JP2008228589A - Method for analyzing nucleic acid - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To quickly and highly accurately detect the single-nucleotide mutation, using simple operations. <P>SOLUTION: A nucleic acid 4 containing a target base sequence is supplied to LCR reaction to amplify the target base sequence, and the obtained LCR reaction product 16 is subjected to LAMP reaction. An LCR primer set 10 in an LCR reaction solution 6 and an LAMP primer set 20 in an LAMP reaction solution 26 are preferably set to prescribed concentrations. The supply of the LCR reaction product 16 to the LAMP reaction enables to reduce the cycle number of the LCR reaction repeating heating and cooling, and a mutation can be detected with high accuracy using the LAMP reaction that does not need the heating and the cooling without depending on a real time measurement. Thus, even when a double-strand DNA is analyzed, the number of heating-cooling operations can be reduced, and the mutation can highly accurately be analyzed without depending on a real time measurement. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a nucleic acid analysis method for analyzing a base sequence by amplifying a nucleic acid containing a target gene sequence, and more particularly to an analysis method for detecting the presence or absence of a base sequence variation in a target gene sequence.

  Nucleotide sequence variations in the nucleic acid gene region are the cause of various constitutional differences. Therefore, mainly in the medical field, the presence or absence of mutations in the base sequence in the gene region is detected for the purpose of enhancing the effect and safety of drug administration, or for the purpose of determining whether or not it is susceptible to a specific disease. Analysis is being carried out.

  One method for detecting such mutations is a method that uses a reaction called ligase chain reaction (hereinafter referred to as “LCR reaction”) (Non-patent Document 1). In the LCR reaction, a pair of oligonucleotides having base sequences complementary to deoxyribonucleic acid (DNA) to be analyzed (hereinafter referred to as “oligo DNA”) are adjacent to each other with a slight gap, and a pair of adjacent oligonucleotides are adjacent to each other. The oligo DNAs are ligated together by ligase. The LCR reaction solution comprises two oligo DNAs that are set to be adjacent to each other by complementary binding to a single-stranded DNA to be analyzed (for example, a sense strand or an antisense strand in the case of analyzing double-stranded DNA). A heat-resistant ligase.

  One of the two oligo DNAs (hereinafter “5 ′ oligo DNA”) binds complementarily to the 5 terminal region of the target gene of the single-stranded DNA, and the other (hereinafter “3 ′ oligo DNA”) Binds complementarily to the 3 terminal region. At this time, the 5′-oligo DNA and the 3′-oligo DNA are set so as to complementarily bind to a single-stranded DNA serving as a template in a state adjacent to each other with a slight gap between them. . If there is no mutation in the base sequence of the template DNA, both the 5'-oligo DNA and the 3'-oligo DNA bind to the template DNA, and the two are linked by ligase to obtain an amplification product. When there is no mutation, the above-described series of reactions are repeated using the obtained amplification product as a template, so that the number of amplification products in which the target base sequence portion is amplified increases exponentially.

  On the other hand, if there is a mutation in the target base sequence of the template DNA, at least one of the 5'-oligo DNA and the 3'-oligo DNA does not completely bind to the single-stranded DNA as the template. For this reason, the 5'-oligo DNA and the 3'-oligo DNA are not linked and the amplification reaction is not repeated, so that DNA having a mutation in the target base sequence is not amplified.

  When analyzing double-stranded DNA, the LCR reaction solution generally consists of two sets of four types of oligo DNAs (first 5′-oligo DNA, first 3′-oligo DNA, and second 5′-side). Oligo DNA and second 3 ′ oligo DNA). The first 5′-oligo DNA and the first 3′-oligo DNA are set so as to have a base sequence that complementarily binds to the target base sequence portion of one (sense strand) of the double-stranded DNA. Yes. In addition, the second 5′-oligo DNA and the second 3′-oligo DNA have a base sequence complementary to the target base sequence portion of the other (antisense strand) of the double-stranded DNA, and the sense strand And the above reaction occurs for the antisense strand.

  Thus, in the LCR method, if there is a mutation in the target base sequence, the amplification reaction is not originally repeated, so that the mutation can be detected. However, in the LCR method, non-specific ligation that does not depend on the presence of a template, in which oligo DNAs are ligated at blunt ends, may occur, so that the accuracy of mutation detection by the LCR method alone is not necessarily high.

  On the other hand, a LAMP method (Loop-Mediated Isothermal Amplification) is known as a method for amplifying a diffusion target base sequence (Patent Document 1, Non-Patent Document 2), and a mutation detection method using the LAMP method is also proposed. (Patent Document 2, Patent Document 3). In the LAMP method, at least two types of inner primers (first inner primer and second inner primer), two types of outer primers (first outer primer and second outer primer), and strand displacement type DNA polymerase are used. Used. The inner primer is designed to include a sequence complementary to the primer at the end of the portion extended from the primer, and the single strand (first extension product) extended from the inner primer has a loop structure. Can be formed.

  That is, the first extension product indicated by reference numeral 35 in FIG. 6 includes an inner primer on one end side, and a portion extended from the inner primer has an end of a sequence complementary to the primer. . Then, when the first extension product 35 is peeled from the template nucleic acid into a single strand in the process in which the outer primer binds further upstream from the inner primer and the extension product is generated, this end is Complementary binding with the primer-derived portion forms a loop (see FIG. 6B). The first extension product 35 extended from one inner primer (for example, the first inner primer FIP) serves as a template for an extension reaction starting from the other inner primer (second inner primer BIP), A second extension product 36 is obtained (see FIG. 6 (c)). A loop is formed at both ends of the second extension product 36, and a further extension reaction starting from the loop occurs (see FIG. 6D).

  Thus, in the LAMP method, the extension reaction and the amplification reaction proceed simultaneously from a plurality of positions while the double strand is peeled off by the strand displacement type DNA polymerase. For this reason, in the LAMP method, nucleic acid amplification occurs in a super exponential manner, and the reaction occurs under isothermal conditions, so that it is not necessary to repeat heating and cooling in order to dissociate double-stranded DNA.

In such a mutation detection method using the LAMP method, an inner primer having a region including a mutation site to be detected is used (see Patent Document 2). If there is no mutation in the nucleic acid to be analyzed, a base sequence complementary to the region containing the mutation will not be generated in the extended product starting from the inner primer. Even if it is single-stranded, no loop is formed. For this reason, the LAMP reaction does not proceed any further. On the other hand, when the nucleic acid to be analyzed contains a mutation, a loop is formed when the extended strand that has been extended from the inner primer as a starting point is formed into a single strand, and hyperexponential amplification occurs. Thus, the presence or absence of mutation can be detected by measuring the amount of product produced as a result of the LAMP reaction.
International Publication No. WO00 / 29082 Pamphlet International Publication No. WO01 / 34838 Pamphlet JP 2003-159100 A Barany F. (1991), Genetic disease detection and DNA amplification using cloned thermostable ligase, Proc. Natl. Acad. Sci. USA .; 88 (1), 189-193 Notomi T. et al. (2000), Loop-mediated isothermal amplification of DNA, Nucleic Acid Research; 28 (12), e63 Iwasaki M. et al. (2003), Validation of the Loop-Mediated Isothermal Amplification Method for Single Nucleotide Polymorphism Genotyping with Whole Blood, Genome Letters 2 (3), 119-126

  Since the LAMP method originally has a margin in primer position selection, it is possible to verify the presence or absence of amplification with high specificity, and the final product (hereinafter referred to as “LAMP”) obtained by performing the LAMP reaction for a predetermined time. The presence or absence of amplification can be determined by measuring the reaction product "). However, the inner primer designed for mutation detection is almost the same as the wild-type primer except that one of the bases is different from the wild-type inner primer, and the different sites are limited to the terminal bases. Non-specific amplification is likely to occur. For this reason, real-time measurement is recommended to increase the accuracy of mutation detection.

