JP2008154552A - Expression vector for bacterium of genus rhodococcus - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a promoter effective for the expression of a gene in a bacterium of the genus Rhodococcus and an expression vector containing the promoter. <P>SOLUTION: The promoter contains the whole or a part of a DNA composed of a specific base sequence or a base sequence complementary to the DNA and provides an expression vector for a bacterium of the genus Rhodococcus contains the promoter. The expression vector contains a gene linked to the downstream side of the promoter, wherein the expression target gene of the above gene is halohydrin epoxidase. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

  The present invention relates to a promoter suitable for gene expression in a microorganism belonging to the genus Rhodococcus (hereinafter also referred to as “Rhodococcus bacterium”) and an expression vector for Rhodococcus bacteria containing the promoter.

Rhodococcus bacteria are known as industrially useful microbial catalysts because of their physical strength and the ability to accumulate large amounts of enzymes and the like in cells. For example, Rhodococcus bacteria are used for the production of amides or acids by enzymatic hydration or hydrolysis of nitriles (Patent Documents 1 and 2).
Attempts have also been made to modify Rhodococcus bacteria to more useful ones by genetic recombination methods (Patent Documents 3 to 5). For example, in order to efficiently promote genetic manipulation of Rhodococcus bacteria, development of host-vector systems has been promoted, search for novel plasmids (Patent Documents 6 to 8), and development of vectors (Patent Documents 9 to 12). Non-Patent Document 1) and the like have been performed.

The present inventor has already cloned a nitrilase gene and its regulatory gene from Rhodococcus erythropolis SK92 strain, and made it possible to express nitrilase in Rhodococcus bacteria using a composite plasmid vector pK4 (Patent Literature). 12). Furthermore, by obtaining a gene encoding a mutation regulatory factor from the mutant strain SK92-B1, and introducing this gene into an inducible nitrilase-producing bacterium, it was possible to obtain nitrilase without adding an inducer. (Patent Document 13).
Further, the present inventor has found a regulatory factor having an action of activating the nitrilase gene promoter, and has developed an expression vector for Rhodococcus bacteria (Patent Document 14).

However, the gene expression mechanism in Rhodococcus bacteria has not yet been fully elucidated, so there is room for further improvement in the gene expression efficiency by the expression vector for Rhodococcus bacteria.
JP-A-2-470 JP-A-3-251192 Japanese Unexamined Patent Publication No. 4-21379 JP-A-6-25296 JP-A-6-303791 Japanese Patent Laid-Open No. 4-148685 JP-A-4-330287 Japanese Unexamined Patent Publication No. 7-255484 Japanese Patent Laid-Open No. 5-64589 JP-A-8-56669 U.S. Pat.No. 4,920,054 JP-A-8-173169 JP-A-9-28332 Japanese Patent Laid-Open No. 10-248578 Journal of Bacteriology 170, 638-645 (1988)

  An object of the present invention is to provide a promoter useful for gene expression in Rhodococcus bacteria and an expression vector for Rhodococcus bacteria using the promoter. Another object of the present invention is to provide a Rhodococcus bacterium transformed with the expression vector.

  The present inventor conducted intensive research to solve the above-mentioned problems, and found a promoter useful for gene expression in Rhodococcus bacteria and an expression vector for Rhodococcus bacteria using the promoter, and completed the present invention.

（８）（１）〜（７）のいずれか１項に記載のベクターにより形質転換されたロドコッカス属細菌。
（９）以下の(a)又は(b)のDNAの全部又は一部を含有するプロモーター。
(i) 配列番号１８で示される塩基配列からなるDNA
(ii) 配列番号１８で示される塩基配列に相補的な塩基配列からなるDNAとストリンジェントな条件下でハイブリダイズし、プロモーター活性を有するDNA The present invention is as follows.
(1) An expression vector for Rhodococcus bacteria, comprising a nitrilase gene promoter containing all or part of the following DNA (a) or (b):
(a) DNA comprising the base sequence represented by SEQ ID NO: 18
(b) DNA having a promoter activity that hybridizes with a DNA comprising a base sequence complementary to the base sequence represented by SEQ ID NO: 18 under stringent conditions
(2) Expression for Rhodococcus bacteria, including a nitrilase gene promoter containing all or part of the following DNA (a) or (b), a nitrilase expression regulatory gene, and a gene required for replication in Rhodococcus bacteria vector.
(a) DNA comprising the base sequence represented by SEQ ID NO: 18
(b) DNA having a promoter activity that hybridizes with a DNA comprising a base sequence complementary to the base sequence represented by SEQ ID NO: 18 under stringent conditions
(3) The vector according to (1) or (2), further comprising an expression target gene.
(4) The vector according to (3), wherein the expression target gene is linked downstream of the promoter so as to be expressed under the control of the promoter.
(5) The vector according to (3) or (4), wherein the expression target gene is a nitrile hydratase gene.
(6) The vector according to (3) or (4), wherein the expression target gene is a halohydrin epoxidase gene.
(7) The vector according to any one of (1) to (4), which is any vector selected from the group consisting of pSJ042, pSJ080, pSJH101, pSJH102, pSJH104, and pSJH105 shown in the following map. .

(8) A Rhodococcus bacterium transformed with the vector according to any one of (1) to (7).
(9) A promoter containing all or part of the following DNA (a) or (b):
(i) DNA consisting of the base sequence represented by SEQ ID NO: 18
(ii) DNA having a promoter activity that hybridizes with a DNA comprising a base sequence complementary to the base sequence represented by SEQ ID NO: 18 under stringent conditions

  The present invention provides a promoter that functions in Rhodococcus bacteria and an expression vector for Rhodococcus bacteria comprising the promoter. The present invention also provides Rhodococcus bacteria transformed with the expression vector of the present invention. By using these, genes such as nitrile hydratase or halohydrin epoxidase are efficiently transcribed in Rhodococcus bacteria, and the production amount can be improved.

The present invention is described in detail below.
1. Vector of the Present Invention The vector of the present invention is a vector containing a nitrilase gene promoter, and can express a gene incorporated as an expression target in Rhodococcus bacteria at a high rate. The vector of the present invention is preferably a vector comprising (i) a nitrilase gene promoter, (ii) a nitrilase expression regulatory gene, and (iii) a gene required for replication in Rhodococcus bacteria.

  The vector of the present invention may further contain (iv) an expression target gene. The vector of the present invention may further contain (v) a drug resistance gene. In the vector of the present invention, an expression target gene can be preferably ligated so as to be expressed under the control of the promoter of the present invention. Therefore, the vector of the present invention is useful for improving the production amount of an expression target protein in Rhodococcus bacteria, and a recombinant vector in which such a structural gene is linked is also included in the vector of the present invention.

(1) Nitrilase Gene Promoter The present invention provides a nitrilase gene promoter that functions in Rhodococcus bacteria (hereinafter also referred to as “the promoter of the present invention”). The promoter of the present invention can transcribe a gene at a high rate in Rhodococcus bacteria.

As used herein, a promoter (or promoter region) means a nucleotide that affects gene transcription. The promoter may contain a transcriptional regulatory sequence such as an enhancer or silencer in addition to a region having promoter activity.
In the present specification, the promoter activity means transcription activity from a gene to mRNA.

  In the present invention, promoter activity can be measured by quantifying mRNA produced by transcription according to a known method. For example, DNA linked with a gene downstream of the promoter so as to be expressed under the control of the promoter is introduced into the cell, and the resulting mRNA is quantified by Northern blot or RT-PCR. RNA produced using an in vitro transcription system is quantified by Northern blot or RT-PCR. Alternatively, transcription is performed using a radiolabeled or fluorescently labeled nucleotide as a substrate in vitro to measure the radioactivity and fluorescence contained in the resulting mRNA, and the resulting mRNA is quantified.

  Furthermore, in the present invention, promoter activity can also be measured by quantifying the expressed protein by a known method. For example, the expressed protein is detected by an immunochemical method such as Western blot or ELISA (enzyme-linked immunosorbent assay). Further, for example, the detection is performed by an electrophoresis technique such as SDS-PAGE or Native-PAGE. In addition, for example, promoter activity can be measured by the activity of the expressed protein. When the target protein for expression is an enzyme, the expression level of the protein is detected by the enzyme activity, and the promoter activity is measured.

