis-inducing agent provided by the present invention can be a composition (medicine) that can be used to cause apoptosis in a target cell (for example, human or other mammalian cell) in vivo or in vitro. The apoptosis-inducing agent of the present invention can be used as a prophylactic / therapeutic agent for diseases in which apoptosis is effective in preventing / treating. Examples of the disease include cancer, autoimmune disease, viral infection, endocrine disease, blood disease, organ hyperplasia, restenosis after angioplasty, and recurrence after cancer resection.

  In addition to the protein and fusion protein of the present invention, the carrier contained in the apoptosis-inducing agent, that is, the secondary component (typically pharmaceutically acceptable depending on the application) includes the use and form of the apoptosis-inducing agent. Depending on the case, water (for example, physiological saline, various buffers), organic solvent, various fillers, extenders, binders, lubricants, moisturizers, surfactants, and excipients may be used. Agents, colorants, preservatives, buffers, fragrances and the like.

There is no particular limitation regarding the form of the apoptosis-inducing agent. Typical forms of internal preparations or external preparations include ointments, solutions (eg, eye drops, injection solutions), suspensions, emulsions, aerosols (sprays), foams, granules, powders, tablets, capsules, Gel, etc. Depending on the form of the inducer (composition), the content (type) of the carrier and other secondary components to be combined with the protein of the present invention as the main component may be different. For example, for use in injection, etc., it may be dissolved in physiological saline or an appropriate buffer solution (for example, PBS) immediately before use to prepare a lyophilized product or granulated product for preparing a drug solution (injection solution, etc.). it can.
The active ingredient of the apoptosis-inducing agent of the present invention (the protein of the present invention, the fusion protein of the present invention, the gene of the present invention or the recombinant vector of the present invention) and various carriers (subcomponents) are used in various forms. The process itself for preparing the drug (composition) may be in accordance with a conventionally known method, and since the formulation method itself does not characterize the present invention, detailed description thereof is omitted. As a detailed information source on prescription, for example, Comprehensive Medicinal Chemistry, supervised by Corwin Hansch, published by Pergamon Press (1990) can be mentioned.

  The apoptosis-inducing agent of the present invention can be used in a method or dosage depending on its form and purpose. For example, as a liquid, it can be administered to a patient by intravenous, intramuscular, subcutaneous, intradermal or intraperitoneal injection, or ileum. Alternatively, solid forms such as tablets can be administered orally. In addition, when used outside the body, a liquid preparation containing an appropriate amount of the active ingredient of the present invention (the protein of the present invention, the fusion protein of the present invention, the gene of the present invention or the recombinant vector of the present invention) is the target (skin surface) The surface of the object may be sprayed directly on the surface of the affected area or the like, or may be wiped with a cloth or paper wet with the liquid. These are merely examples, and the same forms and / or methods of use as conventional apoptosis inducers can be applied. In addition, application of DDS (drug delivery system) makes it possible to supply the apoptosis-inducing agent of the present invention locally at a high concentration to a target affected part (organ, tissue, cell, etc.). The dose of the apoptosis-inducing agent (medicine) may be set individually according to the administration method, the purpose of administration, the type of disease, symptoms, the sex, weight, age, etc. of the patient, and is not particularly limited.

Of the apoptosis inducers of the present invention, when the active ingredient is the gene of the present invention or the recombinant vector of the present invention, the apoptosis inducer can be used as a material used for so-called gene therapy. For example, a gene (typically a DNA segment or an RNA segment) encoding the protein of the present invention is incorporated into an appropriate vector and introduced into a target affected area (organ, tissue, cell, etc.), so that a living body (cell ), The protein of the present invention and the fusion protein can be expressed. Therefore, in the same manner as the apoptosis-inducing agent containing the protein or fusion protein of the present invention as an active ingredient, it can be used as a prophylactic / therapeutic agent for a disease in which apoptosis is effective in preventing or treating.
The apoptosis-inducing agent (medicine) containing the gene or recombinant vector of the present invention as an active ingredient is selectively introduced into the target affected cell, and the affected cell is not damaged without damaging other normal cells. It is preferable to an apoptosis inducer comprising the protein or fusion protein of the present invention as an active ingredient in that it can be selectively killed.

  The method of the present invention is not particularly limited as long as the protein of the present invention or the fusion protein of the present invention is expressed in a target cell to induce apoptosis of the cell. A preferred example is a method of inducing apoptosis of the cell by expressing the protein of the present invention by introducing the cell into a target cell. The method for expressing the protein or the like of the present invention in a target cell is not particularly limited, and for example, a method such as transformation of the recombinant vector of the present invention into the target cell by a known method can be used.

  EXAMPLES Hereinafter, although an Example demonstrates this invention more concretely, the technical scope of this invention is not limited to these illustrations.