  Real-time measurement is excellent in quantitativeness, but the amount of nucleic acid serving as a template contained in the sample to be analyzed is important, and it is necessary that the sample contains a certain amount of nucleic acid and dynamic. The range is low.

  Furthermore, it is recommended to use a purified genome subjected to concentration measurement as a recommended condition for performing the LAMP reaction. In contrast, when the present inventor conducted a LAMP reaction using unpurified blood as a sample with reference to Non-Patent Document 3, it was found that the mutation could not be detected. For this reason, when unpurified blood cannot be used, it is difficult to perform an analysis using the LAMP reaction at a clinical site.

  In view of the above problems, an object of the present invention is to provide a nucleic acid analysis method capable of detecting the presence or absence of a base mutation with high accuracy by suppressing nonspecific amplification. In particular, the LCR reaction and the LAMP reaction may interfere with each other, but the present invention aims to solve the above-described problems by extracting the respective advantages of the LCR method and the LAMP method. Another object of the present invention is to enable mutation detection using unpurified blood as a sample using the LAMP reaction.

  The invention according to claim 1 of the present invention is a method for analyzing a nucleic acid containing a target base sequence, wherein an LCR reaction is performed in an LCR reaction solution containing a sample having the nucleic acid and an LCR primer set for LCR reaction. In this analysis method, an LCR reaction product is generated, and the LCR reaction product is subjected to LAMP reaction in a LAMP reaction solution containing a LAMP primer set for LAMP reaction.

  In the present invention, an amplification product amplified by the LCR method is used as a template for the LAMP method. Specifically, after performing heat treatment in a predetermined range of temperature and time, a cooling operation to a predetermined range of temperature is performed, and an operation of performing a ligation reaction for a predetermined range of time and in one cycle is 10-30. The liquid substance (LCR reaction product) containing the amplification product obtained as a result of the LCR reaction that repeats about the cycle is subjected to the LAMP reaction.

  The invention according to claim 2 of the present invention is the method for analyzing nucleic acid according to claim 1, wherein the LCR reaction product is subjected to the LAMP reaction without heat denaturation treatment.

  Conventionally, in the LAMP method, when double-stranded DNA is an analysis target and this is used as a template, the double-stranded DNA is thermally denatured so that the inner primer can be bound by making the double-stranded DNA into a single strand. is required. Here, in the LCR reaction, the ligation reaction with respect to each double-stranded DNA used as a template for the LCR reaction is not equivalent, and one of the single strands is synthesized in a larger amount than the other single strand. An amplification product synthesized more than one single strand and containing the target gene sequence is included in the LCR reaction product in a single strand state. In the present invention, such an LCR reaction product is subjected to the LAMP reaction, so that an amplification product of the LCR reaction that exists in a single strand state and includes the target gene sequence can be used as a template for the LAMP reaction. Therefore, the heat denaturation treatment can be omitted in the LAMP reaction step, and the operation can be performed simply and quickly.

  In the invention according to claim 3 of the present invention, the concentration of the LCR primer set in the LCR reaction solution and the concentration of the LAMP primer set in the LAMP reaction solution are adjusted to a predetermined range. The nucleic acid analysis method described.

  The LCR reaction product may contain a primer for the LCR reaction in addition to the amplification product obtained as a result of the LCR reaction. If the LCR reaction primer remains in the LCR reaction product, the LAMP reaction may not proceed properly. On the other hand, the concentration of a plurality of types of primers (LCR primer set) used when performing the LCR reaction may be set within a predetermined range. Similarly, the concentration of a plurality of types of primers (LAMP primer set) used when performing the LAMP reaction may be set within a predetermined range. Thus, by adjusting the concentration of the primer used for the LCR reaction and the LAMP reaction to a predetermined concentration, it is possible to avoid the possibility that the LCR reaction and the LAMP reaction interfere with each other.

  The invention according to claim 4 of the present invention is the nucleic acid analysis method according to claim 3, wherein the concentration of the LCR primer set in the LCR reaction solution is 0.1 μM or more and 0.5 μM or less.

  In the invention according to claim 5 of the present invention, the LAMP primer set includes at least an inner primer set, and the concentration of the inner primer set in the LAMP reaction solution is 0.2 μM or more and 1.0 μM or less. 5. The method for analyzing a nucleic acid according to 3 or 4.

  The invention according to claim 6 of the present invention is that the LAMP primer set further includes a loop primer and an outer primer, and the concentration of the loop primer in the LAMP reaction solution is 0.1 μM or more and 0.5 μM or less. The nucleic acid analysis method according to claim 5, wherein the concentration of the outer primer is 0 μM or more and 0.1 μM or less.

  In the invention according to claim 7 of the present invention, the LCR reaction is carried out by heat denaturation treatment for 30 seconds at a temperature of 94 ° C., and then for 10 seconds to 30 seconds under a temperature condition of 65 ° C. to 70 ° C. The method for analyzing a nucleic acid according to any one of claims 1 to 6, wherein the treatment for performing the reaction is one cycle, and the number of cycles of the LCR reaction is 30 cycles or less.

  The invention according to claim 8 of the present invention is that the LAMP primer set includes at least an inner primer set and a loop primer, and the number of cycles of the LCR reaction is 10 cycles or more and 25 cycles or less. This is a nucleic acid analysis method.

  As described above, conventionally, two types of inner primers and two types of outer primers have been required to perform the LAMP reaction. However, as a result of research by the present inventors, it was found that the outer primer can be omitted when the LAMP reaction is performed using the LCR reaction product as a template. Therefore, according to the present invention, the types of primers required for the LAMP reaction can be reduced.

  The invention according to claim 9 of the present invention is the method for analyzing a nucleic acid according to any one of claims 1 to 8, wherein a reaction time for performing the LAMP reaction is 30 minutes or less.

  In the present invention, by combining the LCR reaction and the LAMP reaction, the LCR reaction can be completed with a fewer number of cycles than the number of cycles necessary when detecting mutations with the LCR method alone. Therefore, the time required for analysis can be shortened.

  In the invention according to claim 10 of the present invention, the target base sequence includes a mutation site, and the presence or absence of a mutation in the nucleic acid is detected by examining the presence or absence of an amplification product by the second LAMP reaction. Or a nucleic acid analysis method according to any one of the above.

  Conventionally, when detecting the presence or absence of mutations in the base sequence using the LAMP method alone, real-time measurement is necessary to obtain high accuracy, and the presence or absence of amplification by the LAMP reaction is examined by real-time measurement using a fluorescence detection method. It was. In the present invention, since the LAMP reaction is performed using the LCR reaction product as a template, the presence or absence of amplification can be detected by judging the presence or absence of amplification by examining the final product. For this reason, real-time measurement is not necessary, and the presence or absence of amplification can be detected by methods other than fluorescence detection, such as electrophoresis.

The invention according to claim 11 of the present invention is the nucleic acid analysis method according to any one of claims 1 to 10, wherein the sample contains 2 × 10 to 2 × 10 ³ human genomes / μL.
It is what.

  The invention according to claim 12 of the present invention is the method for analyzing a nucleic acid according to any one of claims 1 to 11, wherein the nucleic acid in the sample is not purified or the genome concentration is not measured.