  The promoter of the present invention contains, for example, all or part of DNA consisting of the base sequence represented by SEQ ID NO: 18. Examples of the DNA containing the DNA consisting of the base sequence shown in SEQ ID NO: 18 include about 0.8 Kbp DNA (SEQ ID NO: 10) located between XbaI-SpeI of pSJ042, pSJH101 or pSJH104, or pSJ080, Examples include about 0.5 Kbp DNA (SEQ ID NO: 11) located between XbaI-SpeI of pSJH105, and these DNAs are included in the promoter of the present invention.

  The DNA consisting of the base sequence represented by SEQ ID NO: 18 is a DNA having promoter activity, located in the vector pSJ034, between the nitrile hydratase gene and the nitrilase expression regulatory gene (described later) (FIG. 1).

The above-described pSJ034 is a vector that expresses nitrile hydratase in Rhodococcus bacteria, and can be prepared from pSJ023 by the method described in JP-A-10-337185. This pSJ023 was transformed into ATCC12674 / pSJ023 (FERM BP-6232) at the National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center (1st, 1st East, 1st Street, Tsukuba City, Ibaraki Prefecture) in March 1997. Deposited on the 4th.
pSJ034 is a vector that expresses a recombinant gene using a nitrilase expression regulatory gene derived from Rhodococcus erythropolis SK92-B1 strain. When an enzyme gene is introduced into the multiple cloning site of pSJ034, a fusion protein in which several amino acids are bound to the N-terminus of the enzyme is expressed.

  In addition, the promoter of the present invention includes, for example, all or part of DNA having a promoter activity that hybridizes under stringent conditions to DNA consisting of a base sequence complementary to the base sequence represented by SEQ ID NO: 18. included.

DNA that hybridizes under stringent conditions to DNA consisting of a base sequence complementary to the base sequence shown in SEQ ID NO: 18 has substantially the same promoter activity as DNA consisting of the base sequence shown in SEQ ID NO: 18. It is preferable to have DNA.
In the present specification, “having substantially the same promoter activity” has a transcription activity (promoter activity) from a gene to mRNA, and the degree of the activity is based on the nucleotide sequence represented by SEQ ID NO: 18. Means 50% or more, preferably 70% or more, more preferably 90% or more of the activity of the resulting DNA.

  In the present specification, stringent conditions are, for example, as conditions for washing after hybridization, for example, a salt concentration of 300 to 2000 mM, a temperature of 40 to 75 ° C., preferably a salt concentration of 600 to 900 mM, and a temperature of 65 ° C. Means the condition. For example, “2 × SSC, 50 ° C.”, “2 × SSC, 45 ° C.”, “2 × SSC, 0.1% SDS, 42 ° C.”, “1 × SSC, 0.1% SDS, 37 ° C.”, more stringent Examples of the conditions include “1 × SSC, 0.1% SDS, 65 ° C.”, “0.5 × SSC, 0.1% SDS, 50 ° C.”, and the like.

  In the present specification, hybridization can be performed by a known method. Hybridization methods include, for example, “Molecular Cloning, A Laboratory Manual 2nd ed.” (Cold Spring Harbor Laboratory Press (1989)), “Current Protocols in Molecular Biology” (John Wiley & Sons (1987-1997)), etc. You can refer to it.

  Furthermore, in the present invention, the DNA that hybridizes under stringent conditions to DNA consisting of a base sequence complementary to the base sequence represented by SEQ ID NO: 18 includes, for example, at least the base sequence represented by SEQ ID NO: 18 Examples thereof include DNA containing a base sequence having identity of 60% or more, preferably 70% or more, more preferably 80% or more, and still more preferably 90%, 95%, 97%, 98%, or 99% or more. . A value indicating identity can be calculated by using a known program such as BLAST.

  In the present invention, the DNA that hybridizes under stringent conditions to DNA consisting of a base sequence complementary to the base sequence shown in SEQ ID NO: 18 is, for example, 1 or 2 in the base sequence shown in SEQ ID NO: 18 Examples thereof include DNA containing a base sequence in which mutation such as deletion, substitution or addition has occurred in several nucleic acids.

  Here, the DNA that hybridizes under stringent conditions to DNA consisting of a base sequence complementary to the base sequence represented by SEQ ID NO: 18 is, for example, (a) 1 to 1 in the base sequence represented by SEQ ID NO: 18 10 (for example, 1 to 5, preferably 1 to 3, more preferably 1 to 2, more preferably 1) nucleic acid deleted base sequence, (b) the base represented by SEQ ID NO: 18 A base sequence in which 1 to 10 (for example, 1 to 5, preferably 1 to 3, more preferably 1 to 2, more preferably 1) nucleic acid in the sequence is replaced with another nucleic acid; c) A base having 1 to 10 (eg, 1 to 5, preferably 1 to 3, more preferably 1 to 2, more preferably 1) nucleic acid added to the base sequence represented by SEQ ID NO: 18 Sequence and (d) a base sequence mutated by the combination of (a) to (c) above And the like.

  DNA containing a nucleotide sequence in which mutation such as deletion, substitution or addition has been made in one or several nucleic acids in the nucleotide sequence shown in SEQ ID NO: 18 is “Molecular Cloning, A Laboratory Manual 2nd ed.” (Cold Spring Harbor Press (1989)), `` Current Protocols in Molecular Biology '' (John Wiley & Sons (1987-1997)), Kunkel (1985) Proc. Natl. Acad. Sci. USA 82: 488-92, Kunkel (1988) Method. Enzymol. 85: 2763-6 etc. and can be prepared according to a method such as site-directed mutagenesis.

In addition, in order to introduce a mutation into DNA, a mutation introduction kit using site-directed mutagenesis by a known method such as Kunkel method or Gapped duplex method, for example, QuikChange ^TM Site-Directed Mutagenesis Kit (Stratagene) Manufactured), GeneTailor ^™ Site-Directed Mutagenesis System (manufactured by Invitrogen), TaKaRa Site-Directed Mutagenesis System (Mutan-K, Mutan-Super Express Km, etc .: manufactured by Takara Bio Inc.) and the like.

  The promoter of the present invention also includes a genetic polymorphism of DNA consisting of a part or all of the base sequence represented by SEQ ID NO: 18. The gene polymorphism can be easily known by using a known database, for example, GenBank (http://www.ncbi.nlm.nih.gov). Examples of gene polymorphism include single nucleotide polymorphism (SNP), VNTR (variable number of tandem repeat), and microsatellite polymorphism.

The promoter of the present invention can be obtained by a known nucleic acid amplification method or primer walking method using a part of the promoter of the present invention described above (for example, a DNA comprising the nucleotide sequence represented by SEQ ID NO: 18) as a primer. The promoter of the present invention is a known one such as colony hybridization, plaque hybridization, Southern blot, etc., using as a probe a part of the promoter of the present invention (for example, DNA comprising the nucleotide sequence represented by SEQ ID NO: 18). It can also be obtained by a hybridization method.
In the above method, a vector, mRNA, total RNA, cDNA, genomic DNA or library thereof containing a nitrile hydratase gene promoter region can be used. These nucleic acids are preferably derived from microorganisms belonging to the genus Rhodococcus. Moreover, those skilled in the art can obtain these nucleic acids by known methods. Commercially available nucleic acids can also be used. For the method for preparing the library, “Molecular Cloning, A Laboratory Manual 2nd ed.” (Cold Spring Harbor Press (1989)) can be referred to. Examples of the vector containing the promoter of the present invention include pSJ034.

  Confirmation of the base sequence of the promoter of the present invention can be carried out by sequencing by a conventional method. For example, the dideoxynucleotide chain termination method (Sanger et al. (1977) Proc. Natl. Acad. Sci. USA 74: 5463) can be used. The sequence can also be analyzed using an appropriate DNA sequencer.

  Further, in the present specification, (a) a part of the DNA consisting of the base sequence represented by SEQ ID NO: 18 or (b) a stringent DNA and a DNA comprising the base sequence complementary to the base sequence represented by SEQ ID NO: 18 The part of the DNA that hybridizes under conditions and has promoter activity means a part of the DNA that is a continuous region. For example, DNA having a nucleic acid length of 90% or more, preferably 95% or more, more preferably 97% or more, more preferably 98% or more of the DNA can be mentioned.