[Expression of CLPABP gene in various human organs and cultured cells]
Primers for PCR were designed based on the sequence of the CLPABP gene (SEQ ID NO: 1). The forward primer (gtttggatcctctgtgcctgcctctgaccct: SEQ ID NO: 3) contains a sequence corresponding to base numbers 1536-1556 of the CLPABP base sequence (SEQ ID NO: 1), and the reverse primer (gaaagaattctctcagatccactgcacaagccc: SEQ ID NO: 4) is the base sequence of CLPABP (SEQ ID NO: 4). It contains the sequence corresponding to base numbers 1851-1871 of SEQ ID NO: 1). Using various commercially available cDNA libraries derived from humans (MTC panel manufactured by Clontech) as a template, PCR reaction was performed using both the above-mentioned primers. The conditions for this PCR reaction are: hold at 94 ° C. for 1 minute, perform 30 cycles of 94 ° C. for 30 seconds, 55 ° C. for 30 seconds, 72 ° C. for 1 minute, and then hold at 72 ° C. for 5 minutes It was a condition.

  Each obtained PCR product was electrophoresed on a 2% agarose gel and stained with ethidium bromide. FIG. 3 shows a band of a transcription product (355 bp) that is considered to have been specifically amplified by the both primers. As shown in FIG. 3, the CLPABP gene is expressed to almost the same level in cells derived from various human organs (FIG. 3 left), and is also expressed in various cultured cells in the same manner ( Figure 3 right).

[Expression of endogenous CLPABP and recombinant CLPABP in cultured cells]
A CLPABP gene fragment was obtained by PCR using the CLPABP gene purchased from RZPD German Resource Center for Genome Research as a template, or by cleaving the PCR product with a restriction enzyme. The fragment was incorporated into pcDNA3 vector (manufactured by Stratagene) or pCMV-FLAG6a (manufactured by Sigma) (a vector capable of adding a FLAG tag to the amino terminal side) so that the gene could be expressed. Both obtained plasmids were named pcDNA3-CLPABP and pCMV-FLAG-CLPABP, respectively. Both of these plasmids were introduced into COS-7 cells by electroporation, and COS-7 / pcDNA3-CLPABP cells and COS-7 / pCMV-FLAG-CLPABP cells were obtained.

  Next, the following Western blot analysis was performed on these three types of cells. HEK293 cells, COS-7 / pcDNA3-CLPABP cells, COS-7 / pCMV-FLAG-CLPABP cells were added to a medium in which 10% fetal bovine serum, 100 μg / ml streptomycin and 100 U / ml ampicillin were added to Dulbecco's modified Eagle medium. Each was added and cultured at 37 ° C. in the presence of 5% CO 2. Centrifugation of these cultures collects the cells of each cell, and extracts the cells (20 mM Tris-HCl (pH 7.5); 1 mM EDTA; 10 mM DTT; 1% Triton X-100; 150 mM NaCl; 10 mM NaF; 1 mM Na3VO4; protease inhibitor cocktail (manufactured by Roche) was added and mixed, and the cells were disrupted to obtain cell extracts. After adding an SDS sample solution to the obtained cell extract, it was denatured at 95 ° C. for 3 minutes, subjected to SDS-PAGE, and then electrically transferred to a PVDF membrane (Immobilon-P: manufactured by Millipore).

  The antibody used for detecting the expression of CLPABP was prepared by the following method. A DNA fragment consisting of a base sequence corresponding to the amino acid sequence of amino acid numbers 500-611 (hereinafter referred to as “500-611 protein”) of the amino acid sequence of CLPABP (SEQ ID NO: 2) is incorporated into a GST fusion protein expression plasmid vector; The resulting plasmid was introduced into E. coli. The E. coli was cultured, and GST fusion 500-611 protein was purified from the resulting cells. The obtained GST fusion 500-611 protein was used as an antigen to immunize a rabbit, and antiserum was collected from this rabbit. The collected antiserum was subjected to affinity purification using a GST fusion 500-611 protein antigen to obtain a purified antibody (anti-CLPABP primary antibody).

  The obtained anti-CLPABP primary antibody is reacted with the above-mentioned PDVF membrane, and after washing the PDVF membrane, an HRP (HorseRadish Peroxydase) labeled secondary antibody (Amersham Biosciences) is reacted, and the labeled secondary antibody Detected by ECL response to. As a detection device, an image analyzer “LAS3000” (manufactured by Fuji Film Co., Ltd.) was used. The result is shown in FIG. As can be seen from FIG. 4, CLPABP is expressed in any of HEK293 cells, COS-7 / pcDNA3-CLPABP cells, and COS-7 / pCMV-FLAG-CLPABP cells, and COS-7 / pcDNA3-CLPABP cells. In COS-7 / pCMV-FLAG-CLPABP cells, CLPABP was actually overexpressed.

