JP2007529510A - Methimazole derivatives and tautomeric cyclic thiones that inhibit cell adhesion - Google Patents

Abstract

The present invention provides novel compounds and methods for use in inhibiting and preventing cell adhesion and diseases mediated by cell adhesion.
The compound and pharmaceutical composition according to the present invention can be used as a therapeutic agent or a prophylactic agent. In particular, methimazole derivatives and tautomeric cyclic thiones have the ability to suppress leukocyte adhesion (eg, monocyte adhesion to endothelial cells) and migration mediated by the VCAM-1 adhesion mechanism. In addition to activating anti-inflammatory properties, methimazole derivatives and tautomeric cyclic thiones and their physiologically acceptable salts and derivatives generally have VCAM-1 and VCAM-1 ligands (eg, It is suitable for the treatment (ie treatment and prevention) of diseases that are based on interaction with VLA-4 or α4β7) or that can be ameliorated by inhibiting said interaction.
[Selection figure] None
58

Description

  The present invention relates to novel compounds and methods for use in inhibiting and preventing cell adhesion and diseases mediated by cell adhesion. The present invention also relates to a pharmaceutical composition comprising the compound according to the present invention, and cell adhesion performed using the pharmaceutical composition and a method for suppressing and preventing a disease caused by cell adhesion.

  Cell adhesion is the process by which bound cells move toward a specific target or are localized in the extracellular matrix. In short, cell adhesion constitutes one of the fundamental mechanisms underlying various biological phenomena. For example, cell adhesion is involved in adhesion of hematopoietic cells to endothelial cells and subsequent migration of the hematopoietic cells from the blood vessel to the site of injury. Cell adhesion is involved in pathological inflammation and immune responses in mammals.

  Adhesion mediated by VCAM-1 and other endothelial cell surface receptors is associated with many inflammatory responses. At the site of injury or other inflammatory stimuli, activated vascular endothelial cells express molecules that are adherent to leukocytes. The mechanism by which leukocytes adhere to endothelial cells includes, in part, that cell surface receptors on leukocytes recognize and bind to corresponding cell surface molecules on endothelial cells. As soon as they bind, the leukocytes pass through the vessel wall and enter the site of injury, releasing a chemical messenger that fights the infection.

  Examples of central nervous system disorders in which healthy brain tissue is destroyed by the adhesion mechanism between endothelial cells and leukocytes are experimental autoimmune encephalomyelitis (EAE), multiple sclerosis (Multiple Sclerosis: MS) and inflammatory brain disorders such as meningitis. In patients with these inflammatory diseases, large amounts of white blood cells migrate through the Blood Brain Barrier (BBB). Leukocytes release toxic mediators that cause extensive tissue damage, leading to nerve conduction disturbances and paralysis.

  In other organ systems, tissue damage is also caused by adhesion mechanisms, leading to leukocyte migration and activation. For example, initial damage to heart tissue after myocardial ischemia has been found to be further exacerbated by leukocytes that have entered the damaged tissue, causing further damage. Other diseases mediated by adhesion mechanisms include, for example, asthma, Alzheimer's disease, atherosclerosis, dementia due to AIDS, diabetes, inflammatory bowel disease, multiple sclerosis, rheumatoid arthritis, tissue transplantation, and tumors There is a metastasis.

Adhesion of leukocytes to endothelial cells in the hydrodynamic environment of blood circulation plays a central role in pathological inflammation (eg, atherosclerosis (1), inflammatory colitis (2)). Endothelial Cell Adhesion Molecule (ECAM ³ ) (eg, VCAM-1, E-selectin, and ICAM-1) known to be involved in leukocyte recruitment, due to their role in leukocyte adhesion, It has been found that up-regulation in such environments and contributes to disease progression and / or tissue damage (3). For example, VCAM-1 is present locally on aortic endothelial cells above the initial droplet cell damage (1) and is increased in the colitis model in endothelial cells (4). Therefore, a promising therapeutic method for treating pathological inflammation is to reduce abnormal adhesion of leukocytes to endothelial cells by suppressing ECAM expression (5).

  ECAM expression is affected by the cytokine environment in which endothelial cells are present. In fact, expression of E-selectin, VCAM-1 and ICAM-1 can be induced by treating cultured endothelial cells with inflammatory cytokine TNF-α for 4 hours (6). Cytokine-dependent ECAM induction includes, for example, nuclear factor kB (NF-kB), activated protein-1 (AP-1), specificity protein (SP-1), interferon regulatory factor-1 (IRF-1), And is regulated at the gene level by the activity of transcription factors such as GATA. For example, the E-selectin promoter has a binding site with NF-kB (7), and the VCAM-1 promoter has NF-kB, AP-1, SP-1, IRF-1, and GATA. It has a binding site (8-11) and the ICAM-1 promoter has functional binding sites for NF-kB and AP-1 (12, 13). Some of these transcription factors (eg, NF-kB) are present in an inactive form in unstimulated endothelial cells (14). Endothelial cytokine treatment promotes the activity of these transcription factors (14) and induces the expression of other transcription factors (eg, IRF-1) (10). The activated or induced transcription factor binds to the binding site of each promoter, resulting in gene transcription.

  Some recent or prevalent pathologic inflammation treatments are at least in part by modulating the activity of transcription factors (15-19). Indeed, compounds that block cytokine-induced ECAM expression at the transcriptional level have been shown to inhibit leukocyte adhesion to endothelial cells (16-18, 20) and reduce inflammation in animal models ( 15, 17). Metimazole is widely used clinically for the treatment of autoimmune Graves' disease or primary hyperthyroidism (21). Methimazole is also used in several other forms of autoimmunity in both psoriasis in humans and systemic lupus, autoimmune blepitis, autoimmune uveitis, thyroiditis and diabetes in a murine experimental model. It has been shown to be effective in the treatment of disease (23-26). Evidence that methimazole acts as a transcription inhibitor against abnormal increases in MHC class I and class II gene expression (26-29) and mimics the effects of class 1 knockouts in the prevention of autoimmune diseases Accumulated (30). Several observations suggest that methimazole can also affect ECAM expression and therefore be a potential anti-inflammatory compound. In particular, (a) Graves' disease patients treated with methimazole have reduced levels of dissolved E-selectin and dissolved CAM-1 in the blood (31), and (b) rat models of experimental colitis with methimazole. It has been reported to reduce colonic mucosal damage in (32). In an attempt to identify derivative compounds that are more effective as anti-inflammatory agents or immunosuppressive than methimazole, phenylmethimazole (compound 10, C-10), tautomeric cyclic thione, Observations have been derived that are 50-100 times more potent in suppressing abnormal increases in MHC gene expression and are highly effective drugs in experimental models of lupus and diabetes (26, 28). . These observations indicate that methimazole, phenylmethimazole, or other derivatives of tautomeric cyclic thiones, induce inflammatory cytokines (eg, TNF-α) -induced ECAM expression and the resulting leukocyte endothelial cells It was a motivation to scrutinize the hypothesis that adhesion could be reduced. There also remains a need for inhibitors of VCAM-1-dependent cell adhesion. Such compounds would provide drugs that are useful for the treatment, prevention or suppression of various diseases associated with cell adhesion mediated by VCAM-1.

  Certain types of methimazole derivatives and tautomeric cyclic thiones are effective as anti-inflammatory drugs to prevent, reduce or suppress a series of undesirable or harmful inflammation against a wide variety of inflammatory symptoms That was newly found. They include, for example, arthritis, rheumatoid arthritis, polyarthritis, inflammatory colitis (Crohn's disease, ulcerative colitis), systemic lupus erythematosus, inflammatory diseases of the central nervous system (eg, multiple sclerosis), asthma, Or it is used for treatment of allergy (for example, delayed type IV allergy). Furthermore, the compounds according to the present invention provide cardioprotection for seizure prevention or seizure prevention, as well as cardiovascular disease, atherosclerosis, myocardial infarction, myocardial reinfarction, acute coronary syndrome, cerebral infarction, restenosis, Diabetes, damage to organ transplants, immune diseases, autoimmune diseases, proliferation of malignant tumors or angels, malaria and other diseases (for prevention, reduction or treatment, abnormal increase in VCAM-1 expression and / or leukocyte activity It is suitable for the treatment of diseases) whose influence should be inhibited. A preferred use is the prevention of inflammatory bowel disease and macrovascular or microvascular complications of type I or type II diabetes mellitus (eg, myocardial infarction, myocardial reinfarction or nephropathy).

  The present invention relates to novel compounds and methods for inhibiting and preventing cell contact and cell contact mediated diseases. The present invention also relates to a pharmaceutical composition and use thereof for suppressing and preventing cell contact and diseases mediated by cell contact. The compounds and pharmaceutical compositions according to the present invention can be used as therapeutic or prophylactic agents. In particular, methimazole derivatives and tautomeric cyclic thiones have the ability to suppress leukocyte adhesion (eg, monocyte adhesion to endothelial cells) and migration mediated by the VCAM-1 adhesion mechanism. In addition to activating anti-inflammatory properties, methimazole derivatives and tautomeric cyclic thiones and their physiologically acceptable salts and derivatives generally have VCAM-1 and VCAM-1 ligands (eg, It is suitable for the treatment (ie treatment and prevention) of diseases that are based on interaction with VLA-4 or α4β7) or that can be ameliorated by inhibiting said interaction. In particular, methimazole derivatives and tautomeric cyclic thiones are suitable, at least in part, for the treatment of diseases caused by or associated with undesirable amounts of leukocyte adhesion and / or leukocyte migration. In addition, it is suitable for prevention, alleviation or treatment of diseases with reduced adhesion and / or migration of leukocytes.

  In addition, the present invention is for suppressing leukocyte adhesion and / or migration, or for suppressing an abnormal increase in VCAM-1 expression (eg, VCAM-1 induced by cytokines such as TNF-α). The present invention relates to a methimazole derivative and a tautomeric cyclic thione, and / or a pharmaceutically acceptable salt and / or derivative thereof. Furthermore, the present invention is to create a medicament for treating diseases that exhibit an undesirable degree of leukocyte adhesion and / or leukocyte migration, or for treating diseases that contribute to a VCAM-1-dependent adhesion process. Of methimazole derivatives and tautomeric cyclic thiones and / or pharmaceutically acceptable salts and / or derivatives thereof. The present invention also relates to the use of methimazole derivatives and tautomeric cyclic thiones and / or pharmaceutically acceptable salts and / or derivatives thereof for the treatment of the aforementioned types of diseases.

  In one embodiment, the present invention reduces abnormal adhesion of leukocytes during pathological inflammation to endothelial cells by suppressing the expression of endothelial cell adhesion molecules (ECAM) at the transcriptional level. Provide a way to make it happen. In particular, the present invention relates to the expression of TNF-α inducible ECAM (eg, E-selectin, ICAM-1, and VCAM-1) and the resulting monocyte (U-937) human aortic endothelial cells (Human A method for regulating adhesion to Aorta Endothelial Cell (HAEC) using a methimazole derivative is provided.

  In certain embodiments of the invention, these novel compounds, compositions and methods are suitably used for the treatment of inflammatory and immune diseases. The present invention also provides methods for making the compounds of the present invention and intermediates useful in the methods.

  In certain embodiments, the present invention provides the use of methimazole (1-methyl-2-mercaptoimidazole) and its derivatives. In another embodiment, the present invention provides the use of prodrug form of methimazole, known as carbimazole (neomercazole) and its derivatives.

  In other embodiments, the invention provides methimazole, metronidazole, mercaptoimidazole, mercaptobenzimidazole, 2-mercapto-5-nitrobenzimidazole, 2-mercapto-5-methylbenzimidazole, s-methylmethimazole, n- Use of a composition comprising one or more compounds selected from the group consisting of methylmethimazole, 5-methylmethimazole, 5-phenylmethimazole, and 1-methyl-2-thiomethyl-5 (4) nitroimidazole. provide. Preferably, 5-phenylmethimazole is used.

  In another embodiment, the present invention provides the use of phenylmethimazole (Compound 10; C-10) and its derivatives.

  One object of the present invention is to modulate or reduce TNF-α-induced mononuclear leukocyte cell adhesion to HAEC by suppressing IRF-1-dependent VCAM-1 gene expression using phenylmethimazole. Is to provide a way to make it happen.

  The compounds according to the invention can be synthesized using any conventional technique. Preferably, the compounds according to the invention are chemically synthesized from readily available starting materials.

  The compounds according to the invention are modulated by adding appropriate functional groups to increase biological selectivity. Such modulation is known in the art and increases biological permeability to a given biological system (eg, blood, lymphatic system, central nervous system), enhances oral efficacy, and allows for injectable administration. Including increasing solubility, changing metabolism, and changing excretion rates.

  As used herein, the term “patient” refers to mammals and includes humans. The term “cell” means a mammalian cell, and includes a human cell.

  Once synthesized, the activity and VCAM-1 specificity of the compounds according to the invention is determined by in vitro and in vivo analyses.

  For example, the cell adhesion inhibitory activity of the compounds according to the present invention inhibits the binding of VCAM-1 expressing cells to VCAM-1 ligand (eg, VLA-4) expressing cells (eg, monocytes, lymphocytes). Determined by measuring the concentration of inhibitor required. In this analysis, microtiter wells are coated with cells capable of expressing VCAM-1 (eg, endothelial cells). As soon as the well is coated, the concentration of the test compound is changed and added with a cytokine (eg, TNF-α) that can induce the expression of VCAM-1. Alternatively, the test compound is first added and incubated with the coated wells containing endothelial cells before adding the cytokine. The cells are cultured in the well for at least 2 hours. After culturing, appropriately labeled VCAM-1 ligand-expressing cells (eg, monocytes, lymphocytes) are added to the wells and incubated for at least 30 minutes. After the incubation period, the well is washed. Inhibition of binding is measured by quantification of fluorescence and radioactivity of VCAM-1-expressing cells in various concentrations of the test compound and the control containing no test compound.

  VCAM-1 expressing cells that can be used for this analysis include non-immune target tissue cells, endothelial cells, and epithelial cells. VCAM-1 ligand expressing cells (eg monocytes, lymphocytes) used in this analysis are fluorescently or radiolabeled.

  Direct binding analysis is also performed to quantify the inhibitory activity of the compounds according to the invention.

  As soon as a VCAM-1 specific inhibitor is identified, the properties of the inhibitor are further revealed by in vivo analysis. One of them tests the effect of inhibitors on VCAM-1 expression and leukocyte adhesion in an already established in vivo model of pathological inflammation. Examples of the in vivo model of the pathological inflammation include an inflamed mesenteric endothelium in a murine model of chronic inflammation (ie, colitis), and apolipoprotein E deficiency (apoE − // in which atherosclerosis has progressed). -) There is a carotid artery removed from the mouse.

  The compounds according to the invention are used in the form of pharmaceutically acceptable salts obtained from inorganic acids, organic acids, inorganic bases or organic bases.

