JP2007267636A - Method for producing nucleic acid and primer set for nucleic acid amplification - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for producing a nucleic acid, a new primer set to be used therefor, a produced nucleic acid fragment having target sequence and/or nucleic acid fragment having complementary chain, a produced nucleic acid fragment having target sequence and/or a nucleic acid fragment having complementary chain as a probe, a transgenic containing at least a part of the nucleic acid fragment having target sequence and/or nucleic acid fragment having complementary chain introduced therein, a template nucleic acid obtained as an intermediate amplification product; to provide a kit for performing the above method, and a method for acquiring information on a specimen nucleic acid obtained from the object by the hybridization of the nucleic acid fragment having target sequence and/or nucleic acid fragment having complementary chain with a recognizable probe. <P>SOLUTION: The method for producing a nucleic acid comprises (a) the preparation of a specimen nucleic acid, (b) the preparation of a primer for the amplification of the specimen nucleic acid and (c) the production of the nucleic acid having target sequence and/or a nucleic acid containing a nucleic acid having its complementary chain by using the specimen nucleic acid prepared by the step (a) as the first template nucleic acid and reacting under a proper amplifiable condition using the first to fourth primers prepared by the step (b). <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

  The present invention relates to nucleic acid production.

  RNA nucleic acid structures are known to be deeply involved in various biological and / or chemical functions. For example, RNA nucleic acid structures play an important role in transcriptional regulation, such as catalytic function, non-complementary sequence recognition ability, protein binding activity and terminator. Furthermore, RNA nucleic acid structures also cause RNA interference reactions in vivo. RNA nucleic acid structures that play such a broad role are currently attracting attention in a wide range of fields including medical, agricultural, livestock, and fisheries, as well as various research fields that seek themselves. In particular, in recent years, RNA nucleic acids have been artificially produced, and the demand for application and use of artificially synthesized RNA in a wide range of fields including the above-mentioned fields is increasing day by day.

  However, conventional RNA synthesis methods require a great deal of cost and labor for production, and thus cannot fully meet such social needs.

  Examples of conventionally known RNA synthesis methods include the following. For example, a method of directly creating an RNA molecule having a specific nucleic acid sequence, for example, a sequence capable of taking a stem-loop structure, etc. by a chemical polymerization reaction using an oligonucleotide synthesizer; with a transcription promoter region upstream For example, an RNA transcription enzyme or the like is allowed to act on a template DNA prepared using an oligonucleotide synthesizer.

  However, artificial oligonucleotide synthesis commonly used in these methods requires a chemical polymerization reaction, and is therefore very expensive and, in addition, a chain length and / or that can be synthesized efficiently. Arrangement is limited.

  In order to solve such problems, recently, a method for efficiently using a small amount of artificially synthesized DNA as a template for RNA synthesis has been frequently used. In this method, amplification is performed once in a DNA state, and then used as a template for RNA synthesis. A typical example of such a method is a method of performing RNA synthesis after amplifying a region containing a template DNA by PCR. However, this method also requires a large capital investment for amplification, and has the following problems. For example, if an RNA having a stem loop is to be prepared, the structure and sequence in the template DNA hinder normal PCR amplification, and a large amount of unintended by-products are produced. As a result, the purity and production efficiency of the originally intended RNA deteriorate.

  Recently, a LAMP amplification system, which is a simple and highly sensitive method for isothermal amplification of DNA, has been developed. Patent Document 1 reports a method in which a promoter or the like is added to a DNA product prepared by the LAMP method, and a vector is prepared and used as a template DNA for RNA synthesis for introduction into a living organism.

  Since this method uses a strand displacement type DNA polymerase for amplification, it can be amplified in such a way that it is not greatly affected by the sequence composition or structure in the target sequence during amplification. However, RNA structure creation can be performed in the following cases: “when the template DNA contains a promoter region” and “an expression vector containing the promoter region or promoter region after amplification of the template DNA It is limited to the case where the two conditions “when the operation of combining with the above is permitted” are satisfied. Therefore, the arrangements that can be designed and adapted are limited. As a result, since the work of linking the template DNA and the promoter region or the expression vector becomes essential after amplification, it becomes difficult to efficiently and economically create the target RNA structure, and there is a big problem in practical use.

On the other hand, in nucleic acid hybridization detection including a DNA chip, Patent Document 2 reports a LAMP amplification system as a method for producing a simple and highly sensitive detection target. For example, detection by nucleic acid hybridization relating to an LAMP amplified product obtained by the LAMP method has been frequently used in recent years as a technique for detecting a specific nucleic acid sequence. However, when such a LAMP method is used, the following problems arise due to the structural characteristics of the LAMP product. That is, amplification primers and probes must be designed while strictly controlling the position of the target sequence, and the degree of freedom in design is poor. Furthermore, it is necessary to use a loop portion present on the terminal side of the LAMP product for detection. Therefore, the absolute number of molecules used for hybridization is defined by the number of LAMP product molecules, and as a result, the detection sensitivity is limited.
JP 2002-233367 A JP 2005-143492 A

  An object of the present invention is to improve the purity and production efficiency and to efficiently and economically produce a target nucleic acid such as DNA or RNA, and a method for producing a nucleic acid structure for use in the method. A novel primer set, an amplification product nucleic acid produced in the method, a transcription nucleic acid corresponding to the target sequence nucleic acid and / or its complementary strand nucleic acid, a probe comprising at least a portion of the transcription nucleic acid, a detection method using the probe, It is to provide a kit for nucleic acid production and / or detection including the probe and primer set, and an introducer into which at least a part of the amplification product nucleic acid and / or the transcription product nucleic acid is introduced.

  Another object of the present invention is to provide a method for producing a nucleic acid structure that can be used to improve the degree of design freedom and detection sensitivity in creating a detection target for use in nucleic acid hybridization detection, and a novel method for use in the method. A primer set, an amplification product nucleic acid produced in the method, a transcript nucleic acid corresponding to a target sequence nucleic acid and / or a complementary strand nucleic acid thereof, a probe comprising at least a part of the transcript nucleic acid, a detection method using the probe, It is an object to provide a kit for nucleic acid production and / or detection including a probe and a primer set, an introducer into which at least a part of an amplification product nucleic acid and / or a transcription product nucleic acid is introduced.

In order to solve the above problems, the present inventors have found the following means. That is,
A method for producing a nucleic acid comprising the following (a), (b) and (c):
(A) preparing a test nucleic acid;
Here, the test nucleic acid has a target sequence and three arbitrary sequences on the 3 ′ side and 5 ′ side thereof,
The three forward arbitrary sequences 3 ′ to the target sequence include a first forward arbitrary sequence located closest to the target sequence and a second forward arbitrary sequence located 3 ′ to the first forward arbitrary sequence. An array and a third forward arbitrary array located on the 3 ′ side of the second forward arbitrary array;
The three backward arbitrary sequences 5 ′ to the target sequence include a first backward arbitrary sequence located closest to the target sequence and a second backward arbitrary sequence 5 ′ to the first backward arbitrary sequence. And a third backward arbitrary array located on the 5 ′ side of the second backward arbitrary array;
(B) preparing a primer for amplifying the test nucleic acid;
Here, the primer includes a first primer, a second primer, a third primer and a fourth primer,
The first primer has a first priming sequence including a sequence complementary to the second forward arbitrary sequence on the 3 ′ end side, and a sequence homologous to the first forward arbitrary sequence on the 5 ′ end side. And a first functional region that can have any function between the first priming sequence and the first stem-loop forming sequence. And
The second primer comprises a second priming sequence comprising a sequence complementary to the third forward arbitrary sequence;
The third primer has a third priming sequence including a sequence homologous to the second backward arbitrary sequence on the 3 ′ end side, and is complementary to the first backward arbitrary sequence on the 5 ′ end side. A second stem-loop forming sequence including a sequence, and a second functional region that can have any function between the third priming sequence and the second stem-loop forming sequence. And
The fourth primer comprises a fourth priming sequence comprising a sequence homologous to the third backward arbitrary sequence;
(C) The test nucleic acid prepared in (a) above is used as the first template nucleic acid, and the reaction is carried out under suitable amplifiable conditions using the first to fourth primers prepared in (b). By doing so, an amplification product nucleic acid containing at least one target sequence nucleic acid and its complementary strand nucleic acid is produced.

  According to the present invention, a method for producing a target nucleic acid structure, a novel primer set for use in the method, an amplification product nucleic acid produced by the method, and a transcription product corresponding to a target sequence nucleic acid and / or its complementary strand nucleic acid Introduction of nucleic acid, probe containing at least a part of a transcription product nucleic acid, detection method using the probe, nucleic acid production and / or detection kit containing the probe and primer set, amplification product nucleic acid and / or transcription product nucleic acid An introduced body was provided.