[Localization of endogenous CLPABP in cultured cells]
In order to investigate the localization of CLPABP in HEK293 cells, HEK cells were fluorescently stained using the aforementioned anti-CLPABP primary antibody and CMX-Rosamine (“Mito-Tracker Red” (registered trademark)).
Specifically, for localization of CLPABP, HEK293 cells were fixed for 10 minutes in the presence of 5% formaldehyde, then washed with PBS containing 0.1% Triton X-100 and subjected to membrane permeabilization. Anti-CLPABP primary antibody was added and allowed to stand for 1 hour. After washing, the secondary antibody was added and allowed to stand for 45 minutes. As the secondary antibody, Alexa series of Molecular Probes was used. Next, washing treatment was performed, and the subsequent HEK293 cells were observed with an LSM510 Meta confocal laser microscope (manufactured by Zeiss). For mitochondrial localization, HEK293 cells were fixed in the presence of 5% formaldehyde for 10 minutes, washed with PBS containing 0.1% Triton X-100, and subjected to membrane permeabilization, and then CMX-Rosamine ( After being treated with “Mito-Tracker Red” (registered trademark), it was observed with the aforementioned microscope.
The results using the purified antibody (anti-CLPABP antibody) described above are shown in the left (a and d) of FIG. 5, and the results of using CMX-Rosamine are shown in the center (b and e) of FIG. Further, in FIG. 5, a superposition of a and b is shown in c, and a superposition of d and e is shown in f. As can be seen from FIG. 5, CLPABP was mainly observed around mitochondria.

[Subcellular localization of GFP-fused CLPABP]
The CLPABP gene fragment in Example 2 was incorporated into pEGFP-C3 (vector capable of adding GFP to the amino terminal side; manufactured by Clontech) so that the gene can be expressed. The obtained plasmid (pGFP-CLPABP) was introduced into COS-7 cells by electroporation to obtain COS-7 / pGFP-CLPABP cells. The cells were fixed in the presence of 5% formaldehyde for 10 minutes, washed with PBS containing 0.1% Triton X-100 and subjected to membrane permeabilization, and CMX-Rosamine (“Mito-Tracker Red” (registered trademark) )), And then observed with the aforementioned LSM510Meta confocal laser microscope (Zeiss). The results of observing the intracellular localization of the GFP-fused CLPABP are shown in FIGS. Moreover, the result of having observed the localization of mitochondria by dyeing | staining with CMX-Rosamine is shown to b and e of FIG. Further, a superposition of a and b in FIG. 6 is shown in c, and a superposition of d and e is shown in f. The results in FIG. 6 suggested that CLPABP exists on mitochondria. CLPABP also formed vesicular structures that existed to penetrate the mitochondrial network by self-assembly, as shown in df of FIG.

[Influence of CLPABP on mitochondrial network formation]
It is known that mitochondria generally repeat fusion and division to form their network structure. From the results shown in FIGS. 5 and 6, CLPABP was present in the vicinity of the tube-like mitochondria, and CLPABP was expected to present some positional information in the network formation. Therefore, the localization of CLPABP and mitochondria was observed over time and the relationship was analyzed.
A pDsRed2-Mito (manufactured by Clontech) plasmid capable of expressing a DsRed protein fused with a mitochondrial localization sequence and the aforementioned pGFP-CLPABP are simultaneously introduced into COS-7 cells by electroporation, and COS-7 / pGFP-CLPABP: pDsRed2-Mito cells were obtained. The cells were fixed in the presence of 5% formaldehyde for 10 minutes, and the fluorescence of the GFP-fused CLPABP expressed in the fixed cells and the fluorescence of the DsRed protein fused with the mitochondrial localization sequence were measured using the Biozero fluorescence microscope system (Keyence And manufactured for 150 seconds every 30 seconds. The result is shown in FIG. In FIG. 7, linear (red) represents mitochondria, and dot (green) represents CLPABP. The part indicated by a small arrow is a part where tube-like mitochondria are newly extended toward the vesicle of CLPABP. In addition, the portion surrounded by the squares above “0” and “150 s” was divided into mitochondria at the start of imaging (“0”). It shows that they are fused.

  Moreover, the result of having observed another site | part of the same cell as what was observed in FIG. 7 is shown in FIG. The part indicated by the arrow in FIG. 8 is mitochondria that move inside the cell so as to pass through the vesicles of CLPABP. In addition, the portion surrounded by a square indicates three independent CLPABP vesicles at the start of imaging (“0”), but after 120 seconds, they are assembled together.

  From the results of FIG. 7 and FIG. 8, it was suggested that CLPABP vesicles functioned as signposts in the cells when mitochondria fused or migrated when forming a network.

