JP2008017777A - Diagnostic kit and diagnostic marker of hepatitis - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To develop a new diagnostic technique of hepatitis because the prediction/diagnosis of the condition of the hepatitis such as fulminant hepatitis is most important for carrying out proper therapy, but it is difficult to predict the condition of the hepatitis by a conventional technique using an expression level of a specific protein, or liver function as a criterion. <P>SOLUTION: The diagnostic kit and the diagnostic marker having high correlation with the condition and excellent accuracy enable the condition of the hepatitis including prognosis to be diagnosed precisely by quantitatively detecting the expression level of a mRNA of TGF-α in a tissue sample including blood by one-step RT-PCR or the like. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

  The present invention relates to a diagnostic kit and a diagnostic marker for diagnosing liver disease.

  The liver is an organ that has a wide variety of functions and plays an important role in maintaining homeostasis. The main functions of the liver are the synthesis and secretion of various plasma proteins, gluconeogenesis and glycogen metabolism Regulation, urea synthesis, bile secretion, metabolism to various drugs and nutrients (proteins, lipids, vitamins, hormones, etc.). When any of these functions is impaired, various symptoms peculiar to liver dysfunction such as overwork, malaise, loss of appetite, yellow bile and slight fever appear. Causes of liver dysfunction include liver diseases such as viral hepatitis, fulminant hepatitis, cirrhosis, and liver cancer.

  The most common liver disease is various hepatitis. As the cause of hepatitis, hepatitis virus and chemical substances are best known, but in Japan, most of hepatitis is caused by hepatitis virus. The prognosis is generally better for younger people, but it is known that 3% -6% shift to fulminant hepatitis, and nearly several tens% progress to cirrhosis and further to liver cancer.

  As the main hepatitis viruses, hepatitis A virus, hepatitis B virus, hepatitis C virus and hepatitis E virus are known, and the existence of an unknown hepatitis virus which does not belong to any of them is also suggested. . Progressing to fulminant hepatitis occurs in the order of type C and type B, and type A is extremely rare. It is also known that when a pregnant woman is infected with hepatitis E virus, the frequency of fulminant hepatitis is high.

  Hepatitis B caused by hepatitis B virus (HBV) is a viral disease that occurs frequently especially in tropical Africa, Southeast Asia and the Far East, and includes acute self-limited infection, life-threatening fulminant hepatitis, and cirrhosis. Includes chronic hepatitis that can progress to primary liver cancer and lead to liver failure. The number of chronically infected HBV carriers is estimated to be 200 million worldwide, of which about 15% are thought to progress to liver cancer. The treatment of acute or chronic hepatitis B is currently inadequate, and symptomatic treatment is mainly used to maintain the physical strength of the patient. In addition, interferon (IFN) -β which is an antiviral agent is used. Is also administered.

  On the other hand, hepatitis C due to hepatitis C virus, which accounts for most of the onset of hepatitis in Japan, often progresses asymptomatically, more than half become chronic, with high probability of malignancy such as cirrhosis and liver cancer It is known to progress to other diseases. Among chronic hepatitis C, chronic active hepatitis in which portal vein inflammation has reached the parenchymal area can be alleviated by administering IFN to reduce hepatitis C virus Since 1992, IFN therapy has been actively performed since 1992. This IFN therapy is approved only for chronic active hepatitis, and a liver biopsy for confirmation is performed before IFN therapy. Furthermore, the determination of the effect after IFN therapy is based on the decrease in GPT (Glutamic-pyruvic transaminase) and the presence or absence of virus, but to examine the recovery of the tissue image from the liver tissue side The only way to do this is to perform a liver biopsy. However, hepatic biopsy requires skilled techniques and is both painful and painful for the patient. It also includes the risk of sampling errors. Therefore, at present, liver biopsy is not performed in many of the determinations of the effect after IFN therapy, and it is difficult to accurately determine the prognosis after IFN therapy.

  Fulminant hepatitis refers to acute hepatitis in which hepatocytes undergo extensive and rapid necrosis during the course, and is known as a disease with a high mortality rate that causes severe liver dysfunction. According to the diagnostic criteria, fulminant hepatitis refers to “having hepatic coma based on severe liver dysfunction within about 8 weeks after the onset of hepatitis symptoms and showing a prothrombin time of 40% or less”. . About 90% of the causes are said to be hepatitis viruses, but there are many complicated and unknown points. In addition to hepatitis A, B and C, the effects of hepatitis E virus and unknown hepatitis viruses Has been suggested. Regarding the prognosis, it is known that the result of hepatitis C virus is the worst. Fulminant hepatitis includes an acute type that develops within 10 days after the onset of symptoms of hepatitis and a subacute type that develops after 11 days, and more than 30% of fulminant hepatitis is acute. Although the subacute type has a higher mortality rate than the acute type, it is difficult to predict early due to clinical symptoms and laboratory findings. Conventional treatment methods for fulminant hepatitis include plasma exchange, exchange transfusion, and combined administration of glucagon and insulin to remove toxic substances caused by liver failure and supply lost essential substances. However, when these usual medical treatments are performed, the survival rate is 20% to 40%, and the improvement is hardly seen.