1. Explanation of Terms “Nucleic acid” as used herein may include artificial nucleic acids partially or completely artificially synthesized and / or designed, such as naturally occurring DNA and RNA, and mixtures thereof.

  As used herein, “test substance” refers to organisms including eukaryotes and prokaryotes, viruses, viroids, rickettsiae, etc., and tissues derived therefrom, blood, blood cells, urine, feces, semen, saliva, oral cavity Substances derived from natural products including mucous membranes and any other cells, or artificial products having any nucleic acid such as DNA and RNA, partially artificial derivatives thereof and non-naturally occurring artificial nucleic acids, and Any of those mixtures or substances combining them may be used. The term “test nucleic acid” refers to any nucleic acid obtained from the aforementioned test substance.

  As used herein, “template nucleic acid” refers to a nucleic acid having a role as a template when nucleic acid is elongated and / or amplified.

  The “LAMP method” used here is an abbreviation for Loop-Mediated Isothermal Amplification. Four types of primers are set for the six regions of the target gene, and a strand displacement reaction is used to maintain a constant temperature. It is the method of making it react. The LAMP method used in the present invention generally includes a method known to those skilled in the art or a partially modified method. Although the basic description of the LAPM method will be described in a later item, for example, documents such as JP-A-2002-186481 may be referred to. The documents cited here are included in the present invention by this reference.

  The “RT-LAMP” method used here is an abbreviation of Reverse-Transcribed Loop-Mediated Isothermal Amplification. The method is an application of the LAMP method. When the target gene is RNA, synthesis into cDNA is also performed simultaneously with the amplification or with a time difference as desired, and used for detection. is there. Any RT-LAMP known in the art and modifications thereof may be utilized in the present invention.

2. Test nucleic acid and primer An outline of the present invention will be described using one embodiment of the present invention described in FIG. In the figure, sequences complementary to each other are indicated by the presence or absence of the symbols “c” or “C”. That is, for example, “F1c” is a complementary sequence of “F1”.

  In the following description, the description of the test nucleic acid 1 in the test nucleic acid can be read as the test nucleic acid 21 that is the complementary strand. Further, the description of the first to third forward arbitrary arrangements can be read as the first to third backward arbitrary arrangements. That is, it is possible to completely or partially replace descriptions such as primers for the forward arbitrary sequence described later with descriptions for the backward arbitrary sequence. One aspect of the present invention that will become apparent upon such replacement is readily understood by those skilled in the art. Moreover, the aspect which becomes clearer by such replacement is also a preferable aspect included in the present invention.

(1) Test nucleic acid First, a test nucleic acid is prepared from a test substance. As the test nucleic acid, a nucleic acid containing a target sequence may be collected by any method known per se, or may be artificially synthesized by a method known per se. In the embodiment of the present invention, the test nucleic acid is the first template nucleic acid. The test nucleic acid used may be single-stranded or double-stranded. First, the case where a single-stranded test nucleic acid is used will be described.

  Please refer to FIG. The test nucleic acid 1 includes a target sequence 2 in a part thereof. On the 3 ′ side of the target sequence 2 is a first forward arbitrary sequence 3 (hereinafter also referred to as “F1c” or “F1c sequence 3”), and on the 3 ′ side is a second forward arbitrary sequence 4 (hereinafter “ F3c "or" F2c sequence 4 "), and further on the 3 'side, a third forward arbitrary sequence 5 (hereinafter also referred to as" F3c "or" F3c sequence 5 ") is included. The target sequence 2 has a first backward arbitrary sequence 6 (hereinafter also referred to as “B1” or “B1 sequence 6”) on the 5 ′ side, and a second backward arbitrary sequence 7 on the 5 ′ side thereof. (Hereinafter also referred to as “B2” or “B2 sequence 7”), and further on the 5 ′ side, a third backward arbitrary sequence 8 (hereinafter also referred to as “B3” or “B3 sequence 8”) is included.

  When the test nucleic acid is double-stranded, the sequences are complementary to each other. Please refer to FIG. The test nucleic acid 21 includes a complementary sequence 22 of the target sequence 2, and a complementary strand 23 of the first forward arbitrary sequence (hereinafter also referred to as “F1” or “F1 sequence 23”) on the 5 ′ side thereof, 5 ′ The second forward arbitrary sequence 24 (hereinafter also referred to as “F2” or “F2 sequence 24”) is provided on the side, and the third forward arbitrary sequence 25 (hereinafter referred to as “F3” or “F3 sequence 25” is provided on the 5 ′ side thereof. ”). A complementary strand 26 (hereinafter also referred to as “B1c” or “B1c sequence 26”) of the first backward arbitrary sequence is located on the 3 ′ side of the complementary sequence 22 of the target sequence, and a second back is located on the 3 ′ side thereof. Complementary strand 27 of the word arbitrary sequence (hereinafter also referred to as “B2c” or “B2c sequence 27”), and further on the 3 ′ side, complementary strand 28 of the third backward arbitrary sequence (hereinafter referred to as “B3c” or “B3c”). Also referred to as “sequence 28”).

  When the test nucleic acid is double-stranded, amplification is started simultaneously for the two strands. When the test nucleic acid is single-stranded, amplification of the test nucleic acid 1 is started. Since a complementary strand of the test nucleic acid 1 is generated, amplification thereof is also started. Therefore, the test nucleic acid may be single-stranded or double-stranded.

  For example, when the test nucleic acid is double-stranded, it may be completely complementary to the test nucleic acid 1 or may contain a sequence that is not partially complementary. Moreover, the length of the test nucleic acid 1 and the test nucleic acid 21 may be the same or different.

  Hereinafter, when there is no description about the backward arbitrary array, the description about the first to third forward arbitrary arrays 3, 4, and 5 can be read as the first to third backward arbitrary arrays 6, 7, and 8. It is. As such, re-reading allows one skilled in the art to understand the first, second and third backward arbitrary sequences.

  Each forward arbitrary sequence 3, 4, 5 may use a naturally occurring base sequence, may use an artificially designed sequence, or may be a mixture thereof. The length of each forward arbitrary sequence 3, 4, 5 is 5 bases or more, preferably 10 bases or more.

  Here, the length of the test nucleic acid is not particularly limited.

  Selection of the target sequence may be freely selected by the practitioner of the present invention, and may be any arbitrary sequence. The length of the preferred target sequence is not particularly limited. When the embodiment of the present invention is used for detection of microorganisms including bacteria, fungi, protozoa, viruses, viroids, rickettsiae, and the like, the target sequence may be a sequence capable of recognizing a microorganism body corresponding thereto.

  In particular, when nucleic acid detection using a nucleic acid array is used and a target sequence according to an embodiment of the present invention or its complementary strand, or its corresponding transcript nucleic acid is used as a probe or target, the target sequence has about 5 bases. Desirably, the length is about 500 bases, preferably about 10 bases to about 300 bases.

  Here, the practitioner of the present invention may freely select each of the F1c sequence 3, the F2c sequence 4, and the F3c sequence 5. In addition, an interstitial arrangement may optionally be included between these forward arbitrary sequences or between the target sequences. The gap sequence may be deeply related to the nucleic acid molecule structure generated in the primer design described below and the amplification reaction according to the embodiment of the present invention. That is, the forward arbitrary sequence and the backward arbitrary sequence are closely related to the selection of appropriate primers for performing the amplification method according to an embodiment of the present invention. Therefore, the gap sequence in particular will be described after the following primer section and explanation of the nucleic acid production method according to the basic embodiment of the present invention.

(2) Primers In order to amplify the test nucleic acid, there may be four types of primers. Please refer to FIG. Two of the primers are the first primer 9 and the third primer 29, each of which contains three regions. When the reaction is initiated under appropriate conditions, the priming sequences 10 (ie, F2 sequence 10, indicated as “F2” in the figure) and 30 (ie B2 Sequence 30 (denoted as “B2” in the figure) is F2c sequence 4 (denoted as “F2c” in the figure) contained in test nucleic acid 1 and test nucleic acid 2 or the complementary strand of test nucleic acid 1 generated by amplification. And B2c array 27 (denoted as “B2c” in the figure) is annealed. Thereafter, nucleic acid extension using the test nucleic acid as a template is started.

  Another two kinds of primers are the second primer 13 and the fourth primer 33, which are different from the two kinds of primers and may include at least one region. These sequences are the third forward arbitrary sequence 5 (ie, F3c sequence 5, denoted as “F3c” in the figure) and the third backward arbitrary sequence (ie, B3c sequence 28, denoted as “B3c” in the figure). These sequences are complementary to each other, and they are annealed to each of the arbitrary positions and extended, and further double strands are formed while separating and separating the double strands formed by the previous primer.

  Furthermore, the primers used in accordance with embodiments of the present invention will be described in detail. The first and third primers include the following three regions. That is, (a) a priming sequence, (b) a functional sequence, and (c) a stem-loop forming sequence.

