JP2008167678A - Fluorescent visualization method for detecting acetylation and deacetylation - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a fluorescent probe measuring the acetylation state of a protein in real time, and a method for measuring the acetylation state of a protein in a living cell in real time using the fluorescent probe. <P>SOLUTION: Disclosed is a fluorescent probe in which an acetylated substrate domain and an acetylated substrate binding domain are linked through a linker peptide and a fluorescent protein having different fluorescent characteristics is individually linked to the acetylated substrate domain and the acetylated substrate binding domain. Also disclosed is a method for measuring the acetylation state of a protein in a living cell by introducing the fluorescent probe into the living cell to detect FRET change from the fluorescent probe. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

  The present invention relates to a method for detecting acetylation and deacetylation of proteins in living cells. More specifically, the present invention relates to a fluorescent probe for detecting the acetylation and deacetylation state of a protein in a living cell, and a method for detecting the acetylation and deacetylation state using the fluorescent probe.

  Along with phosphorylation, acetylation is well known as a phenomenon that controls protein functions. So far, it has been reported that many proteins such as histones and p53 proteins are subject to activity control by acetylation. Among them, many findings on histone acetylation have been reported so far.

Core histone acetylation is an important post-translational modification that controls chromatin structure and function, but histone acetylation is dynamically regulated by histone acetylase (HAT) and histone deacetylase (HDAC) . Acetylated histones bind to proteins with sites that specifically bind to acetylated lysines called bromodomains.
Conventionally, as a method for examining the amount of acetylation of intracellular protein, after treating the cell with tritium-labeled acetic acid to label the acetylated protein in the cell with acetylation, the target protein is purified and acetylated. A method of detecting the radioactivity of a protein by autoradiography and a Western blotting method using an antibody that specifically recognizes an acetylated protein have been used. In addition, as a method for examining the localization of acetylated protein, an immunostaining method is known in which immobilized cells are subjected to membrane permeabilization, and the localization is detected using an antibody that specifically recognizes acetylated protein. Yes. All of these conventional methods require disruption of cells, and it has been impossible to perform analysis with spatial resolution and temporal resolution of protein acetylation / deacetylation in living cells.
On the other hand, protein phosphorylation, which is an important post-translational modification similar to protein acetylation, has been reported to be analyzed with a spatial and temporal resolution in living cells using a fluorescent probe (Non-patent Document 1, Non-patent Document 1, Patent Document 2, Patent Document 1, and Patent Document 2).

  It has also been reported that abnormalities in the activities of histone acetylase (HAT) and histone deacetylase (HDAC) that control histone acetylation are closely related to the onset of cancer (Non-Patent Documents). 3). Observed that when HYDA inhibitor superylamide hydroacid (SAHA) was administered to mice transplanted with prostate cancer cells, cancer cells were reduced by 97% in 20 days compared to mice not administered SAHA (Non-Patent Document 4). SAHA has been reported in Phase I clinical trials (Non-patent Document 5). In addition, FK228 derived from microorganisms having anticancer activity inhibits the activity of HDAC, and clinical phase I trials for patients with chronic lymphocytic leukemia and acute myeloid leukemia have also been conducted (Non-patent Document 6). . Such compounds that inhibit HDAC can be candidates for effective anticancer agents.

Sato et al., Nature Biotechnol. 20: 287-294, 2002 Zhang et al., Proc Natl Acad Sci USA 98: 14997-15002, 2001 Furumai et al., Exp. Med. 24: 1240-1245, 2006 Butler et al., Cancer Res. 60: 5165-5170, 2000 Kelly et al., Clin. Cancer Res. 9: 3578-3588, 2003 Byrd et al., Blood 105: 959-967, 2005. International Publication No. 2002/077623 Pamphlet Special table 2005-501525 gazette

In view of the above circumstances, the present inventors have conducted extensive research on methods for detecting acetylation and deacetylation of proteins in living cells, and as a result, acetylation and deacetylation of proteins without disrupting the cells. The present inventors have developed a fluorescent probe capable of detecting OH and completed the present invention.
Therefore, an object of the present invention is to provide a fluorescent probe for detecting acetylation and deacetylation of a protein in a living cell.
Another object of the present invention is to provide a method for detecting the acetylation and deacetylation status of intracellular proteins using a fluorescent probe for detecting acetylation and deacetylation of proteins in living cells.