  Regarding the diagnosis of hepatitis, for example, bilirubin levels, GOT (Glutamic-oxaloacetic transaminase), GPT, serum cholinesterase, total cholesterol, serum albumin, ammonia and other liver function indicators and clinical markers are common. It is used for.

  In addition to indicators of liver function, hepatitis virus markers such as hepatitis virus proteins are used in viral hepatitis in acute / chronic discrimination, prediction of therapeutic effects, and prognosis. In fulminant hepatitis, blood findings such as an increase in white blood cells and a decrease in platelets, blood coagulation tests such as prothrombin time, serum electrolytes, plasma free amino acids and the like are also used for diagnosis. In addition, since the growth factor receptor and its ligand involved in hepatocyte proliferation are important in the pathogenesis of fulminant hepatitis, EGFR (Epidermal Growth Factor Receptor), c-met, which is a growth factor receptor present in hepatocytes. , And TGF-α (Transforming Growth Factor-α), HGF (Hepatocyte Growth Factor), VEGF (Vascular Endothelial Growth Factor), which are ligands of these receptors, and hTERT (human Telomerase Reverse Transcriptase having an important function for cell life) ) And other proteins have been suggested to be associated with hepatitis. For example, Non-Patent Document 1 describes an acute / chronic determination method for hepatitis using the blood protein concentration of TGF-α. .

  On the other hand, Patent Document 1 describes that mRNA in blood is used in tumor diagnosis.

T. TOMIYA et al., “Liver Regeneration in Fulminant Hepatitis as Evaluated by Serum Transforming Growth Factor α Levels”, Hepatology, 1996; 23: 253-257 International Publication WO2005 / 049864

  In conventional medical treatments for fulminant hepatitis, the survival rate is 20% -40%. However, when liver transplantation is performed, the survival rate improves to 90% or more, so the prognosis of fulminant hepatitis is improved at an early stage. If it becomes possible to diagnose, it becomes possible to switch the treatment method to liver transplantation and the like without continuing ineffective treatment, and the possibility of survival of the patient can be increased. However, it has been difficult to predict the pathology of hepatitis. This is because conventional diagnostic techniques using liver function or marker protein concentration as an index have problems in terms of sensitivity and correlation.

  On the other hand, depending on the disease, mRNA was known as a diagnostic marker having a higher correlation with the disease state than protein, but since mRNA is degraded and unstable by RNase, only specific mRNA can be measured stably. It was not done.

  In view of such circumstances, development of new diagnostic kits and diagnostic markers for diagnosis of pathological conditions including prognosis has been desired.

  According to the present invention, there is provided a diagnostic kit for diagnosing hepatitis in a mammal, comprising a detection reagent for quantitatively detecting mRNA encoding TGF-α in a tissue sample obtained from the mammal. And a diagnostic kit in which the expression level of TGF-α mRNA serves as an index for the diagnosis of hepatitis. This diagnostic kit can perform a diagnosis highly correlated with the pathological condition of hepatitis by using TGF-α mRNA as an index.

  Moreover, according to this invention, the diagnostic marker for diagnosing hepatitis containing mRNA which codes TGF- (alpha) is provided. Since this diagnostic marker can use TGF-α mRNA as an index, it can be used as a marker highly correlated with the pathology of hepatitis.

  The present invention makes it possible to make a diagnosis highly correlated with the pathology of hepatitis.

FIG. 1 is a diagram for explaining primer sequences. FIG. 2 is a diagram for explaining the sequence of TGF-α. FIG. 2 is a diagram for explaining the sequence of TGF-α.

  “Mammal” according to the present embodiment refers to any mammal, and includes humans, livestock animals, pet animals, zoo animals, or sports animals such as dogs, cats, cows, pigs, horses, Includes sheep, rabbits, etc. The mammal is preferably a human.

  “TGF-α” (Transforming Growth Factor-α) according to the present embodiment refers to a polypeptide encoded by the nucleotide sequence shown in FIG. 2 and FIG. 3 or SEQ ID: 4 as cDNA. Also included are gene polymorphisms, gene variants or splicing variants of peptides. TGF-α is a cytokine exhibiting a proliferative action of epithelial cells and the like, and at the same time plays an important role as a cancer exacerbation factor involved in angiogenesis in several cancers such as liver cancer. In addition, the ErbB receptor family has been identified as its receptor, and it has been clarified that the receptor is also involved in an important signal in cancer.

  The “index of diagnosis of hepatitis” according to the present embodiment includes, for example, onset of hepatitis, transition to acute hepatitis / chronic hepatitis / fulminant hepatitis / cirrhosis, observation / evaluation of treatment results, prognosis, early diagnosis / early prediction It is an index used for various diagnoses of hepatitis, such as understanding the pathological condition and estimating the degree of liver damage such as liver failure. The above-described symptoms and parameters representing the symptoms related to evaluating the successful treatment and improvement in the disease can be easily measured by routine techniques well known to physicians in this technical field.

  Here, “prognosis” refers to the outlook including life and death of the patient after treatment for the disease.