  Such acid salts include the following. Acetate, adipate, alginate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, citrate, camphorate, camphorsulfonate, cyclopentanepropionate, digluconate , Dodecyl sulfur, ethanesulfonate, fumarate, glucoheptanoate, glycerophosphate, hemisulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodic acid Salt, 2-hydroxyethanesulfonate, lactate, maleate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, oxalate, pamoate, pectinate, persulfate, 3- Phenyl-propionate, picrate, pivalate, propionate, succinate, tartrate, thiocyanate, thiocyanate, Shireto, and, undecanoate.

  Moreover, there exist the following as such a base salt. Ammonium salts, alkali metal salts (such as sodium and potassium salts), alkaline earth metal salts (such as calcium and magnesium salts), salts with organic bases (dicyclohexylamine salts such as sodium and potassium salts), N-methyl-glucamine, and , Salts with amino acids (arginine, lysine, etc.).

  In addition, groups containing basic nitrogen include, for example, low alkyl group halogen compounds (methyl, ethyl, propyl, butyl chloride, etc.), bromides and iodides, dialkyl sulfates (dimethyl, diethyl, dibutyl, diamyl sulfate, etc.) ), Long chain halogen compounds (such as decyl, lauryl, myristyl, and stearyl chloride), aralkyl halides (benzyl and phenethyl bromide), and the like. Water-soluble, oil-soluble, water-dispersible or oil-dispersible products are thus obtained.

  The compounds according to the invention can be used orally, parenterally, by inhalation spray, topically, rectally, nasally, orally, vaginally or implanted. In the pharmaceutical composition to be administered. The term “parenteral” refers to subcutaneous, intravenous, intraperitoneal, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intrahepatic, intralesional, and intracranial injection or infusion techniques. including.

  The pharmaceutical composition according to the present invention comprises a combination of any of the compounds according to the present invention or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier. The term “carrier” includes acceptable adjuvants and excipients. Pharmaceutically acceptable carriers that can be used in the pharmaceutical composition according to the present invention include ion exchangers, alumina, aluminum stearate, lecithin, serum proteins (such as human serum albumin), buffer substances (such as phosphate), Glycine, sorbic acid, potassium sorbate, partial mixture of glycerides in saturated plant fatty acids, water, salt or electrolyte (eg protamine sulfate), disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salt, colloidal Silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based material, polyethylene glycol, sodium carboxymethylcellulose, polyacrylic acid, wax, polyethylene-polyoxypropylene-block polymer, polyethylene glycol, and woo Fats and the like (but not limited to). These include liposomes or drug carriers made of lipids or polymer particles (including biodegradable polymers) and include targeted gene transfer applications (eg, binding to antibodies). They include solubilization with dimethyl sulfoxide prior to dilution to the final practical concentration.

  According to the invention, the pharmaceutical composition is in the form of a sterile injectable preparation, for example an injectable aqueous solution or oily suspension. This suspension is made by techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation described above is a sterile injectable aqueous solution or suspension in a non-toxic pharmaceutically acceptable diluent or solvent, such as an aqueous solution in 1,3-butanediol or dimethyl sulfoxide, for example. There can be. Among the acceptable carriers and solutions that are used are water, Ringer's solution, and physiological saline. In addition, sterilized, non-volatile oils are conventionally used as solvents or suspending agents. For this purpose any bland fixed nature may be employed, such as synthetic mono- or diglycerides. Fatty acids (eg, oleic acid and its glyceride derivatives) are useful in the preparation of injectable formulations, as are pharmaceutically acceptable natural oils (olive or castor oil, especially those that are polyoxyethylated). . These oils or suspensions can also contain a linear alcohol diluent or dispersant (eg, Ph. Helv or similar alcohol).

  The pharmaceutical composition according to the present invention can be administered orally in any form of oral administration, including but not limited to capsules, tablets, aqueous suspensions or solutions. In the case of tablets for oral administration, carriers commonly used include lactose and corn starch. Also, a smoothing agent such as magnesium stearate is generally added. For oral administration in capsule form, diluents such as lactose and dried corn starch can be used. When aqueous suspensions are required for oral administration, the active ingredient is combined with emulsifying and suspending agents. If desired, some sweetening, flavoring or coloring agents can be added.

  The pharmaceutical composition according to the present invention is administered rectally in the form of a suppository. They are obtained by mixing the substance with a suitable non-irritating excipient (an excipient that is solid at room temperature but liquid at rectal temperature and melts in the rectum to release the drug). Created. Such materials include cocoa butter, beeswax, and polyethylene glycols.

  Also, the pharmaceutical composition according to the present invention may be applied topically, particularly when the target of treatment includes a region or organ that can be easily applied topically (eg when treating diseases of the eyes, skin or lower intestinal tract). Can also be administered. Suitable topical formulations are easily created for those areas or organs.

  Topical administration for the lower intestinal tract can be effected by a rectal suppository formulation (see above) or a suitable enema. It can also be performed using a topical transdermal patch.

  For use in topical applications, the pharmaceutical compositions according to the invention are made in the form of a suitable ointment containing the active ingredient suspended or dissolved in one or more carriers. Carriers used for topical administration of the compounds according to the present invention include mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene, polyoxyethylene compounds, emulsifying wax, and water (however, these Not limited to). Also. The pharmaceutical compositions can also be formed in the form of a suitable lotion or cream containing the active ingredient suspended or dissolved in one or more pharmaceutically acceptable carriers. Suitable carriers include (but are not limited to) mineral oil, sorbitan monostearate, polysorbate 60, cetyl ester wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol, and water. Not)

  For use in ophthalmology, the pharmaceutical composition according to the present invention is in the form of a finely divided suspension in sterile saline adjusted to an isotonic pH, or preferably isotonic pH. Formed in the form of an aqueous solution in conditioned sterile saline (with or without preservatives (eg, benzylalkonium chloride)). Alternatively, for use in ophthalmology, the pharmaceutical composition according to the present invention is formed in the form of an ointment such as petrolatum.

  Also, the pharmaceutical composition according to the present invention can be administered by nasal aerosol or inhalation using a nebulizer, a dry powder inhaler or a metered dose inhaler. Such compositions are made by techniques known in the pharmaceutical composition art and include benzyl alcohol or other suitable preservatives, absorption enhancers to enhance bioavailability, fluorocarbons, and / or Alternatively, it is made up as an aqueous solution in saline using other conventional solubilizers or dispersants.

  The amount of active ingredient that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the dosage form. In addition, as a matter of course, the drug to be administered to a specific patient and the treatment plan include the activity of the drug to be used (compound), age, weight, health condition, sex, dietary life, administration period, elimination rate, drug used in combination. And various factors such as the judgment of the treating physician and the severity of the disease being treated. Moreover, the amount of the active ingredient varies depending on whether it is a therapeutic drug or a preventive drug.

  The effective dose and rate of administration of the compounds of the present invention to prevent, inhibit or inhibit cell adhesion depends on the nature of the inhibitor, the size of the patient's body, the therapeutic goal, the nature of the disease being treated. It is determined by various factors such as the pharmaceutical composition and the judgment of the treating physician. Useful are compounds in which the dosage level of the active ingredient is about 0.001 to 100 mg / kg per day (per kg body weight), preferably about 0.1 to 10 mg / kg per day.

  In another embodiment of the present invention, a composition comprising a compound according to the present invention comprises a corticosteroid, a bronchodilator, an antiasthmatic agent (mast cell stabilizer), an anti-inflammatory agent, an anti-rheumatic agent, an immunosuppression It further comprises an additional substance selected from the group consisting of an agent, an antimetabolite, an immunomodulator, a psoriasis treatment, an antibiotic, and an antidiabetic. Further, the group includes theophylline, sulfasalazine and aminosalicylic acid (anti-inflammatory drug), cyclosporine, FK-506 and rapamycin (immunosuppressive agent), cyclophosphamide and methotrexate (antimetabolite), and interferon (immunostimulatory agent). And the like.

  In other embodiments, the present invention provides methods for preventing, suppressing or suppressing inflammation associated with cell adhesion and immune or autoimmune reactions associated with cell adhesion. Cell adhesion associated with VCAM-1 plays a central role in various inflammatory, immune and autoimmune diseases. Therefore, inhibition of cell adhesion by the compounds according to the present invention can be used in methods for treating or preventing inflammatory, immune and autoimmune diseases. Preferably, the disease to be treated by the method according to the invention is asthma, arthritis, psoriasis, transplant rejection, multiple sclerosis, diabetes, inflammatory bowel disease and inflammatory / inflammatory associated with activation of innate immune responses. Selected from the group consisting of immune diseases (eg, endotoxic shock).

  These methods are performed using the compounds according to the present invention alone or in combination with anti-inflammatory agents or immunosuppressive agents. Treatment with the combination includes administration at the same time or at different times in a single dose or multiple dose form.

  The above summary of the present invention is not intended to describe each embodiment or every implementation of the present invention. Advantages and implementations of the present invention will become apparent from the following detailed description and appended claims, taken in conjunction with the accompanying drawings, together with a more complete understanding of the invention.

  In this specification, all temperatures are expressed in degrees Celsius, and percentages are percentages by weight unless otherwise specified. In addition, all the documents described in the present specification mentioned for the purpose of explaining and disclosing the compositions and methods usable in the present invention described in the document are included in the present invention by reference. Shall. The above document is merely for disclosing the prior art prior to the filing of the present application.

  The present invention provides the use of methimazole derivatives and tautomeric cyclic thione compounds that specifically inhibit VCAM-1 binding. These compounds are useful for the suppression, prevention and suppression of VCAM-1-mediated cell adhesion and diseases associated with the cell adhesion (such as inflammation and immune response). The compounds according to the present invention are used alone or in combination with other therapeutic or prophylactic agents for inhibiting, preventing and inhibiting cell adhesion. The present invention also provides a pharmaceutical preparation containing the above-described inhibitor of VCAM-1-mediated cell adhesion, and a method for inhibiting cell adhesion using the compound and composition according to the present invention. Hereinafter, terms used in this specification will be defined.

  By “safe and effective amount” is meant a sufficient amount of a pharmaceutically active compound to inhibit and prevent cell adhesion and cell adhesion mediated diseases. The required dosage of the pharmaceutically active substance or the pharmaceutical composition containing the active substance is within the scope of normal medical judgment, the severity of the patient being treated, the duration of treatment, the nature of the adjunct treatment, Varies depending on age and health, type of active compound used, etc. Although the compounds described herein provide pharmacological activity at lower doses than conventional methimazole compounds, a “safe and effective amount” for a particular compound should take these risks into account.

  “Pharmaceutically acceptable” refers to pharmaceutically active compounds and other ingredients used in pharmaceutical compositions, and methods defined herein, such as inappropriate toxicity, inflammation, allergic reactions, etc. Means that it is suitable for contact with human and lower animal tissues without having a corresponding benefit / risk ratio.

  “Administration” of the pharmaceutically active compound and the pharmaceutical composition as defined herein includes not only topical application of the compound and composition, but also injection of the composition (especially parenteral injection), intravenous Includes systemic use by injection, suppository, and oral administration. In the present invention, oral administration is particularly preferred.

  The term “amelioration” or “improvement” means an adverse effect or a reduction in the severity of the disease due to cell adhesion in the patient being treated. The extent of the reaction is measured by means known in the art.

  The “disease caused by cell adhesion” is the following disease induced by atypical cell adhesion (but is not limited thereto). Reperfusion injury after ischemia, atherosclerosis, inflammatory bowel disease (Crohn's disease, ulcerative colitis), burns, arthritis, asthma, organ transplantation (host vs graft, graft vs host), Cerebral infarction, malaria, multiple sclerosis, diabetes, hemorrhagic shock, myocardial infarction, lung infarction, cerebral infarction, intestinal infarction, intestinal infarction, renal infarction, sepsis, thrombosis, delayed hypersensitivity reaction, cancer, acute lung injury, Autoimmune or non-autoimmune glomerulonephritis, tuberculosis, sarcoidosis, systemic lupus erythematosus, Sjogren's disease, polymyositis / dermatomyositis, hypertensive vascular disease, vasculitis, nodular polyarteritis, giant cell Arteritis, Wegener's granulomatosis, Kawasaki disease (mucocutaneous lymph node syndrome), obstructive thromboangiitis (Berger's disease), Behoet disease, dermatological vasculitis, rickettsial vasculitis, disseminated intravascular coagulation syndrome, re Papilloid interstitial pneumonia, pulmonary eosinophilic granuloma, gastritis, chronic hepatitis, cirrhosis, Graves' disease, thyroiditis, hypothyroidism, psoriasis, Alzheimer's disease, allergic rhinitis, inflammatory skin disease, cutaneous anaphylaxis Reaction, and meningitis.

  The term “comprising” refers to various other adaptations as well as inert ingredients in the pharmaceutical compositions and methods according to the invention, as long as the defined pharmaceutically active compounds and carriers are used as disclosed. It means that it can be used together with drugs. Thus, the term “comprising” encompasses the more restrictive terms “consisting of” and “consisting essentially of”.

  The term “patient” includes all mammals (animals or humans) that enjoy treatment with the compounds, compositions and methods of the present invention. The term “treatment” means any curative treatment, prophylactic treatment, and ameliorative treatment.

  “Compatible” means that the components of the composition according to the present invention can be mixed without interaction, without substantially reducing the effectiveness of the pharmaceutically active compound in the state of normal use.

  The pharmaceutical composition according to the present invention comprises the use of a specially defined methimazole derivative and tautomeric cyclic thione in a safe and effective amount with a pharmaceutically acceptable carrier.

The methimazole derivative used in the composition according to the present invention is an active compound represented by the following chemical structural formula.

から成る群より選択され、
Ｙの１つだけは前記フェニル部分であり得、
Ｒ^１は、Ｈ、ＯＨ、Ｃ_ｌ−Ｃ_４アルキル、及びＣ_ｌ−Ｃ_４置換アルキルから成る群より選択され、
Ｒ^２は、Ｈ、Ｃ_ｌ−Ｃ_４アルキル、及びＣ_ｌ−Ｃ_４置換アルキルから成る群より選択され、
Ｒ^３は、Ｈ、Ｃ_ｌ−Ｃ_４アルキル、Ｃ_ｌ−Ｃ_４置換アルキル、及びＣＨ_２Ｐｈから成る群より選択され、
Ｒ^４は、Ｈ、Ｃ_ｌ−Ｃ_４アルキル、及びＣ_ｌ−Ｃ_４置換アルキルから成る群より選択され、
Ｘは、Ｓ及びＯから選択され、
Ｚは、ＳＲ^３、ＯＲ^３及びＣ_ｌ−Ｃ_４アルキルから選択され、
Ｙがフェニル部分でない場合は、Ｒ^２及びＲ^３の少なくとも２つはＣ_ｌ−Ｃ_４アルキルであり、
Ｚがアルキルの場合は、少なくとも１つのＹはＮＯ_２である。 In the chemical structure above, Y is H, C ₁ -C ₄ alkyl, C ₁ -C ₄ substituted alkyl, NO ₂ , and a phenyl moiety.