  The invention according to claim 13 of the present invention is the nucleic acid analysis method according to any one of claims 1 to 12, wherein the sample is unpurified blood diluted with pure water.

  The invention according to claim 14 of the present invention is the nucleic acid analysis method according to claim 13, wherein the sample has a dilution ratio of 10 times with pure water.

  In the present invention, it is possible to detect the presence or absence of a base mutation using the LAMP reaction with high accuracy without performing real-time measurement. For this reason, unpurified nucleic acid and nucleic acid whose concentration has not been measured can be used for analysis. For example, the presence or absence of mutation can be detected simply by diluting unpurified blood into pure water.

  According to the present invention, the presence or absence of a mutation in the base sequence of a nucleic acid can be analyzed with high accuracy and in a short time. Further, according to the present invention, it is possible to analyze the presence or absence of a nucleotide sequence mutation without performing genome purification or concentration measurement, and it is possible to analyze simply by diluting unpurified blood in pure water.

  Hereinafter, the present invention will be described in detail with reference to the drawings. In the following, the same members are denoted by the same reference numerals, and description thereof is omitted or simplified.

  In the present invention, a part of a gene region of a nucleic acid is used as a target base sequence, and the presence or absence of a mutation in a specific part of the target base sequence is analyzed. The genome to be analyzed does not need to be a purified genome, and the concentration of the genome need not be measured. For this reason, for example, unpurified blood is diluted with pure water about 5 to 15 times, particularly 10 times, and this can be used as a sample to be an analysis sample according to the present invention.

  The analysis target contains a nucleic acid, and after amplifying the nucleic acid by the LCR reaction, the reaction product containing the amplification product obtained by the LCR reaction is subjected to the LAMP reaction. Therefore, first, the step of performing the LCR reaction (LCR step) will be described.

<< LCR process >>
1 and 2 are schematic diagrams for explaining an LCR process in the analysis method according to one embodiment of the present invention. First, as shown in FIG. 1A, double-stranded DNA to be analyzed indicated by reference numeral 4 is mixed with an LCR reaction solution 6 containing an LCR primer set 10 and a heat-resistant ligase 2. FIG. 1B shows a schematic diagram of the double-stranded DNA 4 and the four types of oligo DNA constituting the LCR primer set 10. In this embodiment, among the gene regions of double-stranded DNA, the base sequence of the region indicated by X in FIG. 1 (b) is used as the target base sequence, and the presence / absence of the mutation at the locus surrounded by the broken line is analyzed.

  The double-stranded DNA 4 is heat-denatured by heat treatment at about 94 ° C. to 99 ° C. for 10 seconds to 120 seconds to dissociate the double strands as shown in FIG. The heat treatment time is preferably 20 seconds to 40 seconds, particularly 25 seconds to 35 seconds. Next, when the heat-treated LCR reaction solution 6 is cooled to about 50 ° C. to 70 ° C., the sense strand 4 (+) as one strand obtained by dissociating the double-stranded DNA 4 and the antisense strand as the other strand The oligo DNA added as LCR primer set 10 is hybridized to 4 (−). The linking reaction by cooling is preferably performed at a temperature of 65 ° C. or higher and 70 ° C. or lower for 30 seconds to 60 seconds, particularly 30 seconds.

  The LCR primer set 10 includes two oligo DNAs having a sequence complementary to the target base sequence of the sense strand 4 (+) as the first oligo DNA pair (the first 3 ′ oligo DNA and the first 5 ′ oligo DNA). ) Is included. The LCR primer set consists of a pair of oligo DNAs (second 3 ′ oligo DNA and second 5 ′ having a sequence complementary to the target base sequence of the antisense strand 4 (−) as the second oligo DNA pair. Oligo DNA). Hereinafter, the first oligo DNA pair is referred to as “3 ′ oligo DNA” and “5 ′ oligo DNA”, respectively, and the second oligo DNA pair is referred to as “3 ′ oligo DNAc” and “5 ′ oligo DNAc”, respectively.

  Among these oligo DNAs, 3 ′ oligo DNA and 5 ′ oligo DNA have a base sequence complementary to the target base sequence of sense strand 4 (+) and are hybridized to sense strand 4 (+). Designed to be adjacent to each other with a slight gap. On the other hand, the 3 ′ oligo DNAc and the 5 ′ oligo DNAc are complementary to the target base sequence of the antisense strand 4 (−), and are adjacent to each other with a slight gap between the single strand 4 (− ).

  Therefore, in this embodiment, the 3 'oligo DNA and the 5' oligo DNA are hybridized to the target base sequence region of the sense strand 4 (+), and both are adjacent to each other with a slight gap. Similarly, 3 'oligo DNAc and 5' oligo DNAc hybridize with the target base sequence region of antisense strand 4 (-) and are adjacent to each other with a slight gap (see Fig. 2 (b)).

  If there is no mutation in the target base sequence of the sense strand 4 (+), the 3 ′ oligo DNA and the 5 ′ oligo DNA hybridize to the target base sequence of the sense strand 4 (+), and the thermostable ligase 2 is 3 ′. The gap between the oligo DNA and the 5 ′ oligo DNA is ligated to obtain a ligation product 15 that is an amplification product by the LCR reaction (see FIG. 2C).

  In the LCR step, a heating operation for dissociating double strands and an operation for cooling the reaction solution after the heat treatment to perform hybridization and a ligation reaction are set as one cycle, and this cycle is 10 to 60 cycles, preferably 20 to 30 cycles, particularly preferably 23 cycles. Since the ligation product becomes a template in the next cycle, by repeating the above reaction, the LC ligation product 15 obtained by copying the target base sequence is exponentially amplified (see FIG. 3A). An LCR reaction product 16 containing is obtained (see FIG. 3 (b)). The LCR process may be within 30 minutes as a whole (ie, when 23 cycles are performed, from the start of the first cycle to the end of the 23rd cycle).

  The LCR primer set 10 only needs to include one-to-two types of oligo DNAs designed to hybridize with a target base sequence on at least one of the double-stranded DNAs 4. That is, if either the first oligo DNA pair (3 ′ oligo DNA and 5 ′ oligo DNA) or the second oligo DNA pair (3 ′ oligo DNA c and 5 ′ oligo DNA c) in this embodiment is included. Good.

  Each oligo DNA of the LCR primer set 10 is preferably contained in the LCR reaction solution 6 at a concentration of 0.1 μM or more and 0.5 μM or less, more preferably about 0.2 μM, particularly 0.25 μM. Use the optimal concentration.

  In the LCR reaction, if there is a mutation in the target base sequence of DNA4, the oligo DNA added as the LCR primer set 10 does not hybridize to the target base sequence region (see FIG. 3 (c)). Therefore, 3 ′ oligo DNA and 5 ′ oligo DNA (or 3 ′ oligo DNA c and 5 ′ oligo DNA c) that are adjacent on the target base sequence are not originally ligated and a ligation product cannot be obtained. For this reason, if there is a mutation, the target base sequence is not originally amplified even if the LCR reaction is performed.

  However, since non-specific ligation may occur at the blunt ends of the oligo DNA and amplification may occur, the accuracy in detecting mutations by the LCR method alone is not necessarily high. Therefore, in the present invention, the detection accuracy of single nucleotide mutations is improved by using the ligation product obtained by the LCR reaction as a template for the LAMP method. Hereinafter, the process of performing the LAMP reaction (LAMP process) will be described.