  According to the diagnostic criteria, “fulminant hepatitis” according to this embodiment is “hepatic coma based on severe liver dysfunction within about 8 weeks after the onset of hepatitis symptoms, and a prothrombin time of 40%. It means “the following”. Fulminant hepatitis refers to acute hepatitis in which hepatocytes undergo extensive and rapid necrosis during the course, and is known as a disease with a high mortality rate that causes severe liver dysfunction. Fulminant hepatitis is about 1% of acute hepatitis, and about 4000 cases occur annually. The gender ratio is almost the same in all ages, but it is particularly common in the 20s and 50s. It is a feature. About 90% of the causes are said to be hepatitis viruses, but there are many complicated and unknown points. In addition to hepatitis A, B and C, the effects of hepatitis E virus and unknown hepatitis viruses Has been suggested. Regarding the prognosis, it is known that those caused by hepatitis C virus are bad. The details of the mechanism of fulminant hepatitis are unknown, but severe inflammation in the liver such as hepatocyte necrosis due to excessive antibody production and cellular immunity to hepatocytes by T cells, followed by the Shwartzman reaction, It is understood as the apoptosis of hepatocytes and the resulting failure of hepatocyte regeneration.

  Fulminant hepatitis includes an acute type that develops within 10 days after the onset of symptoms of hepatitis and a subacute type that develops after 11 days, and more than 30% of fulminant hepatitis is acute. Although the subacute type has a higher mortality rate than the acute type, it is difficult to predict early due to clinical symptoms and laboratory findings. Symptoms include hepatic coma in most cases, as well as progressive jaundice, strong general malaise and loss of appetite, nausea, vomiting, hepatic halitosis, fever, bleeding tendency, edema, ascites, oliguria, Complications such as diminished hepatic sound field, flapping tremor, and disseminated intravascular coagulation syndrome, gastrointestinal bleeding, infection, renal failure, and brain edema are major clinical findings.

  Conventional treatment methods for fulminant hepatitis include removal of addictive substances caused by liver failure, plasma exchange, exchange transfusions, and combined administration of glucagon and insulin to supplement lost essential substances. However, when these usual medical treatments are performed, the survival rate is 20% to 40%, and the improvement is hardly seen. However, when liver transplantation is performed, the survival rate improves to 90% or more, so if it becomes possible to diagnose the prognosis of fulminant hepatitis at an early stage, liver therapy, etc. without continuing invalid treatment It is possible to change the treatment method to increase the possibility of survival of the patient. Therefore, development of more effective diagnostic methods including prognosis diagnosis is required.

  The “oligonucleotide” according to the present embodiment refers to a nucleotide or nucleoside monomer oligomer or polymer comprising a naturally occurring base, sugar and intersugar linkage. The oligonucleotide according to this embodiment also includes a non-naturally occurring monomer that functions in the same manner, a monomer labeled with a fluorescent molecule or a radioisotope, or an oligomer or polymer including a portion thereof.

  “Identity” according to this embodiment refers to a relationship between two or more polynucleotides determined by comparing sequences, and “identity” in this embodiment refers to a sequence between polynucleotide sequences. Means the degree of sequence identity between polynucleotide sequences as determined by fit. Parameters relating to “identity” can be easily calculated by known methods. The method for calculating the parameters related to identity is coded in a publicly available program. As such a program, for example, BLAST (Basic Local Alignment Search Tool) program (for example, Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ., J. Mol. Biol., 215: p403-) by Altschul et al. 410 (1990), Altschyl SF, Madden TL, Schaffer AA, Zhang J, Miller W, Lipman DJ., Nucleic Acids Res. 25: p3389-3402 (1997)). When software such as BLAST is used, the default value is preferably used, but is not limited thereto.

  Hereinafter, embodiments of the present invention will be described.

  An embodiment of the present invention is a diagnostic kit for diagnosing hepatitis in a mammal, obtaining a tissue sample from the mammal, and using the detection reagent in the obtained tissue sample, TGF-α mRNA is obtained. It is a diagnostic kit that is quantitatively detected and the mRNA expression level is used as an index for the diagnosis of hepatitis. According to this diagnostic kit, the pathological condition of hepatitis can be grasped. Conventionally, diagnosis of hepatitis is acute, self-limited or chronic, diagnosis of progression to fulminant hepatitis, diagnosis of responsiveness to IFN therapy, diagnosis of therapeutic effects and prognosis of various hepatitis Although it was difficult to predict, this diagnostic kit can predict or monitor the therapeutic effect and provide a more effective therapeutic method.

  The mRNA used for diagnosis with this diagnostic kit is quantitatively more sensitive than protein, and can be detected with high sensitivity even in trace amounts. In addition, the conventional diagnostic technique using protein concentration in the diagnosis of hepatitis is not highly correlated with the pathological condition, and furthermore, the change in protein amount is slower than the change in mRNA amount. There is no high correlation with symptom changes and predictions, and even when the TGF-α protein is actually used as an index, the correlation with the pathology of hepatitis is not high.