(A) Priming sequence See FIG. The first primer 9 (hereinafter also referred to as “primer 9”) that anneals to the test nucleic acid 1 and extends is referred to as the first priming sequence 10 (“F2” in the figure) on the 3 ′ end side thereof, Here, “F2” and “priming sequence 10” are also included. The priming sequence 10 anneals to the F2c sequence 4 (denoted as “F2c” in the figure) of the test nucleic acid 1 and extends in the 5 ′ direction under appropriate conditions. For example, when the test nucleic acid 1 is artificially synthesized, the priming sequence 10 selects and / or designs any known primer that can be used as a primer in the art, and the method of the present invention. May be used. When the test nucleic acid 1 is recovered from a natural test substance and used, any nucleic acid fragment naturally contained in the test nucleic acid may be used as a primer. In that case, the priming sequence 10 is complementary to the F2c sequence 4 which is the second forward arbitrary sequence.

.

(B) Functional region (i) First and second functional regions The functional regions used in the nucleic acid production method according to the embodiment of the present invention are preferably at least two contained in the first and third primers. It may be. Please refer to FIG. The first functional region may be the first functional region 11 included in the first primer 9 between the priming sequence 10 described above and a stem-loop forming sequence 12 described later. Similarly, the second primer 29 may be the second functional region 31 included between the priming sequence 30 and the stem-loop forming sequence 32.

  The first and second functional regions are preferably promoter regions. Due to the presence of the first and second functional regions as the promoter region, the promoter region is arranged at a desired position of the amplification product nucleic acid obtained by the first nucleic acid production method provided in the nucleic acid production method described later. The This makes it possible to easily obtain a desired transcript from the amplification product nucleic acid using this as a template.

  The promoter sequences used as the first and second functional regions may be arranged in either the forward or reverse direction in the first and second primer sequences.

  See FIG. As used herein, “forward” refers to the primer sequence having a 5 ′ to 3 ′ orientation as shown in FIG. 13 (13A), and the direction in which the promoter functions is the 3 ′ direction. Is a promoter sequence (denoted as “Pro” in the figure). In addition, as shown in FIG. 13 (13B), “reverse” as used herein means that the direction in which the promoter functions is 5 ′ with respect to the primer sequence having the direction from 5 ′ to 3 ′. A promoter sequence that is oriented (denoted as “Pro” in the figure). The white arrow in FIG. 13 indicates the promoter and its directionality, and the arrow that appears from the vicinity of the tip of the white arrow indicates the direction in which the promoter functions.

  According to the present invention, preferred examples of the promoter region include, but are not limited to, for example, T7 promoter, T3 promoter, SP6 promoter, RNA polymerase III system U6 promoter, H1 promoter, tRNA promoter, RNA Including a polymerase II system promoter and an RNA polymerase I system promoter.

  The first and second functional regions may be any part of the test sequence, for example, those naturally contained in the target sequence, or may be artificially inserted with natural or artificial sequences. It may be what was done.

  Of course, the first and second functional regions used in the embodiments of the present invention may be sequences other than the promoter as described later, and may be arranged at different positions.

  Further, the first and second functional regions may be understood as regions where an array having functionality can be arranged. That is, the first primer and the third primer always have the first and second functional regions, but the functional sequences must always be arranged in both functional regions. is not.

(Ii) Functional region In a further embodiment of the present invention, the functional region that is preferably used is not limited thereto, but includes a promoter region, a restriction enzyme site-containing sequence, a terminator sequence, a ribozyme coding sequence, It may be a ribozyme recognition sequence and other modification enzyme recognition sequences. The functional region may be included in the first primer and the second primer or the test nucleic acid. Thereby, in order to recover the amplification product nucleic acid including the target sequence nucleic acid and its complementary strand nucleic acid, which will be described in detail later, and their fragments, and the transcription product nucleic acid and its fragment obtained using the amplification product nucleic acid as a template, as desired. It is very advantageous to get

  When the functional region is contained in the primer sequence, it is not necessary to completely anneal to the corresponding test nucleic acid. However, it may have partially complementary and / or homologous sequences and may not be completely complementary and / or homologous sequences.

  The functional region is, but not limited to, about 1 base to about 200 bases, preferably about 2 bases to about 80 bases, and has a base length depending on the type of functional region desired. It may be selected.

  As described above, the most preferable functional region is arranged in the forward or reverse direction as the promoter sequence 11 between the priming sequence 10 and the stem-loop formation 12 as shown in FIG. There may or may not be additional nucleotides between the sequence 10 and the stem-loop formation 12. If such nucleotides are present, they are also referred to as functional regions. A part of the promoter sequence may also share some nucleotides with the priming sequence 10 and / or the stem-loop forming sequence 12. The shared portion may be interpreted as a promoter region or a part of a priming sequence or stem-loop forming sequence.

  Further functional sequences may also be included in the primer.

  For example, under the condition that the first and / or second functional region is a promoter sequence and is linked to the primer sequence in the forward direction at the position 11 and / or 31 in FIG. The primer may be designed so that a restriction enzyme site is arranged as a third functional region and / or a fourth functional region between the end and the 5 ′ end of the promoter region. In addition, the third functional region and / or the fourth functionality is provided between the 3 ′ end of the primer containing the promoter sequence and the 3 ′ end of the promoter region under the condition that the promoter sequence is connected in the reverse direction. The primer may be designed so that a restriction enzyme site is arranged as a region. Further, instead of the restriction enzyme site, a terminator region may be arranged as the third functional region and / or the fourth functional region with the same design.

  Further, as shown in FIG. 13 (13C), the first promoter sequence is connected in the forward direction as the first functional region, and the second promoter sequence is connected in the reverse direction as the third functional region. Also good. In this case, the first and second promoter sequences may be the same sequence or different sequences.

  In the embodiment of FIG. 1 as described above, the functional region is described as the functional region 11 (for example, the promoter sequence 11) for convenience, but the functional region having functionality according to the present invention is a site. It is not limited to exist as a region between the priming sequence 10 and the stem-loop forming sequence 12 as a region.

  That is, as described above, the functional regions in one embodiment of the present invention are the first functional region 11 and the second functional region 31 shown in FIG. 1, but the first and second functional regions are located at other positions. Functional areas may be arranged, and further third and fourth functional areas may be arranged as the third functional area 11 and the fourth functional area 31, and these Functional areas may be arranged in places other than 11 and 31. For example, other positions of the first and second primer sequences or the test nucleic acid may be arranged.

  When the functional region is a restriction enzyme site-containing sequence, terminator sequence, ribozyme coding sequence, ribozyme recognition sequence and other modification enzyme recognition sequence, etc., the functional region may be provided in the functional region 11 and / or 31 of FIG. Priming sequences 10 and / or 30 and / or stem-loop forming sequences 12 and / or 32 may be fully or partially included. Further, it may be contained in other sites of the primer.

  In addition, the functional region may be naturally contained in any part of the test sequence, for example, the target sequence, or may be artificially inserted.

  According to an embodiment of the present invention, preferred examples of the promoter region include, but are not limited to, for example, T7 promoter, T3 promoter, SP6 promoter, RNA polymerase III-based promoter U6 promoter, H1 promoter, tRNA promoter , RNA polymerase II system promoter, RNA polymerase I system promoter and the like.

  According to the embodiment of the present invention, the present invention is not limited to these. Preferred examples of the restriction enzyme site or the restriction enzyme site-containing sequence include type I restriction enzyme recognition and cleavage site, type II restriction enzyme recognition and cleavage site, and the like. Including. Furthermore, it is possible to use a sequence that recognizes the desired sequence and is cleavable, such as a ribozyme coding sequence, a ribozyme recognition sequence, a proteinase and other modified enzyme recognition sequences, etc. Any substance having an action may be used.

  In addition, the amplification product nucleic acid used as a template that can be used for stopping the transcription reaction by run-off transcription, for example, is subjected to a modified enzyme that performs sequence-specific cleavage, such as a restriction enzyme, to react with the template. A sequence having transcription that is naturally terminated by the end of the template generated by cleaving the DNA may be a substance having a catalytic action for nucleic acid cleavage reaction.

  In accordance with the present invention, preferred examples of such terminator sequences include, but are not limited to, sigma factor dependent terminators and sigma factor independent terminators, but the sequence itself or secondary structure is A terminator is generally used as long as it is a sequence that directly stops RNA synthesis, or a sequence that can indirectly stop RNA synthesis by binding to the sequence itself or a third substance to the secondary structure. Even a sequence not referred to as-can be used as a "terminator" in the embodiment of the present invention.

(C) Stem-loop forming sequence An example of a stem-loop forming sequence is shown in FIG. In FIG. 1, the first stem-loop forming sequence 12 (hereinafter also referred to as “stem-loop forming sequence 12”) is arranged on the most 5 ′ side of the primer sequence 9. This array is also referred to as F1c array 12 as shown in FIG.