[CLPABP knockdown experiment with RNAi]
The results in FIGS. 5 to 8 suggested that CLPABP is involved in mitochondrial network formation. To support this, we attempted to knockdown CLPABP with RNAi.
First, double-stranded RNA (sense sequence: aaggagaagcagauccgcuccuu: SEQ ID NO: 5) was prepared as RNAi (CLPABP-siRNA) for CLPABP. This sequence corresponds to base numbers 867-889 of the base sequence of CLPABP (SEQ ID NO: 1). In addition, RNAi for GFP (Cat # S5C-0201; manufactured by B-Bridge International, Inc.) was prepared as a control RNAi. Using Invitrogen's Oligofectamine, RNAi against CLPABP was transiently introduced into HeLa cells to obtain HeLa / CLPABP-siRNA cells. Similarly, RNAi for GFP was also transiently introduced into HeLa cells to obtain HeLa / control cells.

The following Western blot analysis was performed on HeLa / CLPABP-siRNA cells and HeLa / control cells.
HeLa / CLPABP-siRNA cells and HeLa / control cells were added to a medium in which 10% fetal bovine serum, 100 μg / ml streptomycin and 100 U / ml ampicillin were added to Dulbecco's modified Eagle medium, respectively, and in the presence of 5% CO ₂ . Cultured at 37 ° C. Centrifugation of these cultures collects the cells of each cell, and extracts the cells (20 mM Tris-HCl (pH 7.5); 1 mM EDTA; 10 mM DTT; 1% Triton X-100; 150 mM NaCl; 10 mM NaF; 1 mM Na3VO4; protease inhibitor cocktail (manufactured by Roche) was added and mixed, and the cells were disrupted to obtain cell extracts. After adding an SDS sample solution to the obtained cell extract, it was denatured at 95 ° C. for 3 minutes, subjected to SDS-PAGE, and electrically transferred to a PVDF membrane (Immobilon-P: manufactured by Millipore).

  The same anti-CLPABP primary antibody as described in Example 2 above is reacted with the above-mentioned PDVF membrane, the PDVF membrane is washed, and then reacted with an HRP (HorseRadish Peroxydase) labeled secondary antibody (Amersham Biosciences). And detected by ECL reaction against the labeled secondary antibody. As a detection device, an image analyzer “LAS3000” (manufactured by Fuji Film Co., Ltd.) was used. The result is shown in the left panel of FIG. As can be seen from the left panel of FIG. 9, it was shown that the expression level of CLPABP was decreased in HeLa / CLPABP-siRNA cells compared to HeLa / control cells.

  Further, in order to investigate the localization of CLPABP and mitochondria in HeLa / CLPABP-siRNA cells and HeLa / control cells, the above-mentioned primary anti-CLPABP antibody and CMX-Rosamine (“Mito-Tracker Red” (registered trademark)) are used. In the same manner as in Example 3, both cells were fluorescently stained. The observation results of both cells stained with fluorescence are shown in the center panel and right panel of FIG. As can be seen from these two panels in FIG. 9, in HeLa / CLPABP-siRNA cells (cells indicated by arrows) in which the expression of CLPABP is reduced (middle panel in FIG. 9), the surrounding HeLa / control cells and Is different, mitochondrial fragmentation occurs (right panel in FIG. 9).

[Analysis of CLPABP binding protein (SDS-PAGE)]
From the results of FIGS. 5 to 8, it was revealed that CLPABP forms a vesicle structure in the cell. In addition to CLPABP, it was predicted that some specific binding protein for CLAPBP was involved in the formation of the vesicle structure. Accordingly, an attempt was made to identify a binding protein for CLPABP.
The CLPABP gene fragment in Example 2 was incorporated into pcDNA3-FLAG (a vector capable of adding a FLAG tag to the amino terminal side) so that the gene could be expressed. The obtained plasmid (pFLAG-CLPABP) was introduced into HEK293T cells by electroporation to obtain HEK293T / pFLAG-CLPABP cells. The cell is a cell that transiently expresses the FLAG tag CLPABP. The HEK293T / pFLAG-CLPABP cells were cultured to obtain 1 × 10 ⁸ cells of the cells. To the cells, the extract described in Example 2 was added and mixed, and the cells were crushed to obtain a cell extract. The FLAG-CLPABP complex in the cell extract was immunoprecipitated using an anti-FLAG affinity gel manufactured by Sigma. Centrifugation during immunoprecipitation was performed at 14000 rpm for 10 minutes at a low temperature. After washing the precipitate obtained by immunoprecipitation several times, the complex was eluted with 0.1 M Glycine-HCl (pH 3) buffer, and the pH was immediately returned to neutral. Using this solution as a protein sample solution, electrophoresis was performed by SDS-PAGE, and then the SDS-PAGE was stained with CBB. The gel of the detected main band portion was cut out, and after decolorization, a reductive alkylation reaction was performed. Subsequently, in-gel digestion was performed using trypsin, and mass spectrometry was performed on the eluted peptide. As a mass spectrometer, Q-Tof-type hybrid mass spectrometer (manufactured by Micromass) was used, and peptides were separated by a Waters-Micromass modular CapLC HPLC system (manufactured by Micromass) before sample application. The obtained measurement data was analyzed by Matrix science (manufactured by Matrix science), and the protein contained in the band portion was identified from the molecular weight calculated as a result of the analysis. FIG. 10 shows the results of SDS-PAGE electrophoresis and the results of protein identification by mass spectrometry. From the results of FIG. 10, it was suggested that CLPABP binds to mitochondrial matrix protein p32 (p32Mp) together with proteins (Hsp70, 14-3-3ε, actin, and tubulin) generally having a high expression level.