That is, the present invention relates to the following (1) to (18).
(1) In the first aspect of the present invention, “acetylated substrate domain and acetylated substrate binding domain are linked by a linker peptide, and the acetylated substrate domain and the acetylated substrate binding domain are each different 2 A fluorescent probe in which two fluorescent proteins having two fluorescent properties are linked and the two different fluorescent proteins have a FRET donor-acceptor relationship.
(2) The second aspect of the present invention is “the fluorescent probe according to (1) above, wherein the linker peptide is composed of glycine and / or serine”.
(3) The third aspect of the present invention is as described in (1) above, wherein the sequence of the linker peptide is a sequence in which the sequence represented by SEQ ID NO: 1 is repeated 1 to 9 times. The fluorescent probe.
(4) A fourth aspect of the present invention is the “fluorescent probe according to any one of (1) to (3) above, wherein the fluorescent protein is GFP or a color mutant of GFP”. is there.
(5) According to a fifth aspect of the present invention, “the fluorescence mutant according to (4) above, wherein the GFP color mutant is selected from the group consisting of Venus, CFP, YFP, RFP, and BFP. Probe ".
(6) A sixth aspect of the present invention is the “fluorescent probe according to any one of (1) to (5) above, wherein the acetylated substrate domain is histone H4”.
(7) A seventh aspect of the present invention is the “fluorescent probe according to any one of (1) to (6) above, wherein the acetylated substrate-binding domain is a protein having a bromodomain”. is there.
(8) According to an eighth aspect of the present invention, “the fluorescent probe according to (7) above, wherein the protein having a bromodomain is a polypeptide represented by the following (a) or (b)”: It is.
(A) a polypeptide consisting of amino acids 1 to 443 of the sequence represented by SEQ ID NO: 2,
(B) a 1st to 443rd amino acid sequence of the sequence represented by SEQ ID NO: 2, consisting of an amino acid sequence having one or several amino acid substitutions, deletions or insertions, and bound to an acetylated protein Polypeptide "
(9) According to a ninth aspect of the present invention, “the fluorescent probe according to claim 7, wherein the protein having a bromodomain is a polypeptide represented by the following (a) or (b):
(A) a polypeptide comprising the 57th to 468th amino acids of the sequence represented by SEQ ID NO: 4,
(B) a 57-468th amino acid sequence of the sequence represented by SEQ ID NO: 4 consisting of an amino acid sequence having a substitution, deletion or insertion of one or several amino acids, and binding to an acetylated protein Polypeptide ".
(10) A tenth aspect of the present invention is a nucleic acid encoding the fluorescent probe according to any one of (1) to (9) above.
(11) An eleventh aspect of the present invention is a “vector containing the nucleic acid according to (10) above”.
(12) According to a twelfth aspect of the present invention, “the fluorescent probe according to any one of (1) to (9) above is introduced into a living cell, a change in FRET obtained from the fluorescent probe is detected, “Method for measuring variation in acetylation-deacetylation of the acetylated substrate domain in cells”.
(13) According to a thirteenth aspect of the present invention, “the vector described in (11) above is transduced into a living cell, the cell is cultured under conditions where the fluorescent probe is expressed from the vector, and expressed in the cell. Is a method for detecting a FRET change obtained from a fluorescent probe and measuring a change in acetylation-deacetylation of the acetylated substrate domain in a living cell ".
(14) According to a fourteenth aspect of the present invention, “a fluorescent probe according to any one of (7) to (9) above is introduced into a living cell, the living cell is reacted with a candidate compound, and a fluorescent probe is obtained. Is a screening method for a bromodomain-binding factor, in which FRET is detected as a result of the reaction between a living cell and a candidate compound, and the candidate compound is determined to be a bromodomain-binding factor.
(15) According to a fifteenth aspect of the present invention, “a fluorescent probe according to any one of (7) to (9) described above is introduced into a living cell, the living cell is reacted with a candidate compound, and a fluorescent probe is obtained. Control of histone acetylase activity, wherein when FRET is detected as a result of reacting the living cells with a candidate compound and the FRET changes, the candidate compound is determined to be a regulator of histone acetylase activity Factor screening method ".
(16) According to a sixteenth aspect of the present invention, “a fluorescent probe according to any one of (7) to (9) described above is introduced into a living cell, the living cell is reacted with a candidate compound, and a fluorescent probe is obtained. A histone deacetylase activity that determines that the candidate compound is a regulator of histone deacetylase activity when FRET is changed as a result of detecting FRET obtained from the above and reacting the living cell with the candidate compound Is a screening method for regulatory factors.
(17) A seventeenth aspect of the present invention is “a screening system for a bromodomain binding factor, comprising the following means:
(A) means for introducing the fluorescent probe according to any one of (7) to (9) above into a living cell;
(B) means for reacting the living cells with a candidate compound;
(C) means for detecting a change in FRET obtained from the fluorescent probe, and (d) means for selecting a bromodomain-binding candidate compound from candidate compounds using the detection result of the change in FRET as an index,
Said system comprising ".
(18) The eighteenth aspect of the present invention is “a screening system for a regulator of histone acetylase activity or histone deacetylase activity, comprising the following means:
(A) means for introducing the fluorescent probe according to any one of (7) to (9) above into a living cell;
(B) means for reacting the living cells with a candidate compound;
(C) a means for detecting a change in FRET obtained from the fluorescent probe, and (d) an activity of histone acetylase activity or histone deacetylase activity among candidate compounds, using the detection result of the change in FRET as an index. Means for selecting candidate control factor compounds,
Said system comprising ".

  When the fluorescent probe of the present invention is used, the temporal and spatial dynamics of protein acetylation / deacetylation in living cells can be observed.

  In particular, when the fluorescent probe of the present invention is used, the temporal and spatial dynamics of histone acetylation / deacetylation can be observed.

  Furthermore, when the fluorescent probe of the present invention is used, a protein that undergoes acetylation (hereinafter referred to as “acetylated substrate domain”) and a protein that binds to a protein that has undergone acetylation (hereinafter referred to as “acetylated substrate binding domain”). Can be screened for factors that have an effect on the binding.

  The fluorescent probe of the present invention can detect a protein acetylation state in a living cell simply, rapidly and with high sensitivity. Therefore, the fluorescent probe of the present invention can be used for screening using a living cell for a compound that activates or inhibits HAT and HDAC.

In one embodiment of the present invention, an acetylated substrate domain and an acetylated substrate binding domain are linked by a linker peptide, and the acetylated substrate domain and the acetylated substrate binding domain each have different fluorescent properties. It is a fluorescent probe to which a fluorescent protein is linked (see FIG. 1).
The “acetylated substrate domain” includes a protein or polypeptide fragment containing an amino acid to be acetylated and does not necessarily act as a functional region. Examples of the acetylated substrate domain include histone H2A, histone H2B, histone H3, histone H4, p53 protein, α-tubulin, HSP90, HIF1α, NF-kappaB, Importin α, Ku70, androgen receptor and fragments thereof. Can be mentioned. In addition, the “acetylated substrate binding domain” includes a protein or polypeptide fragment that binds to an acetylated substrate domain and does not necessarily function as a functional region. Examples of the acetylated substrate-binding domain include BRDT (bromodomain protein testis-specific), Brd2 (bromodomain containing protein 2), Brd4, TAF _II 250, PCAF, GCN5, and CBP.

  A “linker peptide” is a peptide for linking and integrating an acetylated substrate domain and an acetylated substrate binding domain. By linking and unifying with a linker peptide, the acetylated substrate domain and the acetylated substrate binding domain in the same molecule are preferentially bound. The linker peptide does not inhibit the binding between the acetylated substrate domain and the acetylated substrate binding domain in a living cell, and is linked to the fluorescent protein linked to the acetylated substrate domain and the acetylated substrate binding domain. Any substance can be used as long as it does not inhibit FRET (fluorescence resonance energy transfer) generated with the fluorescent protein, but it is composed of amino acids that are not bulky and includes hydrophilic (polar) amino acids. Peptides having a length of about 50 amino acids are preferred. As such a linker peptide, for example, a sequence consisting of the sequence represented by SEQ ID NO: 1 that repeats 1 to 9 times, more preferably a sequence consisting of a sequence that repeats 3 to 5 times can be suitably used. .