(2) Nitrilase expression regulatory gene The vector of the present invention contains a nitrilase expression regulatory gene.
In the present specification, an expression regulatory gene is a gene that encodes a protein that regulates the expression of another gene and has activities such as a repressor and an activator.
The nitrilase expression regulatory gene in the present invention means a gene encoding a protein that regulates the expression of the nitrilase gene in Rhodococcus bacteria.
The vector of the present invention contains both a regulator gene and a sensor gene as nitrilase expression regulatory genes. The regulator gene and sensor gene are genes encoding regulator proteins and sensor proteins that are used to regulate the expression of a two-component control system. Sensor proteins sense environmental factors such as the presence of inducers at the sensor site, phosphorylate their own specific histidine residues, and regulator proteins accept phosphate groups from sensor proteins to specific aspartic acid residues Is activated and regulates the expression of specific genes.
Examples of the nitrilase expression regulatory gene in the present invention include the expression regulatory gene 1: regulator gene (276-1010) and the expression regulatory gene 2: sensor gene (1007-2611) contained in the above-described pSJ034 (Japanese Patent Laid-Open No. Hei 9 (1994)). No. 8-173169, JP-A-9-28382).

(3) Genes required for replication in Rhodococcus bacteria Since the vector of the present invention is an expression vector for Rhodococcus bacteria, genes required for autonomous replication in Rhodococcus bacteria (hereinafter referred to as "replication regions"). Need to be incorporated).
When the vector of the present invention is a shuttle vector for adapting to a plurality of host cells, it is necessary to incorporate each gene necessary for autonomous replication in each host into the vector. For example, when constructing a vector that can be introduced not only into Rhodococcus bacteria but also into Escherichia coli, it is necessary to incorporate the respective replication regions for Rhodococcus bacteria and Escherichia coli into the vector.

Examples of genes necessary for replication in Rhodococcus bacteria include, for example, replication regions contained in plasmids pAN12, pNC903, pFAJ2600, pRC10, pRC20, pRC001, pRC002, pRC003, or pRC004, preferably plasmid pRC001, Examples include the replication region contained in pRC002, pRC003, or pRC004.
Plasmids pRC001, pRC002, pRC003, and pRC004 are plasmids derived from Rhodococcus rhodochrous ATCC 4276, ATCC 14349, ATCC 14348, and IFO 3338 strains, respectively, and JP-A-2-84198 and JP-A-4-48685. JP-A-5-64589 and JP-A-5-68566.
Examples of genes necessary for replication in Rhodococcus bacteria include RepA and RepB genes.
RepA and RepB are genes contained in plasmids pRC001, pRC002, pRC003, and pRC004. To identify RepA or RepB, first, the entire DNA sequence of the isolated plasmid is determined, and the presence of RepA or RepB is estimated by homology search. Finally, it is experimentally confirmed that the estimated gene is a gene necessary for replication.

  Examples of vectors containing genes necessary for replication in Rhodococcus bacteria include pSJ023 and pSJ034, and preferably include pSJ034.

  Examples of genes necessary for autonomous replication in E. coli include ColE1 sequence, p15A, and pSC101. These genes can be obtained from existing E. coli vectors by known methods. By incorporating a replication region in E. coli into the vector, E. coli can be used for the production of the vector.

(4) Expression target gene In the present invention, the expression target gene is a structural gene encoding a target protein (hereinafter also referred to as "expression target protein") to be expressed in a Rhodococcus bacterium using the vector of the present invention. Means. The expression target gene incorporated into the vector of the present invention is preferably a gene that encodes a protein that is difficult to be highly expressed in Rhodococcus bacteria or desired to be highly expressed in Rhodococcus bacteria. Examples of such proteins include nitrile hydratase, amidase, nitrilase, oxynitrilase and halohydrin epoxidase.

  An expression target gene can be obtained by a known method such as a PCR method or a hybridization method using a primer or a probe designed from information on a base sequence or amino acid sequence registered in an existing database such as GenBank. it can.

In the present invention, the expression target gene can be incorporated into the site by including a multicloning site downstream of the promoter so that it is transcribed under the control of the promoter of the present invention.
In order to insert an expression target gene into a vector, the gene may be inserted and linked so that the gene is appropriately transcribed under the control of the promoter of the present invention. More specifically, it may be incorporated into the appropriate restriction enzyme cleavage site downstream of the promoter of the present invention in the direction in which the expressed target gene is correctly transcribed. Alternatively, the promoter of the present invention may be incorporated in an appropriate restriction enzyme cleavage site upstream of the expression target gene in the direction in which the promoter of the present invention functions correctly.

  Examples of the expression target protein include halohydrin epoxidase. The halohydrin epoxidase is an enzyme (EC number: 4.5.1.-) having an activity of converting 1,3-dihalo-2-propanol into an epihalohydrin and catalyzing the reverse reaction. Microorganisms producing this enzyme include Corynebacterium sp. N-1074 (FERM BP-2643), Microbacterium sp. N-4701 (FERM BP-2644), Agro Examples include Agrobacteriu radiobacter AD1, Mycobacterium sp. GP1, Arthrobacter sp. AD2, and the like. A particularly preferred microorganism is Corynebacterium sp. N-1074 (FERM BP-2643).

N-1074 shares were deposited on November 10, 1988, at the National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center (1-1-1 Higashi 1-1-1, Tsukuba City, Ibaraki Prefecture). It is FERM BP-2643.
N-4701 stock was deposited on April 19, 2001 at the National Institute of Advanced Industrial Science and Technology Patent Biological Depositary Center (Cut 6th, 1-1-1 Higashi 1-1-1, Tsukuba, Ibaraki). FERM BP-2644.

  The halohydrin epoxidase is published in, for example, GenBank, and the Accession number of the halohydrin epoxidase gene (hheB) derived from Corynebacterium sp. N-1074 is D90350. The amino acid sequence is represented by SEQ ID NO: 19, and the base sequence is represented by SEQ ID NO: 20.

(5) Vector The origin of the basic vector of the vector of the present invention is not particularly limited as long as the gene can be expressed at a high rate in Rhodococcus bacteria. For example, plasmids derived from Rhodococcus bacteria, Escherichia coli, Bacillus subtilis, Insect viruses such as bacteriophages, retroviruses, adenoviruses, adeno-associated viruses, vaccinia viruses, baculoviruses can be used. For example, known vectors such as pSJ023, pTip vector (Japanese Patent Laid-Open No. 2004-73032), pNit vector (Japanese Patent Laid-Open No. 2004-321013), pMVS301, and pAN12 can be used as vectors used in Rhodococcus bacteria.

  As long as the vector of the present invention can express a gene at a high rate in Rhodococcus bacteria, in addition to the DNAs described in (1) to (4) above, a terminator, a drug resistance gene (selection marker), a multicloning site, An enhancer, splicing signal, poly A addition signal, ribosome binding sequence (SD sequence) and the like may be included. Furthermore, a linker may be added as necessary.

  For example, a terminator is preferably incorporated into the vector of the present invention if necessary to terminate transcription of a gene encoding a target protein incorporated into the vector. An example of the terminator is a Pol III terminator such as an oligo d (T) sequence.

  The drug resistance gene can be used to select a transformant introduced with the vector of the present invention. The drug resistance gene can be used for confirming that the vector of the present invention is contained in the transformant. Examples of drug resistance genes (selection markers) include neomycin resistance genes, hygromycin resistance genes, puromycin resistance genes, kanamycin resistance genes, ampicillin resistance genes and other drug resistance genes, and dihydrofolate reductase genes. Examples of selection markers for confirming the expression of the target gene include GFP (green fluorescence protein) and EGFP (enhanced GFP).

  A ligase reaction can be used to insert each region into the vector. For example, a method in which the purified DNA is cleaved with an appropriate restriction enzyme and the resulting DNA fragment is inserted into an appropriate restriction enzyme site or a multicloning site in the vector to be ligated to the vector is employed.

  The vector of the present invention can also be prepared as follows. First, from the vector containing the nitrilase gene promoter region, the promoter of the present invention is amplified by the PCR method using a primer designed based on the sequence information of SEQ ID NO: 18. Subsequently, the PCR product and the vector are treated with a predetermined restriction enzyme, and the obtained DNA fragment is inserted into the vector, whereby the vector of the present invention in which the nitrilase gene promoter region is recombined can be produced.