  Next, the movement of the stem-loop forming sequence 12 during the reaction will be described. Please refer to FIG. The DNA elongation reaction proceeds using the test nucleic acid 1 as a template and starting from the 3 'end of the first primer 9 (FIG. 2 (A)). The third primer 13 ("F3" in the figure) complementary to the third forward arbitrary sequence 5 (denoted as "F3c" in the figure) contained in the double strand of the complementary strand 41 and the test nucleic acid 1 obtained. The DNA extension reaction proceeds from the 3 ′ end of the primer (hereinafter referred to as “primer 13”) (FIG. 2 (C)). As a result, an intramolecular structure in the obtained single strand 41 is formed (FIG. 2 (E)). Here, the stem-loop forming sequence 12 is designed to anneal with the phase sequence (referred to as “F1” in the figure) of the first forward arbitrary sequence 3 existing 5 ′ closest to the target sequence 2. ing.

  The stem-loop forming sequence 12 is, but not limited to, about 5 bases to about 100 bases, preferably about 10 bases to about 60 bases, and designed to obtain a desired intramolecular structure. The

  Here, “intramolecular structure” refers to, for example, a structure formed by annealing in the same molecule represented by annealing of “F1c” and “F1” in FIG. 2 (2E).

  As used herein, “stem-loop forming sequence” refers to a sequence having a sequence complementary to the sequence of a different site in the molecule in order to form an intramolecular structure as shown in FIG. 2 (2E). Say.

  The second primer 13 has a sequence complementary to the third forward arbitrary sequence 5.

  As described above, the primer used in the method according to one embodiment of the present invention has been described. Further, there is a gap sequence between three sequences of a priming sequence, a functional region, and a stem-loop forming sequence or adjacent to each end. May be included. However, the first priming sequence and the second priming sequence, for example, in FIG. 1, the first priming sequence 10 (denoted as “F2” in the figure) and the second priming sequence 30 (denoted as “B2” in the figure) The presence of additional optional sequences at the 3 ′ end of (noted) is undesirable because its function can work well.

  Such a sequence may be an artificially designed sequence or a naturally occurring sequence. The preferred length of such an array as a gap array will be described later.

  Moreover, according to the aspect of the present invention, a method using a loop primer, which is a known method used for increasing the amplification efficiency of the LAMP amplification reaction, may be applied. Here, the loop primer is “the sequence between the B1 region and the B1 region on the 5 ′ end side in FIG. 3 (3G)” or “between the F1 region and the F2 region on the 5 ′ end side in FIG. 3 (32G)”. In the LAMP method, a primer having a sequence complementary to “the sequence of” is called a loop primer. By adding one or more of the above-mentioned loop primers in addition to the four types of primers that are the basis of the LAMP reaction, it is possible to increase the starting point of DNA synthesis and improve the amplification efficiency and amplification speed.

  In addition, the formation of an intramolecular structure in the first nucleic acid production method is very important. In order to form a desired terminal loop structure and perform smooth amplification, it is important to select a forward arbitrary sequence and a backward arbitrary sequence in the test nucleic acid. In particular, the setting of the distance between the first forward arbitrary array and the second forward arbitrary array and the distance between the first backward arbitrary array and the second backward arbitrary array are greatly affected. Accordingly, it is preferred that the distance is from 0 to about 500 bases, preferably from 0 to about 100 bases, most preferably from about 10 to about 70 bases. This distance does not include the arbitrary sequence. Further, in order to obtain intramolecular annealing preferentially, Tm values between the arbitrary sequences in question are (Tm values between F3-F3c between sequences and between B3B3c sequences) ≦ (F2-F2cx between sequences and B2-B2c The arbitrary sequence may be selected so that the Tm value between the two is equal to or less than the Tm value between the F1-F1c sequences and between the B1-B1c sequences (where each symbol such as “F1” and “F1c”). See above and FIG. 1). In addition, according to the aspect of the present invention, the details of the arbitrary sequence and the internal structure of the molecule used in the first nucleic acid production method of the present invention can be conveniently utilized by the conditions in the LAMP method known per se. is there. Therefore, regarding further arbitrary sequences and internal structure of the molecule, refer to literatures regarding the design of arbitrary sequences and primers used in the LAMP method, for example, JP-A No. 2001-309785. This document is incorporated herein by reference.

3. Nucleic acid production method The nucleic acid production method according to the embodiment of the present invention includes a first nucleic acid production method and a second nucleic acid production method.

  In the most basic embodiment, an amplification product nucleic acid is obtained by the first nucleic acid production method, and a transcription product nucleic acid is obtained by the second nucleic acid production method. Specifically, in the first nucleic acid production method, an amplification product nucleic acid is produced by performing an amplification reaction under suitable conditions using the test nucleic acid as the first template. The amplification reaction product nucleic acid is a nucleic acid containing a target sequence nucleic acid and / or a complementary strand nucleic acid thereof or a fragment thereof. Furthermore, in the second nucleic acid production method, it is possible to obtain a transcription product nucleic acid by performing a transcription reaction using the amplification product nucleic acid obtained in the first production as the second template. The transcript nucleic acid includes a nucleic acid corresponding to the target sequence nucleic acid and / or its complementary nucleic acid or fragment thereof.

(1) First nucleic acid production method According to one aspect of the present invention, in the first production method, natural or artificial RNA or DNA or the like is used as a test nucleic acid. By the first nucleic acid production method according to the embodiment of the present invention, it is possible to amplify such a test nucleic acid by using the primer according to the present invention to obtain an amplification product nucleic acid.

  In the first production method, as a preferred amplification method, a LAMP method or RT-LAMP method known per se, or a modified method thereof may be used. As is known, in the LAMP method, DNA is used as a template, and the LAMP product nucleic acid may be DNA. In the RT-LAMP method, RNA is used as a template, and the RT- The LAMP product nucleic acid may be DNA. Such LAMP products should also be understood as “amplified product nucleic acids” according to the present invention. The second production method (details will be described later) using such an amplification product as a template and the product nucleic acid produced by the second production method obtained thereby are also within the scope of the present invention.

  The “appropriate amplification conditions” in the first production method should be at least conditions such as a template, a substrate, an amplification enzyme, a buffer, temperature and pH. For example, when the LAMP method or the RT-LAMP method is used, the reaction temperature may be about 30 ° C. to about 80 ° C., for example, about 50 ° C. to about 70 ° C. About 40 ° C to about 50 ° C, about 50 ° C to about 60 ° C, about 55 ° C to about 60 ° C, about 60 ° C to about 65 ° C, 55 ° C to 60 ° C, or 60 ° C to 65 ° C, preferably Is around 63 ° C. Which reaction temperature is used may be determined depending on the nucleic acid sequence present in the reaction system and conditions such as pH.

  When the LAMP method or the RT-LAMP method is used, the setting of the Tm value of the primer may be a normal value known to those skilled in the art.

  Furthermore, in a further aspect of the present invention, a loop primer known per se may be used in combination with the LAMP method or the RT-LAMP method. In one embodiment of the present invention, by using a loop primer, the amplification time can be advantageously shortened compared to when not using it.

  The nucleic acid containing the target sequence nucleic acid and / or its complementary strand nucleic acid obtained by the first production is useful as a template for further nucleic acid production that can exhibit a unique effect. For example, the nucleic acid containing the target sequence nucleic acid and / or its complementary strand nucleic acid obtained by the first production may be used as a transcription template in the following second production. Alternatively, it may be used as a template in other methods for amplification and production of nucleic acids such as DNA and RNA.

(2) Second nucleic acid production method In a preferred embodiment of the present invention, the amplification product nucleic acid obtained by the first production described above is used as a template, and the functional region according to the present invention is further utilized. A second nucleic acid production method is provided.

  For example, when a single-stranded DNA is obtained as an amplification product nucleic acid, a transcription reaction can be performed using this as a template to obtain a transcription product nucleic acid. In order to obtain the transcript nucleic acid, it is desirable to select a promoter region as the functional region.

  By performing such a second nucleic acid production method, a transcription reaction is performed, and a transcript nucleic acid which is a further aspect of the present invention is obtained. According to the most basic aspect of the present invention, the transcript nucleic acid can be obtained as a transcript nucleic acid consisting of a single-stranded RNA comprising a target sequence nucleic acid and / or a nucleic acid corresponding to a complementary strand nucleic acid or a fragment thereof. These nucleic acids are also included in the scope of the present invention.

  Here, the “condition capable of transcription” may be any condition known per se that allows transcription of RNA based on a template and a promoter.

  In the present invention, the first nucleic acid production method and the second nucleic acid production method described above may be performed simultaneously, sequentially, or at any time. The practitioner may select and use detailed conditions according to the desired manufacturing method and various conditions.