Selected from the group consisting of
Only one of Y can be the phenyl moiety,
R ¹ is selected from the group consisting of H, OH, C ₁ -C ₄ alkyl, and C ₁ -C ₄ substituted alkyl;
R ² is selected from the group consisting of H, C ₁ -C ₄ alkyl, and C ₁ -C ₄ substituted alkyl;
R ³ is selected from the group consisting of H, C ₁ -C ₄ alkyl, C ₁ -C ₄ substituted alkyl, and CH ₂ Ph;
R ⁴ is selected from the group consisting of H, C ₁ -C ₄ alkyl, and C ₁ -C ₄ substituted alkyl;
X is selected from S and O;
Z is selected from SR ³ , OR ³ and C ₁ -C ₄ alkyl;
When Y is not a phenyl moiety, at least two of R ² and R ³ are C ₁ -C ₄ alkyl;
When Z is alkyl, at least one Y is NO _2.

である。 Y is preferably H, the phenyl moiety or NO ₂ , most preferably H or the phenyl moiety.

It is.

  In the compounds defined above, no more than one of the Y groups can be the phenyl moiety.

R ¹ is from H, OH, halogen (F, Cl, Br or I), C ₁ -C ₄ alkyl, C ₁ -C ₄ substituted alkyl, C ₁ -C ₄ ester, and C ₁ -C ₄ substituted ester Selected. R ¹ is preferably H, OH, halogen, OOCCH ₂ M (where M is H or halogen), and most preferably H.

R ² is selected from H, C ₁ -C ₄ alkyl, and C ₁ -C ₄ substituted alkyl. Preferably one or both of the R ² groups is methyl.

As used herein, the term “substituted alkyl” or “substituted ester” refers to a hydroxyl or alkoxyl group, a carboxyl group, a halogen, a nitro group, an amino or acylamino group, and a mixture of parts thereof, at one or more points. It is intended to include alkyl, allyl, or ester groups substituted by Preferably, a “substituted alkyl” group is a C ₁ -C ₄ hydroxyl or alkoxyl group, or a group substituted with a halogen.

R ³ is selected from H, C ₁ -C ₄ alkyl, C ₁ -C ₄ substituted alkyl, and CH ₂ Ph (where Ph is phenyl). R ³ is preferably H or C ₁ -C ₄ alkyl, most preferably C ₁ -C ₄ alkyl, especially methyl.

R ⁴ is selected from H, C ₁ -C ₄ alkyl, and C ₁ -C ₄ substituted alkyl. R ⁴ is preferably H.

  X is S or O, preferably S.

Z is selected from SR ³ , OR ³ , S (O) R ³ , and C ₁ -C ₄ alkyl. Z is preferably SR ³ , OR ³ , and S (O) R ³ , most preferably SR ³ , OR ³ , especially SR ³ .

And in the above chemical structural formula, when Y is not a phenyl moiety, at least two of R ² and R ³ are C ₁ -C ₄ alkyl. Then, when Z is _C l -C ₄ alkyl, at least one Y group is NO _2.

ただし、Ｒ^５，Ｒ^６＝ＣＨ_３，ＣＨ_３、Ｐｈ，Ｈ、又はＨ，Ｐｈであり、Ｒ^７＝Ｈ又はＣＨ_３であり、Ｒ^８＝Ｏ、Ｓ、ＮＨ、又はＮＣＨ_３である。 Compounds that can be used in the present invention are disclosed in the document “Kjellin and Sandstrom, Acta Chemica Scandanavica 23: 2879-2887 (1969)” (which is included in the present invention by this reference), and have the following chemical structure: There are tautomeric cyclic thiones represented by the formula:

However, R ⁵ , R ⁶ = CH ₃ , CH ₃ , Ph, H, or H, Ph, R ⁷ = H or CH ₃ , and R ⁸ = O, S, NH, or NCH ₃ .

Preferred compounds for use in the composition according to the present invention include those represented by the following chemical structural formula.

ただし、Ｒ^１０は、Ｈ、ＮＯ_２、Ｐｈ、４−ＨＯＰｈ、及び４−ｍ−Ｐｈ（ただし、ｍは、Ｆ、Ｃｌ、Ｂｒ又はＩである）から選択される。 Other preferred compositions include those represented by the following chemical structural formula.

However, R ¹⁰ is selected from H, NO ₂ , Ph, 4-HOPh, and 4-m-Ph (where m is F, Cl, Br, or I).

A particularly preferred subset of the pharmaceutical compounds defined herein are those in which one of the Y groups is a phenyl moiety as defined above. These compounds are represented by the following chemical structural formula.

In these compounds, Y is selected from H, C ₁ -C ₄ alkyl, C ₁ -C ₄ substituted alkyl, NO ₂ , and a phenyl moiety, preferably H.

R ¹ is from H, OH, halogen (F, Cl, Br or I), C ₁ -C ₄ alkyl, C ₁ -C ₄ substituted alkyl, C ₁ -C ₄ ester, and C ₁ -C ₄ substituted ester Selected, preferably H, OH, halogen, OOCCH ₂ M, where M is H or halogen. Preferably it is not H.

R ² is selected from H, C ₁ -C ₄ alkyl, and C ₁ -C ₄ substituted alkyl, preferably at least one of the R ² groups is methyl.

R ³ is selected from H, C ₁ -C ₄ alkyl, C ₁ -C ₄ substituted alkyl, and CH ₂ Ph (where Ph is phenyl), preferably H and methyl.

R ⁴ is selected from H, C ₁ -C ₄ alkyl, and C ₁ -C ₄ substituted alkyl, preferably H.

  X is selected from S and O, preferably S.

Z is selected from SR ³ and OR ^3, and preferably, SR ^3.

A particularly preferred compound is a compound represented by the following chemical structural formula.

ただし、Ｒ^９は、ＯＨ、Ｍ、及びＯＯＣＣＨ_２Ｍから成る群より選択され、Ｍは、Ｆ、Ｃｌ、Ｂｒ、及びＩから成る群より選択される。 Another preferable compound is a compound represented by the following chemical structural formula.

Where R ⁹ is selected from the group consisting of OH, M, and OOCCH ₂ M, and M is selected from the group consisting of F, Cl, Br, and I.

５−フェニルメチマゾール The most preferable compound is a compound represented by the following chemical structural formula.

5-phenylmethimazole

  Mixtures of pharmaceutically active compounds as defined herein can also be used. The above methimazole derivatives and tautomeric cyclic thiones can be synthesized using techniques known in the art. For example, the synthesis of some tautomeric cyclic thiones is described in the document “Kjellin and Sandstrom, Acta Chemica Scandanavica 23: 2879. congruent. 2887 (1969)” (which is incorporated herein by this reference). And).

  Representative methimazole derivatives are synthesized using the following method. Suitably substituted analogs of acetaldehyde are brominated in two positions by treatment with bromine and ultraviolet light. The corresponding diethyl acetal is then made using absolute ethanol. The bromine is then removed from the compound by treatment with anhydrous methylamine or other suitable amine in a sealed tube (about 120 ° C., about 16 hours). When the resulting amino acetal is reacted with potassium thiocyanate in the presence of hydrochloric acid (steam bath temperature, overnight), a methimazole analog is obtained.

(Table: Structure of compounds)

  The pharmaceutical composition according to the present invention comprises a safe and effective amount of one or more methimazole derivatives or tautomeric cyclic thiones (ie active compounds). Preferred compositions contain about 0.01% to 25% active compound, and more preferred compositions contain about 0.01% to 10% active compound. The pharmaceutical composition according to the present invention can be administered by any known method, for example, intraperitoneally, intravenously, intramuscularly or locally, but is preferably administered orally. A preferred composition is a single dosage form, i.e. a pharmaceutical, available in a fixed pre-measured form suitable for a single dose, such as a pill, tablet or ampoule, which does not require the user to measure each dose. It is a composition.

  The pharmaceutical composition according to the present invention further comprises a pharmaceutically acceptable carrier that is compatible with the aforementioned methimazole derivative or tautomeric cyclic thione. In addition to the pharmaceutically acceptable carrier, the pharmaceutical composition can include, for example, additional pharmaceutically active agents, excipients, formulation aids (eg, tableting aids), colorants, Additional compatible ingredients such as flavoring agents, preservatives, solubilizers, dispersants, and other materials known in the art can further be included at technically acceptable levels.

  As used herein, the term “pharmaceutical carrier” means a solid or liquid filler, excipient or encapsulating material. These substances are known in the pharmaceutical field. Substances that can be used as pharmaceutical carriers include, for example, sugar (lactose, glucose, saccharose, etc.), starch (corn starch, potato starch, etc.), cellulose and derivatives thereof (carboxylmethyl cellulose sodium, ethyl cellulose, cellulose acetate). Tragacanth powder, malt, gelatin, talc, stearic acid, magnesium stearate, calcium sulfate, calcium sulfate, vegetable oil (peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, theobroma oil, etc.), polyol (propylene glycol, Glycerin, sorbitol, mannitol, and polyethylene glycol), agar, alginic acid, pyrogen-free water, isotonic saline, and phosphate buffer and other non-toxic substances used in pharmaceutical compositions There is a case to substance. These include liposomes or drug carriers that make lipid or polymer particles (including biodegradable polymers) and include targeted gene transfer applications (eg, binding to antibodies). It may also contain wetting agents and lubricating oils (such as sodium lauryl sulfate) and coloring agents, flavoring agents, tableting agents and preservatives. Formulation of the above components into the pharmaceutical composition is performed using known techniques.

  The pharmaceutical carrier used with the pharmaceutical composition according to the present invention is used to bring it to a concentration sufficient to obtain an administrable particle size. Preferably, the pharmaceutical carrier comprises about 75% to 99.99%, more preferably about 90% to 99.99% of the total weight of the pharmaceutical composition. The methimazole derivatives or tautomeric cyclic thiones defined in the present invention are surprisingly more soluble than when dissolving methimazole in conventional carrier materials. This provides great benefits since the flexibility is improved by making pharmaceutical compositions containing these methimazole derivatives. Also, the amount of active compound used is significantly less.

  The methimazole derivative according to the present invention is administered at a dose in the range of about 0.001 to 100 milligrams, preferably about 0.05 to 50 milligrams per day. The pharmaceutical composition according to the present invention is administered in an appropriate amount such that pharmacological activity is obtained in the bloodstream. The exact dosage required in a given case will depend on, for example, the type of methimazole derivative used, the nature of the disease being treated, and the patient's physique, weight, age and health status.

  The term “pharmaceutically acceptable salts” refers to salts made from pharmaceutically acceptable non-toxic bases or acids (such as inorganic or organic bases and inorganic or organic acids). Salts made from inorganic bases include aluminum, ammonium, calcium, copper, ferric, ferrous, lithium, magnesium, manganese salts, manganese, potassium, sodium, zinc, and the like. In particular, ammonium, calcium, magnesium, potassium, and sodium salts are preferable. Salts made from pharmaceutically acceptable non-toxic inorganic bases include primary, secondary and tertiary amines, substituted amines (including naturally occurring substituted amines), cyclic amines, and basic ion exchange resins. (For example, arginine, betaine, caffeine, choline, N, N′-dibenzylethylenediamine, diethylamine, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethyl-morpholine, N-ethylpiperidine, Glucamine, glucosamine, histidine, hydrabamine, isopropylamine, lysine, methylglucamine, morpholine, piperazine, piperidine, polyamine resin, procaine, purine, theobromine, triethylamine, trimethylamine, tripropylamine, tromethamine There is a salt of). When the compound of the present invention is basic, salts are prepared from pharmaceutically acceptable non-toxic acids, including inorganic and organic acids. Such acids include acetic acid, benzenesulfonic acid, benzoic acid, camphorsulfonic acid, citric acid, ethanesulfonic acid, fumaric acid, gluconic acid, glutamic acid, hydrobromic acid, hydrochloric acid, isethionic acid, lactic acid, maleic acid, Examples include malic acid, mandelic acid, methanesulfonic acid, mucous acid, nitric acid, pamonic acid, pantothenic acid, phosphoric acid, succinic acid, sulfuric acid, tartaric acid, p-toluenesulfonic acid, and the like. In particular, citric acid, hydrobromic acid, hydrochloric acid, maleic acid, phosphoric acid, sulfuric acid, and tartaric acid are desirable. Of course, as used herein, the compounds include pharmaceutically acceptable salts.

  The ability of a therapeutic compound according to the present invention to suppress the activity of VCAM-1 is useful in preventing or ameliorating a symptom, disease or condition caused by binding of VCAM-1 to various ligands (eg, VLA-4). . Thus, these compounds can inhibit rolling and cell adhesion processes, including cell signaling, activation, migration, diffusion and differentiation. Therefore, in an aspect of the present invention, a method for treating a disease, illness, illness or symptom mediated by VCAM-1 binding, cell adhesion and cell activation (including prevention, alleviation, amelioration or suppression method) is effective. There is provided a method comprising administering to a mammal an amount of a compound according to the invention. Examples of the disease, illness, illness or symptom include (1) multiple sclerosis, (2) asthma, (3) allergic rhinitis, (4) allergic conjunctivitis, (5) inflammatory lung disease, (6) Rheumatoid arthritis, (7) septic arthritis, (8) type I or type II diabetes and its macrovascular or microvascular complications (eg, nephropathy, cerebral infarction or myocardial infarction), (9) organ transplant rejection, (10 ) Restenosis, (11) autologous bone marrow transplantation, (12) inflammatory sequelae of viral infection, (13) myocarditis, (14) inflammatory colitis (ulcerative colitis, Crohn's disease, etc.), (15) certain types There are (16) contact skin hypersensitivity, (17) psoriasis, (18) tumor metastasis, (19) thyroiditis, and (20) atherosclerosis.

  The prophylactic or therapeutic dose of the therapeutic compound according to the present invention varies depending on the severity of the patient to be treated, the type of the compound according to the present invention and its administration route. The dose varies depending on the patient's age, weight and responsiveness. In general, the range of daily doses (single or divided doses) is about 0.001 to 100 mg, more preferably 0.01 to 50 mg, most preferably 0.01 to 100 mg / kg body weight of the mammal. 10 mg. However, in some cases, it may be necessary to use dosages outside the above ranges.

  When administered intravenously or intraperitoneally, a suitable range for the therapeutic compound dose of the present invention (daily dose per kg body weight) is about 0.001 to 25 mg (preferably about 0.01 to 1 mg), and for the purpose of cytoprotection, an appropriate range of dosage of the therapeutic compound according to the present invention (daily dose per kg body weight) is about 0.1-100 mg (preferably about 1 -10 mg).

  When administered orally, an appropriate range for the therapeutic compound dose (daily dose per kg body weight) according to the present invention is about 0.01-100 mg (preferably about 0.1-10 mg). For the purpose of cell protection, an appropriate range of the therapeutic compound according to the present invention (daily dose per kg body weight) is about 0.1 to 100 mg (preferably about 1 to 10 mg). , More preferably about 10 to 100 mg).

  When treating eye diseases, an ophthalmic solution for ophthalmic administration containing 0.001 to 1% by weight of a solution or suspension of the therapeutic compound according to the present invention, which is acceptable to the eye, is used. be able to.