The vectors pSJ042, pSJ080, pSJH101, pSJH102, pSJH104 and pSJH105 produced in the examples are included in the vector of the present invention.
pSJ042 is a 11.27 kbp vector having a SpeI-XbaI region of about 0.8 kbp as a promoter (FIG. 1).
pSJ080 is a 11.01 kbp vector having a SpeI-XbaI region of about 0.5 kbp as a promoter (FIG. 1).
pSJH101 is a 10.33 kbp vector having a SpeI-XbaI region of about 0.8 kbp as a promoter (FIG. 5).
pSJH102 is a 10.07 kbp vector having a SpeI-XbaI region of about 0.5 kbp as a promoter (FIG. 5).
pSJH104 is a 9.94 kbp vector having a SpeI-XbaI region of about 0.8 kbp as a promoter (FIG. 4).
pSJH105 is a 9.68 kbp vector having a SpeI-XbaI region of about 0.5 kbp as a promoter (FIG. 4).
PSJ042, pSJ080, pSJH101, pSJH102, pSJH104, and pSJH105 are vectors containing a nitrilase gene promoter, a nitrilase expression regulatory gene (regulator gene and sensor gene), and genes necessary for replication in Rhodococcus bacteria (RepA and RepB). is there.
Furthermore, pSJ080 and pSJ042 are vectors containing a nitrile hydratase gene as an expression target gene. pSJH101, pSJH102, pSJH104, and pSJH105 are vectors containing a halohydrin epoxidase gene as an expression target gene.

2. Transformant Next, a transformant can be prepared by introducing the above-described vector of the present invention into a host. Such transformants are also included in the scope of the present invention. The host used in the present invention is preferably Rhodococcus bacteria.

The vector of the present invention can be introduced into Rhodococcus bacteria.
Examples of Rhodococcus bacteria include Rhodococcus rhodochrous ATCC999, ATCC12674, ATCC17895, ATCC15998, ATCC33275, ATCC184, ATCC4001, ATCC4273, ATCC4276, ATCC9356, ATCC12483, ATCC12483, ATCC14347, ATCC14350, ATCC15905, ATCC15998, ATCC170998, ATCC17041, ATCC19149, ATCC19150, ATCC21243, ATCC29670, ATCC29672, ATCC29675, ATCC33258, ATCC13808, ATCC17043, ATCC19067, CC21291, ATCC ATCC21785, ATCC21924, IFO14894, IFO3338, NCIMB11215, NCIMB11216, JCM3202, Rhodococcus rhodochrous, J1 (FERM BP-1478), Rhodococcus globulus (Rhodococcus 145) Rhodococcus luteus JCM6162 strain, JCM6164 strain, Rhodococcus erythropolis IFO12538 strain, IFO123 20 strains, Rhodococcus equi IFO3730 strain, and JCM1313 strain. Preferred are Rhodococcus rhodochrous J1 strain, ATCC 12674 strain, ATCC17895 strain, ATCC15998 strain and the like, and particularly preferred are Rhodococcus rhodochrous J1 strain and ATCC12674 strain.

  The ATCC strain is available from the American Type Culture Collection. IFO strains can be obtained from the National Institute of Product Evaluation Technology Biotechnology Headquarters Biogenetic Resources Division (NBRC). The JCM strain is available from the Microbial Materials Development Department, RIKEN BioResource Center.

  The vector of the present invention can be introduced into a host other than Rhodococcus bacteria, as long as it has a gene that can be replicated in a predetermined host. The host used in the present invention is not particularly limited. For example, Escherichia coli, Bacillus subtilis, Corynebacterium bacteria, Brevibacterium bacteria, yeast, mold, animal cells, plant cells, insect cells, etc. Is mentioned.

  Examples of Escherichia coli include Escherichia coli K12 strain and B strain, and JM109 strain, XL1-Blue strain, and C600 strain, which are derived from these wild strains. These strains can be easily obtained from, for example, the American Type Culture Collection (ATCC). Examples of Bacillus subtilis include Bacillus subtilis.

  The method for introducing the vector into the host is not particularly limited, and any method can be used as long as it introduces DNA into the host. Examples thereof include known methods such as electroporation, calcium ion, lipofection, DEAE dextran, spheroplast, and lithium acetate.

  As a host used for transformation, it is preferable to use competent cells that have been subjected to a predetermined treatment.

  Moreover, in order to select the transformant in which the vector of the present invention has been introduced, a drug resistance gene can be used as necessary. That is, when a predetermined drug is brought into contact with a transformant in culture, only the transformant into which the vector containing the drug resistance gene has been introduced can survive, and the transformant into which the vector of the present invention has been introduced You can choose.

Next, a method for producing an expression target protein from Rhodococcus bacteria will be described.
In the present invention, the expression target protein can be obtained by culturing a transformant containing the vector prepared by the above-described method and collecting it from the culture.
Here, the “culture” means a culture supernatant, a cultured cell, a cultured cell, a disrupted cell of a cultured cell or a cultured cell, or the like.

The method for culturing the transformant of the present invention is performed according to a usual method.
As a medium for cultivating the transformant, a natural medium or a synthetic medium may be used as long as it contains a carbon source, a nitrogen source, inorganic salts, and the like that can be assimilated by microorganisms and can efficiently culture the transformant. Any of the media may be used. Examples of the carbon source include carbohydrates such as glucose, fructose, sucrose, and starch, organic acids such as acetic acid and propionic acid, and alcohols such as ethanol and propanol. Examples of the nitrogen source include ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, ammonium salts of organic acids such as ammonium phosphate or other nitrogen-containing compounds, peptone, meat extract, corn steep liquor, and the like. Examples of the inorganic substance include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, and calcium carbonate.

The culture conditions are not particularly limited, and can be performed at a temperature of 10 ° C to 45 ° C, preferably 10 ° C to 40 ° C for 5 to 120 hours, preferably about 5 to 100 hours. In some cases, a small amount of pre-culture can be performed prior to the main culture.
The transformant of Rhodococcus spp. Is preferably cultured at 30 to 40 ° C. under aerobic conditions such as shaking culture or aeration and agitation culture. The culture is preferably timely adjusted using an inorganic or organic acid, an alkaline solution or the like.

  Further, in order to prevent the vector from falling off from the transformant during the culture, the culture may be performed under a selective pressure with a drug selection marker as necessary. For example, when cultivating a transformant transformed with a vector containing an ampicillin resistance gene, ampicillin may be added to the medium as needed during the culture.

  The transformant into which the vector of the present invention has been introduced can be cultured, and the vector of the present invention can be collected from the resulting culture.

  As the treatment method of the culture of the present invention, a surfactant is added to the culture obtained from the above-mentioned culture so that the final concentration is 0.01% to 10%, and the resultant protein is stirred at a temperature at which the protein is not inactivated You can also.

  When the protein to be produced is halohydrin epoxidase, the final concentration of the surfactant is preferably 0.001% to 1%, and particularly preferably 0.01% to 0.5%. The treatment temperature is preferably 0 ° C to 40 ° C, particularly preferably 4 ° C to 20 ° C. The treatment time may be within the time when the effect of the bacterial cell treatment is recognized, preferably 15 minutes to 24 hours, particularly preferably 30 minutes to 2 hours.

As the surfactant used for the treatment of the culture, an anionic surfactant, a cationic surfactant or a nonionic surfactant can be used. As the anionic surfactant, for example, sodium dodecyl sulfate can be used. As the cationic surfactant, for example, benzethonium chloride can be used. As the nonionic surfactant, for example, Triton X100 or the like can be used.
The bacteria treated with the surfactant may be used after washing with a buffer, or may be used in the next step without washing.

  The culture or the treated product can be collected by centrifugation, and the vector of the present invention can be collected from the obtained culture by the alkaline method. In order to collect the vector from the transformant, a commercially available kit (QIAGEN) may be used. “Processed product” means a microbial cell extract, such as a crushed cell product, a microbial cell treated with a drug, an immobilized microbial cell, or a crude enzyme / purified enzyme.

The expression target protein can be expressed in Rhodococcus bacteria by the vector of the present invention. Protein expression in Rhodococcus bacteria can be confirmed by known methods. For example, the expression of mRNA of the target protein can be measured by a known method such as Northern blot, in situ hybridization, RT-PCR, quantitative PCR.
The expression of the target protein can be measured by a known method such as Western blot, immunocytochemistry, immunohistochemistry, immunochemical methods such as ELISA and RIA, and mass spectrometry.

  In the method of collecting the expression target protein, when the protein is produced in the transformant, first, the transformant is destroyed by lysis treatment using an enzyme such as lysozyme, ultrasonic crushing treatment, grinding treatment or the like. Next, insoluble matters are removed by filtration or centrifugation to obtain a crude protein solution. From this crude solution, the target protein is obtained by salting out, various chromatography (eg, gel filtration chromatography, ion exchange chromatography, affinity chromatography, etc.), SDS polyacrylamide gel electrophoresis, etc. alone or in appropriate combination.