[Identification of p32Mp binding site in CLPABP]
From the results of FIG. 10, it was suggested that CLPABP generally binds to mitochondrial matrix protein p32 (p32Mp) together with proteins with a high expression level. Therefore, the following analysis was performed on which part of CLPABP p32Mp binds.

A DNA fragment encoding the full-length amino acid sequence of CLPABP or its amino-terminal deletion mutant was obtained by PCR using the CLPABP gene purchased from the RZPD German Resource Center for Genome Research as a template or by cleavage of the PCR product with a restriction enzyme. .
Specifically, a DNA fragment encoding the amino acid sequence of amino acid numbers 1-611 of the amino acid sequence of CLPABP (SEQ ID NO: 2), a DNA fragment encoding the amino acid sequence of amino acid numbers 61-611, and the amino acid numbers 101-611 A DNA fragment encoding the amino acid sequence of the above, and a DNA fragment encoding the amino acid sequence of amino acid numbers 181-611 were prepared. These four types of DNA fragments were each incorporated into pCMV-FLAG6a (manufactured by Sigma) (a vector capable of adding a FLAG tag to the amino terminal side) so that the gene can be expressed. The obtained four types of plasmids were named pCMV-FLAG-CLPABP 1-611, pCMV-FLAG-CLPABP 61-611, pCMV-FLAG-CLPABP 101-611, and pCMV-FLAG-CLPABP 181-611, respectively. These four kinds of plasmids were respectively introduced into COS-7 cells by electroporation, and COS-7 / pCMV-FLAG-CLPABP 1-611 cells (“1-611”), COS-7 / pCMV-FLAG. -CLPABP 61-611 cells ("61-611"), COS-7 / pCMV-FLAG-CLPABP 101-611 cells ("101-611"), COS-7 / pCMV-FLAG-CLPABP 181-611 ("181" -611 ") cells were obtained. As a negative control, COS-7 / pCMV-FLAG6a (“vector”) was prepared by introducing pCMV-FLAG6a (Sigma) itself into COS-7 cells.

The following SDS-PAGE analysis was performed on the above five types of cells.
A total of 5 types of cells were cultured, and 1 × 10 ⁸ cells of the cells were obtained. The extract described in Example 2 was added to each cell and mixed, and the cell was disrupted to obtain a cell extract. The FLAG-CLPABP (or CLPABP amino terminal mutant) complex in the cell extract was immunoprecipitated using anti-FLAG antibody beads (manufactured by Sigma). Centrifugation during immunoprecipitation was performed at 14000 rpm for 10 minutes at a low temperature. The beads obtained by immunoprecipitation were washed and then suspended in a buffer to obtain a protein sample solution. After the protein sample solution was electrophoresed by SDS-PAGE, the SDS-PAGE was stained with CBB. The result is shown in the upper panel of FIG.

  Further, western blot analysis using an anti-p32Mp antibody (SC-23885: manufactured by Santa-Cruz) was performed on the above five types of cells in the same manner as in Example 2. The results are shown in the lower panel of FIG. From this result, it was suggested that the p32Mp binding site in CLPABP is between amino acid numbers 61 to 100 of CLPABP.

[Influence of CLPABP domain on intracellular localization of CLPABP]
In order to examine the relationship between the binding of CLPABP and p32Mp and the intracellular localization of CLPABP, COS-7 / pCMV-FLAG-CLPABP 1-611, COS-7 / pCMV-FLAG-CLPABP 61-611, COS-7 / For the three types of cells pCMV-FLAG-CLPABP 101-611, anti-FLAG antibody and anti-mitochondrial antibody (anti-cytochrome c antibody: SC-7159: manufactured by Santa-Cruz) are used in the same manner as in Example 3 above. Fluorescent staining was performed.