  For example, examples of enzymes necessary for transcription include, but are not limited to, T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, H1 RNA polymerase, U6 RNA polymerase, and the like. The reaction temperature suitable for the transcription reaction may be about 4 ° C to about 100 ° C, preferably about 15 ° C to about 80 ° C.

  In addition, substrates necessary for transcription may be ATP, GTP, CTP, UTP, and the like. Further, derivatives of these substrates may be used. Furthermore, a buffering agent or the like may be used to maintain an appropriate pH.

  In the second nucleic acid production method according to the embodiment of the present invention, the amplification product nucleic acid obtained by the first nucleic acid production method is used as a template. In order to synthesize the amplification product nucleic acid, it is possible to use a functional site provided by the functional region used in the first nucleic acid production method, such as a cleavage site. Since these functional parts have different times to be used depending on the nature of the functions, it is desirable to use them at a time when the functions can be fully utilized.

  In an aspect of the present invention, the second nucleic acid production method comprises the following: 1) Using the amplification product obtained by the first nucleic acid synthesis method as a template nucleic acid, transcription is performed under appropriate conditions allowing transcription. And 2) functioning the functional region used in the first nucleic acid synthesis or a functional site derived therefrom, and 3) producing a transcript by the above 1) and 2).

  In order to function a functional region or a functional site derived therefrom, it is necessary to use it at an appropriate time. For example, when the functional region of the first primer contains a promoter, it may be used at the transcription stage. If the functional region is a restriction enzyme site, the amplification product nucleic acid due to its presence includes a functional site derived from the restriction enzyme site, that is, a cleavage site. Therefore, the amplified product nucleic acid may be treated with an appropriate enzyme prior to or simultaneously with transcription. Further, when the functional region is a terminator sequence for imparting a terminator sequence to the amplification product nucleic acid, it only needs to function during the transcription.

  As used herein, the term “cleavage site” should be cleaved provided by the presence of a restriction enzyme site-containing sequence, a ribozyme coding sequence, a ribozyme recognition sequence and other modifying enzyme recognition sequences as described above. Refers to the site.

(3) One Embodiment of First Nucleic Acid Production Method The primer provided by one embodiment of the present invention can be effectively used particularly in the LAMP method. The LAMP method is a method of amplifying a nucleic acid using a strand displacement reaction. For this purpose, four types of primers are set for the six regions of the target gene and reacted at a constant temperature, and as a result, a nucleic acid consisting of continuous repetitive sequences can be obtained.

  An example of using the basic LAMP method as one embodiment of the present invention will be described with reference to FIGS.

  Please refer to FIG. First, the primer 9 and the test nucleic acid 1 prepared according to the present invention described above are subjected to extension and amplification reactions under appropriate conditions. As a result, F2 and F2c anneal and start to extend (FIG. 2B), and F3 and F3c anneal to start extension simultaneously or non-simultaneously or sequentially (FIG. 2C). ).

  The appropriate conditions may be conditions under which a desired appropriate reaction can be obtained. For example, the reaction condition composition such as temperature, pH, substrate and buffer is a condition under which the amplification reaction by the enzyme used proceeds. There is no particular limitation, and it is not particularly limited. For example, the appropriate condition may be a condition that provides a desired LAMP reaction. The enzyme for extension may be a polymerase known per se and is not limited to the following, but is particularly preferably a strand displacement type DNA polymerase, for example, Bst DNA polymerase and BcaDNA polymerase excluding exonuclease activity. Etc. are examples. However, various mutants of these enzymes can be used in the present invention as long as the mutant has sequence-dependent complementary strand synthesis activity and strand displacement activity.

  Examples of suitable temperatures are about 4 ° C to about 100 ° C, preferably about 20 ° C to about 95 ° C.

  The substrate present in the reaction system may be a dNTP mixture, an NTP mixture, or the like according to the reaction, or may be an artificially synthesized substrate.

  The pH is about 2 to about 11, preferably about 5 to about 10. Buffers for maintaining the preferred pH may be included, such as phosphorus buffer, Tris buffer, and Hepes buffer.

  By the reaction shown in FIG. 2C, double strands of the test nucleic acid 1 and the synthetic nucleic acid 42, which are templates as shown in FIG. 2D, and a single-stranded extended strand 41 separated by F3 are obtained. It is done. In addition, since the extended strand 41 has a complementary sequence on the 5 ′ end side, a nucleic acid 43 having an intramolecular structure is generated (FIG. 2E).

  Next, refer to FIG. 3 (3E). The obtained nucleic acid 43 is subsequently subjected to an extension reaction as a template nucleic acid of the primer 29 (also referred to herein as “third primer”), whereby an extended chain 44 is formed. This reaction generates a double-stranded nucleic acid 45 (FIG. 3 (3F)). The double-stranded nucleic acid 45 is peeled off by the primer 33 to generate a single strand 47.

  Since the obtained single strand 47 has complementary sequences on the 5 'end side and 3' end side, a loop nucleic acid 48 having an intramolecular structure with loops on both ends is obtained (FIG. 3 (3G)).

  Even when the test nucleic acid is double-stranded, the single strand 50 (FIG. 3 (32F)) is obtained through the same process for the complementary strand generated by amplification of the single-stranded test nucleic acid. The loop nucleic acid 51 (FIG. 3 (32G)) is obtained through a further process. This complementary strand also undergoes amplification similar to that of the test nucleic acid 1 in the amplification cycle described later.

  In the method according to the preferred embodiment of the present invention, the following amplification cycle is further performed. Please refer to FIG.

  As shown in FIG. 4 (4A), the loop nucleic acid 48 obtained in FIG. 3 (3G) has a probe 49 (referred to as the “third primer” in the above description) using F3 at the 3 ′ end as a starting point as a template. Nucleic acid elongation). Along with this extension, the loop which is the intramolecular structure at the 5 'end is peeled off. Similarly, the complementary loop nucleic acid 51 shown in FIG. 4 (4B) is also nucleic acid extended by the probe 52 (also referred to as “third primer” above).

  The nucleic acids shown in FIGS. 4 (4C) and (4D) are intermediates 53 and 54 obtained after the extension reaction of FIG. 4 (4A). After extension with the first and third primers, stripping with the second and fourth primers is repeated. Ultimately, a LAMP product, for example, a LAMP product 55, containing a homologous sequence and a complementary sequence with respect to the target sequence alternately and repeatedly is obtained. This LAMP product 55 is an amplification product nucleic acid provided as one embodiment of the present invention.

  Assuming that the third primer used in the first nucleic acid production method is the primer 56 shown in FIG. 4 (4E), the obtained amplification product nucleic acid contains a promoter region described below. Amplified product nucleic acid 55 is obtained. The third primer 56 includes a promoter region (denoted as “Pro” in the figure) connected to the functional region in the reverse direction.

  Accordingly, the promoter is always arranged between the sequence B2 and the sequence B1C, which are repeatedly present in the obtained amplification product nucleic acid 55. The promoter is indicated by a thick white arrow in the figure. It should also be understood that additional sequences are present on the 3 'and 5' sides of the amplified product 55.

  Here, in the above description, it has been described that the amplification product nucleic acid 55 is obtained when the third primer is the primer 56 shown in FIG. 4 (4E). However, the sequence of the minimum unit of the amplification product nucleic acid is not necessarily limited. This is not always the case. That is, in the amplified product nucleic acid 55, from the 3 ′ side, the minimum unit for convenience here is arranged as follows: “F1-F2C-F1C”, target sequence (or its complementary sequence), “B1-B2” -B1C ", target sequence complementary sequence (or target sequence)," F1-F2-F1C ", target sequence (or its complementary sequence)," B1-B2C-B1C ", target sequence complementary sequence (or target sequence) , “F1-F2C-F1C”, target sequence (or its complementary sequence), “B1-B2-B1C”. However, although this sequence does not necessarily occur, although the “target sequence” and the “complementary strand of the target sequence” are alternately repeated, the region between the target sequence / the complementary strand of the target sequence (the above “ The order and the period of the regions described in FIG. 2 depend on the terminal structure at the time of LAMP amplification, and thus have some variations, and may not necessarily have a fixed sequence and / or period. Accordingly, it will be understood by those skilled in the art that the amplification product nucleic acid 55 shown in FIG. 4 (4E) is one example. Accordingly, the same can be said for the amplification product nucleic acids shown in FIGS. 6, 7, 8, 9, 10, and 14 described later.

  Such an amplification product nucleic acid is advantageously used in a second nucleic acid production method using it as a template DNA.

(4) One aspect of the second nucleic acid production method As described above, the amplification product nucleic acid obtained by the first nucleic acid production contains a functional region. By using the amplification product nucleic acid and the functional region, the second nucleic acid production method can be performed. A second nucleic acid production method is performed using the amplification product nucleic acid 55 described in FIG. 4 (4E) as a template DNA. Thus, it is a preferable example in the second nucleic acid production method that at least one of the functional regions is a promoter region.