  When the expression target protein is produced outside the transformant, the culture solution is used as it is, or the transformant is removed by centrifugation or the like. Thereafter, a general biochemical method used for enzyme isolation and purification, for example, ammonium sulfate precipitation, gel chromatography, ion exchange chromatography, affinity chromatography, etc., can be used alone or in appropriate combination in the culture. The target protein can be obtained from

When the gene to be expressed is nitrile hydratase, the culture obtained by culturing the transformant prepared by the above-mentioned method or its treated product can be subjected to the following conversion reaction of acrylonitrile to acrylamide.
This conversion reaction is performed by converting acrylonitrile to the above-mentioned culture or a processed product thereof. The substrate concentration used for the conversion reaction is preferably 0.1 to 10% (W / V), particularly preferably 5% (W / V). The reaction is preferably performed in a pH 6 to 8 buffer solution or water, and can be performed, for example, in a 50 mM phosphate buffer solution (pH 7.7).

  Acrylamide purified by the reaction can be quantified using a known method such as gas chromatography. The nitrile hydratase activity can be converted from the amount of acrylamide produced.

（式（１）中、Ｘ₁及びＸ₂はハロゲン原子を示す）
ハロゲン原子としては、フッ素、塩素、臭素、ヨウ素が好ましく、塩素、臭素が特に好ましい。 In addition, when the gene to be expressed is a halohydrin epoxidase gene, the culture obtained by culturing the transformant prepared by the above method or the treated product thereof is subjected to the reactions shown in the following (1) to (3). Can be provided.
(1) Conversion of 1,3-dihalo-2-propanol to epihalohydrin This conversion reaction is carried out by bringing 1,3-dihalo-2-propanol into contact with the above-mentioned culture or its treated product. 1,3-Dihalo-2-propanol as a substrate is a compound represented by the following formula (1).

(In formula (1), X ₁ and X ₂ represent halogen atoms)
As the halogen atom, fluorine, chlorine, bromine and iodine are preferable, and chlorine and bromine are particularly preferable.

  Examples of the compound represented by the formula (1) include 1,3-difluoro-2-propanol, 1,3-dichloro-2-propanol, 1,3-dibromo-2-propanol, 1,3-diiodo-2- Examples include propanol and the like, preferably 1,3-dichloro-2-propanol and 1,3-dibromo-2-propanol.

  The substrate concentration in the conversion reaction solution is preferably from 0.01 to 15 (W / V)%, particularly preferably from 0.01 to 10%, from the viewpoint of enzyme stability. The substrate can be added to the reaction solution all at once or in divided portions. It is desirable to make the substrate concentration constant by dividing addition in order to increase the accumulation of the product.

As a solvent for the reaction solution, water or a buffer solution having an enzyme activity near the optimum pH of 4 to 10 is preferable, and water is particularly preferable. As the buffer solution, for example, a buffer solution composed of a salt such as phosphoric acid, boric acid, citric acid, glutaric acid, malic acid, malonic acid, o-phthalic acid, succinic acid or acetic acid, Tris buffer or Good A buffer solution or the like is preferable.
The reaction temperature is 5 to 50 ° C, more preferably 10 to 40 ° C. The reaction pH is preferably in the range of 4 to 10, more preferably pH 6 to 9. The reaction time is appropriately selected depending on the concentration of the substrate and the like, the bacterial cell concentration or other reaction conditions, but it is preferable to set the conditions so that the reaction time is completed in 1 to 120 hours. In this reaction, the optical purity can be further improved by removing chlorine ions generated as the reaction proceeds from the reaction system. This removal of chlorine ions is preferably performed by adding silver nitrate or the like.

  Epihalohydrin produced and accumulated in the reaction solution can be collected and purified using a known method. For example, after removing the cells from the reaction solution using a method such as centrifugation, extraction with a solvent such as ethyl acetate and removal of the solvent under reduced pressure can give an epihalohydrin syrup. Further, these syrups can be further purified by distillation under reduced pressure.

(2) Conversion of 1,3-dihalo-2-propanol to 4-halo-3-hydroxybutyronitrile In this conversion reaction, 1,3-dihalo-2-propanol was converted into a cyanide compound and the above-mentioned culture or its It is carried out by bringing it into contact with the treated product.
1,3-Dihalo-2-propanol as a substrate is a compound represented by the formula (1), preferably 1,3-dichloro-2-propanol, 1,3-dibromo-2-propanol or the like.

  Further, as the cyanide compound, a compound that generates cyanide ion (CN-) or hydrogen cyanide when added to a reaction solution such as hydrogen cyanide, potassium cyanide, sodium cyanide, cyanic acid, or acetone cyanohydrin, or a solution thereof is used. it can.

The substrate concentration in the reaction solution is preferably from 0.01 to 15 (W / V)%, particularly preferably from 0.01 to 10%, from the viewpoint of enzyme stability.
Moreover, the usage-amount of a cyanide compound has the preferable 1-3 times amount (mol) of a substrate from a viewpoint of enzyme stability.
The reaction conditions can be the same as in (1) above.

  The 4-halo-3-hydroxybutyronitrile produced and accumulated in the reaction solution can be collected and purified using a known method. For example, after removing bacterial cells from the reaction solution using a method such as centrifugation, extraction with a solvent such as ethyl acetate is performed, and the solvent is removed under reduced pressure to remove 4-halo-3-hydroxybutyronitrile. You can get syrup. Further, these syrups can be further purified by distillation under reduced pressure.

（式（２）中、X₁はハロゲン原子を示す）
ハロゲン原子としては、フッ素、塩素、臭素、ヨウ素が好ましく、塩素、臭素が特に好ましい。 (3) Conversion of epihalohydrin to 4-halo-3-hydroxybutyronitrile This conversion reaction is carried out by bringing an epihalohydrin into contact with a cyanide compound and the above-mentioned culture or treated product thereof.
Epihalohydrin as a substrate is a compound represented by the following formula (2).

(In formula (2), X ₁ represents a halogen atom)
As the halogen atom, fluorine, chlorine, bromine and iodine are preferable, and chlorine and bromine are particularly preferable.

  Examples of the compound represented by the formula (2) include epifluorohydrin, epichlorohydrin, epibromohydrin, epiiodohydrin, and the like, particularly preferably epichlorohydrin and epibromohydrin. .

In addition, as the cyanide compound, a compound that generates cyanide ion (CN ⁻ ) or hydrogen cyanide or a solution thereof when added to a reaction solution such as hydrogen cyanide, potassium cyanide, sodium cyanide, cyanic acid, or acetone cyanohydrin can be used.
Reaction conditions, collection and purification methods can be carried out in the same manner as (2) above.

  EXAMPLES Hereinafter, although an Example demonstrates this invention concretely, this invention is not limited to a following example.

[Example 1] DNA sequencing of vector The pSJ034 used was a vector that expresses nitrile hydratase in bacteria belonging to the genus Rhodococcus, and was prepared from pSJ023 by the method described in JP-A-10-337185. In addition, pSJ023 was transformed into ATCC12674 / pSJ023 (FERM BP-6232) at the National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center (1st, 1st East, 1st Street, Tsukuba City, Ibaraki Prefecture, March 6). Deposited by date.

The DNA sequence in the downstream region of the nitrilase expression regulatory sequence of pSJ034 (Fig. 1 EcoRI to Xba1 surrounded by □ in pSJ034) was determined using the primer walking method. The determined DNA sequence is shown in SEQ ID NO: 1. The gene represented by SEQ ID NO: 1 represents a nitrilase gene promoter region derived from SK92-B1. Further, the amino acid sequence of expression gene 1 (regulator gene 276-1010) is shown in SEQ ID NO: 2, and the base sequence is shown in SEQ ID NO: 3. The amino acid sequence of expression gene 2 (sensor gene 1007-2611) is shown in SEQ ID NO: 4, and the base sequence is shown in SEQ ID NO: 5.
SK-92B1 is a mutant strain that constitutively produces nitrilase by performing a mutation treatment on the Rhodococcus erythropolis SK-92 strain isolated as a nitrilase-bearing strain.