  As described above, diagnosis using mRNA is more accurate and advantageous than diagnosis using a conventional protein. However, RNA is degraded by RNase, so that stable and quantitative detection is possible in certain cases. It is limited to RNA, and not all RNA can be diagnosed using mRNA. In one embodiment of the present invention, TGF-α is found as mRNA that can be stably quantitatively detected, and diagnosis is performed using the amount of mRNA of TGF-α, whereby the diagnostic kit according to this embodiment provides a pathological condition of hepatitis. And has a remarkable effect of showing high correlation. Furthermore, by grasping the pathology of hepatitis using the diagnostic kit according to the present embodiment, it becomes possible to identify various pathologies between hepatitis and is useful for designing an appropriate treatment plan.

  A further embodiment is a diagnostic kit for fulminant hepatitis, which can be used, for example, to provide indicators relating to, for example, transition to fulminant hepatitis, observation of treatment results for fulminant hepatitis, prognosis, and estimation of the degree of liver damage. Can be obtained. The diagnostic kit according to the present embodiment is suitable for diagnosis of acute symptom such as fulminant hepatitis because mRNA with high immediacy of change is used as an index.

  Further, another embodiment is a diagnostic kit using TGF-α mRNA as an index of prognosis of hepatitis. By using this diagnostic kit having a high correlation with the prognosis of hepatitis, Observation of treatment results and prediction of transplantation cases, death cases, and survival cases are facilitated. In this diagnostic kit, the prognosis is diagnosed when the expression level of TGF-α mRNA is high. Conventionally, there is no known index for accurately diagnosing the prognosis of fulminant hepatitis, and the diagnostic kit according to the present embodiment is particularly effective for improving the prognosis of patients with fulminant hepatitis.

  Another further embodiment is a diagnostic kit that can use blood as a tissue sample. In hepatitis, TGF-α mRNA is effluxed in the blood due to its inflammatory reaction, and the mRNA is stable in blood for more than 24 hours. It becomes possible. By using blood, non-invasive examinations that do not rely on liver biopsy are possible, and diagnosis can be performed quickly and easily using a method that is convenient for the patient. When blood is used as a sample, for example, by performing an appropriate centrifugation operation on the blood, serum that has been reduced to a negligible amount of lymphocytes can be obtained, and mRNA detection reagent can be reacted to the serum. This can be implemented, but is not limited to this.

  In further embodiments, additional processing operations may be added to serum obtained from blood. Examples of such treatment operations include DNA removal by deoxynuclease treatment, oligo (dT) -immobilized cellulose column method (Molecular Cloning Second Edition), oligo dT latex method, fast track mRNA isolation. Examples include, but are not limited to, preparation of mRNA using a kit (Invitrogen), a quick prep mRNA purification kit (Pharmacia), or the like.

  In addition, the sample in the above embodiment is blood, but in other embodiments, an RNA extraction reagent from a solid sample such as TRIzol reagent (Invitrogen) is used based on hepatocytes / liver tissues. It is also easy for those skilled in the art to prepare a sample and detect TGF-α mRNA.

  A further embodiment is a diagnostic kit for detecting TGF-α mRNA by RT-PCR using a set of oligonucleotide primers as a detection reagent. By using a PCR reaction, which is an amplification reaction, as a detection means, detection with higher sensitivity is possible, and detection of a minute amount and diagnosis with higher accuracy are possible than when protein or liver function is used as an index.

  Primers used in this RT-PCR are TGF-α mRNA based on the cDNA shown in FIG. 2 and FIG. 3 or SEQ ID: 4 or the DNA corresponding to the polypeptide encoded by them, or their complementary strands. More preferably, the primer itself contains a TGF-α specific sequence so as to generate a PCR product (in chain length or sequence) that is preferably TGF-α specific, so that it can hybridize and perform a PCR reaction. As designed. Such primers can be easily designed by those skilled in the art by using a program such as BLAST and a database. In this case, the 3'-side region of the primer is preferably complementary to TGF-α mRNA, but a restriction enzyme recognition sequence, a tag or the like can be added to the 5'-side. The primer is usually designed to have a chain length of 15 bp-100 bp, preferably 15 bp-35 bp.

  Using the primers designed as described above, a step of generating cDNA from a sample containing mRNA by reverse transcriptase, a step of amplifying a PCR product from the cDNA by PCR, and a step of detecting the PCR product Thus, diagnosis using RT-PCR can be performed. A person skilled in the art can easily adjust the conditions such as the temperature and the ionic strength under suitable conditions by adapting to factors such as the probe length by a known method.

  In a further embodiment, the expression level of TGF-α mRNA is quantitatively determined by RT-PCR using a pair of oligonucleotide primers represented by FIG. 1 or SEQ ID: 1 and SEQ ID: 2. Diagnostic kit to detect. The diagnostic kit according to the present embodiment makes it possible to reliably detect TGF-α mRNA by performing RT-PCR using these oligonucleotide primers that react with specificity to TGF-α mRNA. There is an effect.

  A further embodiment is a diagnostic kit for detecting TGF-α mRNA by real-time RT-PCR. By using real-time PCR, mRNA can be detected easily, in real time, and quantitatively in a single step or a short number of steps. As the real-time RT-PCR, for example, various fluorescent PCR-based techniques can be used. Examples of fluorescent PCR-based techniques include intercalator methods using various fluorescent nucleic acid labeling agents such as SYBR GREEN I (for example, LightCycler (registered trademark: Roche), ABI Prizm 7700 Sequence Detection System (registered trademark)). (Using Perkin Elmer, Applied Biosystems), TaqMan probe method for monitoring amplification in real time using 5 ′ exonuclease activity of Taq DNA polymerase enzyme, RNase activity of RNase H enzyme and dedicated chimeric RNA probe Examples include, but are not limited to, cycling probe methods.