The results of fluorescence staining using the anti-FLAG antibody are shown in the left three panels of FIG. 12, and the results of fluorescence staining using the anti-mitochondrial antibody are shown in the center three panels of FIG. In addition, the right panel is shown by superimposing the left panel and the center panel in FIG. The upper three panels in FIG. 12 show the results of COS-7 / pCMV-FLAG-CLPABP 1-611 (CLPABP full 1-611), and the three middle panels show COS-7 / pCMV-FLAG. -CLPABP 61-611 (61-611)), and the lower three panels show the results of COS-7 / pCMV-FLAG-CLPABP 101-611 (101-611).
As can be seen from FIG. 12, CLPABP having a p32Mp binding site and CLPABP amino terminal deletion mutants (CLPABP full 1-611 and 61-611) have the ability to form a vesicle structure in the vicinity of mitochondria, but have a p32Mp binding site. The lacking CLPABP amino-terminal deletion mutant (101-611) showed slight vesicle formation but tended to spread throughout the cell, indicating a very different localization from the full-length CLPABP. This suggested that the characteristic intracellular localization mode of CLPABP requires binding to p32Mp.

[Identification of lipid binding to PH region of CLPABP]
As shown in FIG. 2, CLPABP has two PH regions in the molecule. Generally, it is known that the PH region has lipid binding ability and contributes to protein transfer to organelles such as cell membranes and endoplasmic reticulum. However, from the results of the localization experiment of CLPABP in cells in Examples of the present application, it was considered that the PH region of CLPABP exhibits different properties from those known so far. Therefore, lipid binding to the PH region of CLPABP was identified as follows.

A DNA fragment encoding a protein in the PH1 region of CLPABP (amino acid sequence of amino acid numbers 85-192 of SEQ ID NO: 2) by PCR using the same CLPABP gene as that used in Example 2, and the PH2 region A DNA fragment encoding a protein (amino acid sequences 211 to 320 of SEQ ID NO: 2) was amplified. For amplification to the DNA fragment encoding the protein of the PH1 region, a forward primer (gtttggatcccggcggagggtgcctgtgagg: SEQ ID NO: 6) and a reverse primer (gaaagaattcgagggccgtctgcttctccag: SEQ ID NO: 7) are used to amplify the DNA fragment encoding the protein of the PH2 region. Used a forward primer (gtttggatcccggacggcgtcagggcacgaa: SEQ ID NO: 8) and a reverse primer (gaaagaattcctacccctccctgtgggtgacagc: SEQ ID NO: 9).
Each of these amplified DNA fragments was inserted into a pGEX4T vector (manufactured by Amersham Bioscience) (GST fusion protein expression vector), and the resulting both recombinant vectors were each introduced into Escherichia coli. These E. coli were cultured, and GST-fused PH1 region protein and GST-fused PH2 region protein were purified from the obtained cells using Glutathion-Sepharose beads. The upper panel of FIG. 13 shows the results of electrophoresis of purified GST-fused PH1 region protein and GST-fused PH2 region protein by SDS-PAGE and CBB staining.

  Further, Membrane lipid strips (manufactured by Echelon) were prepared as a membrane (lower left in FIG. 13) on which a certain amount of 15 types of lipids present in the living body were spotted. After blocking the membrane with 3% BSA without fatty acid, 0.5 mg / ml GST fusion protein in TBS-T (20 mM Tris pH 8.0; 150 mM NaCl; 0.1% Tween 20) (GST-fused PH1 region protein or GST-fused PH2 region protein) was incubated for 3 hours. The membrane was then washed and incubated with anti-GST antibody (MBL) for 2 hours. After washing the membrane, an HRP-labeled secondary antibody was further added and incubated, and the binding of lipid and GST fusion protein (GST fusion PH1 region protein or GST fusion PH2 region protein) was detected by ECL reaction. As a result, as shown in the lower right of FIG. 13, cardiolipin and phosphatidic acid bind to PH1 region protein, and phosphatidylserine and phosphatidylinositol-4 phsphate bind to PH2 region protein in addition to them. found.

[Colocalization of CLPABP and cardiolipin in cells]
In order to investigate the colocalization of CLPABP and cardiolipin in cells, using an anti-cardiolipin antibody (manufactured by MBL), in the same manner as in Example 3 above, COS-7 / in Example 4 above was used. Fluorescent staining was performed on pGFP-CLPABP cells.
The observation result of GFP-fused CLPABP is shown in the left panel of FIG. 14, the result of fluorescence staining with anti-cardiolipin antibody is shown in the center panel of FIG. 14, and the left panel of FIG. . The results in FIG. 14 showed that cardiolipin colocalizes with vesicles formed by CLPABP.

[Influence of PH region on intracellular localization of CLPABP]
The results in FIG. 12 show that the p32Mp binding site is important for the intracellular localization of CLPABP, that is, the unique localization that forms vesicles in the vicinity of mitochondria. In order to examine how the regions (PH1 region and PH2 region) affect the intracellular localization of CLPABP, the following assay was performed.