<< LAMP process >>
In the LAMP process, a LAMP primer set 20 including at least two types of inner primers is used as a primer for the LAMP reaction. Specifically, the LAMP primer set 20 includes at least a pair of inner primers FIP and BIP. The LAMP primer set 20 preferably further includes at least one loop primer (loop primer FLP or BLP). The LAMP primer set 20 may further include at least one outer primer (outer primer FOP or BOP). The LAMP primer set 20 is mixed with the LCR reaction product 16 in the presence of the strand displacement type DNA polymerase 12 in the LAMP reaction solution 26 (see FIG. 4).

  The first inner primer FIP and the second inner primer BIP are configured such that the 5 'side forms a loop structure. One or both of the pair of inner primers FIP and BIP are designed to function as a check primer for checking the presence or absence of a mutation in the target base sequence. The check primer is designed to include a base sequence of a specific region where a target base sequence mutation may exist and a predicted base sequence. If there is a mutation, the check primer checks whether there is a mutation by not forming a loop structure.

  The outline of the LAMP reaction will be described with reference to FIGS. FIG. 5A schematically shows the ligation product 15 obtained by the LCR reaction. In the present invention, as shown in FIG. 4, the LCR reaction product 16 containing the ligation product 15 is subjected to the LAMP reaction. The LCR reaction product 16 includes a ligation product 15 that has been amplified using a region including a locus where a mutation may exist as a target base sequence, and the ligation product 15 includes a specific region (mutation region) where a mutation may exist. A partial region on the 3 'side of the region containing the target base sequence of the ligation product 15 is defined as a region (first defined region) F2 that defines the 3' side of the target base sequence. A part of the region on the 5 'side of the region including the target base sequence is defined as a region (second defining region) B2 that defines the 5' side of the target base sequence. The region where the mutation can exist is located between the first defined region F2 and the second defined region B2, and this region is hereinafter referred to as a mutated region.

  In the LCR step, double-stranded DNA is synthesized, and the first defined region F2 on one strand (sense strand) of the double-stranded DNA is located on the other strand (antisense strand). A region having a base sequence complementary to the sequence predicted to be the base sequence of the first defined region F2 is referred to as an anti first defined region F2c. Hereinafter, the same applies, and a region having a base sequence complementary to the sequence expected to be the base sequence of the second defined region B2 on the sense strand is referred to as an anti-second defined region B2c. In the drawing, reference numeral 15 (+) is attached to the sense strand and reference numeral 15 (−) is attached to the antisense strand, but in the text, the reference numerals are omitted for the sake of simplicity.

  When the first inner primer FIP is used as a check primer, the first defined region F2 in the sense strand is a region adjacent to the 5 ′ side of the mutated region F1, and the first inner primer FIP is the first defined region of the sense strand. It sets so that it may hybridize to the area | region F2. Specifically, the first inner primer FIP has an anti-first defined region F2c composed of a base sequence complementary to the predicted base sequence of the first defined region F2 on the 3 'side. The first inner primer FIP is designed to have a mutation region F1 composed of the base sequence of the mutation region F1 and the predicted base sequence on the 5 'side.

  Therefore, when the LCR reaction product 15 and the first inner primer FIP are mixed and incubated at a temperature of around 65 ° C., the double-stranded DNA is in a dynamic equilibrium state, whereby the first inner primer The anti-first defined region F2c portion of FIP hybridizes to the first defined region F2 of the sense strand (see FIG. 5 (b)). In the LAMP process, a strand displacement type DNA polymerase 12 is contained in the reaction solution, and a DNA strand complementary to the sense strand (first strand) starting from 3 ′ of the first inner primer FIP hybridized to the sense strand. ) 35) is synthesized (see FIG. 5C).

  In this embodiment, the LAMP primer set 20 includes an outer primer set that is a pair of outer primers FOP and BOP. Each of the outer primers FOP and BOP is designed to perform an extension reaction while peeling off the extension product 35 synthesized by each of the inner primers FIP and BIP from the template DNA by the action of the strand displacement type DNA polymerase. Specifically, the first outer primer FOP is configured to have a base sequence complementary to the base sequence of the peeling region F3 on the 5 ′ side of the first defined region F2 of the sense strand on the 3 ′ side. Has been. For this reason, the first outer primer FOP hybridizes to the region F3 located 5 'to the first defined region F2 of the sense strand as shown in FIG. 5 (d).

  In this way, the outer primer FOP is hybridized so as to be sandwiched between the extension product 35 of the first inner primer FIP and the sense strand as a template thereof, and by DNA synthesis starting from the outer primer FOP. Then, a complementary strand 15 (−) ′ that is a duplicate of the sense strand is synthesized (see FIG. 6A). On the other hand, the first extension product 35 made into a single strand by synthesizing the complementary strand 15 (−) ′ replicated by DNA synthesis starting from the outer primer FOP has a loop structure on the 5 ′ side. Form.

  Here, the first extension product 35 includes portions (F1 and F2c) derived from the first inner primer FIP on the 5 ′ side, and the 3 ′ side is extended from the first inner primer FIP as a starting point. Region (extension region). On the 5 'side of the extension region, the mutation region F1 adjacent to the 5' side of the first defined region F2 of the sense strand is copied. Accordingly, in the first extension product 35, as shown in FIG. 6B, F1 and F1c on the 5 'side are complementarily bonded to form a loop.

  On the other hand, on the 3 'side of the first extension product 35, an anti-second defined region B2c in which the second defined region B2 of the sense strand is copied is included. Here, the second inner primer BIP has an anti second prescribed region B2c composed of a base sequence complementary to the predicted base sequence of the second prescribed region B2 on the 3 ′ side. On the side, the region has a region B1 composed of a base sequence predicted from the base sequence of the region B1 on the 5 ′ side of the second defined region B2c. Therefore, the second inner primer BIP can not only hybridize with the antisense strand, but also can hybridize with the first extension product 35 as shown in FIG. 6 (b).

  By hybridizing the second inner primer BIP to the first extension product 35, the second extension product 36 is synthesized using the first extension product 35 as a template. Then, when the second outer primer BOP is hybridized to the first extension product 35, the second extension product 36 is peeled from the first extension product 35 and becomes a single strand. At this time, the second extension product 36 forms a loop at both ends (see FIG. 6 (d)), and the synthesis reaction starting from the loop on the 3 'side starts.

  Thus, if there is no mutation in the mutation region F1, the target base sequence is also synthesized from the extension product by the LAMP reaction. On the other hand, if there is a mutation in the mutation region F1, the base sequence of the region where the anti-mutation region F1c is originally formed will not be a complementary nucleotide sequence to the mutation region F1. Therefore, if there is a mutation, a loop structure is not formed, and the LAMP reaction stops when the second extension product 36 is synthesized.

  Therefore, the presence or absence of mutation can be detected by measuring the amount of the final product in the LAMP process by electrophoresis as described later. Thus, according to the present invention, since it is not necessary to perform real-time measurement, it is not necessary to purify the genome to be analyzed and to measure the concentration, and it is possible to measure a sample obtained by diluting unpurified blood with pure water. In addition, since a strand displacement type DNA polymerase is used in the LAMP process, the amplification reaction proceeds in a state where the temperature condition is around 60 ° C. to 65 ° C. Therefore, it is not necessary to repeat heating and cooling as in the LCR reaction. Furthermore, since the LCR reaction product containing the amplification product by the LCR reaction existing in a single strand state is subjected to the LAMP reaction, the LCR reaction product can be subjected to the LAMP reaction without being thermally denatured.