  Another further embodiment is a diagnostic kit for detecting TGF-α mRNA by microarray analysis using an oligonucleotide probe as a detection reagent and a chip. By using microarray analysis, multifaceted simultaneous analysis including many factors such as other pathological genes and simple analysis are possible. The microarray according to this embodiment can be provided by a method including a step of immobilizing oligonucleotide probes on a chip.

  The probe used in the microarray analysis is a partial sequence of cDNA of TGF-α shown in FIG. 2 and FIG. 3 or SEQ ID: 4, a partial sequence of corresponding mRNA, a sequence complementary thereto, or a sequence that hybridizes with them. Designed from any oligomer, including The probe is designed to be an oligonucleotide having a chain length of at least 15 bp. The designed probe is synthesized and provided using techniques such as PCR and nucleic acid chemical synthesis. The microarray includes one or two or more arbitrary probes per spot, and one or two or more TGF-α mRNA oligonucleotides are included in any spot. This probe may be fixed to the microarray chip by physical bonding or chemical bonding.

  The microarray chip material may be all known types of substances, preferably those used in ordinary microarrays, reactive groups capable of immobilizing oligonucleotides on the chip surface, nitrocellulose or 3 Subsequent structure formation may be further included. For example, silicon wafers, glass, polycarbonate, membranes, polymer films such as polystyrene or polyurethane, and porous materials are used. The probe can be fixed by a method used in a normal microarray manufacturing method, for example, a photolithography method, a piezoelectric printing method, a micropipetting method, or a spotting method.

  The probe described above can be immobilized at 2 pg to 100 pg per spot on the microarray. Further, the number of spots on the microarray may be 1 or more, preferably 2 to 3 times. At this time, for example, the spot may have a diameter of 50 μm to 500 μm and the spot interval may be 10 μm to 500 μm. However, it is preferable to appropriately adjust the size and density of the spot according to the resolution of the microarray analysis system. The microarray according to the present embodiment is installed in a well of a microwell plate, for example, a 96-well plate, and sample molecules, labels, and hybridization are performed using automatic equipment (Biomek, Genetix robo, etc.) using an existing 96-well plate It is also possible to process the cleaning process mechanically.

  Another further embodiment uses a diagnostic probe to detect TGF-α mRNA by performing in situ hybridization on a sample such as liver tissue, liver cell or blood cell using an oligonucleotide probe as a detection reagent. It is a kit. Combined with liver biopsy before or after treatment or at the time of treatment, hepatitis can be diagnosed and analyzed in more detail and in many ways. In situ hybridization is effective for detecting nucleic acid sequences and detecting localization in cells or tissues.

  In situ hybridization follows, for example, the protocol of Lu and Gillett, Cell Vision 1: 169-176 (1994) or, for example, INFORM (R) (Ventana) or PATHVISION (R) (Bissis). However, the present invention is not limited to this.

  An example of the method is briefly described below. After formalin fixation, the paraffin-embedded tissue was sectioned, deparaffinized, deproteinized with proteinase K (20 g / ml) for 15 minutes at 37 ° C., and as described in the above-mentioned Lu and Gillett literature. To process for in situ hybridization. Finally, various labeled nucleotide probes are hybridized to the tissue at 55 ° C. overnight and the slides are immersed in Kodak NTB2 nuclear track emulsion and exposed for 4 weeks to obtain an analytical image. The above description is an example, and those skilled in the art can adjust various conditions (temperature, time, concentration, etc.) as necessary, and perform appropriate steps (fixing method (frozen section method, methanol fixation method, etc.), development. Appropriate in situ hybridization can be performed.

  Regarding the labeling of the probe, for example, radioactive labels such as α-33P, various fluorescent labels (FISH method: refer to International Publication 98/45479 published in October 1998) or dye labels (“hydroxy peroxidase (HRP) etc.) Or a chromogenic substrate such as diaminobenzidine). Regarding the labeling of the probe, those skilled in the art can carry out any labeling according to the method of using various labeling reagents and kits or the usual method. Further, as counterstaining, for example, nuclear staining such as hematoxylin or antibody staining may be further added.

  The probe may be any oligomer containing the TGF-α cDNA partial sequence shown in FIG. 2 and FIG. 3 or SEQ ID: 4, the corresponding mRNA partial sequence, a sequence complementary thereto, or a sequence hybridizing therewith. Designed from The designed probe is synthesized and provided using techniques such as PCR and nucleic acid chemical synthesis.

  In general, the longer the probe chain length, the higher the temperature required for proper annealing, and the shorter the probe chain length, the lower the required temperature. The higher the degree of homology desired between the probe and the hybridization sequence, the higher the relative temperature that can be used. As a result, higher relative temperatures will make the reaction conditions more stringent and lower temperatures will reduce stringency. (See Ausubel et al., Current Protocols in Molecular Biology (Wiley Interscience Publishers, 1995) for stringency of hybridization reactions.)