  In the fluorescent probe of the present invention (see FIG. 1), two fluorescent proteins, an acetylated substrate binding domain, a linker peptide, and an acetylated substrate domain can bind to each other if the acetylated substrate binding domain and the acetylated substrate domain can bind to each other. , May be directly bonded, or several to several tens of amino acids may be interposed as a space (a sequence having no function in particular). The two “fluorescent proteins” used in the fluorescent probe of the present invention may be any one as long as they have different fluorescence characteristics and are in a relationship between a FRET donor and an acceptor. Although not limited, for example, a combination in which FRET occurs can be appropriately selected and used from Venus, CFP, YFP, RFP, GFP, BFP, and the like.

  Another embodiment of the present invention is a nucleic acid encoding the fluorescent probe of the present invention and a vector having the nucleic acid. The nucleic acid encoding the fluorescent probe of the present invention can be prepared by techniques well known to those skilled in the art. For example, each polypeptide constituting the fluorescent probe (fluorescent protein, acetylated substrate binding domain, linker peptide, acetylated) It can be prepared by linking the necessary regions of the gene encoding the (substrate domain). Each gene may be obtained by preparing a cDNA library from cells expressing the gene and using a conventional screening method, or may be obtained using a commercially available cDNA library or the like. . Alternatively, RNA may be prepared from cells expressing each gene, cDNA may be synthesized by reverse transcriptase, and then amplified by PCR primers designed based on the gene sequence. In this case, each gene can be easily linked by designing an appropriate restriction enzyme site on the 5 'end side of the PCR primer.

  As a vector for expressing a fluorescent probe in a cell, a vector that can be replicated in a target cell and has a promoter that can express the fluorescent probe can be used. For example, when animal cells are used, CMV promoter, SRα promoter, LTR promoter, SV40 promoter, etc. can be used. The DNA encoding the fluorescent probe can be inserted into the vector using techniques well known to those skilled in the art. The obtained expression vector can be introduced into a target cell according to a conventional method.

A further embodiment of the present invention introduces the fluorescent probe of the present invention into a living cell, measures FRET changes detected from the fluorescent probe, and acetylates-deacetylates the acetylated substrate domain in the living cell. This is a method for detecting fluctuations in crystallization.
The fluorescent probe of the present invention (see FIG. 1) monitors the change in FRET accompanying the bond dissociation between the acetylated substrate domain (FIG. 1, histone H4) and the acetylated substrate binding domain (FIG. 1, bromodomain). This makes it possible to detect in real time changes in the acetylation and deacetylation status of the acetylated substrate domain in living cells. That is, when the acetylated substrate domain is not acetylated, it does not bind to the acetylated substrate binding domain and FRET occurs between the fluorescent proteins linked to both domains, but the acetylated substrate domain is acetylated. And FRET between fluorescent proteins is eliminated because it binds to the acetylated substrate binding domain. By detecting such a change in FRET, the acetylation state of the acetylated substrate domain can be monitored.
Further, when the fluorescent probe of the present invention is used, a full-length protein or a part of the protein having a length that does not affect the intracellular localization of the protein is used as an acetylated substrate domain. It is possible to monitor the change in the acetylation state at the localization position by showing an appropriate localization in. In this case, since the change in FRET can be observed with a fluorescence microscope or the like for a specific cell, the change in the acetylation state of the target protein (acetylated substrate domain) can be visualized in real time.

  The fluorescent probe of the present invention can be introduced into a cell by linking the expressed fluorescent probe with an intracellular introduction reagent, a transmembrane peptide, or the like. Alternatively, a method may be used in which the cells are transduced and expressed in the cells.

  Another embodiment of the present invention is a method for screening a factor that controls the activity of histone acetylase (HAT) or histone deacetylase (HDAC) by introducing the fluorescent probe of the present invention into a living cell. . The fluorescent probe of the present invention is characterized in that FRET is eliminated when it binds to an acetylated substrate domain in cells. By utilizing this feature, by detecting changes in the acetylation state of the fluorescent probe in cells, substances that affect the activity of histone acetylase (HAT) or histone deacetylase (HDAC) can be detected. can do. Here, the “regulatory factor” includes both a factor that promotes enzyme activity and a factor that inhibits enzyme activity. The candidate compound obtained according to this embodiment is a promoter or inhibitor of each enzyme activity by further examining the effect on the target histone acetylase (HAT) or histone deacetylase (HDAC). It can be easily determined whether or not there is. In this embodiment, a known inhibitor (HAT or HDAC) of each enzyme (HAT or HDAC) may be added to the cell in advance, or each enzyme (HAT or HDAC) is expressed in the cell in advance. You may leave it.

  Another embodiment of the present invention is a method for screening a factor that competitively inhibits the binding between an acetylated substrate domain and an acetylated substrate binding domain by introducing the fluorescent probe of the present invention into a living cell. As described above, the fluorescent probe of the present invention is characterized in that FRET is eliminated when bound to an acetylated acetylated substrate domain in a cell. Utilizing this feature, the binding of the acetylated substrate domain and the acetylated substrate binding domain can be competitively bound to one of the domains to detect a substance that inhibits the binding between the two domains. . That is, when the fluorescent probe of the present invention is introduced into a cell and the acetylated substrate domain is kept in a constant acetylated state, the binding between the acetylated substrate domain and the acetylated substrate binding domain is also constant. Will be kept in a state. Here, when a substance that competes with the interaction between the acetylated substrate domain and the acetylated substrate binding domain acts, the FRET between the fluorescent proteins present in the fluorescent probe varies, so the presence or absence of the competitor is determined by the change in the fluorescence intensity ratio. It can be understood as For example, if a fluorescent probe is prepared with histone H4 or H3 as the acetylated substrate domain and a bromodomain protein or bromodomain as the acetylated substrate binding domain, screening for substances that competitively inhibit the binding between the bromodomain and histone Is possible. Here, the bromodomain is not limited, but, for example, a polypeptide consisting of the 1st to 443rd amino acids of the sequence represented by SEQ ID NO: 2, or the 1st to 443th amino acids of the sequence represented by SEQ ID NO: 2 A polypeptide comprising an amino acid sequence having one or several amino acid substitutions, deletions or insertions, and binding to an acetylated protein, or the sequence represented by SEQ ID NO: 4 A polypeptide consisting of the 468th amino acid, or an amino acid sequence having a substitution, deletion or insertion of one or several amino acids in the 57th to 468th amino acid sequence of the sequence represented by SEQ ID NO: 4; And a polypeptide that binds to an acetylated protein.