  In this embodiment, the LAMP primer set 20 further includes a loop primer set including a pair of loop primers FLP and BLP. The loop primers FLP and BLP are designed to hybridize to loops formed at different ends of the extension products 35 and 36 synthesized by the inner primers FIP and BIP, respectively. Specifically, the first loop primer FLP has a sequence F2c complementary to the first defined region F2, and the second loop primer BLP has a sequence B2c complementary to the second defined region B2. On the 3 ′ side of the extension product synthesized by the first inner primer FIP, the anti-first defined region F2c is sandwiched between the mutation region F1 and the anti-mutation region F1c having a sequence complementary thereto. When the extension product is single-stranded, the mutation region F1 and the antimutation region F1c are hybridized to form a loop. The first loop primer FLP hybridizes to the anti-first defined region F2c that becomes the circular portion of the loop (see FIG. 6 (d)).

  Then, the synthesis reaction proceeds with the first loop primer FLP as a starting point. Thus, the origin of DNA synthesis can be increased by including the loop primers FLP and BLP in the LAMP primer set 20. For this reason, the time required for the LAMP reaction can be shortened. In the present invention, the number of cycles of the LCR reaction can be reduced as will be described later.

  In this embodiment, a pair of outer primers FIP and BIP are used, but either outer primer FIP or BIP may be used. Similarly, although the loop primer is also paired, either the loop primer FLP or BLP may be used. In the present invention, not only the loop primer but also the outer primer can be omitted, and the LAMP reaction can be performed using only the inner primer.

  In the present invention, since the LAMP reaction is performed using the reaction product of the LCR reaction as a template, the primer concentration in the reaction solution used for each reaction may be set within a predetermined range. Specifically, the LCR reaction is as described above, and for the LAMP reaction, the concentration of the inner primer is preferably 0.2 μM or more and 1.0 μM or less, particularly 0.4 μM. Since it is possible to omit the outer primer, the concentration is set to 0 μM or more and 0.1 μM or less, particularly 0.05 μM. Further, when the loop primer is included in the LAMP primer set, the concentration of the loop primer is preferably 0.1 μM or more and 0.5 μM or less, particularly 0.2 μM.

  The LAMP process is preferably performed within 30 minutes, particularly about 15 to 20 minutes. After completion of the LAMP step, the presence or absence of mutation can be detected by measuring the final product contained in the reacted solution obtained from the LAMP step and analyzing whether the target base sequence is amplified. If the target base sequence is amplified, the reaction solution obtained from the LAMP process contains a lot of amplification products, so the presence or absence of amplification can be analyzed regardless of the fluorescence detection method. Other than the method, for example, electrophoresis, diffusion electrochemical method, diffusion spectroscopic altitude measurement, turbidity measurement or the like can be used.

[Reference Example 1]
In Reference Example 1, purified genomic DNA was used as a sample for analysis. As the purified genome, a commercially available purified human genome (Roche, Human Genomic DNA, Cat. No. 11-691-001) was used. The concentration of DNA derived from the purified genome was 0.5 ng / μL. In the following, it was assumed that the presence or absence of mutation was detected using the human CYP2C19 gene as the target gene sequence in the sample DNA base sequence and the G636A1 nucleotide polymorphism of the CYP2C19 gene as the target mutation. The wild-type base sequence of the CYP2C19 gene is shown in SEQ ID NO: 1. In the single nucleotide variant, the 56th position of SEQ ID NO: 1 (the locus underlined in the following sequence) is A instead of G.
CYP2C19 gene; SEQ ID NO: 1
Ttct taacttgatg gaaaaattga atgaaaacat caggattgta agcaccccct g g atccaggt aaggccaagt tttttgcttc ctgagaaacc acttacagtc tttttttctg gg

First, let us consider the time required for the LCR reaction. From the first 3′-side oligo DNA, the second 3′-side oligo DNA, the first 5′-side oligo DNA, and the second 5′-side oligo DNA, The following LCR primer set was prepared. The base sequence of the first 3 ′ oligo DNA is SEQ ID NO: 2, the base sequence of the second 3 ′ oligo DNA is SEQ ID NO: 3, and the base sequence of the first 5 ′ oligo DNA is SEQ ID NO: 4. The base sequence of the second 5 ′ oligo DNA is shown in SEQ ID NO: 5.
First 3 ′ oligo DNA (WT-sp-FIP); SEQ ID NO: 2
tct taacttgatg gaaaaattga atgaaaacat caggattgta agcaccccct gG
Second 3 ′ oligo DNA (WT-sp-rFIP); SEQ ID NO: 3
Ccagggggtgcttacaatcctgatgttttcattcaatttttccatcaagttaaga
First 5 ′ oligo DNA (sp-BIP); SEQ ID NO: 4
atccaggt aaggccaagt tttttgcttc ctgagaaacc acttacagtc tttttttctg gg
Second 5 ′ oligo DNA (sp-rBIP); SEQ ID NO: 5
cccagaaaaaaagactgtaagtggtttctcaggaagcaaaaaacttggccttacctggat

  The first 3′-side oligo DNA and the first 5′-side oligo DNA (hereinafter referred to as “first oligo DNA pair”) have a complementary base sequence in the sense strand, and the second 3′-side oligo DNA The second 5 ′ oligo DNA (hereinafter “second oligo DNA pair” has a base sequence complementary to the antisense strand.

  All four types of oligo DNAs were mixed in the LCR reaction solution so as to have a final concentration of 2 μM. As the thermostable ligase, Ampligase (trade name, 5 U / μM, manufactured by Epicentre) was used, and the buffer attached to this enzyme was used at the recommended concentration. The composition of the LCR reaction solution is described below.

<LCR reaction solution>
Purified genome (10 ng / μL): 1 μL
Distilled water: 12 μL
Ampligase buffer (diluted 10 times): 2μL
Heat-resistant ligase (5U / μL): 1μL
Each primer (each 40μM): 1μL

  The recommended temperature reaction when performing an LCR reaction using Ampligase was to react at 94 ° C. for 120 seconds and then at 68 ° C. for 60 seconds. In Reference Example 1, the conditions of the LCR reaction were changed. A total of 11 patterns were tested, 10 patterns tested and 1 pattern without temperature cycling. Table 1 shows the experimental conditions for each pattern.

  The results are shown in FIG. In FIG. 7, each lane is indicated by a round bracket. Even when the time of holding at 94 ° C. and the time of holding at 68 ° C. are both shortened to 30 seconds (the ninth lane and the tenth lane in FIG. 7), the amount of amplified product is reduced, but there is a significant effect on the enzyme activity. It turns out that it doesn't happen.

[Reference Example 2]

  In Reference Example 2, the length (number of cycles) of the LCR reaction required when the amplification product by the LCR reaction was used as a template for the LAMP reaction was examined.

  In Reference Example 2, the purified DNA used in Reference Example 1 was subjected to an LCR reaction at a concentration of 100 ng / μL, 10 ng / μL, 1 ng / μL, or 0.1 ng / μL, respectively. The reaction solution for the LCR reaction was the same as in Reference Example 1 except that the concentration of the purified genome used as a template was different. The LCR primer set used for the LCR reaction was also the same as in Reference Example 1.

  In Reference Example 2, one cycle of the LCR reaction was made to react at 68 ° C. for 30 seconds after heat denaturation treatment at 94 ° C. for 30 seconds, and the number of reaction cycles was 10 cycles, 30 cycles, or 50 cycles. Moreover, as a control in Reference Example 2, after reacting at 94 ° C. for 60 seconds and then reacting at 68 ° C. for 120 seconds, one cycle is performed, and this is repeated 50 cycles to obtain an LCR reaction product containing the amplified product. It was.