  As shown in FIG. 4 (4E), the obtained amplification product nucleic acid 55 contains the first backward arbitrary sequence on the 5 ′ side of the homologous sequence (“B2” in the figure) of the second backward arbitrary sequence. Promoter connected in the 5 'direction to the 3' side of the complementary sequence of the sequence ("B1C" in the figure) (In the figure, the approximate position of the promoter sequence is surrounded by an ellipse with a broken line. Also, the promoter sequence is outlined. (Indicated by a thick arrow). By using this promoter and performing transcription under appropriate conditions allowing transcription, synthesized RNA can be obtained. This transcription is achieved in almost all the positions of the promoter in the amplification product nucleic acid. In the case of the example shown in FIG. 4 (4E), transcription starts from two places, and as a result, a desired nucleic acid fragment is formed. In this example, the number of probes shown in the drawing is two, but there are actually as many promoters as amplified. Thus, it is possible to obtain a very large number of desired transcripts in the transcript nucleic acid.

(5) Conventional transcripts See FIG. The conventional amplification product nucleic acid shown in FIG. 5 is obtained by performing a conventional LAMP method using a conventional primer. Conventional methods can only have one at the end of the LAMP product molecule that writes the RNA synthesis origin. That is, in FIG. 5, only the region of the arrow 61 shown on the 3 ′ end side is the transcription starting point. Accordingly, the amount of product obtained by transcription is limited in the length and type of the obtained transcription product.

4). Example of Primer Design and Second Nucleic Acid Production Method in First Nucleic Acid Production Method According to one embodiment of the present invention, a first nucleic acid production method is performed using a primer containing a promoter as a functional region. An example of the second nucleic acid production method using the amplification product nucleic acid obtained by the above as a template is shown as a design example below.

(1) First Design Example Refer to FIG. 6 (6A). In this embodiment, the primer containing a promoter as a functional region is the third primer. It is sandwiched 5 'to the B2 region (denoted as "B2" in the figure) that is the priming sequence of the third primer and 3' to the B1C region (denoted as "B1C" in the figure) that is the stem-loop forming sequence. The promoter region is connected in the reverse direction.

  Using such a third primer, the first nucleic acid production method is performed as described above. As a result, the amplification product nucleic acid obtained is the amplification product nucleic acid 70 shown in FIG. 6 (6B).

  The amplification product nucleic acid 70 obtained by using the primer as described above has a sequence B2 homologous to the second backward arbitrary sequence (ie, “B2”) of the amplification product nucleic acid and the first backward arbitrary sequence. It is designed so that the sequence B1C complementary to the sequence (ie, “B1C”) is connected in the reverse direction.

  The promoter regions 71a and 71b are shown by thick white arrows in the figure and surrounded by a broken line.

  Specifically, the first primer designed without function in the first functional region, the third primer shown in FIG. 6 (6A) designed as described above, the second and second primers The amplification reaction of the primer No. 4 and the test nucleic acid further comprising DNA is carried out together with an enzyme, a buffer solution, a substrate and the like under conditions that provide an appropriate amplification reaction. An amplification product nucleic acid 70 as described in FIG. 6 is obtained.

  Subsequently, the transcription reaction is carried out under the condition that an appropriate transcription reaction is obtained together with the enzyme, the buffer solution, the substrate and the like using the amplification product nucleic acid 70 as a template.

  In this way, transcription product nucleic acids 72a and 72b are obtained by performing a transcription reaction using the promoter regions 71a and 71b using the amplification product nucleic acid 70 as a template.

  According to such an embodiment, a DNA having a form in which one or more promoter regions 71 (two representative positions 71a and 71b are shown in the figure) is incorporated for each amplification unit of the so-called LAMP product. Can do. As a result, during the transcription reaction using this DNA as a template, a plurality of transcription origins are generated for one molecule of LAMP product, which is more efficient than the conventional method as shown in FIG. It is possible to provide a reaction. As shown in FIG. 6, in this embodiment, the synthesized RNA obtained by the transcription reaction can be obtained as, for example, transcription products 72a and 72b.

  Here, “amplification unit of LAMP product” refers to a range including two target sequences and two complementary strand sequences.

  In the above design, in order to simplify the explanation, the promoter region is arranged only in the second functional region of the third primer, and the first functional region of the first primer has functionality. Although no example has been shown, it is possible to actually design in this way, and it is also possible to incorporate a promoter region into the first functional region of the first primer, in which case the transcription It is possible to further increase the RNA synthesis starting point, and to achieve more RNA synthesis.

(2) Second Design Example Refer to FIG. According to this embodiment, the first functional region of the first primer is not functionalized, but a desired functional restriction is imposed on the amplification product nucleic acid as a third functional region in any part of the first primer. It can be designed like the first primer 84 provided with a sequence for providing an enzyme site. Other than that, the same primer as the above-mentioned 1st design example is prepared. That is, as in the first design example, the second functional region of the third primer is designed by connecting the promoter in the reverse direction between the sequences B2 and B1C (FIG. 7 (7A)). As described above, the first primer 84 has, as the third functional sequence region, a restriction enzyme site from the vicinity of the 3 ′ end of the first priming sequence (denoted as “F2” in the figure) to the first stem − It is given until the front of the 3 ′ end of the loop array (FIG. 7 (7C)). The other second and fourth primers are the same as in the first design example described above, and are designed to include a sequence complementary to the third forward arbitrary sequence and a sequence complementary to the third backward arbitrary sequence. To do.

  Thereafter, the amplification reaction is carried out under conditions for obtaining an appropriate amplification reaction together with the test nucleic acid, the first to fourth primers, the enzyme, the buffer solution, the substrate and the like. As a result, the amplification product nucleic acid 81 shown in FIG. 7 (7B) is obtained. The amplification product nucleic acid 81 includes restriction enzyme sites 82a, 82b, and 82c due to the action of the third functional region of the first primer for providing restriction enzyme sites.

  In the case of this embodiment, the restriction enzyme site preferably has a third functional sequence for providing it from the 3 ′ end of the first primer 84 to the 3 ′ end of the first stem-loop sequence. It is arranged so that it is included in between. As a result, as shown in FIG. 7 (7B), the restriction enzyme sites are arranged at positions 82a, 82b, and 82c.

  When such an amplification product nucleic acid 81 is used as a template in the second nucleic acid production method, it must be previously digested under appropriate conditions using a restriction enzyme capable of recognizing and cleaving the restriction enzyme site. Is preferred. Thereafter, the cleaved amplification product nucleic acid 81 is used as a template, and a transcription reaction is performed together with an enzyme, a buffer solution, a substrate, and the like under conditions that provide an appropriate transcription reaction.

  The transcript nucleic acid thus obtained is described in FIG. 7 as RNA 83a and 83b to be transcribed, but not limited to this, a large amount of the transcript nucleic acid can be obtained.

  In the above description, the example in which the first functional region of the first primer is not functionalized has been described. However, a further promoter region may be incorporated in the first functional region, thereby increasing the number of the first functional region. It is possible to generate a transfer origin.

  Further, a restriction enzyme site may be arranged at any position of the third primer, preferably between the 3 'end of the third primer and the 3' end of the promoter region.

  Variations of this aspect as described above are also within the scope of the present invention.

  According to the above-described embodiment and modifications of this embodiment, it is possible to obtain many desired transcript nucleic acids simply and efficiently in a short time.

  Here, an example of a relationship between a promoter sequence arranged in the first or second functional region and a further third functional region such as a restriction enzyme site is described.

The first and / or third primer is arranged with the first and / or second promoter, and the arranged promoter is in the forward direction to the first functional region and / or the second functional region. When included, the third functional region is preferably arranged between the 5 ′ end of the primer containing the promoter region and the 5 ′ end of the promoter region. And / or when the first and / or second promoter is contained in the first functional region and / or the second functional region in the reverse direction, the third functional region is the promoter region It is preferable to arrange between the 3 ′ end of the primer containing and the 3 ′ end of the promoter region.

  Alternatively, the third functional region may be included in the test nucleic acid.

(3) Third Design Example Refer to FIG. According to this embodiment, the first functional region of the first primer is not functionalized, but a desired region of the amplification product nucleic acid is provided as a third functional region in any part of the first primer 94. It is designed to have a sequence that provides a restriction enzyme site. In addition, the second functional region of the third primer 90 is designed by connecting a promoter region between sequences B2 and B1C in the forward direction (FIG. 8 (8A)). Further, the second and fourth primers are the same as those in the first design example described above, and are sequences complementary to the third forward arbitrary sequence and include sequences complementary to the third backward arbitrary sequence. design.

  Thereafter, an amplification reaction is performed in the same manner as in the second design example described above. As a result, the amplification product nucleic acid 91 shown in FIG. 8 (8B) is obtained. The amplification product nucleic acid 91 includes restriction enzyme sites 92a, 92b and 92c due to the action of the third functional region of the first primer for providing a desired restriction enzyme site.