  Another aspect of the present invention provides a pharmaceutical composition comprising a compound according to the present invention and a pharmaceutically acceptable carrier. The term “composition”, such as in a pharmaceutical composition, includes a product comprising an active ingredient and an inactive ingredient (pharmaceutically acceptable excipient) that constitutes a carrier. Also, directly or indirectly from the binding, complexation or aggregation of any two or more components, or from the dissociation of one or more components, or from other types of reactions or interactions of one or more components Includes other product materials that are produced. Accordingly, the pharmaceutical composition according to the present invention includes any composition prepared by mixing the composition according to the present invention, an additional active ingredient, and a pharmaceutically acceptable excipient.

  An effective amount of a compound according to the invention is administered to a mammal (especially a human) using any suitable route of administration. Examples of administration routes include oral, rectal, topical, parenteral, ophthalmic, pulmonary, and nasal. Examples of the dosage form include tablets, troches, dispersions, suspensions, solutions, capsules, creams, ointments, aerosols and the like.

  The pharmaceutical composition according to the present invention comprises the compound according to the present invention or a pharmaceutically acceptable salt thereof as an active ingredient, a pharmaceutically acceptable carrier, and optionally other therapeutic ingredients. The term “pharmaceutically acceptable salts” refers to salts made from pharmaceutically acceptable non-toxic bases or acids (inorganic bases, inorganic acids, organic bases, organic acids, etc.).

  The composition of the present invention is suitable for oral, rectal, topical, parenteral (subcutaneous, intramuscular, intravenous, etc.), ocular (eyeball), transpulmonary (aerosol inhalation), or nasal administration. Including a suitable composition. The most suitable route of administration will depend on the nature and severity of the condition being treated and the nature of the active ingredient. The composition according to the present invention is formed into a single dosage form by a method known in the field of pharmaceutical manufacture.

  For administration by inhalation, the compounds according to the invention are used in the form of pressurized packs or nebuliser aerosol sprays. The compounds according to the invention are also used in powder form and are inhaled using a powder inhaler. A preferred delivery system for inhalation is a metered dose inhalation (MDI) made as a suspension or solution of a compound according to the invention in a high-pressure gas (fluorocarbon or hydrocarbon). ) Aerosols and Dry Powder Inhalation (DPI) aerosols made as dry powders of the compounds according to the invention with or without further excipients.

  Suitable topical formulations include transdermal devices, aerosols, creams, ointments, lotions, powders and the like.

  In actual use, the compounds according to the invention are combined with a pharmaceutical carrier by conventional pharmaceutical binding techniques as the active ingredient in intimate mixing. The carrier may take a wide variety of forms depending on the form of preparation desired for administration (eg, parenteral (including intravenous)). When the compound according to the present invention is formulated into an oral dosage form, as an oral liquid formulation (suspension, elixir, solution, etc.), water, glycol, oil, alcohol, flavoring, preservative, coloring agent, etc. Oral solid preparations (powder, capsules, tablets, etc.) include any pharmaceutical medium such as starch, sugar, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrants and other carriers Can be used. Oral solid preparations are preferred over oral liquid preparations. Because tablets and capsules are easy to administer, they are suitable as a single oral dosage form, and solid pharmaceutical carriers are clearly used. If desired, tablets may be coated by standard aqueous or nonaqueous techniques. In addition to the standard dosage forms described above, therapeutic compounds according to the present invention are described, for example, in U.S. Pat. Nos. 3,845,770, 3,916,899, 3,536,809, , 598,123, 3,630,200, and 4,008,719, by controlled release means and / or delivery systems.

  A pharmaceutical composition according to the present invention suitable for oral administration comprises a predetermined amount of the active ingredient as a powder or granule, or as a solution or suspension as an aqueous solution, non-aqueous solution, oil-in-water emulsion, or oil. Obtained as individual units, such as capsules or tablets, contained in the water emulsion. Such compositions are made by any pharmaceutical method, but all methods include the step of bringing into association the active ingredient with the carrier which constitutes one or more necessary ingredients. In general, the compositions are made by uniformly and intimately mixing the active ingredient with a liquid carrier or a finely divided carrier (or both). Thereafter, if necessary, the product is formed into a desired shape. For example, a tablet is made by compression or molding, optionally with one or more accessory ingredients. A compressed tablet is a suitable machine to compress the active ingredient in an easy-to-drink form, such as powder or granules, optionally combined with a binder, lubricant, inert diluent, surfactant or dispersant. Created by. Molded tablets are made by casting in a suitable machine a mixture of the powdered compound soaked in an inert liquid excipient. Desirably, each tablet contains about 1 to 500 mg of active ingredient and each capsule contains about 1 to 500 mg of active ingredient.

The compounds according to the present invention are used in combination with other drugs used for the treatment, prevention, suppression or amelioration of diseases or conditions for which the compounds according to the present invention are useful. Such other drugs are administered simultaneously or sequentially with the compounds according to the invention, such as methimazole derivatives and tautomeric cyclic thiones, by the routes and amounts generally used therefor. When the compound according to the present invention is used simultaneously with one or more drugs, a pharmaceutical composition containing such other drugs in addition to the compound according to the present invention is preferred. Accordingly, the pharmaceutical compositions according to the present invention include those that comprise one or more other active ingredients, in addition to a compound according to the present invention.
Examples of other active ingredients that may be administered separately with Compound I according to the invention or administered together as the same pharmaceutical composition include (but are not limited to): .
(A) VCAM-1 antagonist.
(B) Steroids: for example, beclomethasone, methylprednisolone, betamethasone, prednisone, dexamethasone, hydrocortisone and the like.
(C) Immunosuppressants: for example, cyclosporine, tacrolimus, rapamycin, other FK-506 type immunosuppressants, etc.
(D) Antihistamine (H1 histamine antagonist): for example, bromopheniramine, chlorpheniramine, dexchlorphenylamine, triprolidine, clemastine, diphenhydramine, diphenylpyralin, tripelenamine, hydroxyzine, methodirazine, promethazine, trimeprazine, azatazine, cyproheptazine Antazoline, pheniramine, pyrilamine, astemizole, terfenadine, loratadine, cetirizine, fexofenadine, descarboethoxyloratadine (active metabolite of loratadine) and the like.
(E) Non-steroidal anti-asthma drugs: for example, β2 agonists (terbutaline, metaproterenol, fenoterol, isobuterol, albuterol, vitorterol, salmeterol, pyrbuterol), theophylline, cromoglycate sodium, atropine, ipratropium bromide, leukotriene antagonist (Zafirukast, Montelukast, Pranlukast, Iralukast, Povirukast, SKB-106, 203), leukotriene biosynthesis inhibitors (zileuton, BAY-1005) and the like.
(F) Non-steroidal anti-inflammatory drug (NSAID): for example, propionic acid derivatives (aluminoprofen, profenprofen, bucloxic acid, carprofen, fenbufen, fenoprofen, flurbiprofen, flurbiprofen, ibuprofen, Indoprofen, ketoprofen, myloprofen, naproxen, oxaprozin, pyrprofen, pranoprofen, suprofen, thiaprofenic acid, thiooxaprofen), acetic acid derivatives (indomethacin, acemetacin, alclofenac, clidanac, diclofenac, fenclofenac, fencloz Acid, fenthiazac, flofenac, ibufenac, isoxepac, oxpinac, sulindac, thiopinac, tolmethine, didomethacin, zomepirac), fenam Acid derivatives (flufenamic acid, meclofenamic acid, mefenamic acid, niflumic acid, tolfenamic acid), biphenylcarboxylic acid (diflunisal, flufenisal), oxicam (isoxicam, piroxicam, sudoxicam, tenoxicam), salicylate (acetyl salicylic acid, sulfasalazine), and , Pyrazolone (apazone, bezpiperylon, feprazone, mofebutazone, oxyphenbutazone, phenylbutazone) and so on.
(G) Cyclooxygenase-2 (COX-2) inhibitor: For example, celecoxib and the like.
(H) Type IV phosphodiesterase inhibitor (PDE-IV).
(I) Chemokine receptor antagonists: in particular CCR-1, CCR-2 and CCR-3.
(J) Cholesterol-lowering drugs: for example, HMG-CoA reductase inhibitors (lovastatin, simvastatin, pravastatin, fluvastatin, atorvastatin, and other statins), sequestering agents (cholestyramine, colestipol), nicotinic acid, phenophy Brick acid derivatives (gemfibrozil, clofibrate, fenofibrate, benzafibrate), probucol and the like.
(K) Antidiabetic drugs: for example, insulin, sulfonylurea, biguanide (metformin), a-glucosidase inhibitor (acarbose), glitazone (troglitazone, pioglitazone, englitazone, MCC-555, BRL49653) and the like.
(L) Interferon / beta preparation: For example, beta / interferon, alpha interferon, etc.
(M) Anticholinergic agent: For example, muscarinic antagonist (ipratropium bromide) and the like.
(N) Other compounds: for example, 5-aminosalicylic acid and prodrugs thereof, antimetabolites (azathiopurine, 6-mercaptopurine), cytotoxic cancer chemotherapeutic drugs.
(O) Antibiotics.

  The weight ratio of the therapeutic compound according to the present invention to the second active ingredient depends on the effective amount of each ingredient. In general, an effective amount of each component is used. Thus, when the therapeutic compound according to the present invention is used together with an NSAID, the weight ratio of the therapeutic compound according to the present invention to the NSAID is in the range of about 1000: 1 to 1: 1000, preferably about 200: 1 to The range is 1: 200. Combinations of therapeutic ingredients with other active ingredients are also generally within the above ranges. In any case, however, an effective amount of each active ingredient is used.

  The following examples are intended to illustrate the pharmaceutically active compounds, pharmaceutical compositions and methods of treatment according to the present invention, but are not intended to limit them.

Endothelial Cell Adhesion Molecule (ECAM) expression and the resulting increase in leukocyte adhesion induced by inflammatory cytokines (eg, TNF-α) are pathological It is an important aspect of inflammation. The present invention provides the use of a methimazole derivative having the following actions (i) to (iv) and a tautomeric cyclic thione.
(I) Significantly suppresses the expression of VCAM-1 · mRNA and protein in TNF-α-inducible human aortic endothelial cells (HAEC). And the inhibitory effect with respect to TNF- (alpha) induction | guidance | derivation E-selectin expression is comparatively small, and does not affect ICAM-1 expression.
(Ii) significantly reduce cell adhesion of TNF-α-induced monocytes (U937) to HAEC under in vitro flow conditions similar to those in vivo.
(Iii) TNF-α-inducible interferon regulatory factor-1 (IRF-1) binding to VCAM-1 promoter is suppressed.
(Iv) Reduce IRF-1 expression in HAEC cells, which is TNF-α induced.
In combination, this result shows that methimazole derivatives and tautomeric cyclic thiones reduce TNF-α-induced monocyte cell adhesion to HAEC, primarily by suppressing IRF-1-dependent VCAM-1 expression. Indicates that

  ≪Materials and methods≫

  <Material>

Media 199 (M199), RPMI-1640 (RPMI), and Hanks Balanced Salt Solution (HBSS) (HBSS +) containing Ca ⁺⁺ and Mg ⁺⁺ were all obtained from Biowhittaker (Walkersville, MD). Dulbecco's Phosphate Buffered Saline (PBS) without Ca ⁺⁺ and Mg ⁺⁺ was obtained from KD Medical (Columbia, MD). Heat-inactivated defined fetal bovine serum (FBS) was obtained from Hyclone Laboratories Inc. (Logan, UT). L-glutamine, trypsin-basen solution, penicillin / streptomycin, and non-essential amino acids were all obtained from Biosource International (Camarillo, CA). Endothelial growth factor was obtained from Calbiochem (San Diego, CA). Bovine hypothalamic extract was obtained from Pel-Freeze Biological Inc. (Rogers, AR). Citrate phosphate buffered tablets with gelatin, heparin, DMSO, BSA, O-phenylenediamine dihydrochloride (OPD), and sodium perborate are available from Sigma Chemical Co. (St. Louis, MO). ). Add BSA to HBSS + to produce an assay buffer of HBSS +, 0.5% BSA. Recombinant human TNF-α was obtained from Calbiochem. C-10 is synthesized as described in Richerca (Cleveland, OH) (26). C-10 is made as a 200 mM stock solution in DMSO.

  <Antibody>

Function blocking murine mAb HEL3 / 2 (anti-human E- selectin; IgG ₁₎ are, Dr Raymond T. Camphausen. (Wyeth Laboratories; Cambridge, MA) were provided by. Function-inhibiting mouse mAb 51-10C9 (anti-human VCAM-1; IgG ₁ ) was obtained from BD Phanningen (San Diego, Calif.). Mouse mAb R6.5 (anti-human ICAM-1; IgG _2a ) was provided by Dr. Robert Rothlein (Boehr.ingerIngelheim; Ridgefield, CT). Mouse mAb TS1 / 22 (anti-human LFA-1; IgG ₁ ) was obtained from Endogen (Woburn, Mass.). HRP-conjugated goat F (ab ′) 2 anti-mouse IgG polyclonal secondary antibody (Calbiochem) is used to detect the first mAb in ELISA. Polyclonal antibodies against p50 (sc-1191), p65 (sc-109), p52 (sc-298), c-rel (sc-70), RelB (sc-226), IRF-1 (sc-1041X) are Obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

  <HAEC cell culture and treatment>

  Human Aortic Endothelial Cell (HAEC; Cambrex Bio Science Walkersville, Inc., Walkersville, MD) is 8% FBS, 100 μg / ml heparin, 10 ng / ml endothelial growth factor, 100 μg / ml thalamus. Incubate on M199 supplemented with bottom extract, 2 mM L-glutamine, 1% non-essential amino acids, 100 units / ml penicillin, and 100 μg / ml streptomycin. HAECs are subcultured on gelatin-coated 96-well tissue culture plates (Corning Incorporated; Corning, NY) for viability testing and ELISA. HAEC are also subcultured on gelatin-coated 100 mm tissue culture dishes (BD Falcon; Franklin Lakes, NJ) for Northern blot analysis, Western blot analysis, and EMSA. HAECs are also subcultured on 35 mm tissue culture dishes (Corning) coated with gelatin for adhesion analysis. HAECs are also subcultured on gelatin-coated 24-well tissue culture dishes for luciferase promoter assay (BD Falcon). All experiments are performed with confluent HAEC monolayers. Unless otherwise stated, HAEC are treated with 25 ng / ml TNF-α in the presence or absence of C-10 or 0.25% DMSO (carrier control for C-10) for 2-24 hours. . The DMSO concentration remains constant at 0.25% under all C-10 conditions (unless otherwise stated). Treatment of HAEC with C-10 at the concentrations used in this experiment has little or no effect on HAEC viability by MTS analysis (20) or visual inspection of HAEC monolayers (data is Not shown).

  U937 cells (American Type Culture Collection; Manassas, VA) are cultured on RPMI supplemented with 8% FBS, 2 mM L-glutamine, 100 units / ml penicillin, and 00 μg / ml streptomycin. For adhesion analysis, U937 cells are washed, resuspended in RPMI, and kept on ice until used for flow adhesion analysis (<4 hours).