  The bromodomain is a domain found in transcription mediators / coactivators and the like, and has been reported to bind to acetylated histones. Proteins with bromodomains are thought to be involved in transcriptional regulation through chromatin structural changes, but recently it has been suggested that bromodomain proteins may be associated with the development of human diseases . For example, a t (15:19) chromosomal translocation that induces BRD4-NUT oncogene expression has been identified in multiple tumor patients (French et al., Cancer Res 63: 304-307, 2003). Brd2 and Brd4 are also known to bind to Kaposi's sarcoma-associated herpesvirus (KSHV) protein (LANA-1) (You et al., J Virol. 80: 8909-8919, 2006; Viejo-Borbolla et al., J Virol. 79: 13618-13629, 2005; Platt et al., J Virol. 73: 9789-9795, 1999), and Brd4 binds to human papillomavirus E2 (You et al., Cell 117: 349-360, 2004); It is considered to play an important role in virus infection because it becomes a scaffold on the host chromosome and is used for transmission of the virus in the host cell. For these functions, the function of the bromodomain that binds to the chromosome via acetylated histones is considered important. Therefore, substances that bind to the bromodomain and inhibit the interaction with acetylhistone H4 are anticancer agents, antivirals It can be expected as an agent.

Embodiments of the invention also include a system for screening agents that compete with an acetylated substrate domain and bind to the acetylated substrate binding domain.
The system of the present invention includes
(A) means for introducing the fluorescent probe of the present invention into living cells,
(B) means for reacting the living cells with a bromodomain binding candidate compound;
(C) means for detecting a change in FRET obtained from the fluorescent probe, and (d) means for selecting a bromodomain binding candidate compound using the detection result of the change in FRET as an index,
as well as,
(A) means for introducing the fluorescent probe of the present invention into living cells,
(B) means for reacting the living cells with a candidate compound;
(C) a means for detecting a change in FRET obtained from the fluorescent probe, and (d) an activity of histone acetylase activity or histone deacetylase activity among candidate compounds, using the detection result of the change in FRET as an index. Means for selecting candidate control factor compounds,
Including the system

  As a means for introducing the fluorescent probe of the present invention into a cell, a method of transducing via an expression vector is generally used. However, in some cases, a fluorescent probe is directly applied by a microinjection method or an electroporation method. It may be a method of introduction, and when these methods are adopted, a cell introduction device such as an inverted microscope, a micromanipulator and an injector, an electroporation device, or the like may be used. As a means for reacting the candidate compound with the cell, a method of mixing an appropriate amount of the candidate compound with the cell together with an appropriate carrier can be used. Fluorescence images were captured using, for example, MetaFluor (Universal Imaging) equipped with a 440AF21 excitation filter 455DRLP dichroic mirror and two emission filters (for CFP; 480AF30, for Venus; 535AF26), fluorescence intensity at 480 nm / 535 nm The ratio can be observed over time. Further, the means for selecting candidate compounds is a candidate for a compound that binds to an acetylated substrate binding domain, or histone acetyl, when it can be determined that the fluorescence intensity has changed as a result of FRET from the fluorescent probe. It is a means to judge that it is a candidate of the compound which controls the activity of acetylase or histone deacetylase.

  Examples are shown below, but the present invention is not limited thereto.

1. Preparation of Fluorescent Probe In this example, a fluorescent probe was prepared using full-length histone H4 as an acetylated substrate domain, BRDT bromodomain or Brd2 bromodomain as an acetylated substrate binding domain, and CFP and Venus as fluorescent proteins ( FIG. 1). The DNAs encoding Venus, BRDT bromodomain, Brd2 bromodomain, histone H4, and CFP are respectively template DNA consisting of SEQ ID NO: 9, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, and SEQ ID NO: 11, Using the following primer set, PCR was performed using pyrobest DNA Polymerase (Takara) according to the attached instructions. As for the template DNA, mouse histone H4 is obtained from the Proquest two hybrid cDNA library (mouse brain; invitrogen),
H4-For: 5′-GGGGACAAGTTTGTACAAAAAACAGCGCTCCGGTACCATGTCAGGACGAGGGA-3 ′ (SEQ ID NO: 12)
H4-Rev no Stop: 5′-GGGGACCACTTTTGTACAAGAAAAGCTGGGTCGACGCCGCCGAAGCCGTA-3 ′ (SEQ ID NO: 13)
PCR was performed using pyrobest DNA polymerase (Takara) using the above primer pairs, and cloning was performed by the GATEWAY method (Invitrogen). For mouse BRDT, Pivot-Pajot et al., Mol. Cell. Biol. 23: 5354-5365, 2003, human Brd2 was obtained from a superscript premade cDNA library (human brain; invitrogen),
hBrd2_EcoRI_for: 5′-CGAATTCACCCCTCGCCAACCCA-3 ′ (SEQ ID NO: 14)
hBrd2_XhoIstopSalI_rev: 5′-AGTTCTCGAGTTTAGTCGACGGCAGTAGAGACTGG-3 ′ (SEQ ID NO: 15)
Using primer pairs, pyrobest DNA polymerase (Takara) was used for PCR and cloning. For Venus, see Nagai et al., Nat. Biotechnol. 20: 87-90, 2000. The CFP was purchased from Clontech.
Venus
GFPforEcoRI: 5'-CCGTGGTACCATGGTGAGCAAGGGC-3 '(SEQ ID NO: 16)
GFPrevEcoRI: 5′-CCGTGAATTCCCTTGTACAGCTCGTC-3 ′ (SEQ ID NO: 17)
BRDT bromodomain BRDTforEcoRI: 5′-AGTTGAATTCTTTAAACCCGAGGAGCTA-3 ′ (SEQ ID NO: 18)
BRDTrevSalI: 5′-AGTTGTCGACAAGAGACTGCATGACAGG-3 ′ (SEQ ID NO: 19)
Brod2 Bromodomain hBrd2_EcoRI_for: 5′-CGAATTCACCCTCGCCAACCCA-3 ′ (SEQ ID NO: 14)
hBrd2_XhoIstopSalI_rev: 5′-AGTTCTCGAGTTTAGTCGACGGCAGTAGAGACTGG-3 ′ (SEQ ID NO: 15)
Histone H4
H4forBamHI: 5′-AGTTGGATCCCATGTCAGGACGAGGGAAA-3 ′ (SEQ ID NO: 22)
H4revSalI: 5′-AGTTGTCGACGCCGCCGAAGCCGTA-3 ′ (SEQ ID NO: 23)
CFP
GFPforSalI_EcoRV: 5′-AGTTGTCGACCCAGCTTTCTTGTACAAAGTGGTTGATATCATGGTGGAGCAGAGGC-3 ′ (SEQ ID NO: 24)
GFPrevXhoI: 5′-AGTTCTCGAGTTACTTGTACAGCTCGTC-3 ′ (SEQ ID NO: 25)
Moreover, the DNA encoding the linker peptide was prepared by annealing the following polynucleotide according to a conventional method.
Linker peptide Linker (GGGGS) 4for: 5′-TCGACGGAGGAGGTGGATCTGGTGGAGGAGGTTCTGGAGGTGGTGGTTCA GGTGGGTGGGGATGTG-3 ′ (SEQ ID NO: 20)
Linker (GGGGS) 4rev: 5′-GATCCAGATCTCCCACCACCCTGAACCACCACCTCCCAGAACCTCCCTCACCAGATCCACCCTCCTCCG-3 ′ (SEQ ID NO: 21)