A DNA fragment encoding the amino acid sequence of amino acid numbers 1-450 of the amino acid sequence of CLPABP (SEQ ID NO: 2) by PCR using the same CLPABP gene as used in Example 2 as a template, and the amino acid numbers 251-611 A DNA fragment encoding the amino acid sequence of was amplified. For amplification into a DNA fragment encoding the amino acid sequence of amino acid number 1-450 of SEQ ID NO: 2, a forward primer (gtttaagcttatggggaacagccactgtgtc: SEQ ID NO: 10) and a reverse primer (gaaagaattcctatgtttccgaagtgtggtc: SEQ ID NO: 11) are used, and the amino acid number of SEQ ID NO: 2 A forward primer (gtttaagcttgccattttctccgaggag: SEQ ID NO: 12) and reverse primer (gaaagaattctcagatccactgcacaagccc: SEQ ID NO: 13) were used for amplification into a DNA fragment encoding the amino acid sequence of 251-611.
These two kinds of amplified DNA fragments were each incorporated into pCMV-FLAG6a (manufactured by Sigma) (a vector capable of adding a FLAG tag to the amino terminal side) so that the gene can be expressed. The obtained two types of plasmids were named pCMV-FLAG-CLPABP 1-450 and pCMV-FLAG-CLPABP 251-611, respectively. These two types of plasmids were introduced into COS-7 cells by electroporation, respectively, and COS-7 / pCMV-FLAG-CLPABP 1-450 cells (“1-450”), COS-7 / pCMV-FLAG. -CLPABP 251-611 cells ("251-611") were obtained.

These two types of cells were subjected to fluorescent staining using an anti-FLAG antibody or an anti-mitochondrial antibody (anti-cytochrome c antibody: SC-7159: manufactured by Santa-Cruz) in the same manner as in Example 3 above.
The results of fluorescence staining using the anti-FLAG antibody are shown in the two left panels of FIG. 15, and the results of fluorescence staining using the anti-mitochondrial antibody are shown in the two middle panels of FIG. Also, the right panel is shown by superimposing the left panel and the center panel in FIG. The upper three panels in FIG. 15 show the results of COS-7 / pCMV-FLAG-CLPABP 251-611 (25-611), and the lower three panels show COS-7 / pCMV-FLAG-CLPABP. 1-450 (1-450)) is shown.

  As can be seen from FIG. 15, the CLPABP mutant (251-611) deleted to the amino terminal side of the PH2 region completely lost the ability to form vesicles and to localize mitochondria (FIG. 15). Upper panel). On the other hand, although the C-terminal of CLPABP was deleted by about 160 amino acids, the mutant (1-450) having the p32Mp binding region and the two PH regions still had the ability to form vesicles (FIG. 15). Lower panel).

[Influence of CLPABP overexpression on apoptosis]
The results in FIGS. 6 to 8 suggested that CLPABP plays an important role in the formation of the mitochondrial network. In order to examine how CLPABP overexpression affects apoptosis, the following experiment was performed.
In the COS-7 / pGFP-CLPABP cells used in Example 4, the GFP-fused CLPABP was transiently expressed and cultured for about 60 hours, and then the cells were collected by trypsin treatment, and Annexin V-Alexa594 ( Molecular Probes) was added to stain apoptotic cells. The stained cells were mounted on a glass preparation, and the green fluorescence of GFP and the blue fluorescence of Alexa594 were observed with the aforementioned LSM510Meta confocal laser microscope (manufactured by Zeiss). The observation result of GFP is shown in the leftmost panel of FIG. 16, the observation result of Alexa594 is shown in the second panel from the left, and the leftmost panel and the second panel from the left are overlaid. Shown on the second panel. As can be seen from the second panel from the left in FIG. 16, CLPABP-expressing cells caused apoptosis after prolonged culture.
Further, the results of quantifying the observation results of the left three panels and calculating the percentage (%) of cells in which both GFP and Alexa 594 were observed are shown in the rightmost panel of FIG. As a control, the percentage of cells in which both GFP and Alexa594 were observed in COS-7 cells that transiently express GFP, not GFP-fused CLPABP, is shown. As can be seen from the rightmost panel of FIG. 16, overexpression of CLPABP showed that apoptosis was remarkably induced.