  <ELISA>

  ELISA is used to elucidate the protein level of ECAM in HAEC in a similar manner as previously described (20). HAEC are washed with cold HBSS +, fixed with 1% formaldehyde at 4 ° C. for 20 minutes, washed with cold HBSS + and incubated with cold M199 containing 8% FBS. Unless otherwise stated, all subsequent antibody dilutions and washings are performed with M199 containing 8% FBS. Mouse mAb (primary mAb) against ECAM is added (10 g / ml) and HAEC is incubated at 4 ° C. for 20 minutes. After incubation, the wells are washed and a peroxidase-conjugated polyclonal (secondary) antibody against mouse IgG is added (diluted 1:50). After incubation at 4 ° C. for 20 minutes, the wells are washed and treated with OPD dissolved in citrate phosphate buffer containing sodium perborate. After incubation at room temperature for 10 minutes, the absorbance of the liquid in each well is measured at 450 nm using a microwell plate spectrophotometer (Molecular Devices; Sunnyvale, CA). In all experiments, each condition is performed in 3 wells.

  <RNA isolation and Northern blot analysis>

Northern blot analysis is used to reveal mRNA levels in the same manner as previously described (27, 29, 33). HAEC is washed with PBS and all RNA is extracted using a commercially available kit (RNeasy Mini Kit; Qiagen Inc .; Valencia, CA). All 12 μg of RNA in each lane is dispersed on a 1% denaturing agarose gel containing 0.66 M formaldehyde. Gels are capillary blotted onto Nytran membranes (Schleicher and Schuell Inc .; Keene, NH), UV cross-linked and used for hybridization. The probe for IRF-1 was described above (33). G3PDH cDNA was obtained from Clontech (Palo Alto, CA). Other probe sequences are synthesized by RT-PCR (33) using the following specific primers. VCAM-1,5'GACTCCGTCTCATTGACTTGCAGCACCACAG3' and 5'ATACTCCCGCATCCTTCAACTGGGCCTTTCG3' (1876bp), E- selectin, 5'JitijiCAGCCATTCCCCTGCTGGAGAGTTC3' and 5'GGGCCAGAGACCCGAGGAGAGTTATCTG3' (977bp), as well as ICAM-1,5'CTCAGGTATCCATCCATCCCAGAGAAGCCTTCC3' and 5'CCCTTGAGTTTTATGGCCTCCTCCTGAGCCTTC3' (1514bp ). The cDNA is labeled with α- ³² P-dCTP using a Ladderman Labeling Kit (Takara Biochemical Inc .; Berkeley, Calif.) (33). Northern blot analysis is performed using a BAS 1500 Bioimaging Analyzer (Fuji Photo Film Co., Ltd. Medical Systems USA Inc .; Stanford, CA). Each experiment is repeated at least twice.

  <Nuclear extract and EMSA>

Nuclear extracts were obtained from harvested HAEC using NE-PER® extraction reagent (Pierce Chemical Co .; Rockford, IL) in the presence of protease inhibitor mixture (PMSF, Leupeptin, Pepstatin-A). Created. Oligonucleotides (Biosynthesis Inc .; Lewisville, TX) are annealed and precipitate the double-stranded oligonucleotide ends labeled with γ- ³² P-ATP using T4 polynucleotide kinase enzyme. The binding reaction (20 minutes, room temperature) consists of a ³² P-labeled probe (activity 100,000 cpm), 3-6 μg HAEC nuclear extract, 1 μg poly (dI-dC), 1 mM DTT, 10% glycerol, and A 1X combined buffer is included. Binding buffer for NF-kB EMSA (1OX) is, 200 mM of HEPES-KOH (pH7.9), KCl of 340mM, MgCl _2, 5mM of EDTA (pH 8.0) of 50 mM, 1% of Triton X-100 It is. The binding buffer (1OX) for IRF-1 EMSA is 100 mM Tris-HCL (pH 7.5), 500 mM NaCl, 50 mM MgCl ₂ , 10 mM EDTA (pH 8.0). In control experiments, nuclear extracts are cultured in a 100-fold molar excess of unlabeled double stranded oligonucleotide. In supershift experiments, nuclear extracts are incubated with 2 μg of the appropriate antibody. After incubation, the reaction mixture is electrophoresed on 1% TBE (50 mM Tris, 50 mM boric acid, and 1 mM EDTA) on a 5% non-denaturing polyacrylamide gel containing 5% glycerol. (160 V, room temperature). The gel is dried and autoradiographed. Each experiment is repeated at least twice.

  <Flow adhesion analysis>

A parallel plate flow chamber similar to that described in McIntire, Smith and colleagues (34) is used for this experiment. Our special setup was described previously (20). A 35-mm tissue culture dish containing a fusible HAEC monolayer is loaded into the flow chamber. After a brief wash, U937 cells (5 * 10 ⁵ cells / ml in assay buffer) are drawn onto the HAEC monolayer with a shear stress of 1.8 dynes / cm ² . To measure the accumulation of U937 cells, after 2.5 minutes of flow, the number of U937 cells attached (rolling or sticking) to the HAEC monolayer was measured in 8 different fields of view, and the results of performing To obtain, averaged and normalized in the field of view. The analysis is performed at least three times. In some experiments, HAECs activated by TNF-α in the absence or presence of C-10 were mAb HEL3 / 2 or 51-10C9 (10 μg / ml), or HEL3 / 2 and 51-10C9. Processed in combination. HAECs treated with mAb are incubated at 37 ° C. for 15 minutes prior to use in adhesion analysis.

  <Dual luciferase analysis>

  Four human VCAM-1 promoter-deficient structures consisting of different lengths -1641 / + 12, -288 / + 12, -228 / + 12, -85 / + 12 bp are amplified by PCR from human genomic DNA. Each upstream primer contains a restriction endonuclease Mlu I site located at the 5 'end of the primer. The downstream primer corresponding to the +12 end contains endonuclease Xho I located at the 5 ′ end. The PCR product was digested with Mlu I and Xho I (New England Biolabs Inc., Beverly, Mass.) And ligated into similarly digested pGL3 basic luciferase reporter vector (Promega, Madison, Wis.). The Cells are transfected with 400 ng of the indicated structure or pGL3 basic luciferase reporter vector as a control for 24 hours using GeneJuice transfection reagent (Novagen Inc., Madison, Wis.). All cells are transfected into the phRL-TIL (Int-) vector (Promega) containing wild type Renilla luciferase (Rluc) as an “internal” transfection control. Luciferase analysis is performed on a Lumat LB 9507 tube luminometer using the Dual-Luciferase Reporter Assay System (Promega). In all experiments, each condition is performed in 3 wells. Each experiment is repeated at least twice.

  <Western blot analysis>

  Whole cell lysate is made up in lysis buffer (150 mM NaCl, 1% IGEPAL CA-630, 50 mM Tris-HCL, pH 8.0). 20 μg of lysate is then dispersed on a 4-12% Bis-Tris PAGE gel using the NuPAGE Bis-Tris System (Invitrogen; Carlsbad, Calif.) Under denaturing conditions. The protein is transferred to a nitrocellulose membrane that is tested by the IRF-1 antibody. Subsequent binding of HRP-conjugated goat anti-rabbit Ab (sc-2054, Santa Cruz Biotechnology, Inc.) is detected using Lumigen PS-3 detection reagent (Amersham Pharmacia Biotech .; Piscataway, NJ).

  <Statistics>

  Single element ANOVA is used to assess the presence of statistical differences. If ANOVA shows a significant difference between multiple conditions, the Bonferroni test is used for multiple pair comparisons. Student's t-test is used to assess statistical differences in luciferase promoter analysis. P values <0.001 (ELISA) and <0.05 (adhesion analysis and luciferase promoter analysis) are considered statistically significant. Unless otherwise stated, all error bars mean standard deviation.

  <Results> The methimazole derivative and the tautomeric cyclic thione significantly suppress the TNF-α-induced VCAM-1 expression, exert a little effect on the E-selectin expression, and suppress the ICAM-1 expression. Has no effect.

  The effects of methimazole derivatives and tautomeric cyclic thiones on TNF-α-induced ECAM expression were examined using arterial endothelial cells (eg, HAEC). Since ECAM profiles differ greatly between endothelial cells treated with TNF-α for 4 hours and endothelial cells treated with 24 hours (6), endothelial cells treated with TNF-α for 4 hours and endothelial cells treated with 24 hours The effect of C-10 on each was investigated. Initially, the effect of C-10 on TNF-α-induced ECAM protein expression in HAEC at 4 and 24 hours was examined. Non-activated HAEC did not appear to express E-selectin or VCAM-1, but expressed ICAM-1 (FIG. 1A). HAEC treated with TNF-α for 4 hours caused E-selectin and VCAM-1 protein expression and greatly increased ICAM-1 protein expression (FIG. 1A). Treatment of HAEC with DMSO (carrier control) (4 hours) had little or no effect on TNF-α-induced E-selectin, ICAM-1 and VCAM-1 protein expression (FIG. 1A). . In contrast, treatment of HAEC with C-10 (4 hours) significantly reduced TNF-α-induced VCAM-1 protein expression (FIG. 1A). This effect was observed when the concentration of C-10 was 0.25 mM (FIG. 1A). Treatment of HAEC with a methimazole derivative and tautomeric cyclic thione for 4 hours had little effect on TNF-α-induced E-selectin and ICAM-1 protein expression (FIG. 1A). Expression at the protein level is similar to expression at the RNA level. In particular, by Northern blot analysis, C-10 decreased TNF-α-induced VCAM-1 mRNA expression and had little effect on E-selectin mRNA expression, depending on the dose. It was revealed that ICAM-1 mRNA expression was not affected at all (FIG. 1B).

  Even in the case of 24 hours, the same result was observed except that an inhibitory effect on E-selectin expression was also observed. Although the E-selectin expression level in HAEC treated with TNF-α for 24 hours was higher than the basal level (FIG. 2A), it was clearly lower than when treated with TNF-α for 4 hours (FIG. 1A). In the case of 24 hours, HAEC activated by TNF-α showed increased levels of ICAM-1 and VCAM-1 compared to non-activated HAEC (FIG. 2A). HAEC treatment with DMSO (24 hours) had little or no effect on TNF-α-induced E-selectin, ICAM-1 and VCAM-1 expression (FIG. 2A). In contrast, HAEC treatment (24 hours) with C-10 significantly reduced TNF-α-induced E-selectin and VCAM-1 expression, but had no effect on ICAM-1 expression. (FIG. 2A). This effect was observed when the concentration of C-10 was ≧ 0.05 mM (FIG. 2A). Again, protein level expression is similar to RNA level expression. In particular, by Northern blot analysis, when C-10 was treated with TNF-α for 24 hours, depending on the dose, TNF-α-induced mRNA expression of VCAM-1 and E-selectin was decreased, and ICAM -1 mRNA expression was found to have little or no effect (FIG. 2B).

  This effect is not limited to the case of C-10, but has been demonstrated by other methimazole derivatives or tautomeric cyclic thiones.

数値は、実験を３回繰り返した平均±ＳＤである。
ＮＤは、実施せず（not done）を意味する。
太字の数値は、大幅な抑制（Ｐ＜０．０５又はそれ以上）を示す。 Table 1. Effect of different concentrations of MMI derivatives or tautomeric cyclic thiones on TNF-α-induced VCAM-1 RNA levels in aortic endothelial cells.

Numbers are mean ± SD of experiments repeated 3 times.
ND means not done.
Numbers in bold indicate significant inhibition (P <0.05 or higher).

  <Methimazole derivative or tautomeric cyclic thione (for example, C10) suppresses monocyte cell adhesion to HAEC activated by TNF-α>

  VCAM-1 is known to play an important role in the adhesion of mononuclear leukocytes to the vascular endothelium (35). This fact, coupled with our finding that C-10 significantly suppresses VCAM-1 protein expression (FIGS. 1A and 2A), methimazole derivatives and mutual interactions in monocyte (U937) cell adhesion to HAEC. Motivated to investigate the effects of mutant cyclic thiones (4 and 24 hours). This experiment used an in vitro flow chamber that replicated the flow conditions in vivo. The concentration of C-10 was 0.5 mM (for 4 hours) and 0.1 mM (for 24 hours), which showed the greatest effect in our ELISA analysis (FIGS. 1A and 2A).

  Initially, mAb inhibition was used to determine which ECAMs are involved in adhesion of U937 cells to HAEC activated by TNF-α treatment (4 hours). A significant number of U937 cells adhered to HAEC activated by TNF-α treatment (4 hours) (column 2; FIG. 3A). On the other hand, U937 cells hardly adhered to non-activated HAEC (column 1; FIG. 3A). Treatment of HAEC activated by TNF-α treatment (4 hours) with 51-1OC9, a function-inhibiting mAb for VCAM-1, did not affect U937 cell adhesion (column 3 vs. column 2; FIG. 3A). ). In addition, treatment of HAEC activated by TNF-α treatment (4 hours) with HEL3 / 2, a function-inhibiting mAb against E-selectin, partially reduced U937 cell adhesion (column 4 versus column 2). FIG. 3A). A further reduction was seen when the HAEC activated by TNF-α treatment (4 hours) was treated with the combination of 51-1OC9 and HEL3 / 2 (column 5 vs. column 4; FIG. 3A). These results suggest that cell adhesion of U937 to HAEC activated by TNF-α treatment (4 hours) is mediated by both E-selectin and VCAM-1. This is consistent with other reports (18).

  The combination of C-10 and mAb against E-selectin (HEL3 / 2) significantly reduces TNF-α-induced U937 cell adhesion (4 hours) (column 6 vs. column 2; FIG. 3A). Furthermore, the combination of C-10 and mAb against E-selectin significantly reduces TNF-α-induced U937 cell adhesion (4 hours) compared to treatment with mAb alone against E-selectin ( Column 6 vs. column 4; FIG. 3A). Treatment with C-10 alone has little effect on TNF-α-induced U937 cell adhesion (4 hours) compared to treatment with DMSO (column 7 vs. column 8; FIG. 3A). ). When combined, these data demonstrate that C-10 has a modest effect on TNF-α-induced cell adhesion of U937 to HAEC (4 hours). This indicates that the mAb data above indicates that mAb requires inhibition of E-selectin and VCAM-1, and at the 4 hour time point shown in FIG. Consistent with the evidence that it has a selective effect on protein expression.

  A more significant effect is observed when TNF-α is activated for 24 hours (FIG. 3B). A significant number of U937 cells adhere to HAEC activated for 24 hours by TNF-α (column 2; FIG. 3B). On the other hand, U937 cells hardly adhere to non-activated HAEC (column 1; FIG. 3B). U937 cell adhesion to HAEC activated by TNF-α for 24 hours depends on both E-selectin and VCAM-1 (column 5 vs. columns 2, 3, 4; FIG. 3B). The combination of C-10 and mAb against E-selectin (HEL3 / 2) greatly reduces TNF-α-induced U937 cell adhesion (24 hours) (column 6 vs. column 2; FIG. 3B). Furthermore, the combination of C-10 and mAb against E-selectin significantly reduces TNF-α-induced cell adhesion of U937 (24 hours) compared to treatment with mAb against E-selectin alone. (Column 6 vs. Column 4; FIG. 3B). In addition, treatment of HAEC with C-10 alone also significantly reduces TNF-α-induced U937 cell adhesion (24 hours) compared to treatment with DMSO (column 7 vs. column 8; FIG. 3B). . Thus, the results described above clearly demonstrate that C-10 significantly reduces long-term (24 hours) TNF-α-induced cell adhesion of U937 to HAEC.