  A LAMP reaction solution in which the obtained LCR reaction product was mixed was prepared, and a LAMP reaction was performed. The composition of the LAMP reaction solution is described below. For each experimental group, the case where the loop primer set was added to the LAMP reaction solution and the case where it was not added were set.

SEQ ID NO: 6 shows the base sequence of one (first inner primer FIP) of the pair of inner primers constituting the LAMP primer set, and SEQ ID NO: 7 shows the base sequence of the other (second inner primer BIP).
First inner primer FIP; SEQ ID NO: 6
TCCAGGGGTCTTAACTTGATGGAAAAAT
Second inner primer BIP; SEQ ID NO: 7
GGATCCAGGCCCAGAAAAAAAGACTGT

SEQ ID NO: 8 shows the base sequence of one (first loop primer FLP) of the pair of loop primers included in the LAMP primer set, and SEQ ID NO: 9 shows the base sequence of the other (second loop primer BLP).
First loop primer FLP; SEQ ID NO: 8
GCTTACAATCCTGATGTT
Second loop primer BLP; SEQ ID NO: 9
GTAAGGCCAAGTTTTTTG

The base sequence of one of the pair of outer primers included in the LAMP primer set (first outer primer FOP) is shown in SEQ ID NO: 10, and the base sequence of the other (second outer primer BOP) is shown in SEQ ID NO: 9.
First outer primer FOP; SEQ ID NO: 10
TCCAGAAACGTTTCG
Second outer primer BOP; SEQ ID NO: 11
AGGGCTTGGTCAATAT

<LAMP reaction solution>
LCR reaction product: 1.0 μL
Distilled water: 0.45 μL
Attached buffer (10-fold dilution): 0.8 μL
2.5 mM each dNTP: 1.0 μL
Betaine (5M): 1.0 μL
Strand displacement type DNA polymerase (5 U / μL): 0.25 μL
Primer mix: 0.5 μL

In addition, as a primer, the primer mix attached to the Eiken Chemical Co., Ltd. Loopamp (trademark) P450 typing reagent kit was used. The composition of the primer mix is as follows.
<Primer mix>
Inner primer (16 pmol / μL)
Outer primer (2 pmol / μL)
Loop primer (8 pmol / μL)

    The LAMP reaction was performed at 60 ° C. for 30 minutes, and the reacted solution after completion of the LAMP reaction was subjected to analysis by electrophoresis to examine the presence or absence of amplification. The results are as shown in FIG.

  From Reference Example 2, it was found that if the number of cycles of the LCR reaction is 30 cycles or more, amplification by the LAMP reaction using the LCR reaction product obtained by the LCR reaction as a template occurs. Further, it was found that when the LAMP reaction is performed, if a loop primer is included in the reaction solution, the number of LCR reaction cycles can be reduced to 30 cycles or less, and 10 cycles or more is sufficient.

[Reference Example 3]
In Reference Example 3, the influence of the primer used in the LCR reaction (LCR primer) remaining in the LCR reaction product on the amplification rate and mutation discrimination ability of the LAMP reaction was examined. In Reference Example 3, instead of the purified genome used in Reference Examples 1 and 2, a purified genome derived from LSI74T cultured cells, which is a G homozygote, was used in order to find out whether the specificity could be accurately determined. The G allele and A allele are used in separate reactions, and the primer set used in the LCR reaction for G allele detection is the LCR primer set used in Reference Example 1 (hereinafter referred to as “LCR primer set (G)”). Was used.

On the other hand, as the LCR primer set (LCR primer set (A)) used in the LCR reaction for detecting the A allele, the nucleotide sequence shown in SEQ ID NO: 12 instead of the first 3′-side oligo DNA of the LCR primer set (G) (Hereinafter referred to as “first 3′-oligo DNA (A)”). In addition, an LCR primer set (G), an oligo DNA having a base sequence shown in Sequence Listing 13 (hereinafter, “second 3 ′ oligo DNA (A)”) was used instead of the second 3 ′ oligo DNA.
First 3 ′ oligo DNA for detection of A allele (MT-sp-FIP); SEQ ID NO: 12
tct taacttgatg gaaaaattga atgaaaacat caggattgta agcaccccct gA
Second 3 ′ oligo DNA for detection of A allele (MT-sp-rFIP); SEQ ID NO: 13
Tcagggggtgcttacaatcctgatgttttcattcaatttttccatcaagttaaga

  Prepare an LCR reaction solution of these LCR primer sets (G) or (A) so that the final concentration of each oligo DNA is 2.0 μM, 1.5 μM, 1.0 μM, 0.5 μM, or 0.2 μM. did. The concentration of the DNA derived from the purified genome as a template was 10 ng / μL, and the addition amount was 1 μL. The concentrations and addition amounts of the other components contained in the LCR reaction solution were the same as in Reference Example 1.

  In Reference Example 3, as in Reference Example 2, the LCR reaction was repeated at 94 ° C. for 30 seconds and then at 68 ° C. for 30 seconds, and this was repeated for 10, 23, 37, or 50 cycles. In Reference Example 3, distilled water as an accessory of Loopamp (registered trademark) P450 typing reagent kit manufactured by Eiken Chemical Co., Ltd. was used as a negative control instead of DNA.

  The LAMP reaction was performed based on Non-Patent Document 2, and the LAMP primer used in Reference Example 2 was used as a primer set for G allele detection (LAMP primer set (G)).

As a primer set for detecting an A allele (LAMP primer set (A)), the first allele for A allele having the base sequence shown in SEQ ID NO: 14 is used instead of the first inner primer FIP of the LAMP primer set (G). Inner primer MT-FIP was used. Further, in the LAMP primer set (A), the second inner primer MT-BIP for A allele having the base sequence shown in SEQ ID NO: 15 was used instead of the second inner primer BIP of the LAMP primer set (G). .
First inner primer for detection of A allele (MT-FIP); SEQ ID NO: 14
TTCAGGGGTCTTAACTTGATGGAAAAAT
Second inner primer for detection of A allele (MT-BIP); SEQ ID NO: 15
GAATCCAGGCCCAGAAAAAAAGACTGT

  In the reaction solution of the LAMP reaction, a pair of two types of inner primers are each at a concentration of 1.6 μM, a pair of two types of loop primers are each at a concentration of 0.8 μM, and a pair of two types of outer primers are each 0.2 μM ( All were contained at the final concentration). The LAMP reaction was performed with a reaction time of 20 minutes. The results are shown in FIG. In FIG. 9, the lane name indicates the aryl type (G or A) and the added primer concentration used for the LCR reaction. D01 and D02 indicate lanes when distilled water is used in place of purified genomic DNA as a negative control.

  As shown in FIG. 9, when the reaction in the LCR step was 10 cycles, amplification occurred in the LCR reaction, but there was no specificity, and specificity was obtained when the number of cycles was 10 or more, especially 23. It was also found that the concentration of the LCR primer affected the specificity.

[Reference Example 4]
In Reference Example 4, the LAMP primer concentration in the case of performing the LAMP reaction using the amplification product by the LCR reaction as a template was examined. Specifically, in Reference Example 3, the concentration of the LAMP primer was diluted 2-fold, 4-fold, or 8-fold. Reference Example 4 was the same as Reference Example 3 except for the LAMP primer concentration, and the LCR reaction was 10 cycles or 23 cycles. When the LAMP amplification product obtained by the LAMP reaction in Reference Example 4 was subjected to analysis by electrophoresis, the results shown in FIG. 10 were obtained, and the LAMP primer concentration should be 4 times that of Reference Example 3. There was found.