[Example 2] Improvement of vector
pSJ041 to pSJ041 were prepared, and pSJ041 to pSJ042, pSJ080, and pSJ081 were prepared as shown below. FIG. 1 shows a construction diagram of vectors pSJ041, pSJ042, pSJ080, and pSJ081. FIG. 2 shows a part of the base sequence of pSJ034 and the positions of primers NR-14, NR-15 and NR-16 used in the examples.
In FIG. 2, “−10” indicates a −10 region 10 bases upstream from the transcription start position, and “−35” indicates a −35 region 35 bases upstream from the transcription start position (+1). These two regions are conserved in promoter sequences that function in prokaryotes, and typical sequences are TATAAT and TTGACA, respectively.

(1) Preparation of pSJ041
pSJ034 was cleaved with EcoRI, blunted using DNA Bluntinng Kit (Takara Bio), and SpeI linker (GACTAGTC) was inserted. The prepared vector was designated as pSJ041.

(2) Preparation of pSJ042, pSJ080, pSJ081
pSJ034 was used as a template, and PCR was performed using the reaction solution composition and primers shown below.
(Reaction solution composition)
pSJ034 (1/100 dilution) 1μl
10 × Pfu Buffer (Sratagene) 10μl
Primer NLR-09 (SEQ ID NO: 6) 1μl
Primer NR-14 (SEQ ID NO: 7) 1 μl
2.5mM dNTP 8μl
Sterile water 78μl
Pfu turbo DNA polymerase (Sratagene) 1μl
Total volume 100μl
(Primer)
NLR-09: ggtctagagctccttgatgtgtggagtgatgc (SEQ ID NO: 6)
NR-14: ggactagtcgcggcacatccctggtcgtg (SEQ ID NO: 7)

After preparing the reaction solution, 30 cycles of a reaction in which one cycle was 93 ° C: 30 seconds, 55 ° C: 30 seconds, and 72 ° C: 1 minute were performed. The reaction solution was electrophoresed to confirm a DNA fragment (SEQ ID NO: 10) of about 0.8 Kb.
Next, the reaction solution was purified with GFX PCR DNA band and GelBand Purification kit (Amersham Biosciences), treated with restriction enzymes XbaI and SpeI to cleave the PCR product. The PCR product subjected to the restriction enzyme treatment was subjected to electrophoresis on a 0.7% agarose gel, and a band around 0.8 Kb was recovered. The collected PCR product was ligated to the XbaI-SpeI site of the vector pSJ041 using a Ligation Kit (Takara Shuzo) to prepare a vector: pSJ042.

Using the same technique, a PCR fragment of NLR-09 and NR-15 (SEQ ID NO: 8) was used to amplify an approximately 0.5 Kb DNA fragment (SEQ ID NO: 11), and this was amplified into the XbaI-SpeI site of vector pSJ041. To produce a vector: pSJ080.
Furthermore, NLR-09 and NR-16 (SEQ ID NO: 9) were used as PCR primers to amplify an approximately 0.3 Kb DNA fragment (SEQ ID NO: 12), which was ligated to the XbaI-SpeI site of vector pSJ041. pSJ081 was prepared.
(Primer)
NR-15 cgactagtgcactccgctgcgacatgtatcg (SEQ ID NO: 8)
NR-16 ggactaGTCATTGGTTGATCTGCCGTTGAGAG (SEQ ID NO: 9)

[Example 3] Production of Rhodococcus genus bacterial transformant having nitrile hydratase gene (1) Production of competent cell Centrifuge for cells in logarithmic growth phase of Rhodococcus rhodochrous ATCC 12674 strain Were collected three times with ice-cooled sterilized water and suspended in sterilized water to prepare competent cells.

(2) Preparation of transformants 1 μl of each of the vectors (pSJ042, pSJ080, pSJ081) prepared in Example 2 and 10 μl of each of the competent cell suspensions prepared in (1) were mixed with ice cooling. did. Each liquid mixture was put into a cuvette and subjected to electric pulse treatment at 20 KV / cm and 200 OHMS using a gene introduction apparatus Gene Pulser (BIO RAD). The electric pulse treatment solution was allowed to stand for 10 minutes under ice cooling, and heat shock was performed at 37 ° C. for 10 minutes. Then, add 500 μl of MYK medium (0.5% polypeptone, 0.3% bacto yeast extract, 0.3% bacto malt extract, 0.2% K ₂ HPO ₄ , 0.2% KH ₂ PO ₄ ) to the cuvette and let stand at 30 ° C for 5 hours. After that, it was applied to a MYK agar medium containing 50 μg / ml kanamycin and cultured at 30 ° C. for 3 days.
The vector contained in the obtained colonies was confirmed, and three transformants (Rhodococcus rhodochrous ATCC12674 / pSJ042, ATCC12674 / pSJ080, ATCC12674 / pSJ081) were obtained.
In addition, ATCC12674 / pSJ034 was prepared as a comparative control.

(3) Culture of transformant The colony obtained in (2) was inoculated into 10 ml of MYK medium (containing 50 μg / ml kanamycin) and pre-cultured at 30 ° C. for 72 hours. After preculture, 1% of the preculture was inoculated into 100 ml of MYK medium (containing 50 μg / ml kanamycin and 10 μg / ml cobalt chloride), and main culture was performed at 30 ° C. for 96 hours. After the main culture, the culture was centrifuged to collect microbial cells. The obtained cells were washed with 100 mM phosphate buffer (pH 8.0) and finally suspended in a small amount of buffer.

[Example 4] Measurement of nitrile hydratase activity The measurement of the nitrile hydratase activity of the culture solution containing the bacterial cells prepared in Example 3 was performed according to the following method.
First, 1 ml of the culture solution obtained after the main culture in Example 3 (3) and 4 ml of 50 mM phosphate buffer (pH 7.7) are mixed and further contain 5.0% (w / v) acrylonitrile. 5 ml of 50 mM phosphate buffer (pH 7.7) was added to the mixture and reacted at 10 ° C. for 10 minutes. Subsequently, the cells were separated by filtration, and the amount of produced acrylamide was quantified using gas chromatography, and the nitrile hydratase activity was converted from the amount of acrylamide. Nitrile hydratase activity was expressed as activity per dry cell weight (U / mgDC). The analysis conditions were as shown below.
(Analysis conditions)
Analytical instrument Gas chromatograph GC-14B (manufactured by Shimadzu Corporation)
Detector FID (detected at 200 ° C)
Filled with Column Polapack PS (Waters column filler)
1m glass column Column temperature 190 ℃

以上の結果より、改良ベクターを用いたpSJ042、及びpSJ080は、比較例のベクターを用いた場合より高いニトリルヒドラターゼ活性が認められた。
したがって、本発明のプロモーターを含有するベクターは、ロドコッカス属細菌における遺伝子発現を促進可能であることが示された。 result

From the above results, pSJ042 and pSJ080 using the improved vector were found to have higher nitrile hydratase activity than when the comparative vector was used.
Therefore, it was shown that the vector containing the promoter of the present invention can promote gene expression in Rhodococcus bacteria.

  Moreover, the result of SDS-PAGE using the microbial cell lysate supernatant is shown in FIG. The cell disruption solution was loaded with 1 μg protein per lane. Bands at molecular weights of about 22 KDa (arrow “α subunit”) and 26 KDa (arrow “β subunit”) indicate nitrile hydratase. From the results of SDS-PAGE, it was shown that pSJ042 and pSJH080 using the improved vector had improved enzyme production.

[Example 5] Preparation of Rhodococcus bacterium transformant having halohydrin epoxidase activity (1) Preparation of vector
(i) A vector containing a halohydrin epoxidase gene Corynebacterium sp. N-1074 (FERM BP-2643) was added to a MYKG medium (0.5% polypeptone, 0.3% bactoeast extract, 0.3% bactomalt extract, 1% glucose, 0.2% K ₂ HPO ₄ and 0.2% KH ₂ PO ₄ , pH 7.0) were cultured with shaking at 30 ° C. for 72 hours in 100 ml.
After the cultivation, the cells were collected and suspended in 4 ml of Saline-EDTA solution (0.1 M EDTA and 0.15 M NaCl (pH 8.0)). Next, 8 mg of lysozyme was added to the suspension, shaken at 37 ° C. for 1 to 2 hours, and then frozen at −20 ° C.