  <Methimazole derivatives or tautomeric cyclic thiones (eg C-10) affect VCAM-1 gene transcription>

  From the above, it is clear that the methimazole derivative suppresses TNF-α-induced VCAM-1 expression under both conditions tested (FIGS. 1 and 2). In order to examine whether a methimazole derivative acts transcriptionally to suppress TNF-α induction and to know the molecular mechanism of C-10 inhibitory action, VCAM-1 promoter / reporter analysis was performed. Carried out. Binding sites for NF-kB, AP-1, SP-1, IRF-1, and GATA, which are various transcription factors known to affect TNF-α-induced human VCAM-1 expression. As shown in FIG. 4, the position exists between -1641 and +12 (8 to 11). Four truncations of the VCAM-1 transcriptional regulatory element were created (−1641 / + 12, −288 / + 12, −228 / + 12, and −85 / + 12 bp constructs) to greatly separate their activity (see FIG. 4). These are then inserted into a luciferase reporter plasmid and transfected into HAEC.

  TNF-α treatment induces an increase in promoter activity in the four constructs (FIG. 4). C-10 treatment suppresses TNF-α induced activity in all four constructs (FIG. 4). Note that the increase in TNF-α-induced promoter activity decreases between the -228 / + 12 and -85 / + 12 bp constructs (Figure 4). The inhibitory effect of C-10 is observed with the −85 / + 12 bp construct (FIG. 4). These data clearly demonstrate that C-10 acts on VCAM-1 gene transcription, and methimazole derivatives and tautomeric cyclic thiones act on the transcriptional regulation that occurs at -85 / + 12 bp of the VCAM-1 promoter. Indicates to do.

  This effect is not limited to the case of C-10, but has been demonstrated by other methimazole derivatives or tautomeric cyclic thiones.

数値は、実験を３回繰り返した平均±ＳＤである。
ＮＤは、実施せず（not done）を意味する。
太字の数値は、大幅な抑制（Ｐ＜０．０５又はそれ以上）を示す。 Table 2. Effects of different concentrations of MMI derivatives or tautomeric cyclic thiones on TNF-α-inducible VCAM-1 promoter activity using hVCAM-1 (-228 to +12) luciferase constitutive activity.

Numbers are mean ± SD of experiments repeated 3 times.
ND means not done.
Numbers in bold indicate significant inhibition (P <0.05 or higher).

  <The methimazole derivative or tautomeric cyclic thione (for example, C10) does not affect the binding activity of TNF-α-induced NF-kB to the VCAM-1 promoter>

The binding site with NF-kB in the VCAM-1 promoter is located at −85 / + 12 bp (FIG. 4) (8, 9, 11). To determine whether the inhibitory effect of C-10 on TNF-α-induced VCAM-1 expression is a result of T-10-NF-inducible NF-kB activity of C-10, EMSA was performed. EMSA uses ³² P-labeled NF-kB probe and 6 μg nuclear extract made from HAEC treated or not treated with TNF-α in the presence or absence of C-10. (Results not shown). When treated for 2 hours with TNF-α, the complex was significantly induced compared to the control without TNF-α treatment. In a control experiment, TNF-α induced complex formation was removed by a 100-fold molar excess of unlabeled NF-kB probe. Addition of 0.5 mM C-10 or DMSO did not affect TNF-α dependent complex formation (data not shown). To identify the components of the complex, supershift experiments were performed using antibodies against various NF-kB subunits. Antibodies against the p50 and p65 subunits of NF-kB supershifted the TNF-α inducible complex. On the other hand, antibodies against p52, c-rel and rel-B did not supershift (data not shown). In addition, the addition of 0.5 mM C-10 has no effect in the supershift experiment (data not shown). Note that DMSO or C-10 treatment alone has no effect on non-activated HAEC. Without wishing to be bound by theory, this data suggests that the mechanism by which methimazole derivatives and tautomeric cyclic thiones repress ECAM expression is due to inhibition of NF-kB activity and binding to the VCAM-1 promoter. It strongly suggests that it is not due to.

  <Metimazole derivative or tautomeric cyclic thione (for example, C10) suppresses the binding activity of TNF-α-induced IRF-I to VCAM-1 promoter>

Luciferase reporter analysis suggested that methimazole derivatives and tautomeric cyclic thiones affect the transcriptional regulation that occurs at -85 / + 12 bp of the VCAM-1 promoter, and by EMSA C-10 is TNF-α. Since it was demonstrated that it does not affect NF-kB activation induced by, we considered the possibility that methimazole derivatives and tautomeric cyclic thiones act at different downstream sites. The binding site for IRF-1 is located downstream of the NF-KB binding site of -85 / + 12 bp and -11 to -1 bp of the VCAM-1 promoter. To investigate whether the inhibitory action of methimazole derivatives and tautomeric cyclic thiones on TNF-α-induced VCAM-1 expression is the result of TNF-α-induced IRF-1 activation by methimazole derivatives and tautomeric cyclic thiones In order to do so, we performed EMSA. EMSA was performed in the presence of C-10 using ³² P-labeled IRF-1 probe (FIG. 5A) and 3 μg of nuclear extract made from HAEC treated or not treated with TNF-α or Performed in the absence (FIG. 5B). Treatment with TNF-α for 2 hours resulted in a complex (lane 3, FIG. 5B) that was very prominent compared to the control without TNF-α treatment (lane 3 vs. lane 2, FIG. 5B). Addition of 0.5 mM and 1 mM C-10 suppresses the formation of TNF-α induced complexes (lanes 4 and 5 vs. lane 3, FIG. 5B). Note that DMSO does not affect TNF-α dependent complexation (lane 6 vs. lane 3, FIG. 5B). In control experiments, a 100-fold molar excess of unlabeled VCAM-1 IRF-1 probe (lane 7, FIG. 5B) or matching IRF-1 probe (lane 9, FIG. 5B) resulted in TNF-α-induced complex formation. Removed. However, control experiments with a 100-fold molar excess of unlabeled VCAM-1 IRF-1 probe (lane 8, FIG. 5B) or matching IRF-1 probe (lane 10, FIG. 5B) showed that TNF-α induced complex formation. Did not affect. Supershift experiments (FIG. 5C) showed that antibodies to IRF-1 supershifted the complex induced by TNF-α (lane 4 vs. lane 3, FIG. 5C). In combination, these data demonstrate that methimazole derivatives and tautomeric cyclic thiones affect IRF-1 binding activity to the VCAM-1 promoter, and methimazole derivatives and tautomeric cyclic thiones are IRF-1-dependent. It strongly suggests that the expression of VCAM-1 is suppressed.

  To further examine and measure the mechanism by which methimazole derivatives and tautomeric cyclic thiones inhibit TNF-α-induced binding of IRF-1 to the VCAM-1 promoter (FIG. 5B), we conducted TNF-α induction. The effects of methimazole derivatives and tautomeric rings on the expression of sex IRF-1 protein and mRNA were investigated. Unactivated HAEC did not appear to express IRF-1 mRNA (FIG. 6A). HAEC treated with TNF-α for 2 hours induces IRF-1 · mRNA (FIG. 6A). Addition of 0.5 mM or 1 mM C-10 reduces TNF-α-induced IRF-1 mRNA expression in HAEC (FIG. 6A). Expression at the RNA level is similar to expression at the protein level. In particular, HA-10 C-10 treatment reduces the protein expression of IRF-1 induced by TNF-α (FIG. 6B). When combined, the data in this section demonstrate that methimazole derivatives and tautomeric cyclic thiones reduce TNF-α-induced IRF-1 protein and mRNA expression.

  These effects are not limited to C-10, but have been demonstrated by other methimazole derivatives or tautomeric cyclic thiones.

数値は、実験を２回繰り返した平均±ＳＤである。
太字の数値は、大幅な抑制（Ｐ＜０．０５又はそれ以上）を示す。 Table 3. Effect of different concentrations of MMI derivatives or tautomeric cyclic thiones on TNF-alpha-induced IRF-1 RNA levels.

Numbers are mean ± SD of experiments repeated twice.
Numbers in bold indicate significant inhibition (P <0.05 or higher).

数値は、実験を２回繰り返した平均±ＳＤである。
太字の数値は、大幅な抑制（Ｐ＜０．０５又はそれ以上）を示す。 Table 4. Effect of different concentrations of MMI derivatives or tautomeric cyclic thiones on TNF-alpha-inducible IRF-1 protein.

Numbers are mean ± SD of experiments repeated twice.
Numbers in bold indicate significant inhibition (P <0.05 or higher).

  <Discussion>

  Through this experiment, we found that C-10, a phenyl derivative of methimazole (a compound commonly used in the treatment of autoimmune disease (Graves' disease)) has a novel anti-inflammatory property. In particular, methimazole derivatives and tautomeric cyclic thiones dramatically suppress TNF-α-induced VCAM-1 mRNA and protein expression and have relatively little inhibitory action on E-selectin expression. It has no effect on -1 expression. Also, the effect on VCAM-1 inhibition is transcriptional, and in an in vitro flow state that is similar to the in vivo flow state, methimazole derivatives and tautomeric cyclic thiones can induce TNF-α-induced monocytes to HAEC. It was found to significantly reduce cell adhesion.

  Some current and potential anti-inflammatory agents reduce leukocyte adhesion by suppressing cytokine-induced ECAM expression at the transcriptional level (5). Not all of these compounds show the same effect on cytokine-induced ECAM expression. For example, lactacystin can reduce itocaine-induced E-selectin, ICAM-1, and VCAM-1 expression (20), while other compounds can be selected for certain ECAMs (eg, VCAM-1 ) (19, 36). The leukocyte adhesion cascade has been demonstrated to have receptor-ligand functional duplication (eg, both E-selectin and VCAM-1 have been shown to support lymphocyte ligation and rolling (37 38)), some compounds that suppress ECAM expression are more effective at inhibiting leukocyte adhesion in various inflammatory situations. In particular, methimazole derivatives and tautomeric cyclic thiones have a large inhibitory effect on the expression of TNF-α-induced VCAM-1 compared to the effects on E-selectin and ICAM-1, and even in the flow state Reduces cell adhesion to the endothelium.

  The present invention suppresses the expression of TNF-α-induced VCAM-1 by a methimazole derivative and a tautomeric cyclic thione independent of NF-kB and dependent on IRF-1. provide. Furthermore, methimazole derivatives and tautomeric cyclic thiones can be used as tools to examine the role of IRF-1 in gene regulation.

  The increase in TNF-α-induced VCAM-1 promoter activity is not significantly altered by deletion of the AP-1 site between −1641 and −288 bp (FIG. 4). This is consistent with the previously described promoter analysis (8) and reports showing that AP-1 action is mediated by the NF-kB element. The apparent loss of TNF-α-induced promoter activity from -288 to -228 bp (Figure 4) is a notable conventional study of other endothelial cell types (8, 42). Interestingly, despite the fact that the NF-kB element is intact in the −85 / + 12 bp structure (FIG. 4), the TNF-α-induced increase in promoter activity is −228 / + 12 and −85. Decrease between / + 12 bp structure.

  In conclusion, the present invention revealed that methimazole derivatives and tautomeric cyclic thiones exhibit anti-inflammatory properties. In particular, phenylmethimazole (i) dramatically suppresses TNF-α-induced VCAM-1 expression in HAEC, has a slight effect on E-selectin expression, and acts on ICAM-1 expression. (Ii) significantly reduce cell adhesion of TNF-α-induced monocytes (U937) to HAEC under in vitro flow conditions similar to in vivo flow conditions; (iii) It was revealed that TNF-α-induced IRF-1 binding activity to the VCAM-1 promoter was suppressed, and (iv) TNF-α-induced IRF-1 expression in HAEC was decreased. Thus, methimazole derivatives and tautomeric cyclic thiones can be used to treat pathological inflammation, particularly diseases associated with VCAM-1 (eg, atherosclerosis, and inflammatory bowel disease).

  <Pharmaceutical composition according to the present invention>

  For treating cell adhesion and inflammatory diseases, a pharmaceutical composition in unit dosage form provides about 0.05 to 60 milligrams (preferably about 0.05 to 20 milligrams) of active compound per day. Is included. The pharmaceutical compositions useful for the administration of the active compounds according to the invention are shown below. These are created using conventional methods.

(Capsule)
Active ingredient: 0.05-20mg
Lactose: 20-100mg
Cornstarch, U. S. P. : 20-100mg
Aerosolized silica gel: 2-4mg
Magnesium stearate: 1-2 mg

(tablet)
Active ingredient: 0.05-20mg
Microcrystalline cellulose: 50mg
Cornstarch, U. S. P. : 80mg
Lactose, U.S. Pat. S. P. : 50mg
Magnesium stearate: 1-2 mg
The tablets can be coated with sugar using conventional techniques. It can also be colored.

(Chewable tablet)
Active ingredient: 0.05-20mg
Mannitol, N.I. F. : 100mg
Fragrance: 1mg
Magnesium stearate, U.S.A. S. P. : 2mg

(Suppository)
Active ingredient: 0.05-20mg
Suppository base: 1900 mg
Dimethyl sulfoxide: 0.1 to 3%

(Liquid)
Active ingredient: 2.0%
Polyethylene glycol 300, N.I. F. : 10.0%
Glycerin: 5.0%
Sodium bisulfite: 0.02%
Sorbitol solution 70%, US S. P. : 50%
Methylparaben, U.S.A. S. P. : 0.1%
Propylparaben, U.I. S. P. : 0.2%
Distilled water, U.S. S. P. (Q.s.): 100.0 cc
Dimethyl sulfoxide: 0.1 to 3%

(Injection)
Active ingredient: 0.05-60mg
Polyethylene glycol 600: 1.0cc
Sodium bisulfite, U.S. Pat. S. P. : 0.4mg
Distilled water for injection (qs): 2.0cc
Dimethyl sulfoxide: 0.1 to 3%

  As mentioned above, although various embodiment of this invention was described, these embodiment is an illustration and does not limit this invention. Therefore, the scope of the present invention is defined only by the claims and their equivalents.