Each prepared DNA was first cleaved with the following restriction enzyme set, and then cloned into pcDNA3.1 (Invitrogen).
Venus: KpnI, EcoRI
BRDT and Brd2 bromodomains: EcoRI, SalI
Linker peptide: SalI, BamHI
Histone H4: BamHI, SalI
CFP: SalI, XhoI
Next, histone H4 and CFP were cloned into the BamHI-XhoI site of pcDNA3.1, and then the Venus, BRDT bromodomain and linker peptide were sequentially cloned, and from the 5 ′ side, Venus, BRDT bromodomain or Brd2 An expression vector was prepared in which DNAs encoding bromodomain, linker peptide, histone H4, and CFP were arranged in this order.
Cos7 cells expressing a fluorescent probe were cultured in DMDM supplemented with 10% FCS, 1% penicillin / streptomycin, 1% MEM Non-Essential Amino Acids (Invitrogen), 1 mM sodium pyruvate.
The prepared expression vector was transduced into Cos7 cells using FuGENE6 (Roche), and then allowed to stand under conditions of 37 ° C. and 5% CO ₂ .

2. Detection of acetylation and deacetylation state using fluorescent probe Hereinafter, the prepared fluorescent probe (FIG. 1, hereinafter referred to as VB4HC (using BRDT bromodomain) or Brd2-VB4HC (using Brd2 bromodomain)) is used. Shows the result of detecting the acetylation state of histone H4. As a control of the experiment, two tyrosines present in the bromodomain of BRDT were substituted with alanine to eliminate the binding ability to acetylated histone (FIG. 1, VB4HC-Y2A), four lysines of histone H4 (5 The 8th, 12th, and 16th) were substituted with arginine to produce a mutant that did not undergo acetylation (FIG. 1, VB4HC-K4R) and used as appropriate.
2-1. About the function of VB4HC The bromodomain of BRDT binds when the 5th lysine and 8th lysine of histone H4 are acetylated, but the acetylation of 5th and 8th lysine results in highly acetylated histone H4. It occurs in the state. Therefore, the fluorescent probe used in this example can monitor the hyperacetylation state of histone H4. FIG. 2 shows the results of a peptide pull-down assay in which a Venus-BRDT construct was transduced into cells and performed by the method of Pivot-Pajot et al. (Pivot-Pajot et al., Mol. Cell Biol. 23: 5354-5364, 2003). Is shown. From this result, it is clear that the bromodomain of BRDT specifically binds to acetylated histone H4 and binds to the bromodomain of BRDT only when both the fifth and eighth lysines of histone H4 are acetylated. (Lower row in FIG. 2).

2-2. Intracellular localization of VB4HC The subcellular localization of VB4HC was examined (FIG. 3). After transducing VB4HC into Cos7 cells, the medium was replaced with a culture solution containing no phenol red for observation of the fluorescence image. The cells were observed under conditions of 37 ° C. and 5% CO ₂ using a microscope (Olympus IX81; Olympus) equipped with a CCD camera (UIC-QE; Molecular Devices). Hoechst 33342 and Venus images were captured using a Delta Vision system (Applied Precision) and a microscope (Olympus IX70; Olympus) equipped with a CCD camera (Photometrics CH350L; Roper). As a result, it was found that the prepared VB4HC showed the same localization as DNA (FIG. 3D).
In addition, when cell components were fractionated and the presence of VB4HC was confirmed, it was also found that it was incorporated into chromatin in the same manner as endogenous histone (FIG. 4).