Next, thaw the frozen suspension and add 10 ml of Tris-SDS solution (1% SDS, 0.1 M NaCl and 0.1 M Tris-HCl (pH 9.0)) with gentle shaking. K (Merck) (final concentration 0.1 mg) was added and shaken at 37 ° C. for 1 hour to obtain a mixture.
Next, an equal amount of TE-saturated phenol (TE: 10 mM Tris-HCl and 1 mM EDTA (pH 8.0)) was added to the mixture and stirred, followed by centrifugation. After centrifugation, the upper layer was collected, twice as much ethanol was added, the precipitated DNA was wound up with a glass rod, rinsed in the order of 90%, 80%, and 70% ethanol to remove the remaining phenol.

The obtained DNA was dissolved in 3 ml of TE buffer. Next, ribonuclease A solution (100 ° C., heat-treated for 15 minutes) was added to the solution to 10 μg / ml, and the mixture was shaken at 37 ° C. for 30 minutes. Thereafter, proteinase K was added and shaken at 37 ° C. for 30 minutes, and then an equal amount of TE saturated phenol was added and centrifuged to separate the upper layer and the lower layer.
After repeating the operation from adding an equal amount of TE saturated phenol to the upper layer obtained until the upper layer and the lower layer were separated, adding an equal amount of chloroform (containing 4% isoamyl alcohol) to the upper layer obtained. And then separated into an upper layer and a lower layer (hereinafter, the above operation is also referred to as “phenol treatment”). Thereafter, twice the amount of ethanol was added to the upper layer, and the DNA was wound up and collected with a glass rod to obtain chromosomal DNA.

Using the obtained chromosomal DNA as a template, PCR was performed using the reaction solution composition and primers shown below.
(Reaction solution composition)
Chromosomal DNA (1/20 dilution) 10μl
10 × PCR Buffer (Takara Bio) 10 μl
Primer DH-04 (SEQ ID NO: 13) 1 μl
Primer DH-07 (SEQ ID NO: 14) 1 μl
2.5mM dNTP 8μl
Sterile water 69μl
ExTaq DNA polymerase (Takara Bio) 1μl
Total volume 100μl
(Primer)
DH-04: ggtctagaatggctaacggaagactggcaggc (SEQ ID NO: 13)
DH-07: cgcctgcaggctacaacgacgacgagcgcctg (SEQ ID NO: 14)

  After preparing the reaction solution, 30 cycles of a reaction in which one cycle was 93 ° C .: 30 seconds, 55 ° C .: 30 seconds, and 72 ° C .: 1 minute were performed. An approximately 0.7 Kb DNA fragment (SEQ ID NO: 16) encoding the halohydrin epoxidase gene was confirmed by electrophoresis.

  Next, the reaction solution was purified by GFX PCR DNA band and GelBand Purification kit (Amersham Bioscience), and subjected to restriction enzyme treatment with restriction enzymes XbaI and Sse8387I to cleave the PCR product. The PCR product subjected to the restriction enzyme treatment was subjected to electrophoresis on a 0.7% agarose gel, and a band around 0.7 Kb was recovered. The collected PCR product was ligated to the XbaI-Sse8387I site of vector pSJ034 using Ligation Kit (Takara Shuzo) to prepare vector: pJHB047. This pJHB047 is expressed in Rhodococcus bacteria as a fusion protein in which a 14-residue nitrilase protein is bound to the N-terminus of halohydrin epoxidase. FIG. 4 is a schematic diagram showing the structure of vector pJHB047.

Similarly, PCR was performed using primers DH-05 and DH-07, and a vector pJHB057 was constructed using the amplified 1.1 Kb PCR fragment (SEQ ID NO: 17). PCR was performed using the following reaction solution composition and primers.
(Reaction solution composition)
Chromosomal DNA (1/20 dilution) 10μl
10 × PCR Buffer (Takara Bio) 10 μl
Primer DH-05 (SEQ ID NO: 15) 1 μl
Primer DH-07 (SEQ ID NO: 14) 1 μl
2.5mM dNTP 8μl
Sterile water 69μl
ExTaq DNA polymerase (Takara Bio) 1μl
Total volume 100μl
(Primer)
DH-05: ggtctagaccgattactactccaacttcacca (SEQ ID NO: 15)
DH-07: cgcctgcaggctacaacgacgacgagcgcctg (SEQ ID NO: 14)
This vector was named pJHB057. FIG. 5 is a schematic diagram showing the structure of pJHB057.

(ii) Preparation of vector Next, pJHB057 was cleaved with restriction enzymes XbaI and Sse8387I, and a DNA fragment (SEQ ID NO: 17) containing about 1.1 Kb of halohydrin epoxidase gene was recovered by electrophoresis. Next, the reaction solution was purified with GFX PCR DNA band and GelBand Purification kit (Amersham Bioscience), and the recovered DNA fragment was ligated to the XbaI-Sse8387I site of vector pSJ042 using Ligation Kit (Takara Shuzo). Vector: pSJH101 was prepared. Similarly, vectors pSJ080 and pSJ081 were ligated to the XbaI-Sse8387I site to prepare vectors pSJH102 and pSJH103.

  Further, a DNA fragment (SEQ ID NO: 16) containing about 0.7 Kb of halohydrin epoxidase gene was recovered from the vector pJHB047 in the same manner and ligated to the XbaI-Sse8387I site of the vectors pSJ042, pSJ080, and pSJ081, and the vector: pSJH104 PSJH105 and pSJH106 were also produced.

Table 2 shows combinations of vectors derived from halohydrin epoxidase genes (hereinafter also referred to as “HheB” or “H-Lyase”) and vectors incorporating the HheB gene.

(2) Production of ATCC12674 Recombinant Bacteria and Vector Recovery Using the same method as in Example 3 (1) and (2), transformants of six vectors obtained above (Rhodococcus (Rhodococcus) rhodochrous) ATCC12674 / pSJH101, ATCC12674 / pSJH102, ATCC12674 / pSJH103, ATCC12674 / pSJH104, ATCC12674 / pSJH105, ATCC12674 / pSJH106).

  Next, culture was performed to prepare a vector from the prepared ATCC12674 recombinant bacteria. Inoculated into 100 ml of MY medium (0.5% polypeptone, 0.3% bacto yeast extract, 0.3% bacto malt extract, 1% glucose, 50 μg / ml kanamycin) and sterilized to a final concentration of 2% after 24 hours 20 % Glycine solution was added, and further cultured for 24 hours. After incubation, the cells are collected by centrifugation, washed with 40 ml TES buffer (10 mM Tris-HCl (pH 8), 10 mM NaCl, 1 mM EDTA), and then 11 ml of lysozyme solution (50 mM). The suspension was suspended in Tris-HCl (pH 8), 12.5% sucrose, 100 mM NaCl, 1 mg / ml lysozyme) and shaken at 37 ° C. for 3 hours. 1 ml of 10% SDS was added thereto, and the mixture was gently shaken at room temperature for 1 hour. Further, 1 ml of 5 M sodium acetate buffer (pH 5.2) was added, and the mixture was allowed to stand in ice for 1 hour. Thereafter, the supernatant was obtained by centrifugation at 10,000 × g for 1 hour at 4 ° C. Five times the amount of ethanol was added thereto, and the mixture was allowed to stand at −20 ° C. for 30 minutes, and then centrifuged at 10,000 × g for 20 minutes. The precipitate was washed with 30 ml of 70% ethanol and then dissolved in 100 μl of TE buffer to obtain a DNA solution. The obtained DNA solution was further purified by the following method using QIAprep Spin Miniprep Kit (Qiagen). The DNA solution was mixed with Buffer P1, the subsequent operation was performed according to the manual, and finally collected with 50 μl of sterilized water.

(3) Preparation of J-1 bacteria competent cell Rhodococcus rhodocrouse J-1 bacteria is Rhodococcus rhodocrouse J-1 (FERM BP-1478), National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center (East Tsukuba City, Ibaraki Prefecture) It is deposited at 1-chome, 1-address 1 and center 6).
Inoculate J-1 in 10 ml of MYKG medium (0.5% polypeptone, 0.3% bactoeast extract, 0.3% bactomalt extract, 0.2% KH ₂ PO ₄ , 0.2% K ₂ HPO ₄ , 1% glucose) Cultured at 30 ° C. After 17 hours, a 20% glycine solution sterilized to a final concentration of 2% was added, and further cultured for 24 hours. 2% of this culture was inoculated into 10 ml of MYKG medium containing 1% glycine, and further cultured at 30 ° C. for 48 hours. The culture was washed 3 times with sterile water and finally resuspended in 500 μl of sterile water. The obtained bacteria were used as competent cells.