(Reference)
1. Cybulsky, MI, and MA Gimbrone, Jr. 1991. Endothelial expression of a mononuclear leukocyte adhesion molecule during atherogenesis. Science 251: 788-791.
2. Schumann, GM, AE Bishop, P. Facer, M. Vecchio, JC Lee, DS Rampton, and JM Polak. 1995. Increased expression of cell adhesion molecule P-selectin in active inflammatory bowel disease. Gut 36: 411-418 .
3. Luscinskas, FW, and MA Gimbrone. 1996. Endothelial-dependent mechanisms inclironic inflammatory leukocyte recruitment. Annu. Rev. Med. 47: 413-421.
4. Soriano, A., A. Salas, M. Sans, M. Gironella, M. Elena, DC Anderson, JM Pique, and J. Panes. 2000. VCAM-1, but notICAM-1 or MAdCAM-1, immunoblockade ameliorates DSS-induced colitis in mice. Lab. Invest. 80: 1541-1551.
5. Panes, J., M. Perry, and DN Granger. 1999. Leukocyte-endothelial cell adhesion: avenues for therapeutic intervention. Br J Pharsnacol 126: 537-550.
6. Bevilacqua, MP 1993. Endothelial-leukocyte adhesion molecules. Annu. Rev. Immunol. 11: 767-804.
7. Schindler, U., and VR Baichwal. 1994. ThreeNF-kappa B binding sites in the human E-selectin gene required for maximal tumor necrosis factor alpha-induced expression. Mol Cell Biol 14: 5820-5831.
8. Neish, AS, AJ Williams, HJ Palmer, MZ Whitley, and T. Collins. 1992. Functional analysis of the human vascular cell adhesion molecule 1 promoter. J Exp Med 176: 1583-1593.
9. Neish, AS, LM Khachigian, A. Park, VR Baichwal, and T. Collins. 1995. Spl is a component of the cytokine-inducible enhancer in the promoter of vascular cell adhesion molecule-1. J Biol Chenu 270: 28903 -28909.
10. Neish, AS, MA Read, D. Thanos, R. Pine, T. Maniatis, and T. Collins. 1995. Endothelial interferon regulatory factor 1 cooperates with NF-kappa B as a transcriptional activator of vascular cell adhesion molecule 1. Mol Cell Biol 15: 2558-2569.
11. Iademarco, MF, JJ McQuillan, GD Rosen, and DC Dean. 1992. Characterization of the promoter for vascular cell adhesion molecule-1 (VCAM-1). J Biol Chem 267: 16323-16329.
12. Ledebur, HC, and TP Parks. 1995.Transcriptional regulation of the intercellular adhesion molecule-1 gene by inflammatory cytokines in human endothelial cells.Essential roles of a variant NF-kappa B site and p65 homodimers.J Biol Chem 270: 933 -943.
13. Munoz, C., MC Castellanos, A. Alfranca, A. Vara, MA Esteban, JM Redondo, and MO de Landazuri. 1996. Transcriptional up-regulation of intracellular adhesion molecule-1 in human endothelial cells by the antioxidant pyrrolidine dithiocarbamate involves the activation of activating protein-1. J Immunol 157: 3587-3597.
14. May, MJ, and S. Ghosh. 1998. Signal transduction through NF-kappa B. Immunol Today 19: 80-88.
15. Conner, EM, S. Brand, JM Davis, FS Laroux, VJ Palombella, JW Fuseler, DY Kang, RE Wolf, and MB Grisham. 1997. Proteasome inhibition attenuates nitric oxide synthase expression, VCAM-1 transcription and the development of chronic colitis. J Pharmacol Exp Ther 282: 1615-1622.
16. Pierce, JW, MA Read, H. Ding, FW Luscinskas, and T. Collins. 1996. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophiltransmigration. J Immunol 156: 3961-3969.
17. Pierce, JW, R. Schoenleber, G. Jesmok, J. Best, SA Moore, T. Collins, and ME Gerritsen. 1997. Novel inhibitors of cytokine-induced IkBa phosphorylation and endothelial cell adhesion molecule expression show anti-inflammatory effects in vivo. J. Biol. Chem. 272: 21096-21103.
18. Weber, C., W. Erl, A. Pietsch, and PC Weber. 1995. Aspirin inhibits nuclear factor-kappa B mobilization and monocyte adhesion in stimulated human endothelial cells. Circulation 91: 1914-1917.
19. Umetani, M., H. Nakao, T. Doi, A. Iwasaki, M. Ohtaka, T. Nagoya, C. Mataki, T. Hamakubo, and T. Kodama. 2000. A novel cell adhesion inhibitor, K- 7174, reduces the endothelial VCAM-1 induction by inflammatory cytokines, acting through the regulation of GATA. Biochem Biophys Res Commun 272: 370-374.
20. Dagia, NM, and DJ Goetz. 2003. A proteasome inhibitor reduces concurrent, sequential and long term IL-β and TNF-α induced endothelial cell adhesion molecule expression and adhesion. Am. J. Phys. 285: C813-C822.
21. Cooper, DS 1984. Antithyroid drugs. NEngl JMed 311: 1353-1362.
22. Elias, AN, RJ Barr, MK Rohan, and K. Dangaran. 1995. Effect of orally administered antithyroid thioureylenes on PCNA and P53 expression in psoriatic lesions. Int J Dermatol 34: 280-283.
23. Chan, CC, I. Gery, LD Kohn, RB Nussenblatt, E. Mozes, and DS Singer. 1995. Periocular inflammation in mice with experimental systemic lupus erythematosus. A new experimentalblepharitis and its modulation. J Immunol 154: 4830-4835 .
24. Davies, TF, 1. Weiss, and MA Gerber. 1984. Influence of methimazole on murine thyroiditis. Evidence forimmunosuppression in vivo. J ClinInvest 73: 397-404.
25. Wang, P., SH Sun, PB Silver, CC Chan, RK Agarwal, B. Wiggert, LD Kohn, GA Jamieson, Jr., and RR Caspi. 2003. Methimazole protects from experimental autoimmune uveitis by inhibiting antigen presenting cell function and reducing antigen priming. J Leukoc Biol 73: 57-64.
26. Kohn, LD, RWJ Curley, and JM Rice. 2002. Methimazole derivatives and tautomeric cyclic thiones to treat autoimmune diseases. US Patent 6,365, 616.
27. Saji, M., J. Moriarty, T. Ban, DS Singer, and LD Kohn. 1992. Major histocompatibility complex class I gene expression in rat thyroid cells is regulated by hormones, methimazole, and iodide as well as interferon. Clin Endocrinol Metab 75: 871-878.
28. Singer, DS, LD Kohn, E. Mozes, M. Saji, J. Weissman, G. Napolitano, and FD Ledley. 1996. Methods for assessing the ability of a candidate drug to suppress MHC class I expression.US Patent 5,556 , 754.
29. Montani, V., M. Shong, S.1.Taniguchi, K. Suzuki, C. Giuliani, G. Napolitano, J. Saito, M. Saji, B. Fiorentino, AM Reimold, DS Singer, and LD Kohn 1998. Regulation of major histocompatibility class II gene expression in FRTL-5 thyrocytes: opposite effects of interferon and methimazole. Endocrinology 139: 290-302.
30. Mozes, E., LD Kohn, F. Hakim, and DS Singer. 1993. Resistance of MHC class 1-deficient mice to experimental systemic lupus erythematosus. Science 261: 91-93.
31. Wenisch, C., D. Myskiw, A. Gessl, and W. Graninger. 1995. Circulating selectins, intercellular adhesion molecule-1, and vascular cell adhesion molecule-1 in hyperthyroidism. J Clin Endocrinol Metab 80: 2122-2126 .
32. Oren, R., Y. Maaravi, F. Karmeli, G. Kenet, L. Zeidel, A. Hubert, and R. Eliakim. 1997. Anti-thyroid drugs decrease mucosal damage in a rat model of experimental colitis. AlimentPharmacol Ther 11: 341-345.
33.Suzuki, K., A. Mori, KJ Ishii, J. Saito, DS Singer, DM Klinman, PR Krause, and LD Kohn. 1999. Activation of target- tissue immune-recognition molecules by double-stranded polynucleotides.Proc Natl Acad Sci USA 96: 2285-2290.
34. Gopalan, PK, DA Jones, LV McIntire, and CW Smith. 1996. Cell adhesion under hydrodynamic flow conditions. In Current Protocols in Immunology. JE Coligan, AM Kruisbeek, DH Margulies, EM Shevach, and W. Strober, eds. J. Wiley, New York, p. 7.29. 1-7.29. 23.
35. Carlos, T., N. Kovach, B. Schwartz, M. Rosa, B. Newman, E. Wayner, C. Benjamin, L. Osborn, R. Lobb, and J. Harlan. 1991. Human monocytes bind to two cytokine-induced adhesive ligands on cultured human endothelial cells: endothelial-leukocyte adhesion molecule-1 and vascular cell adhesion molecule-1. Blood 77: 2266-2271.
36. Zapolska-Downar, D., A. Zapolski-Downar, M. Markiewski, A. Ciechanowicz, M. Kaczmarczyk, and M. Naruszewicz. 2001. Selective inhibition by probucol of vascular cell adhesion molecule-1 (VCAM-1) expression in human vascular endothelial cells. Atherosclerosis 155: 123-130.
37. Alon, R., H. Rossitier, X. Wang, TA Springer, and TS Kupper. 1994. Distinct cell surface ligands mediate T lymphocyte attachment and rolling on P-and E-selectin under physiological flow. J. CellBiol. 127 : 1485-1495.
38. Alon, R., PD Kassner, MW Carr, EB Finger, ME Hemler, and TA Springer. 1995. The integrin VLA-4 supports tethering and rolling in flow on VCAM-1. J Cell Biol 128: 1243-1253.
39. Ochi, H., J. Masuda, and MA Gimbrone. 2002. Hyperosmotic stimuli inhibit VCAM-1 expression in cultured endothelial cells via effects on interferon regulatory factor-1 expression and activity. Eur J Immunol 32: 1821-1831.
40. Koo, SW, KA Casper, KB Otto, AK Gira, and RA Swerlick. 2003.Iron chelators inhibit VCAM-1 expression in human dermal microvascular endothelialcells.J Invest Dermatol 120: 871-879.
41. Ahmad, M., P. Theofanidis, and RM Medford. 1998. Role of activating protein-1 in the regulation of the vascular cell adhesion molecule-1 gene expression by tumor necrosis factor-alpha.J Biol Chern 273: 4616- 4621.
42.Umetani, M., C. Mataki, N. Minegishi, M. Yamamoto, T. Hamakubo, and T. Kodama. 2001. Function of GATA transcription factors in induction of endothelial vascular cell adhesion molecule-1 by tumor necrosis factor- alpha.Arterioscler Thromb Vasc Biol 21: 917-922.

The methimazole derivative (C-10) remarkably suppresses TNF-α-induced VCAM-1 expression in a short period of time, but little or no TNF-α-induced E-selectin and ICAM-1 expression. No effect at all. E-selectin, ICAM-1, in HAEC not activated in the presence of C-10 or in the presence of one or more and activated with TNF-α for 4 (ELISA) or 24 (mRNA) time, VCAM-1 protein (A) and mRNA (B) levels were measured by ELISA and Northern blot, respectively. (A) The absorbance level indicated by the optical density (450 nm) correlates with the level of ECAM protein (eg E-selectin) in HAEC. All values are mean ± SD in experiments where the experiments were repeated at least 3 times. The mAb against TS1 / 22ni is a negative control. (B) RNA isolated from HAEC was analyzed by Northern blot using appropriate probes for E-selectin, ICAM-1, VCAM-1. A G3PDH probe was used as a loading control. The results show representative examples of experiments performed three times. TNF-α activation indicates activation of HAEC by TNF-α (+) or inactivation (−) before analysis. The treatment indicates C-10, treatment of HAEC with DMSO, or non-treatment (−) during activation with TNF-α. * Indicates p <0.001. C-10 significantly suppresses TNF-α-induced VCAM-1 and E-selectin expression at 24 hours, but has little or no effect on ICAM-1 expression. E-selectin, ICAM-1, VCAM-1 protein (A) and mRNA (B) levels in HAEC activated with TNF-α for 24 hours in the presence of C-10 or in the presence of one or more. , Measured by ELISA and Northern blot, respectively. (A) The absorbance level indicated by the optical density (450 nm) correlates with the level of ECAM protein (eg E-selectin) in HAEC. All values are the mean ± standard deviation of 3 wells. The results show representative examples of experiments performed three times. MAb against TS1 / 22ni is a negative control and shows the same results as in FIG. (B) RNA isolated from HAEC was analyzed by Northern blot using appropriate probes for E-selectin, ICAM-1, VCAM-1. A G3PDH probe was used as a loading control. The results show representative examples of experiments performed three times. TNF-α activation indicates the activation or deactivation (−) of HAEC by TNF-α (+) prior to analysis. The treatment indicates C-10, treatment of HAEC with DMSO, or non-treatment (−) during activation with TNF-α. * Indicates p <0.001. C-10 shows little effect on cell adhesion of HAEC U937 activated with TNF-α for 4 hours, and against HAEC U937 cell adhesion activated with TNF-α for 24 hours. Showed a dramatic effect. HAEC were treated with TNF-α for 4 hours (A) or 24 hours (B) in the presence of C-10 or in the presence of one or more. In some cases, the HAEC is pretreated with mAb prior to adhesion analysis. U937 cells were then perfused with HAEC and the number of U937 cells adhering to HAEC during the last 2.5 minutes of flow was determined. TNF-α activation indicates activation (+) or inactivation (−) of HAEC by TNF-α prior to adhesion analysis. Treatment indicates treatment with 0.5 mM (A) or 0.1 mM (B) C-10, treatment with HASO with DMSO, or non-treatment (−) during activation with TNF-α. mAbs are HEL3 / 2 (E), which is a mAb against E-selectin, 51-1OC9 (V), which is a mAb against VCAM-1, mAb against 51-OC9 (V), which is a mAb against VCAM-1, and mAb against E-selectin. HAEC pretreatment by combination with HEL3 / 2 (V + E), or non-treatment (−) after other treatment and before adhesion analysis is shown. Shear stress = 1.8 dynes / cm ² , n ≧ 3, error bars indicate SEM, # indicates p <0.05. C-10 suppresses TNF-α-induced increase in VCAM-1 promoter activity in HAEC. (Left) The location of the binding sites with various transcription elements known to be involved in TNF-α-induced VCAM-1 expression are -1641 / + 12, -288 / + 12, -228 / + 12, And as a template for creating -85 / + 12 bp structures. (Right side) HAECs are transduced for 24 hours into the 400 ng structure shown on the left side, or the pGL3 basic luciferase reporter vector. All HAECs are transduced into the phRL-TK (Int-) vector containing Renilla luciferase (Rluc) as an “internal” transfection control. HAEC are treated with 10 ng / ml TNF-α for 6 hours in the presence or absence of 0.3 mM C-10. All processing conditions contain 0.3% DMSO. Analysis is performed with a dual luciferase reporter assay system. Luciferase activity expressed in terms of luminescence (relative light unit: RLU) is related to the level of promoter activity. All values are the mean ± standard deviation of 3 wells. The results shown are typical of three separate experiments. Bar 1 shows untreated HAEC, Bar 2 shows HAEC treated with 0.3 mM C-10, Bar 3 shows HAEC treated with 10 ng / ml TNF-α, 4 shows HAEC treated with 10 ng / ml TNF-α in the presence of 0.3 mM C-10. C-10 suppresses the increase in TNF-α-induced increase in binding activity of IRF-1 to the VCAM-1 promoter at 2 hours. (A) Probe sequence used in EMSA. The upper line indicates the binding site. Lower case letters indicate mutated bases. The sense strand sequence of the consensus NF-kβ probe (not shown) is 5 ′ AGTTGAGGGGACTTTCCCAGC3 ′. (B) EMSA or (C) Supershift ESMA made from ³² P-labeled IRF-1 probe and HAEC treated with 10 ng / ml TNF-α in the presence or absence of C-10 Performed with 3 μg of each extract. The results shown are typical of two separate experiments. TNF-α activation indicates activation (+) or inactivation (−) of HAEC by TNF-α before analysis. Treatment indicates treatment with 0.5 mM HAEC, 1 mM HAEC, or DMSO during activation with TNF-α, or untreated (−). Control experiments included unlabeled VCAM-1 IRF-1 probe (VCAM-1 IRF wild type) or VCAM-1 IRF-1 mutant probe (VCAM-1 IRF mutation) or consensus IRF-1 probe (Cons. IRF) or consensus NF-kβ probe (Cons. NF-kβ) or 2 μg of antibody (IRF-1 Ab) against IRF-1 (−) or in the presence of a 100-fold molar excess. C-10 decreases TNF-α-induced IRF-1 expression. The levels of RNA (A) and protein (B) in IRF-1 activated and unactivated with TNF-α in the presence or absence of C-10 were determined by Northern blot analysis and Western blot, respectively. Measured by blot analysis. (A) RNA isolated from HAEC was Northern blot analyzed using the IRF-1 probe. The ethidium bromide stained rRNA was loading controlled. (B) All cell lysates of HAEC were analyzed by Western blot using IRF-1 antibody. Ponceau S staining of the blot after transfer revealed all protein loading (data not shown). TNF-α activation indicates HAEC activation or deactivation (−) by 10 ng / ml TNF-α (+) prior to analysis. C-10 indicates treatment with 0.5 mM HAEC, 1 mM C-10, or DMSO (−) during activation with TNF-α.