  In the case of this embodiment, preferably, the restriction enzyme site provides a third functional sequence for providing it from the 3 ′ end of the first primer to the front of the 3 ′ end of the first stem-loop sequence. It is arrange | positioned so that it may be included between. As a result, as shown in FIG. 8 (8B), restriction enzyme sites are arranged at positions 92a, 92b, and 92c in FIG. 8 (8B).

  When such an amplification product nucleic acid 91 is used as a template in the second nucleic acid production method, it is preferable to digest in advance using a restriction enzyme capable of recognizing and cleaving the restriction enzyme site in advance under appropriate conditions. . Thereafter, the digested amplification product nucleic acid 91 is used as a template, and a transcription reaction is performed under conditions that allow an appropriate transcription reaction to be obtained together with an enzyme, a buffer solution, a substrate, and the like.

  The transcription product nucleic acid obtained by the complementary strand of the amplification product nucleic acid 91 linked so that the promoter sequence functions appropriately is obtained as RNAs 93a and 93b to be transcribed as described in FIG. 8 (8B). . In addition, many desired transcript nucleic acids can be obtained even in portions not shown in the drawings.

  Furthermore, from the amplified product nucleic acid 91 itself, transcription is initiated by a promoter sequence 96 (indicated by a thick arrow in the figure) connected so as to function properly in the amplified nucleic acid 91, and RNA 95 to be transcribed is transferred. Is obtained.

  In the above description, an example in which the first functional region of the first primer is not functionalized has been described. However, a promoter region may be incorporated in the first functional region, thereby increasing the number of transcription origins. Can be generated.

  In addition, the restriction enzyme site may be arranged at any position of the third primer, preferably between the 5 'end of the third primer and the 5' end of the promoter region.

  Variations of this aspect as described above are also within the scope of the present invention.

  According to the above-described embodiment and modifications of this embodiment, it is possible to obtain many desired transcript nucleic acids simply and efficiently in a short time.

(4) Fourth Design Example Refer to FIG. According to this aspect, no functionality is imparted to the first functional region of the first primer, and a promoter region is disposed in the second functional region of the third primer 100. That is, the promoter sequence is designed to be connected in the reverse direction between sequences B2 and B1C (FIG. 9 (9A)). Furthermore, it is designed such that any part of the third primer is provided with a sequence that gives a desired restriction enzyme site to the amplification product nucleic acid as a third functional region. Preferably, the third functional region of the third primer has a sequence for giving a desired restriction enzyme site to the amplification product nucleic acid from the 3 ′ end of the third primer, ie, the third functional region, , Preferably between the 3 'end of the promoter sequence.

  Using such a third primer 100, the first primer, the second and fourth primers, and the test nucleic acid as a template nucleic acid, appropriate amplification can be obtained together with an enzyme, a buffer solution, a substrate and the like. Perform the amplification reaction under the conditions.

  The obtained amplification product nucleic acid is shown in FIG. 9 (9B). In the amplified product nucleic acid 101, the promoter sequences 102a and 102b are arranged in a reverse direction between B1C which is a complementary sequence of the first backward arbitrary sequence and B2 which is a homologous sequence of the second backward arbitrary sequence. The

  Furthermore, due to the function of the third functional region, restriction enzyme sites 103a, 103b and 103c are added around the homologous sequence of the second backward arbitrary sequence (indicated as “B2” in the figure) and the B2C sequence. (FIG. 9 (9B)).

  When such an amplification product nucleic acid 101 is used as a template in the second nucleic acid production method, a restriction enzyme capable of recognizing and cleaving the restriction enzyme site is used in advance as in the second and third design examples described above. It is preferable to digest under appropriate conditions. Thereafter, the digested amplification product 81 is used as a template and, for example, a transcription reaction is performed with an enzyme such as a transcription polymerase, a buffer solution, a substrate and the like under conditions that allow an appropriate transcription reaction.

  The resulting transcript nucleic acid is shown as transcribed RNA 104a and 104b in FIG.

  These obtained transcript nucleic acids are single-stranded, have sequences complementary to each other at the 5 ′ and 3 ′ ends, and anneal to obtain a stem-loop nucleic acid 105a having an intramolecular structure (FIG. 9 (9C )). The stem-loop nucleic acid 105a shown in FIG. 9 (9D) is a schematic representation of the stem-loop nucleic acid 105a. Not only the stem-loop nucleic acid 105a but also a stem-loop nucleic acid having a similar internal structure (not shown) can be obtained from RNA 104b to be transcribed.

  Such stem-loop nucleic acids can be used as functional RNA molecules such as Pre-miRNA, RNA catalyst and siRNA. According to this embodiment, a nucleic acid having a stem-loop structure can be produced economically and simply.

  Incidentally, the amplification product nucleic acid 101 has a complementary sequence in a certain part. Therefore, it exists as an amplification product nucleic acid 106 having an internal structure as shown in FIG. 9 (9E).

  By using such a method combining restriction enzyme and template cleavage, an RNA structure having a stem-loop structure containing at least one copy of a desired sequence can be efficiently, economically and easily prepared.

  As used herein, the term “restriction enzyme site” includes the meaning of a “restriction enzyme site” that is recognized and cleaved by a specific restriction enzyme. It also means a sequence capable of providing a desired restriction enzyme site. Therefore, in the case of simply “restriction enzyme site”, any meaning may be selected depending on the context and situation.

(5) Fifth design example In any one of the methods described in the design examples (1) to (3) above, it is also possible to add an RNA polymerase terminator sequence to the amplification product nucleic acid obtained. . Thereby, RNA synthesis in the second nucleic acid production method can be stopped at a desired position. Such a method is also within the scope of the present invention.

  As a specific example, a primer may be designed so that a terminator sequence can be incorporated in place of the restriction enzyme site used in the above-described method used in (2) and (3) above. Thereby, an effect similar to the effect of the restriction enzyme site function can be obtained (see FIG. 10).

  The position where the terminator is previously incorporated may be selected and incorporated by the practitioner as desired, but is preferably about 1 base or more, preferably about 5 bases or more downstream from the transcription start point by the promoter.

  For example, when a primer is designed so as to obtain the amplification product nucleic acid 110 shown in FIG. 10 (10A), the result is as follows. That is, a function is not given to the 1st functional region of the 1st primer, and a promoter region is arranged in the 2nd functional region of the 3rd primer. That is, the promoter sequence is designed by connecting in a reverse direction between sequences B2 and B1C. Further, a terminator sequence is arranged 3 'from the promoter of the third primer.

  Conditions under which such a third primer, the first primer, the second and fourth primers, and the test nucleic acid are used as template nucleic acids, together with an enzyme, a buffer solution, a substrate, etc., to obtain an appropriate amplification When the amplification reaction is performed under the condition, the amplification product nucleic acid 110 is obtained.

  Furthermore, by the function of the third functional region, the terminator sequence 112 is added around the complementary sequence (denoted as “B2C” in the figure) of the second backward arbitrary sequence (FIG. 10 (10A)). ).

  When such an amplification product nucleic acid 110 is used as a template in the second nucleic acid production method, for example, a transcription reaction is carried out under conditions where an appropriate transcription reaction reaction is obtained together with an enzyme such as a transcription polymerase, a buffer solution and a substrate. Just do it.

  The transcript nucleic acid 113 obtained thereby is described as RNAs 113a and 113b to be transcribed in FIG. 10 (10B).

  The transcript nucleic acid thus obtained is single-stranded and has a sequence complementary to each other at the 5 ′ and 3 ′ ends, so that they anneal to obtain a stem-loop nucleic acid 114 having an intramolecular structure. (FIG. 10 (10C)).

(6) Sixth design example Refer to FIG. 10 (10D). In this aspect, an example is shown in which, except for the design of the first primer and the third primer, the same procedure as the above (5) fifth design example is performed.

  A function is not given to the first functional region of the first primer, but a terminator sequence is incorporated as a third functional region downstream of the functional region, and the second functional region is incorporated into the third primer. The promoter region is designed to be connected in the reverse direction.

  By performing the first nucleic acid production method in the same manner as in the fifth design example, the amplification product nucleic acid 120 shown in FIG. 10 (10D) is obtained.

  By the function of the third functional region, the promoter sequences 121a and b are added around the complementary sequence of the second backward arbitrary sequence (denoted as “B2C” in the figure) (FIG. 10 (10D)). ). The terminator sequence 122 is added around the complementary sequence (denoted as “F2” in the figure) of the second forward arbitrary sequence (FIG. 10 (10D)).