(4) Transformation 1 μl of each vector prepared in (2) and 10 μl of J-1 bacterium competent cell prepared in (3) were mixed and ice-cooled for 30 minutes. A suspension of DNA and bacterial cells was placed in a cuvette and subjected to electric pulse treatment at 20 KV / cm and 100 OHMS using a gene introduction apparatus Gene Pulser (BIO RAD). The electric pulse treatment solution was allowed to stand for 10 minutes under ice-cooling, heat shocked at 37 ° C. for 10 minutes, and MYK medium (0.5% polypeptone, 0.3% bactoeast extract, 0.3% bactomalt extract, 0.2% K ₂ HPO ₄ , 0.2% KH ₂ PO ₄ ) (500 μl) was added and the mixture was allowed to stand at 30 ° C. for 24 hours. Thereafter, the mixture was applied to a MYK agar medium containing 10 μg / ml kanamycin and cultured at 30 ° C. for 3 days.
Confirming the vector of the obtained colony, six transformants (Rhodococcus rhodochrous J1 / pSJH101, J1 / pSJH102, J1 / pSJH103, J1 / pSJH104, J1 / pSJH105, J1 / pSJH106) were obtained. It was. In addition, J1 / pSJHB057 and J1 / pSJHB047 were also prepared as comparative controls.

[Example 6] Activity measurement of halohydrin epoxidase Rhodococcus rhodochrous J1 / pSJH101, J1 / pSJH102, J1 / pSJH103, J1 / pSJH104, J1 / pSJH105 obtained in Example 5 (4) J1 / pSJH106 in GGPK medium (1.5% glucose, 1% sodium glutamate, 0.1% bacto yeast extract, 0.05% K ₂ HPO ₄ , 0.05% KH ₂ PO ₄ , 0.05% MgSO ₄ · 7H ₂ O, kanamycin 50 μg / ml, pH 7.2) was inoculated into 100 ml and cultured with shaking at 30 ° C. for 72 hours. The cultured cells were washed with 50 mM Tris-sulfate buffer (pH 8.0) and crushed with an ultrasonic crusher in ice. The activity of halohydrin epoxidase was measured using the centrifuged supernatant of the disrupted cells as an enzyme solution. The protein concentration in each enzyme solution was adjusted to a fixed amount using a protein quantification kit (manufactured by BioRad).

  Add 1 ml of this enzyme solution (protein concentration: 30 mg / ml) to 50 ml of 300 mM Tris-sulfate buffer (pH 8.0), and add 1% (W / V) (= 77.5 mM). 1,3-Dichloro-2-propanol was added and reacted at 20 ° C. for 1 hour. The activity was measured by gas chromatography to determine the concentrations of 1,3-dichloro-2-propanol and produced epichlorohydrin. The analysis conditions are shown below.

Sample preparation method: Dissolve the sample in an equal amount of ethyl acetate Device: Column oven GC-17A manufactured by Shimadzu Corporation
Integrator C-R5A manufactured by Shimadzu Corporation
Column: ULBON HR-1701 manufactured by Shinwa Kako Co., Ltd. Carrier: He purity 99.995% or more Makeup gas: He purity 99.995% or more Detector gas: Hydrogen purity 99.995% or more Column temperature: 50 ° C. to 10 ° C. Increase the temperature gradually and hold at 250 ° C for 5 minutes Injection temperature: 250 ° C
Detector temperature: 250 ° C
Linear velocity: 35 cm / s
Retention time: 1,3-dichloro-2-propanol 10 min
Epichlorohydrin 5min

The results of measuring the activity of halohydrin epoxidase are shown in Table 3.

  Moreover, the result of SDS-PAGE using the microbial cell lysate supernatant is shown in FIG. The cell disruption solution was loaded with 1 μg protein per lane. The numbers on the left of each cell in Table 3 indicate the lane numbers of SDS-PAGE in FIG. Bands with molecular weights of about 32 KDa and 35 KDa indicate halohydrin epoxidase (arrow in FIG. 6). From the results of SDS-PAGE, it was shown that pSJH101, pSJH102, pSJH104 and pSJH105 using the improved vector had improved enzyme production.

As described above, pSJH101, 104 (from pSJ042), 102, and 105 (from pSJ080) using the improved vector are higher than those using pSJH103, 106 (from pSJ081) and the comparative vector. Hydrin epoxidase activity was observed.
Therefore, in consideration of the difference between the nitrilase gene promoters contained in pSJ080 and pSJ081, for example, a DNA comprising a base sequence represented by SEQ ID NO: 18 or a base sequence complementary to the base sequence represented by SEQ ID NO: 18 and stringent conditions It has been found that the promoter of the present invention, which hybridizes underneath and contains all or part of the DNA encoding a protein having promoter activity, can function in Rhodococcus bacteria. And it was shown that the vector which has a promoter of this invention is useful for the expression of the gene integrated under control of this promoter in Rhodococcus bacteria.

FIG. 4 is a construction diagram of vectors pSJ042, pSJ080, and pSJ081. It is a figure which shows a part (sequence number 21) of pSJ034 base sequence, and the position of a primer. It is a figure which shows the result of SDS-PAGE using the microbial cell lysate supernatant. It is a figure which shows the structure of vector pJHB047, pSJH104, and pSJH105. It is a figure which shows the structure of vector pJHB057, pSJH101, and pSJH102. It is a figure which shows the result of SDS-PAGE using the microbial cell lysate supernatant.

SEQ ID NO: 1: Nitrilase gene promoter region derived from SK92-B1 SEQ ID NO: 2: Amino acid sequence of expression control gene 1 SEQ ID NO: 3: Base sequence of expression control gene 1 SEQ ID NO: 4: Amino acid sequence of expression control gene 2 SEQ ID NO: 5 Base sequence of expression control gene 2 SEQ ID NO: 6: Primer NLR-09
Sequence number 7: Primer NR-14
Sequence number 8: Primer NR-15
Sequence number 9: Primer NR-16
SEQ ID NO: 10: PCR fragment about 0.8 kb
SEQ ID NO: 11: PCR fragment about 0.5 kb
SEQ ID NO: 12: PCR fragment about 0.3 kb
Sequence number 13: Primer DH-04
Sequence number 14: Primer DH-07
Sequence number 15: Primer DH-05
SEQ ID NO: 16: PCR fragment about 0.7 Kb
SEQ ID NO: 17: PCR fragment about 1.1 Kb
SEQ ID NO: 18: Nitrilase gene promoter of the present invention SEQ ID NO: 19: Amino acid sequence of halohydrin epoxidase SEQ ID NO: 20: Base sequence of halohydrin epoxidase SEQ ID NO: 21: Part of the base sequence of pSJ034 (FIG. 2)

Claims (9)

An expression vector for Rhodococcus bacteria, comprising a nitrilase gene promoter containing all or part of the following DNA (a) or (b):
(a) DNA comprising the base sequence represented by SEQ ID NO: 18
(b) DNA having a promoter activity that hybridizes with a DNA comprising a base sequence complementary to the base sequence represented by SEQ ID NO: 18 under stringent conditions An expression vector for Rhodococcus bacteria, comprising a nitrilase gene promoter containing all or part of the following DNA (a) or (b), a nitrilase expression regulatory gene, and a gene required for replication in Rhodococcus bacteria:
(a) DNA comprising the base sequence represented by SEQ ID NO: 18
(b) DNA having a promoter activity that hybridizes with a DNA comprising a base sequence complementary to the base sequence represented by SEQ ID NO: 18 under stringent conditions   The vector according to claim 1 or 2, further comprising an expression target gene.   The vector according to claim 3, wherein the expression target gene is linked downstream of the promoter so as to be expressed under the control of the promoter.   The vector according to claim 3 or 4, wherein the expression target gene is a nitrile hydratase gene.   The vector according to claim 3 or 4, wherein the expression target gene is a halohydrin epoxidase gene. The vector according to any one of claims 1 to 4, which is any vector selected from the group consisting of pSJ042, pSJ080, pSJH101, pSJH102, pSJH104 and pSJH105 shown in the following map.

  A Rhodococcus bacterium transformed with the vector according to any one of claims 1 to 7. A promoter containing all or part of the following DNA (a) or (b):
(i) DNA consisting of the base sequence represented by SEQ ID NO: 18
(ii) DNA having a promoter activity that hybridizes with a DNA comprising a base sequence complementary to the base sequence represented by SEQ ID NO: 18 under stringent conditions

Images