2-3. Time-dependent change of acetylation state in cells of VB4HC It is the result of detecting the accumulation of acetylation of VB4HC by the treatment with trichostatin A (TSA), a histone deacetylation inhibitor, by immunoblotting (Western blotting method) (Fig. 5). Cos7 cells expressing VB4HC and non-expressing Cos7 cells were treated with 1 μM TSA at 37 ° C. for 0, 1, 2, 3, 4, 8 hours, and at each time point (Lys5, 8, Immunoblotting was performed on whole cells with antibodies against histone H4 acetylated in 12 and 16) (FIG. 5). As a result, it was confirmed that the time course of accumulation of acetylation of the fluorescent probe coincided with the time course of accumulation of acetylation of endogenous histone H4 (FIG. 5, comparison between A and B).
Next, FRET obtained from VB4HC was detected in the presence of TSA. Fluorescence images were captured using a MetaFluor (Universal Imaging) equipped with a 440AF21 excitation filter 455DRLP dichroic mirror and two emission filters (for CFP; 480AF30, for Venus; 535AF26) with a fluorescence intensity ratio of 480 nm / 535 nm. Observed over time (FIGS. 6 and 7). As a result, when TSA was added to Cos7 cells expressing a fluorescent probe, VB4HC, the fluorescence intensity ratio change occurred so that FRET disappeared in the whole nucleus (FIG. 6), and this response was observed within 3 hours after TSA addition. It was found that equilibrium was reached (Figure 7). The time taken to reach this equilibrium is equal to the time taken to detect an acetylated band by Western blotting (see FIG. 5). Even if TSA was added to Cos7 cells expressing a mutant (VB4HC-K4R) (Fig. 1, B4HC-K4R) in which four lysines at VB4HC acetylation sites were replaced with arginine, the change in fluorescence intensity ratio was It did not happen (Figure 8, K4R). This indicates that the response of the fluorescent probe depends on the acetylation of the fluorescent probe. Even if TSA is added to Cos7 cells expressing a fluorescent probe (VB4HC-Y2A) using a BRDT bromodomain that does not bind to acetylated histone H4 in the acetylated substrate binding domain, the fluorescence intensity ratio changes. Did not occur (FIG. 8, Y2A). When strong excitation light is directly applied to the Venus FRET acceptor to break the Venus fluorophore, the fluorescence from the Venus fluorophore (535 nm) decreases and the fluorescence of the FRET donor CFP (480 nm) is restored (FIG. 9). ). This result shows that this fluorescent probe (VB4HC) causes FRET before acetylation is induced. Further, even when TSA was added after breaking the Venus fluorophore, the fluorescence intensity ratio did not change (FIG. 8, photobleaching). This result shows that the change in the fluorescence intensity ratio of the fluorescent probe depends on the FRET change due to acetylation of the fluorescent probe.
Also, Brd2-VB4HC also caused a change in fluorescence intensity ratio so that FRET was eliminated by TSA as in VB4HC (FIGS. 10 and 11). Therefore, it was clarified that the fluorescent probe of the present invention functions effectively not only with BRDT but also with other bromodomains.

  From the above, the prepared fluorescent probe showed the same behavior as endogenous histone H4 in living cells, and it was found that acetylation of the fluorescent probe can be detected as a change in fluorescence intensity ratio accompanying a FRET change. In addition, when TSA was removed by exchanging the medium after inducing acetylation by TSA, the fluorescence intensity ratio decreased to the basal level (FIG. 12). This result indicates that this fluorescent probe can reversibly detect acetylation and deacetylation. In addition, even when HeLa cells in which this fluorescent probe was expressed were treated with 1 μMTSA, the same change in fluorescence intensity ratio as in the case of expression in Cos7 cells occurred (FIG. 13).

3. Application of various HDAC inhibitors to the monitoring of acetylation status of histone H4 Using the fluorescent probe (VB4HC) reported in this example, the induction of histone H4 acetylation by various HDAC (histone deacetylase) inhibitors was investigated. It was. Examples of TSA are shown in FIG. 14, and examples of CHAP31, SCOP304, and SCOP402 (Nishino et al., Org Lett 5: 5079-5082, 2003) are shown in FIGS. 15, 16, and 17, respectively. It was found that accumulation of acetylation started immediately after addition of TSA (FIG. 14), whereas accumulation of acetylation started 90 minutes after addition of SCOP304 (FIG. 16). This indicates that this fluorescent probe can follow the temporal change in the accumulation of histone H4 acetylation with high resolution. Further, when the accumulation of acetylation due to the addition of TSA was compared with Western blotting, acetylation could be detected from 1 nM, which is one-tenth the concentration of TSA that can be detected by Western blotting (FIG. 14). This result shows that this fluorescent probe can detect histone H4 acetylation with higher sensitivity than the conventional Western blotting method. Furthermore, FIG. 18 and FIG. 19 show the response of the fluorescent probe by adding scriptaid (Sigma-Aldrich), which is a commercially available HDAC inhibitor, and sodium butyrate (Wako Pure Chemical Industries, Ltd.).
From the above results, it was clarified that the fluorescent probe of the present invention can detect the influence of an inhibitor of histone deacetylase (HDAC) and is therefore effective for screening for an HDAC inhibitor. .

4). Observation of the acetylation state of histone H4 in the mitosis phase The acetylation state of histone H4 in the mitosis process was observed using the fluorescent probe (VB4HC) of the present invention. FIG. 20 shows the acetylation state of histone H4 during mitosis in a pseudo color display. As the chromosome aggregates, deacetylation of histone H4 occurs, the amount of acetylation of histone H4 becomes the lowest at the beginning of mitosis, histone H4 acetylates again from the latter half of mitosis, and in the latter half of mitosis It recovered to the acetylation state before division (FIGS. 20 and 21). Cos7 cells arrested in the mitotic phase by treatment with nocodazole, a microtubule polymerization inhibitor, were confirmed to have increased S10 phosphorylation of histone H3, a marker of mitosis, compared to Cos7 cells not treated with nocodazole, It was confirmed by Western blotting that histone H4 acetylation was reduced (FIG. 22).

5. Screening of bromodomain binding factor The above results show that the change in histone H4 acetylation in vivo is detected in real time by using the fluorescent probe of the present invention. If there is a substance that competitively inhibits the binding of histone and bromodomain, such an inhibitor should be easily detectable. That is, since there is a certain level of acetylation in the normal cellular state, there is a partial acetylated histone-bromodomain interaction, so the ratio of 480 nm / 535 nm shows a certain value. If anything competes and inhibits the acetylated histone-bromodomain interaction, this value should decrease. In fact, a decrease in the fluorescence intensity ratio was observed when Compound A (SPECS, ID number; AG-670 / 40909756) that binds to the acetylated lysine binding domain of the bromodomain was added (FIG. 23). This decrease in the fluorescence intensity ratio of the fluorescent probe was not observed even when Compound B (SPECS, ID number; AF-399 / 15128278) having a similar structure but not binding to the bromodomain was added. This result shows that this compound A inhibits the binding of bromodomain and acetylated lysine by competitively binding to the bromodomain of BRDT in the fluorescent probe in living cells.

Compound A

Compound B

  With the fluorescent probe of the present invention, changes in the acetylation state of proteins in cells can be detected simply and rapidly with high sensitivity. Therefore, the fluorescent probe of the present invention can be expected to have a great effect in the diagnosis of diseases and the like closely related to the change in the acetylation state of a specific protein or the detection of the change in the disease state. In particular, since there is a report that the binding between acetylated histone H4 and bromodomain protein is involved in canceration or infectious diseases, a substance that inhibits the binding between acetylated histone H4 and bromodomain protein is: Expected to be effective as an anticancer or antiviral agent. Therefore, the fluorescent probe of the present invention can be used for screening therapeutic agents for various diseases such as cancer and infectious diseases.