[Reference Example 5]
Furthermore, the concentration of the DNA derived from the purified genome used in Reference Example 3 was adjusted to 100 ng / μL, 10 ng / μL, or 1 ng / μL, and the LCR reaction was performed, followed by the LAMP reaction. The LCR reaction solution was adjusted to have an LCR primer concentration of 20 pmol / μL, 15 pmol / μL, 10 pmol / μL, 5 pmol / μL, or 2 pmol / μL, and otherwise the same as in Reference Example 1. In the LCR reaction, after the reaction at 94 ° C. for 30 seconds, the operation of reacting at 68 ° C. for 30 seconds was one cycle, and the cycle number was 23 cycles.

  The LAMP reaction was performed at 60 ° C. for 20 minutes using the same LAMP reaction solution as that used in Reference Example 2 except that the primer mix concentration was diluted 2 or 4 times. . The results are shown in FIG.

  As shown in FIG. 11, there is no difference in the concentration range of purified genomic DNA used as a template, and it is possible to control nonspecific amplification by adjusting the LCR primer concentration and the LAMP primer concentration. Was shown to be higher. Further, when the LAMP primer was diluted 2-fold, the range of high specificity was different, although the specificity was obtained even when the LAMP primer was diluted 4-fold. It was found that the lower the LAMP primer concentration, the more specific amplification can be obtained even when the LCR primer concentration is higher, and that the non-specific amplification is observed when the LCR primer concentration is too low.

[Reference Example 6]
As Reference Example 6, the LAMP reaction times in Reference Example 3 were 10 minutes, 15 minutes, and 17 minutes. Reference Example 5 was the same as Reference Example 3 except for the LAMP reaction time. When the LAMP amplification product obtained by the LAMP reaction in Reference Example 6 was subjected to analysis by electrophoresis, it was found that the LAMP reaction time should be 17 minutes.

[Reference Example 7]
In Reference Example 7, the purified genomic DNA used in Reference Example 3 was diluted to 100 ng / μL, 10 ng / L, or 1 ng / L to prepare a sample. In Reference Example 7, the LCR primer concentration of the LCR reaction solution was added at a concentration of 5 μM with an addition amount of 1 μL with respect to a total reaction solution amount of 20 μL to a final concentration of 0.25 μM. Other conditions in the LCR process were the same as in Reference Example 3. In addition, the LAMP reaction was added so that the final concentration of each LAMP primer was 0.4 μM for the inner primer, 0.05 μM for the outer primer, and 0.2 μM for the loop primer. Similarly, the LAMP reaction time was 17 minutes.

  Furthermore, in Reference Example 7, as a control, the purified genome diluted in three steps was subjected to the LAMP reaction without performing the LCR reaction. For control, a LAMP Eiken Chemical Co., Ltd. Loopamp (registered trademark) P450 typing reagent kit was used, and the inner primer, outer primer, and loop primer were all used as they were without diluting the kit accessories. A sample diluted in three stages for a time of 35 minutes was subjected to a LAMP reaction.

  The results are shown in FIG. As shown in FIG. 12, when the LCR reaction product was used as a template for the LAMP reaction, it was shown that the dynamic range could be increased by an order of magnitude or more compared to the case where the LAMP reaction was performed alone without the LCR reaction.

[Reference Example 8]
As Reference Example 8, an experiment was performed comparing the case where the outer primers FOP and BOP were not included with the case where the LAMP primer set was included. In Reference Example 8, the LCR reaction was performed using the LCR reaction solution having the composition described in Reference Example 1 and the reaction performed at 94 ° C. for 30 seconds and then at 68 ° C. for 30 seconds was one cycle, and the number of cycles was 23. Cycle. As the LCR reaction liquid, two kinds of LCR primer concentrations of 5 pmol / μL and 2 pmol / μL were used.

The LAMP reaction was performed at 60 ° C. for 15 minutes using the LAMP reaction solution used in Reference Example 2 except that a primer mix having the following composition was used.
<Primer mix>
Inner primer (8 pmol / μL)
Loop primer (4 pmol / μL)
Outer primer (1.6 pmol / μL)

  The results are shown in FIG. As shown in FIG. 13, when the outer primer was not used as compared with the case where the outer primer was used, the reaction efficiency was slightly reduced, but it was revealed that the detection accuracy was not greatly affected.

[Example 1]
As Example 1, an LCR reaction was performed using an LCR reaction solution having the composition shown in Reference Example 1 using a sample of the purified genomic DNA (G allele homo) derived from LSI74T cultured cells used in Reference Example 3 at a concentration of 10 ng / μL. Went. One cycle of the LCR reaction was a heat treatment at 94 ° C. for 30 seconds, followed by a reaction at 68 ° C. for 30 seconds, and the number of reaction cycles was 23.

  Next, the obtained LCR reaction product was subjected to a LAMP reaction. The composition of the LAMP reaction solution is as shown below. As the LAMP primer set, the same primer as the primer set used in Reference Example 3 was used for both G allele detection and A allele detection.

<LAMP reaction solution>
LCR reaction product: 1.25 μL
Distilled water: 5.25 μL
RM buffer included in the kit: 5.0 μL
Strand displacement type DNA polymerase (8 U / μL): 0.5 μL

  As the LAMP primer, the primer mix used in Reference Example 2 was used, the addition amount was 0.5 μL, the final concentration of the inner primer was 0.4 μM, the final concentration of the outer primer was 0.05 μM, and the final concentration of the loop primer was 0.2 μM. It was.

  In Example 1, instead of purified genomic DNA derived from LSI74T cultured cells (G allele homozygote) as a positive control, an experiment using DNA derived from a purified genomic genome of hetero was also performed. Furthermore, as a negative control, an experiment using pure water instead of purified genomic DNA was also conducted.

[Comparative Example 1]
As a comparative example, the purified genome subjected to the LCR reaction in Example 1 was directly subjected to the LAMP method. That is, in Comparative Example 1, the LAMP method was performed alone. In Comparative Example 1, before starting the LAMP reaction, the purified genome was heat denatured at 95 ° C. for 5 minutes as described in the instruction manual of Loopamp (registered trademark) P450 typing reagent kit manufactured by Eiken Chemical Co., Ltd. After the treatment, cooling on ice was performed for 5 minutes. In Example 1, the LCR reaction product is subjected to the LAMP reaction without such heat denaturation and cooling treatment.

[Results of Example 1 and Comparative Example 1]
By repeating the experiment of Example 1 and Comparative Example 1 20 times, the LAMP reaction alone was compared with the present invention, and the stability of the reaction was verified by repeated verification. An example of the experimental results is shown in FIG. In FIG. 14, PC is a positive control (G and A are positive), LS is hetero (G positive, A negative), and DDW is negative control (both G and A are negative).

  In Example 1 and Comparative Example 1, with regard to the positive control, the correct result was obtained if specific amplification occurred regardless of whether the primer set for G allele detection or the primer set for A allele detection was used. . On the other hand, in the case of using purified genomic DNA derived from G allele homologous LSI74T cultured cells, the experimental result was correct if specific amplification occurred only when the primer set for G allele detection was used. Furthermore, for negative controls, the experimental results are correct if no specific growth occurs with either primer.

  In Example 1, the experimental results for the positive control, the negative control, and the purified genomic DNA derived from LSI74T cultured cells were incorrect three times. In Comparative Example 1, as shown in FIG. 14, in the purified genomic DNA derived from LSI74T cultured cells, amplification does not occur even when the G allele detection primer is used. It became clear that even if amplified, it was non-specific amplification and induced misjudgment.