  Another further embodiment is a diagnostic kit for detecting TGF-α mRNA by Northern blot analysis using an oligonucleotide probe as a detection reagent. By using Northern blot analysis, mRNA can be analyzed without the need for special equipment or reagents. Northern blotting can be performed, for example, according to the protocol of Thomas, Proc. Natl. Acad. Sci. USA, 77: 5201-5205 (1980). It is also possible to adjust the temperature, time, concentration, etc.) and select / add an appropriate process. The probe used in the Northern blot method and the label thereof can be carried out in the same manner as described above for the probe used in the microarray.

  In addition to the above-described embodiments, various in vivo assays can be used as means for detecting TGF-α mRNA. For example, a cell or body fluid in a patient's body is exposed to an oligonucleotide probe with a detectable label, such as a radioisotope, and the binding of the oligonucleotide probe to the cell or body fluid is, for example, a radioactive external scan. It can also be evaluated by ning or biopsy.

  In any of the above embodiments, or an antibody or RNA capable of recognizing TGF-α mRNA, RNA duplex containing the mRNA, DNA-RNA hybrid duplex or RNA-protein duplex It is also possible to detect TGF-α mRNA using other compounds capable of recognizing and is within the technical scope of the present invention.

  Another embodiment according to the present invention is a manufactured product including the diagnostic kit according to the present invention. The article of manufacture includes a container and a label or package insert attached to the container. Containers include, for example, bottles, vials, syringes, etc., and are selected from suitable materials such as glass or plastic. The container may contain a composition containing a diagnostic kit according to the present invention, and may optionally have a sterile access port (eg, an intravenous solution vial having a stopper pierceable with a hypodermic needle. May be). The label or package insert indicates that the composition is used for the diagnosis of hepatitis. The label or package insert further includes precautionary notes for use in diagnosis. The article of manufacture may further comprise additional containers containing control samples, various buffers, diluents, filters, needles, syringes, bacteriostatic water (BWFI) for injection, and the like.

  Another embodiment of the present invention is a new diagnostic marker for hepatitis using the amount of TGF-α mRNA as an index, and it is possible to grasp the pathological condition of hepatitis by this diagnostic marker. Conventionally, diagnosis of hepatitis is acute, self-limited or chronic, diagnosis of progression to fulminant hepatitis, diagnosis of responsiveness to IFN therapy, diagnosis of therapeutic effects and prognosis of various hepatitis Although the prediction is difficult, it is possible to predict or monitor the therapeutic effect by this diagnostic marker, and to provide a more effective treatment method.

  The mRNA used for this diagnostic marker is quantitatively more sensitive than the protein. In addition, since the change in the amount of protein is slower than the change in the amount of mRNA, diagnosis based on the amount of protein is not highly correlated with sudden changes in symptom or prediction thereof, and actually TGF-α protein was used as an index. In some cases, the correlation with the pathology of hepatitis is not high.

  As described above, diagnostic markers using mRNA are more advantageous than diagnostic markers using conventional proteins. However, stable quantitative detection is limited to specific RNA, and mRNA can be detected for all RNA. Is not used as a diagnostic marker. In the present embodiment, TGF-α was found as mRNA that can be stably quantitatively detected. By using the amount of TGF-α mRNA as a diagnostic marker, the diagnostic marker according to this embodiment has a remarkable effect of showing high correlation with the pathology of hepatitis. Furthermore, by grasping the pathology of hepatitis using the diagnostic marker according to the present embodiment, it becomes possible to identify various pathologies between hepatitis, which is useful for designing an appropriate treatment plan.

  Another further embodiment is a new diagnostic marker for fulminant hepatitis using the amount of TGF-α mRNA as an index, and for example, the transition to fulminant hepatitis, treatment of fulminant hepatitis It is possible to make a diagnosis regarding observation of results, prognosis, estimation of the degree of liver damage, and the like. In addition, since the diagnostic marker according to the present embodiment uses mRNA with high immediate change as an index, it is suitable for diagnosis of acute symptoms such as fulminant hepatitis.

  Another further embodiment is a new diagnostic marker for fulminant hepatitis using the amount of TGF-α mRNA as a prognostic diagnostic index, and by using this diagnostic marker highly correlated with the prognosis of hepatitis. After treatment of various hepatitis, observation of treatment results and prediction of transplantation cases, death cases, and survival cases are facilitated. With this diagnostic marker, a high prognosis is diagnosed when the expression level of TGF-α mRNA is high. Conventionally, there is no known diagnostic marker for accurately diagnosing the prognosis of fulminant hepatitis, and the diagnostic marker according to this embodiment is particularly effective for improving the prognosis of patients with fulminant hepatitis.

  In addition, the diagnostic kit and diagnostic marker demonstrated by the said embodiment do not limit this invention, and are disclosed with the intention of illustrating. The technical scope of the present invention is defined by the description of the scope of claims, and those skilled in the art can make various design changes within the technical scope of the invention described in the scope of claims. For example, detection of TGF-α mRNA may be achieved by dot blotting or various modified PCR methods, and it goes without saying that such diagnostic kits and diagnostic markers are included in the technical scope of the present invention. Nor.