The schematic diagram of a fluorescent probe is shown (VB4HC, Brd2-VB4HC). As the bromodomain, the 1st to 443th amino acid sequence portion of BRDT or the 57th to 468th amino acid portion of Brd2 was used. In addition, BRDT bromodomain tyrosine substituted with alanine (VB4HC-Y2A) and histone H4 all lysine substituted with arginine (VB4HC-K4R) were prepared as experimental controls. The result of the peptide pull-down assay using an untreated or excessively acetylated (Ac) histone N-terminal tail peptide is shown (upper panel). Moreover, the result of the peptide pull-down assay using the partially acetylated N-terminal tail peptide of histone H4 is shown (middle and lower panels). The fluorescence image of the intracellular localization of a fluorescent probe (VB4HC) is shown. A shows an observation image by differential interference, B and C show fluorescence observation images by Hoechst 33342 and Venus, and D shows an observation image in which B and C are superimposed. The result of having confirmed that the fluorescent probe (VB4HC) was taken in into the nucleosome is shown. The upper row shows the results of immunoblotting using an anti-histone H4 antibody on the cytoplasm fraction (1), the nuclear fraction excluding chromatin (2), and the chromatin fraction. The middle row shows the result of immunoprecipitation of each fraction with anti-GFP antibody and immunoblotting of the precipitate with anti-GP antibody. The lower panel shows the results of analyzing each fraction after electrophoresis on 1.5% agarose gel and then staining with ethidium bromide. IP and IB represent that immunoprecipitation and immunoblotting were performed, respectively. The result of having investigated the time-dependent change of the acetylation state of a fluorescent probe (VB4HC) is shown. Cos7 cells expressing VB4HC (A) and non-expressing Cos7 cells (B) were treated with 1 μM TSA, and at each time point antibodies against acetylated histones (A and B top), antibodies against GFP ( (Lower part A), the result of immunoblotting the whole cell with an antibody against histone (lower part B). A control is an experimental result for a sample that was subjected to the same treatment for 8 hours with the same amount of ethanol without TSA. TSA (1 μM) was added to Cos7 cells expressing a fluorescent probe (VB4HC) at 30 minutes, and after 30 minutes, 90 minutes, 150 minutes, and 210 minutes, the fluorescence intensity ratio obtained from the probe was changed to 480 nm / 535 nm. It is the figure shown with the image of the pseudo color. It is the result of having measured the time-dependent change of the fluorescence intensity ratio from the Cos7 cell nucleus which expresses a fluorescent probe (VB4HC). The cells were treated with 1 μM TSA or the same amount of ethanol (control) at 30 minutes for measurement. It is a graph which shows the change (average value +/- standard deviation) of the fluorescence intensity ratio in 3 hours after adding the same amount ethanol which does not contain 1 micromol TSA or TSA of a fluorescent probe (VB4HC, VB4HC-K4R and VB4HC-Y2A). . The control is a measurement result of VB4HC when TSA (1 μM) is not contained. The photobleaching indicates the change in the fluorescence intensity ratio when the VB4HC Venus is photobleached and then subjected to TSA treatment. After irradiating Cos7 cells expressing a fluorescent probe (VB4HC) with intense excitation light of 495 ± 5 nm for 5 minutes to photobleach the FRET acceptor Venus, fluorescence intensity of CFP (480 nm) and Venus (535 nm) The result of having measured the change of is shown. It is the result of having measured the time-dependent change of the fluorescence intensity ratio from the Cos7 cell nucleus which expresses a fluorescent probe (Brd2-VB4HC). The cells were treated with 1 μM TSA or the same amount of ethanol (control) at 30 minutes for measurement. It is a graph which shows the change (average value +/- standard deviation) of the fluorescence intensity ratio in 3 hours after adding the same amount ethanol which does not contain 1 micromol TSA or TSA of a fluorescent probe (Brd2-VB4HC). The control is a measurement result of Brd2-VB4HC when TSA (1 μM) is not contained. The time-dependent change of the 480 nm / 535 nm fluorescence intensity ratio from the Cos7 cell in which the fluorescent probe (VB4HC) was expressed is shown. Cells were treated with 100 nMTSA at 30 minutes and washed with growth medium without phenol red at 210 minutes. It is the result of having measured the time-dependent change of the fluorescence intensity ratio from the HeLa cell nucleus which expresses a fluorescent probe (VB4HC). Cells were treated with 1 μM TSA at 30 minutes for measurement. The time-dependent change in the fluorescence intensity ratio from the VB4HC-expressing cells treated with TSA (upper row) and the fluorescence intensity ratio (average value ± standard deviation) for each treatment concentration (lower row) are shown. In the case of measurement of change over time, the cells were treated with TSA at 30 minutes (upper). Moreover, the fluorescence intensity ratio for each treatment concentration of TSA was measured 3 hours after the TSA treatment (lower). -Is a control without adding TSA. The time-dependent change of the fluorescence intensity ratio from the VB4HC-expressing cells treated with CHAP31 (upper) and the fluorescence intensity ratio (average value ± standard deviation) (lower) for each treatment concentration are shown. In the case of measurement of changes over time, the cells were treated with CHAP31 at 30 minutes (upper row). The fluorescence intensity ratio for each treatment concentration of CHAP31 was measured 3 hours after the CHAP31 treatment (lower). -Is a control to which CHAP31 is not added. A time-dependent change (upper stage) of the fluorescence intensity ratio from the VB4HC expression cell processed by SCOP304, and the fluorescence intensity ratio (average value +/- standard deviation) (lower stage) for every treatment concentration are shown. In the case of measurement of change over time, the cells were treated with SCOP304 at the 30 minute point (upper row). The fluorescence intensity ratio for each treatment concentration of SCOP304 was measured 5 hours after the treatment with SCOP304 (lower row). -Is a control to which SCOP304 is not added. A time-dependent change (upper stage) of the fluorescence intensity ratio from the VB4HC expression cell processed by SCOP402 and the fluorescence intensity ratio (average value +/- standard deviation) (lower stage) for each treatment concentration are shown. In the case of measurement of changes over time, the cells were treated with SCOP402 at the 30-minute point (top). In addition, the fluorescence intensity ratio for each treatment concentration of SCOP402 was measured 3 hours after the treatment with SCOP402 (lower row). -Is a control to which SCOP402 is not added. The time-dependent change of the fluorescence intensity ratio from the VB4HC expression cell processed with the scriptaide is shown. Cells were scripted at 30 minutes. The time-dependent change of the fluorescence intensity ratio from the VB4HC expression cell treated with sodium butyrate is shown. Cells were treated with sodium butyrate at 30 minutes. It is the figure which showed the time-dependent change of the 480 nm / 535 nm fluorescence intensity ratio from the Cos7 cell which expresses VB4HC in a mitotic phase by the pseudo color. 2 shows the time course of the fluorescence intensity ratio of 480 nm / 535 nm from Cos7 cells expressing VB4HC in the mitotic phase. Regarding acetylation of histone H4 in Cos7 cells (M) synchronized with mitotic phase and Cos7 cells out of synchronization, antibodies against histone H4 in which the 5th or 8th lysine is acetylated and the 10th serine are phosphorylated. The result analyzed using this song for histone H3 is shown. AcK5 and AcK8 represent that the fifth and eighth lysines are acetylated, respectively. PS10 represents that the 10th serine is phosphorylated. CBB: Staining with Coomassie Brilliant Blue. The time-dependent change of the fluorescence intensity ratio from the VB4HC expression cell processed with 10 micromol compound A or B is shown. Cells were treated with Compound A or B at 30 minutes. -Is a control to which no compound was added.