Claims (53)

A method for inhibiting cell adhesion in a mammal, comprising:
A method comprising administering to said mammal a pharmaceutical composition containing an amount of a methimazole derivative or tautomeric cyclic thione or a mixture thereof effective to prevent, inhibit or inhibit cell adhesion. A method of treating a disease, illness, illness or symptom mediated by cell adhesion in a mammal, comprising:
A method comprising administering to said mammal a pharmaceutical composition containing an amount of a methimazole derivative or tautomeric cyclic thione or a mixture thereof effective to prevent, inhibit or inhibit cell adhesion. The method of claim 1, comprising:
The disease or illness includes acute lung injury, allergic rhinitis, Alzheimer's disease, arthritis, asthma, atherosclerosis, autoimmune glomerulonephritis, Behcet's disease, cancer, cerebral infarction, chronic hepatitis, cirrhosis, skin anaphylaxis Reaction, cutaneous vasculitis, delayed hypersensitivity reaction, diabetes, disseminated intravascular coagulation syndrome, pulmonary eosinophilic granuloma, gastritis, giant cell arteritis, Graves' disease, hemorrhagic shock, hypertensive vascular disease, thyroid function Hypoxia, inflammatory bowel disease (Crohn's disease, ulcerative colitis), inflammatory skin disease, intestinal infarction, Kawasaki disease (mucocutaneous lymph node syndrome), lymphoid interstitial pneumonia, malaria, meningitis, multiple occurrences Multiple sclerosis, myocardial infarction, organ transplantation (host vs. graft, graft vs. host), polyarteritis nodosa, polymyositis / dermatomyositis, psoriasis, lung infarction, renal infarction, reperfusion injury after ischemia Rickettsia vasculitis, sarcoidosis, sepsis, Sjogren's disease, cerebral infarction, systemic lupus erythematosus, burns, obstructive thromboangitis (Berger's disease), thrombosis, thyroiditis, tuberculosis, vasculitis, and Wegener's granulation A method characterized in that it is one or more of the tumors. A method for preventing, inhibiting or suppressing cell adhesion in a mammal, comprising:
A pharmaceutical composition comprising an amount of a methimazole derivative or tautomeric cyclic thione or a mixture thereof effective to prevent, inhibit or suppress cell adhesion mediated by VCAM-1, and a pharmaceutically acceptable carrier, Administering to said mammal. The method of claim 4, comprising:
The method wherein the cell adhesion is mediated by VCAM-1 and E-selectin. 6. A method according to claim 5, wherein
The method wherein the cell adhesion is IRF-1-dependent VCAM-1-mediated cell adhesion. A method for preventing, inhibiting or suppressing cytokine-induced cell adhesion in mammals, comprising:
A pharmaceutical composition comprising an amount of a methimazole derivative or tautomeric cyclic thione or a mixture thereof effective to prevent, inhibit or suppress cell adhesion mediated by VCAM-1, and a pharmaceutically acceptable carrier, Administering to said mammal. The method of claim 7, comprising:
The method wherein the cell adhesion is mediated by VCAM-1 and E-selectin. The method according to claim 8, comprising:
The method wherein the cell adhesion is IRF-1-dependent VCAM-1-mediated cell adhesion. The method of claim 7, comprising:
The method wherein the cytokine is TNF-alpha. A method according to claim 1, 4 or 7,
A method characterized by being used for preventing, inhibiting or suppressing inflammation associated with cell adhesion. The method of claim 7, comprising:
A method which is used for preventing, inhibiting or suppressing inflammation associated with cytokine-induced cell adhesion. A method according to claim 1, 4 or 7,
Used to prevent, inhibit or suppress cell adhesion associated with immune or autoimmune reactions The method of claim 4, comprising:
Adult respiratory distress syndrome, AIDS, allergic disease, arteriosclerosis, arthritis, asthma, atherosclerosis, cardiovascular disease, retinal detachment, harmful platelet aggregation, inflammation, inflammatory bowel disease, multiple sclerosis, neoplastic Disease, ocular inflammatory disease, osteoarthritis, osteoporosis, psoriasis, localized enteritis, rejection after transplantation, reocclusion after thrombolysis, reperfusion injury, Sjogren's syndrome, skin inflammatory disease, systemic lupus erythematosus, thrombus A method characterized in that it is used to treat or prevent one or more illnesses selected from the group consisting of infectious diseases, type I diabetes, thyroiditis, and wounds. A method according to claim 1, 4 or 7,
The pharmaceutical composition comprises

A method comprising a safe and effective amount of an active compound selected from: and a pharmaceutically acceptable carrier.
However,
Y _{is, H,} C l -C _{4 alkyl,} C l -C ₄ substituted alkyl, NO _2, and phenyl moieties

Selected from the group consisting of
Only one of Y can be the phenyl moiety,
R ¹ is selected from the group consisting of H, OH, C ₁ -C ₄ alkyl, and C ₁ -C ₄ substituted alkyl;
R ² is selected from the group consisting of H, C ₁ -C ₄ alkyl, and C ₁ -C ₄ substituted alkyl;
R ³ is selected from the group consisting of H, C ₁ -C ₄ alkyl, C ₁ -C ₄ substituted alkyl, and CH ₂ Ph;
R ⁴ is selected from the group consisting of H, C ₁ -C ₄ alkyl, and C ₁ -C ₄ substituted alkyl;
X is selected from S and O;
Z is selected from SR ³ , OR ³ and C ₁ -C ₄ alkyl;
When Y is not a phenyl moiety, at least two of R ² and R ³ are C ₁ -C ₄ alkyl;
When Z is alkyl, at least one of Y is NO _2. 16. A method according to claim 15, comprising
A method characterized in that Z is selected from SR ³ and OR ³ . The method according to claim 16, comprising:
A method wherein Z is SR ³ and X is S. The method of claim 17, comprising:
A method wherein Y is H. The method according to claim 18, comprising:
Wherein the R ³ is _C l -C ₄ alkyl. 20. The method according to claim 19, comprising
A method wherein R ³ is methyl. 20. The method according to claim 19, comprising
A method wherein at least one of R ² is methyl. The method of claim 20, comprising:
A method characterized in that both R ² are methyl. 16. A method according to claim 15, comprising
The active compound is represented by the following chemical structural formula:

16. A method according to claim 15, comprising
The active compound is represented by the following chemical structural formula:

16. A method according to claim 15, comprising
The active compound is represented by the following chemical structural formula:

16. A method according to claim 15, comprising
The active compound is represented by the following chemical structural formula:

16. A method according to claim 15, comprising
The active compound is represented by the following chemical structural formula:

The method of claim 17, comprising:
A method wherein one of Y is a phenyl moiety. 27. The method of claim 26, comprising:
A method wherein R ¹ and R ⁴ are H. 28. The method of claim 27, comprising:
A method wherein R ³ is methyl and at least one of R ² is methyl. 30. The method of claim 28, wherein
A method wherein R ³ is H. 30. The method of claim 29, comprising:
A method wherein both R ² are both methyl. 16. A method according to claim 15, comprising
The active compound is

A method characterized in that it is selected from the group consisting of: 16. A method according to claim 15, comprising
The method wherein the pharmaceutical composition is in the form of a prodrug. 16. A method according to claim 15, comprising
The pharmaceutical composition comprises
About 0.01% to 25% active compound;
About 75% to 99.9% of a pharmaceutically acceptable carrier. A method according to claim 1, 4 or 7,
The pharmaceutical composition comprises
A method comprising a safe and effective amount of an active compound represented by the following chemical structural formula:

Where R ² is selected from the group consisting of H, C ₁ -C ₄ alkyl and C ₁ -C ₄ substituted alkyl. 35. The method of claim 34, comprising:
A method wherein R ² is selected from the group consisting of C ₁ -C ₄ alkyl and C ₁ -C ₄ substituted alkyl. 36. The method of claim 35, comprising:
A method wherein R ² is methyl. A method according to claim 1, 4 or 7,
The pharmaceutical composition comprises a safe and effective amount of

A method comprising: a compound selected from: and a pharmaceutically acceptable carrier.
Where Y is H, C ₁ -C ₄ alkyl, C ₁ -C ₄ substituted alkyl, NO ₂ , and phenyl moiety

Selected from the group consisting of
Only one of Y can be the phenyl moiety,
R ¹ is selected from the group consisting of H, OH, halogen, C ₁ -C ₄ alkyl, C ₁ -C ₄ substituted alkyl, C ₁ -C ₄ ester, and C ₁ -C ₄ substituted ester;
R ² is selected from the group consisting of H, C ₁ -C ₄ alkyl, and C ₁ -C ₄ substituted alkyl;
R ³ is selected from the group consisting of H, C ₁ -C ₄ alkyl, C ₁ -C ₄ substituted alkyl, and CH ₂ Ph;
R ⁴ is selected from the group consisting of H, C ₁ -C ₄ alkyl, and C ₁ -C ₄ substituted alkyl;
X is selected from S and O;
Z is selected from SR ³ , OR ³ , S (O) R ³ , and C ₁ -C ₄ alkyl;
When Y is not a phenyl moiety, at least two of R ² and R ³ are C ₁ -C ₄ alkyl;
When Z is alkyl, at least one of Y is NO _2. 38. The method of claim 37, comprising:
The active compound is

Wherein R ⁹ is selected from the group consisting of OH, M, and OOCCH ₂ M;
M is selected from the group consisting of F, Cl, Br, and I. 40. The method of claim 38, comprising:
The active compound is

Where R ¹⁰ is selected from the group consisting of H, NO ₂ , Ph, 4-HOPh, and 4-MP;
M is selected from the group consisting of F, Cl, Br, and I. A method of treating a disease related to vascular adhesion of leukocytes,
(A) identifying a patient suspected of having a disease associated with abnormal adhesion of white blood cells into blood vessels;
(B) a pharmaceutical composition comprising an amount of methimazole derivative or tautomeric cyclic thione or a mixture thereof sufficient to reduce cell surface expression of at least one of VCAM-1 and E-selectin in endothelial cells; Administering to
A method for reducing adhesion of white blood cells into blood vessels. 41. The method of claim 40, comprising:
One or more further active ingredients are used in combination with a compound according to the invention,
(A) a VCAM-1 antagonist,
(B) steroids,
(C) an immunosuppressant,
(D) an antihistamine,
(E) non-steroidal anti-asthma drugs,
(F) non-steroidal anti-inflammatory drugs (NSAIDs),
(G) cyclooxygenase-2 (COX-2) inhibitor,
(H) a type IV phosphodiesterase inhibitor (PDE-IV),
(I) chemokine receptor antagonist,
(J) cholesterol-lowering drugs,
(K) anti-diabetic drugs,
(L) Interferon / beta preparation,
A method comprising administering separately or integrally with a pharmaceutical composition selected from (m) an anticholinergic agent and (n) an antibiotic. A method of screening for a compound capable of preventing, inhibiting or suppressing VCAM-1 mediated cell adhesion or preventing, inhibiting or suppressing inflammation associated with cell adhesion in a mammal, comprising:
(A) contacting the mammal with a test compound;
(B) measuring the effect of the test compound on leukocyte adhesion or migration or both;
(C) determining whether the test compound is an inhibitor of the adhesion or migration or both. 43. The method of claim 42, wherein
Measurement of the action of the test compound
Measurement of IRF-1 • RNA expression level,
Measurement of IRF-1 protein expression level,
Measurement of IRF-1-dependent VCAM-1 promoter activation,
Measurement of cytokine-induced IRF-1 RNA expression levels,
Measurement of cytokine-induced IRF-1 protein expression levels,
Measurement of cytokine-induced IRF-1-dependent VCAM-1 promoter activation,
Measurement of IRF-1 RNA expression level increased by TNF-alpha,
Measurement of IRF-1 protein expression level increased by TNF-alpha, and measurement of IRF-1-dependent VCAM-1 promoter activation increased by TNF-alpha,
Comprising one or more of the following: 43. The method of claim 42, wherein
Measurement of the effect of the test test compound
Measurement of the expression level of VCAM-1 RNA;
Measurement of cytokine-induced VCAM-1 protein expression levels;
Measurement of cytokine-induced VCAM-1 promoter activation,
Measurement of the VCAM-1 RNA expression level increased by TNF-alpha,
Measurement of VCAM-1 protein expression level increased by TNF-alpha, and measurement of VCAM-1 promoter activation increased by TNF-alpha,
Comprising one or more of: A screening method for a compound having a cell adhesion inhibitory action in a VCAM-1-expressing cell,
(A) contacting the test compound with the VCAM-1 expressing cells;
(B) contacting the VCAM-1 expressing cell with a VCAM-1 ligand expressing cell;
(C) measuring the effect of the test compound on the binding of the VCAM-1 expressing cell to the VCAM-1 ligand expressing cell;
(D) determining whether the test compound is an inhibitor of the binding action of the VCAM-1 expressing cell to the VCAM-1 ligand expressing cell. 46. The method of claim 45, comprising:
Before, simultaneously with, or after adding the test compound
The method further comprises a step of contacting a VCAM-1-expressing cell with a cytokine capable of suppressing the expression of VCAM-1. 47. The method of claim 46, comprising:
The method wherein the cytokine is TNF-alpha. 48. The method of claim 47, comprising:
The VCAM-1 expressing cell is
A method characterized in that it is selected from the group consisting of non-immune target tissue cells, endothelial cells, and epithelial cells. 48. The method of claim 47, comprising:
The VCAM-1-expressing cell is a human aortic endothelial cell (HAEC). 48. The method of claim 47, comprising:
The VCAM-1 ligand-expressing cell is a leukocyte. 48. The method of claim 47, comprising:
The method wherein the cells are kept in contact for at least 30 minutes.