  EXAMPLES Hereinafter, although an Example demonstrates this invention concretely, this is an example and this invention is not limited to these. The commercially available reagents mentioned in the examples were used according to the manufacturer's instructions unless otherwise indicated.

Examples Acute hepatitis (AH), 9 severe hepatitis (SH), fulminant hepatitis, approved by Tottori University Medical Hospital, Iwate Medical University Hospital, Saitama Medical University Hospital for the period 2000-2005 (FH) A test was conducted on 28 people. The average patient age was 53 years (18 to 89 years).

  In conducting this study, informed consent was obtained from the patient, and the study protocol (plan) was in accordance with the ethical guidelines of the 1975 Declaration of Helsinki and was approved by the Ethics Committee of Tottori University. The test was conducted.

  In this example, first, blood of a subject (patient) was collected, and then a sample containing RNA was obtained from the blood.

  More specifically, lymphocytes were reduced by performing three-stage centrifugation (800 × g, 1000 × g, 1500 × g) for 10 minutes at 10 ° C. on blood collected from patients (about 1-2 mL). Serum was obtained and used as a test sample. The effective removal of lymphocytes was confirmed by examining the expression levels of CD2, CD3, CD8, CD19, CD22 and CD68 using β2-microglobulin as a control. Subsequently, RNA was extracted from serum using a deoxyribonuclease treatment by a conventionally known method. RNA extracted from 200 μL of serum was dissolved in 200 μL of nuclease-free water.

  Next, 2 μL of SYBR Green I (Roche) was used as a fluorescent agent for 1 μL of the sample, and real-time RT-PCR was performed using a one-step RT-PCR kit (Qiagen). Β2-microglobulin RNA was used as a PCR control sample.

  The nucleotide sequences of the primer and target TGF-α cDNA used in this experiment are shown in FIG. 1, FIG. 2, FIG. 3, or SEQ ID: 1, SEQ ID: 2 and SEQ ID: 4, respectively.

  As a primer set for detecting TGF-α, an upstream primer (CCTGTTCGCTCTGGGTATTG, SEQ ID: 1) and a downstream primer (GTTGCATGGAAGCAGAACTG, SEQ ID: 2) were used. As shown in FIG. 1, the upstream primer is set in the forward direction (5 ′ → 3 ′) of the target base sequence, and the downstream primer is complementary in the reverse direction (3 ′ → 5 ′) of the target base sequence. It is set by the base sequence.

  For comparison purposes, primer sets were designed for EGFR, HGF, c-met, and hTERT as in the case of TGF-α.

  The conditions for real-time PCR are that the initial reverse transcription reaction is carried out at 50 ° C. for 30 minutes, and then kept at 95 ° C. for 12 minutes as a reaction activation stage. Thereafter, the PCR reaction is repeated 50 cycles (95 ° C. (0 seconds), 55 ° C. (10 seconds), 72 ° C. (15 seconds)), and heat-denatured at 40 ° C. for 20 seconds.

  This RT-PCR analysis was repeated twice, and quantification was performed using a light cycler (registered trademark: Roche), and it was confirmed that there was repeated reproducibility.

Various statistical analyzes were performed using SPSSII (SPSS) based on the numerical data of the mRNA expression level obtained by RT-PCR. The stratification classification in each clinical factor was evaluated by the multivariate analysis method for the numerical data of each mRNA expression level using a logical regression analysis model. Analysis using RNA control showed a strong linear relationship between copy number and PCR cycle under the conditions of this example. (R ² > 0.99)

In addition, prognosis and clinical parameters were used as pathological conditions. As for the prognosis, an example of recovery from fulminant hepatitis was regarded as good prognosis (1), and an example of death from fulminant hepatitis was regarded as poor prognosis (2). Clinical parameters include PT (Prothorombin Time), TB (Total Bilirubin), DB (Direct Bilirubin), AST (Asparate aminotransferase, GOT), ALT (Alanine aminotransferase, GPT), AFP ( α-FetoProtein, α-fetoprotein), NH ₃ (ammonia), WBC (White Blood Cell count, white blood cell count), and PLT (Platelet count, platelet count) were used. Moreover, the protein expression level of HGF was detected by ELISA as a diagnostic marker (comparative example) of the expression level of a protein not using RNA.

  Among fulminant hepatitis cases, those with no missing value were targeted, and P values in each test were calculated in order to investigate the correlation between the amount of each mRNA and the prognosis. When the P value is 0.05 or less, it can be considered that there is a statistically significant difference. Mann-Whitney U test or t test was used for calculation of P value. The Mann-Whitney U test is a parametric version of the t test that replaces data with ranks and compares the sums by a method of testing the difference between two unmatched groups. The t-test is a test relating to the average of two populations, and is a test performed by regarding how far the sample average is, assuming that the population distribution is normally distributed. The rank information used for the U test is shown in Table 1, the test result of the U test is shown in Table 2, the group information used in the t test is shown in Table 3, and the test result of the t test is shown in Table 4.