Claims (18)

  An acetylated substrate domain and an acetylated substrate binding domain are linked by a linker peptide, and fluorescent proteins having two different fluorescence properties are linked to the acetylated substrate domain and the acetylated substrate binding domain, respectively. A fluorescent probe in which a fluorescent protein having two fluorescent properties has a donor-acceptor relationship with FRET.   The fluorescent probe according to claim 1, wherein the linker peptide is composed of glycine and / or serine.   The fluorescent probe according to claim 1, wherein the sequence of the linker peptide is a sequence in which the sequence represented by SEQ ID NO: 1 is repeated 1 to 9 times.   The fluorescent probe according to any one of claims 1 to 3, wherein the fluorescent protein is GFP or a color variant of GFP.   The fluorescent probe according to claim 4, wherein the color variant of GFP is selected from the group consisting of Venus, CFP, YFP, RFP, and BFP.   The fluorescent probe according to claim 1, wherein the acetylated substrate domain is histone H4.   The fluorescent probe according to claim 1, wherein the acetylated substrate binding domain is a protein having a bromodomain. The fluorescent probe according to claim 7, wherein the protein having the bromodomain is a polypeptide represented by the following (a) or (b).
(A) a polypeptide consisting of amino acids 1 to 443 of the sequence represented by SEQ ID NO: 2,
(B) a 1st to 443rd amino acid sequence of the sequence represented by SEQ ID NO: 2, consisting of an amino acid sequence having one or several amino acid substitutions, deletions or insertions, and bound to an acetylated protein Polypeptide The fluorescent probe according to claim 7, wherein the protein having the bromodomain is a polypeptide represented by the following (a) or (b).
(A) a polypeptide comprising the 57th to 468th amino acids of the sequence represented by SEQ ID NO: 4,
(B) a 57-468th amino acid sequence of the sequence represented by SEQ ID NO: 4 consisting of an amino acid sequence having a substitution, deletion or insertion of one or several amino acids, and binding to an acetylated protein Polypeptide   A nucleic acid encoding the fluorescent probe according to any one of claims 1 to 9.   A vector comprising the nucleic acid according to claim 10.   A fluorescent probe according to any one of claims 1 to 9 is introduced into a living cell, a change in FRET obtained from the fluorescent probe is detected, and acetylation-deacetylation of the acetylated substrate domain in the living cell is detected. A method of measuring variation.   A vector according to claim 11 is transduced into a living cell, the cell is cultured under conditions where the fluorescent probe is expressed from the vector, a change in FRET obtained from the fluorescent probe expressed in the cell is detected, and the living cell The method of measuring the fluctuation | variation of acetylation-deacetylation of the said acetylated substrate domain in the inside.   The fluorescent probe according to any one of claims 7 to 9 is introduced into a living cell, the living cell is reacted with a candidate compound, FRET obtained from the fluorescent probe is detected, and the living cell is reacted with the candidate compound. As a result, when FRET changes, the candidate compound is judged to be a bromodomain binding factor, and a screening method for a bromodomain binding factor.   10. The fluorescent probe according to claim 7 is introduced into a living cell, the living cell is reacted with a candidate compound, FRET obtained from the fluorescent probe is detected, and the living cell is reacted with the candidate compound. A screening method for a histone acetylase activity regulator that determines that the candidate compound is a regulator of histone acetylase activity when FRET changes as a result of the treatment.   10. The fluorescent probe according to claim 7 is introduced into a living cell, the living cell is reacted with a candidate compound, FRET obtained from the fluorescent probe is detected, and the living cell is reacted with the candidate compound. A screening method for a histone deacetylase activity regulator that determines that the candidate compound is a regulator of histone deacetylase activity when FRET changes as a result of the treatment. A bromodomain binding factor screening system comprising the following means:
(A) means for introducing the fluorescent probe according to any one of claims 7 to 9 into a living cell;
(B) means for reacting the living cells with a candidate compound;
(C) means for detecting a change in FRET obtained from the fluorescent probe, and (d) means for selecting a bromodomain-binding candidate compound from candidate compounds using the detection result of the change in FRET as an index,
Including said system. A screening system for a regulator of histone acetylase activity or histone deacetylase activity, comprising the following means:
(A) means for introducing the fluorescent probe according to any one of claims 7 to 9 into a living cell;
(B) means for reacting the living cells with a candidate compound;
(C) a means for detecting a change in FRET obtained from the fluorescent probe, and (d) an activity of histone acetylase activity or histone deacetylase activity among candidate compounds, using the detection result of the change in FRET as an index. Means for selecting candidate control factor compounds,
Including said system.