[Example 2]
As Example 2, an experiment was conducted using a sample obtained by diluting unpurified blood 10 times with pure water instead of purified genomic DNA. In Example 2, blood was stored for 3 months under the condition of −80 ° C. without additives, blood not stored without additives, and blood stored with addition of EDTA for 3 months at 4 ° C. Samples were prepared from In Example 2, the presence or absence of the G636A mutation in the CYP2C19 gene was detected.

  In Example 2, an experiment was performed under the same conditions as in Example 1 except that the sample was unpurified blood diluted with pure water. As a result, the results shown in FIG. 15 were obtained. Amplification was obtained.

  Hereinafter, when using unpurified blood as a sample, a nucleic acid analysis method recommended in the present invention is described, but the present invention is not limited to this.

<sample>
The blood is diluted 10-fold with pure water prepared with a pure water production apparatus (Millipore, trade name: Milli-Q GPAII).

<LCR reaction solution>
Unpurified blood (10-fold dilution): 1 μL
Pure water: 5.5 μL
Heat-resistant ligase (Epicentre, 5 U / μL): 0.5 μL
Each primer (each 5 μM): 0.5 μL

<LCR reaction>
The operation of reacting at 94 ° C. for 30 seconds after heat treatment at 94 ° C. for 30 seconds is one cycle, and the LCR reaction is completed in 23 cycles to obtain an LCR reaction product.

<LAMP reaction solution>
LCR reaction product: 1.25 μL
Pure water: 5.25 μL
Buffer (4-fold dilution): 5 μL
LAMP primer set: 0.5 μL
Strand DNA polymerase (8 U / μL): 0.5 μL

  As the buffer, the LAMP primer set, and the strand displacement type DNA polymerase in the LAMP reaction solution, the reagents included in the Loopamp P450 typing reagent kit, RNA amplification reagent kit, DNA amplification reagent kit, etc. manufactured by Eiken Chemical Co., Ltd. may be used. . However, a reagent is not limited to these, For example, you may adjust the LAMP reaction liquid according to the nonpatent literature 3. However, when the LAMP reaction solution having the composition of Non-Patent Document 3 is used, the concentration of the LAMP primer is ¼. The LAMP reaction may be performed at 60 ° C. for 17 minutes.

  Table 2 shows the LCR method recommended when using Ampicase (trade name) manufactured by Epicentre, the LAMP method recommended when using the Loopamp P450 typing reagent kit manufactured by Eiken Chemical Co., Ltd., and the present invention. The characteristics of are described. In Table 2, “rapid cooling” means an operation of heat-denaturing double-stranded DNA and then rapidly cooling to 4 ° C. or lower in order to prevent the DNA from returning to the original double-stranded DNA. This operation is referred to as “rapid cooling” because it is distinguished from an operation of cooling in order to perform a ligation reaction after the heat treatment in the LCR reaction.

  As shown in Table 2, according to the present invention, the mutation of the base sequence can be detected quickly by a simple operation, and the dynamic range is wider than that of the LAMP method. In addition, in order to detect the presence or absence of mutation by two kinds of chemical reactions by combining LCR reaction and LAMP reaction, the mutation detection accuracy is improved as shown in Example 1 and Example 2 while simplifying the operation as shown in Table 2. Can be high. Furthermore, since unpurified blood can be used as a sample, the present invention is suitable for clinical analysis, and a cooling mechanism can be omitted in the analytical instrument according to the method of the present invention.

  The present invention can be used for detecting a nucleotide sequence variation of a gene.

The schematic diagram which shows the LCR process in one embodiment of this invention. The schematic diagram which shows the LCR process in one embodiment of this invention. The schematic diagram which shows the LCR process in one embodiment of this invention. The schematic diagram which shows the LAMP process in one embodiment of this invention. The schematic diagram which shows the LAMP process in one embodiment of this invention. The schematic diagram which shows the LCR process in one embodiment of this invention. The figure of the electrophoresis photograph which shows the result of the reference example 1. The figure of the electrophoresis photograph which shows the result of the reference example 2. The figure of the electrophoresis photograph which shows the result of the reference example 3. The figure of the electrophoresis photograph which shows the result of the reference example 4. The figure of the electrophoresis photograph which shows the result of the reference example 5. The figure of the electrophoresis photograph which shows the result of the reference example 7. The figure of the electrophoresis photograph which shows the result of the reference example 8. The figure of the electrophoresis photograph which shows the result of Example 1 and Comparative Example 1. FIG. 6 is an electrophoretogram showing the results of Example 2.

Explanation of symbols

2: Heat-resistant ligase 4: DNA (nucleic acid)
6: LCR reaction solution 10: LCR primer set 12: Strand displacement type DNA polymerase 16: LCR reaction product 20: LAMP primer set 26: LAMP reaction solution

Claims (14)

A method for analyzing a nucleic acid containing a target base sequence,
Performing an LCR reaction in an LCR reaction solution containing the nucleic acid-containing sample and an LCR primer set for LCR reaction to generate an LCR reaction product;
An analysis method in which the LCR reaction product is subjected to LAMP reaction in a LAMP reaction solution containing a LAMP primer set for LAMP reaction.   The method for analyzing nucleic acid according to claim 1, wherein the LAMP reaction product is subjected to the LAMP reaction without heat denaturation treatment.   The nucleic acid analysis method according to claim 2, wherein the concentration of the LCR primer set in the LCR reaction solution and the concentration of the LAMP primer set in the LAMP reaction solution are adjusted to a predetermined range.   The nucleic acid analysis method according to claim 3, wherein the concentration of the LCR primer set in the LCR reaction solution is 0.1 µM or more and 0.5 µM or less. The LAMP primer set includes at least an inner primer set,
The nucleic acid analysis method according to claim 3 or 4, wherein the concentration of the inner primer set in the LAMP reaction solution is 0.2 µM or more and 1.0 µM or less. The LAMP primer set further includes a loop primer and an outer primer,
The nucleic acid analysis method according to claim 5, wherein the concentration of the loop primer in the LAMP reaction solution is 0.1 μM or more and 0.5 μM or less, and the concentration of the outer primer is 0 μM or more and 0.1 μM or less.   The LCR reaction is a cycle in which a heat denaturation treatment is performed at 94 ° C. for 10 seconds to 30 seconds and then a ligation reaction for 30 seconds is performed at a temperature of 65 ° C. to 70 ° C. for one cycle. The method for analyzing a nucleic acid according to any one of claims 1 to 6, wherein the number of reaction cycles is 30 cycles or less. The LAMP primer set includes at least an inner primer set and a loop primer,
The nucleic acid analysis method according to claim 7, wherein the number of cycles of the LCR reaction is 10 cycles or more and 25 cycles or less.   The method for analyzing a nucleic acid according to any one of claims 1 to 8, wherein a reaction time for performing the LAMP reaction is 30 minutes or less. The target base sequence includes a mutation site,
The nucleic acid analysis method according to any one of claims 1 to 9, wherein the presence or absence of a mutation in the nucleic acid is detected by examining the presence or absence of an amplification product by the LAMP reaction. The nucleic acid analysis method according to claim 1, wherein the sample contains 2 × 10 to 2 × 10 ³ human genomes / μL.   The method for analyzing a nucleic acid according to any one of claims 1 to 11, wherein the nucleic acid in the sample is not purified or has not been subjected to genome concentration measurement.   The nucleic acid analysis method according to claim 1, wherein the sample is unpurified blood diluted with pure water.   The nucleic acid analysis method according to claim 13, wherein the sample has a dilution ratio of 10 times with pure water.