  When Mann-Whitney U test was performed, there was a significant correlation between TGF-α mRNA in survival cases and death cases. (P = 0.0455) At this time, TGF-α mRNA was higher in the surviving cases. On the other hand, EGFR mRNA, HGF mRNA, c-met mRNA, and hTERT mRNA did not show a significant correlation with prognosis. (P = 0.3670, 0.1009, 0.8855, 0.9449, respectively)

Next, when a t-test was performed, a correlation was observed between surviving cases and dead cases in TGF-α mRNA. (P = 0.0428) At this time, the amount of TGF-α mRNA in the surviving cases was about 6 × 10 ²³ times higher than that in the dead cases. On the other hand, EGFR mRNA, HGF mRNA, c-met mRNA, and hTERT mRNA did not show a significant correlation with prognosis. (P = 0.4356, 0.3670, 0.5901, 0.6271 respectively)

  Next, in order to examine the correlation between some clinical parameters and the amount of each mRNA for all test examples, the P value in each test was calculated. When the P value is 0.05 or less, it can be considered that there is a statistically significant difference. In calculating the P value, a Firedman test was performed between lesions, and a Spearman test was used for correlation with clinical parameters and prognosis. The Friedman test is a non-parametric version of the two-way ANOVA without repetition. The Spearman test is a non-parametric test in which data is replaced by rank in a method of testing between groups that do not follow a normal distribution. The results are described below.

  In the comparison between AH, SH, and FH groups by the Friedman test, significant differences were observed in the expression levels of TGF-α, EGFR, and c-met, respectively. (P = 0.033, 0.046, 0.004 respectively)

  In comparison between each parameter by the Spearman test, TGF-α mRNA and AST and AFP (P = 0.199, P = 0.033, respectively), EGFR mRNA and c-met mRNA and PT (respectively, respectively) , P = 0.013, 0.026), HGF mRNA and c-met mRNA and ammonia (P = 0.011, <0.001 respectively), hTERT mRNA and PLT (P = 0.001) There was a significant correlation between the two. Parameters associated with prognosis are ammonia, PT, and TB (P = 0.001, 0.007, and 0.028, respectively), and mRNA levels are significantly better only in cases with high TGF-α (survival). It was). (P = 0.001)

  From the above results, among 5 serum genes of TGF-α, EGFR, HGF, c-met, and hTERT, which have been suggested to be related to the protein function or protein concentration and hepatitis, the mRNA amount and the prognosis are correlated. It was revealed that only TGF-α was used. That is, a technique was developed that can diagnose prognosis of fulminant hepatitis at a single point by measuring TGF-α mRNA, which is highly correlated with the pathological condition.

  In another test, the amount of TGF-α mRNA was significantly different between acute hepatitis, severe hepatitis, and fulminant hepatitis, and it was also found that there was a significant difference between prognostic survivors and deaths. . From this result, it is clear that biomarkers using TGF-α mRNA in blood can be used to distinguish between dead and surviving cases and various hepatitis conditions, which are useful for understanding the pathology including prognosis. It became.

  In the above, this invention was demonstrated based on the Example. It is to be understood by those skilled in the art that this embodiment is merely an example, and that various modifications are possible and that such modifications are within the scope of the present invention.

  As described above, the diagnostic kit and the diagnostic marker according to the present invention are useful as a diagnostic kit and a diagnostic marker that can provide an index highly correlated with the pathology of hepatitis.

Claims (13)

A diagnostic kit for diagnosing hepatitis in a mammal,
A diagnostic kit comprising a detection reagent for quantitatively detecting mRNA encoding TGF-α in a tissue sample obtained from the mammal, wherein the expression level of the mRNA serves as an index for diagnosis of hepatitis. The diagnostic kit according to claim 1, wherein the hepatitis is fulminant hepatitis. The diagnostic kit according to claim 1 or 2, wherein the index is a prognostic index of hepatitis. The diagnostic kit according to any one of claims 1 to 3, wherein the tissue sample is blood. The diagnostic kit according to any one of claims 1 to 4, wherein the detection reagent comprises a set of oligonucleotide primers for use in RT-PCR. The diagnostic kit according to claim 5, wherein the RT-PCR is real-time RT-PCR using a fluorescent dye. Diagnosis according to claim 5 or 6, characterized in that said set of oligonucleotide primers is a set of oligonucleotides having at least 80% identity with SEQ ID: 1 and SEQ ID: 2, respectively. kit. The diagnostic kit according to any one of claims 1 to 4, wherein the detection reagent includes an oligonucleotide probe to be used for microarray analysis, and further includes a microarray chip equipped with the probe. The diagnostic kit according to any one of claims 1 to 4, wherein the detection reagent includes an oligonucleotide probe for use in in situ hybridization. The diagnostic kit according to any one of claims 1 to 4, wherein the detection reagent comprises an oligonucleotide probe for use in Northern blot analysis. A diagnostic marker for diagnosing hepatitis, comprising mRNA encoding TGF-α. The diagnostic marker according to claim 11, wherein the hepatitis is fulminant hepatitis. The diagnostic marker according to claim 11 or 12, wherein the diagnosis is a prognosis diagnosis of hepatitis.

Images