It is a figure which shows the deduced amino acid sequence of human CLPABP. It is a figure which shows the position of PH area | region which is a presumed functional area | region of human CLPABP. The numbers in the figure represent amino acid numbers. It is a figure (ethidium bromide dyeing | staining) which shows the expression of the CLPABP gene in various human organs and cultured cells. It is a figure (Western blot analysis) which shows expression in culture cells of endogenous and recombinant CLPABP. It is a figure (fluorescence staining) which shows localization in culture cells, such as endogenous CLPABP. It is a figure which shows the localization in cells, such as GFP fusion CLPABP. It is a figure which shows the influence in mitochondrial network formation of CLPABP. It is a figure which shows the influence in mitochondrial network formation of CLPABP. The left panel is a diagram (Western blot analysis) showing expression of CLPABP in a knockdown cell of CLPABP by RNAi. Moreover, the center panel and the right panel are diagrams showing the localization of CLPABP and the like in the knockdown cell of CLPABP by RNAi (fluorescence staining). It is a figure which shows the result of SDS-PAGE of CLPABP and its binding protein. The protein name described on the right side of the figure indicates the result identified by mass spectrometry. The upper panel shows the results of electrophoresis of immunoprecipitated CLPABP and CLPABP amino-terminal mutants. The lower panel shows the results of Western blotting with anti-p32Mp antibody. It is a figure which shows localization of CLPABP or CLPABP amino terminal variant etc. in the cell which expresses CLPABP and CLPABP amino terminal variant (fluorescence dyeing | staining). The upper panel is a diagram showing the results of electrophoresis of purified GST-fused PH1 region protein and GST-fused PH2 region protein by SDS-PAGE and CBB staining. The lower left panel is a diagram showing a membrane in which a certain amount of 15 types of lipids existing in a living body are spotted. Moreover, the lower right panel is a figure which shows the result of having detected the coupling | bonding of a lipid and GST fusion protein (GST fusion PH1 area | region protein or GST fusion PH2 area | region protein) by ECL reaction. It is a figure which shows the localization in the cell of CLPABP and cardiolipin. It is a figure (fluorescence staining) showing intracellular localization of CLPABP mutants (mutants containing a PH region and mutants not containing a PH region). The first to third panels from the left are diagrams showing the localization of GFP-fused CLPABP in cells and the results of fluorescent staining of apoptotic cells. The rightmost panel shows the percentage of apoptotic cells after 60 hours of culture.

Claims (20)

A gene comprising DNA encoding the following protein (a) or (b).
(a) a protein comprising the amino acid sequence shown in SEQ ID NO: 2
(b) a protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2 and having apoptosis-inducing activity A gene comprising a DNA comprising a nucleotide sequence of nucleotide numbers 36 to 1868 of the nucleotide sequence shown in SEQ ID NO: 1 or a complementary sequence thereof, or a sequence containing a part or all of these sequences. A gene comprising a DNA that hybridizes with the DNA of claim 2 under stringent conditions and encodes a protein having apoptosis-inducing activity. A recombinant vector comprising the gene according to any one of claims 1 to 3 and capable of expressing an apoptosis-inducing protein. A transformant into which the recombinant vector according to claim 4 has been introduced and which expresses an apoptosis-inducing protein. The transformant according to claim 5, wherein the transformant is an animal. A protein consisting of the amino acid sequence shown in SEQ ID NO: 2. A protein having a partial amino acid sequence of the amino acid sequence shown in SEQ ID NO: 2 and having apoptosis-inducing activity. A protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2, and having apoptosis-inducing activity. A protein having an amino acid sequence in which one or several amino acids are deleted, substituted or added in a part of the amino acid sequence shown in SEQ ID NO: 2 and having apoptosis-inducing activity. The amino acid sequence of a part of the amino acid sequence shown in SEQ ID NO: 2 is the amino acid sequence of amino acid numbers 61-318 or the amino acid sequence of amino acid numbers 85-318 of the amino acid sequence shown in SEQ ID NO: 2. The protein described. The fusion protein which combined the protein in any one of Claims 7-11, and marker protein and / or a peptide tag. An antibody against the protein according to any one of claims 7 to 11, or the fusion protein according to claim 12. An apoptosis inducer comprising the protein according to any one of claims 7 to 11 or the fusion protein according to claim 12. The apoptosis inducer containing the gene in any one of Claims 1-3, or the recombinant vector of Claim 4. A method for inducing apoptosis of a cell by expressing the protein according to any one of claims 7 to 11 or the fusion protein according to claim 12 in a target cell. By introducing the gene according to any one of claims 1 to 3 into a target cell, the protein according to any one of claims 7 to 11 or the fusion protein according to claim 12 is expressed. The method of claim 16. The pharmaceutical which uses the protein in any one of Claims 7-11, or the fusion protein of Claim 12 as an active ingredient. 19. The medicament according to claim 18, which is a prophylactic / therapeutic agent for a disease effective in inducing apoptosis in a prophylactic / therapeutic manner. 20. The disease according to claim 19, wherein the disease is selected from the group consisting of cancer, autoimmune disease, viral infection, endocrine disease, blood disease, organ hyperplasia, post-angioplasty restenosis and recurrence after cancer resection. Medicine.