  By using the amplification product nucleic acid 120 and performing the second nucleic acid production method in the same manner as in the fifth design example, transcribed RNAs 123a and 123b are obtained. The transcribed RNAs 123a and b obtained here are RNA fragments having only one of the target sequence and its complementary sequence. Such nucleic acid fragments can be used for various molecular biological and genetic engineering applications. Typical examples of such nucleic acid fragments are effective as a probe for detecting a target sequence or a target to be detected. Used for.

(7) Seventh Design Example Refer to FIG. Furthermore, as an action of the functional region, a further example of a method in which incorporation of a promoter sequence and template cleavage with a restriction enzyme are combined will be described.

  According to this embodiment, a promoter sequence is linked in the forward direction as the second functional region of the third primer, and a restriction enzyme site is provided between the 5 ′ end of the third primer and the 5 ′ end of the promoter. Except for this, a mode for designing a primer in the same manner as in the fourth design example is provided.

  The third primer 190 is shown in FIG. 14 (14A). A promoter sequence (denoted as “Pro” in the figure) as the second functional region includes a second priming sequence (denoted as “B1C” in the figure) and a second stem-loop forming sequence (denoted as “B2” in the figure). ) And is designed to be connected in a forward direction.

  As described in the above fourth design example, the first nucleic acid production method and the second nucleic acid production method are performed.

  The amplification product nucleic acid 191 obtained by the first nucleic acid production method comprises a promoter sequence 192a, 192b complementary to the first backward arbitrary sequence (denoted as “B1C” in the figure) and the second backward arbitrary sequence. It is given so as to be arranged in the 3 ′ direction between the arrays (denoted as “B2” in the figure). Further, restriction enzyme sites 193a, b and c are added in the form shown in the figure by the action of the third primer.

  In the second nucleic acid production method using the complementary strand of the amplification product nucleic acid 191 as a template, the promoters 192a and b (indicated by the thick white arrows in the figure) function appropriately to obtain RNAs 194a and b to be transcribed. (FIG. 14 (14B)). Since sequences complementary to each other exist at the 3 'end and 5' end of each single-stranded RNA, a stem-loop nucleic acid 195a having an intramolecular structure is formed (FIG. 14 (14C)). This is further modeled by the stem-loop nucleic acid 195b (FIG. 14 (14D)).

  Further, in the second nucleic acid amplification method using the amplification product nucleic acid 191 itself as a template, the promoter sequence 196 (indicated by a black thick arrow in the figure) linked so as to function properly in the amplification product nucleic acid 191 functions. RNA 197 to be transcribed is obtained.

  Such stem-loop nucleic acids can also be used as functional RNA molecules such as Pre-miRNA, RNA catalyst and siRNA. According to this embodiment, a nucleic acid having a stem-loop structure can be produced economically and simply.

  Incidentally, the amplification product nucleic acid 191 and its complementary strand have a complementary sequence in a certain part. Therefore, it exists in the form of amplified nucleic acid 196 having an internal structure as shown in FIG. 14 (14E).

  By using such a method combining restriction enzyme and template cleavage, an RNA structure having a stem-loop structure containing at least one copy of a desired sequence can be efficiently, economically and easily prepared. Here, a method for producing RNA that can take a stem-loop structure using a promoter and a restriction enzyme site has been described. However, as described in the sixth design example, a terminator sequence is used instead of the restriction enzyme site. By doing so, a desired RNA structure can be easily produced.

  In the above-described example, the first nucleic acid production method and the second nucleic acid production method are separately or sequentially performed. For example, the first nucleic acid production method and the second nucleic acid production method are performed by using heat-resistant polymerase. Two nucleic acid production methods may be performed simultaneously, and such an embodiment is also within the scope of the present invention.

  In the first nucleic acid production method described above, for example, the LAMP method, the second primer (for example, also referred to as “F3” in FIG. 1) and the fourth primer (for example, FIG. In some cases, the desired amplification according to the embodiment of the present invention is possible even when the amplification reaction system is not present in the amplification reaction system. Therefore, in the above-described aspect of the present invention, the second primer and the fourth primer are not necessarily required.

(8) About the directionality of a promoter The connection method in the case of arrange | positioning a promoter sequence to a primer as a functional region, and the effect | action in a transcription reaction are demonstrated using FIG.

  There are three ways to connect to the promoter sequence. First, as shown in FIG. 13 (13A), a primer 160 priming sequence (indicated by “2” in a hatched box in the figure) and a stem-loop sequence (indicated by “1C” in the figure). In this method, a promoter sequence (referred to as “Pro” in the figure) is arranged in the forward direction to the primer 160 so as to be arranged in the 3 ′ direction.

  In this way, when the template is a nucleic acid 161 in the 5 ′ to 3 ′ direction with respect to the direction of the promoter, the transcription reaction does not proceed and the template is a nucleic acid 162 in the 3 ′ to 5 ′ direction. Sometimes the transcription reaction proceeds.

  Next, between the priming sequence of the primer 170 (denoted as “2” in the hatched box in the figure) and the stem-loop sequence (denoted as “1C” in the figure), it is directed in the 5 ′ direction. There is a method of reversely connecting to the primer 170 so as to arrange a promoter sequence (denoted as “Pro” in the figure).

  In this way, when the template is a nucleic acid 172 in the 5 ′ to 3 ′ direction relative to the direction of the promoter, the transcription reaction does not proceed and the template is a nucleic acid 171 in the 3 ′ to 5 ′ direction. Sometimes the transcription reaction proceeds.

  Furthermore, between the priming sequence of the primer 180 (indicated by “2” in the hatched box in the figure) and the stem-loop sequence (indicated by “1C” in the figure), 5 ′ Two promoter sequences are arranged such that a promoter sequence (denoted as “Pro” in the figure) is arranged in the direction, and a second promoter sequence is arranged in the 3 ′ direction on the 3 ′ side. There is a method of connecting the promoter sequence to the primer 170 by reverse.

  In this way, the 5 ′ first promoter proceeds to the transcription reaction only when the template is the nucleic acid 181 in the 3 ′ to 5 ′ direction with respect to the direction of the promoter, and the second promoter on the 3 ′ side. The transcription reaction of this promoter proceeds only when the template is the nucleic acid 182 in the 3 ′ to 5 ′ direction with respect to the promoter direction.

  As described above, the first and third primers according to this embodiment have the homologous sequence of the first forward arbitrary sequence and the complementary sequence of the second forward arbitrary sequence and / or the complementary sequence of the first backward arbitrary sequence and the first sequence. One or more promoter sequences may be designed so as to be inserted in the forward and / or reverse direction between the homologous sequences of two backward arbitrary sequences.

  The primer designed in this way is advantageously used in the first nucleic acid production method, and as a result, it is possible to provide a number of advantageous transcription start points in the transcript nucleic acid as a functional region. Thereby, a more efficient transcription reaction can be performed as compared with the conventional method.

5). Detection Method In the above-mentioned (4) one embodiment of the second nucleic acid production method and (1) the first design example to the design example (7), a specific nucleic acid sequence is synthesized using the designed and produced RNA. It is also possible to detect. Therefore, a detection method for detecting nucleic acid hybridization is also within the scope of the present invention.

  See FIGS. 11 and 12. According to the embodiment of the present invention, it is possible to further transcribe the amplification product nucleic acid obtained by the first nucleic acid synthesis method, for example, the LAMP product, to obtain a stem-loop nucleic acid as desired. Accordingly, it is possible to design the detection probe 103a as described in FIG. 11 (11A) so that it can be appropriately coupled. That is, the stem-loop nucleic acid according to the embodiment of the present invention is a transcription product, its chain length is short, and there is little influence of the higher order structure that can be taken by the molecule, so that the hybridization inhibition effect is small. This is a great advantage in any detection method using hybridization.

  On the other hand, in the conventional method, detection is performed by hybridizing the portion of the stem-loop structure of the LAMP product nucleic acids 131a, 131b, and 131c as shown in FIG. 9 (9E) to the probe 130. Therefore, the hybridization inhibition effect due to the influence of the higher-order structure that can be taken by the molecule due to the structural characteristics of the LAMP product nucleic acid 131 that repeatedly includes a plurality of stem-loop structures, that is, the length of the chain is large. Therefore, amplification primers and probes must be designed while strictly controlling the position of the “sequence to be targeted”, and the degree of freedom in design is poor.

  Furthermore, in the conventional method, depending on whether the stem-loop portions 131a, b, and c contained in the LAMP product hybridize to the probe 130 in any of the manners of FIGS. 11 (11A) to (11C). It is also a problem that it can be false positives and / or false negatives.

  That is, for example, when the loop structure portion as shown in FIG. 11 (11A) faces the direction of the substrate on which the probe 130 is solid-phased and the desired arrangement exists near the side surface of the loop structure portion. As shown in the figure, preferred hybridization is obtained.

  On the other hand, for example, as shown in FIG. 11 (11B), that is, when the stem structure portion is directed toward the substrate and a desired arrangement is present near the side surface of the loop structure portion. Yes, when the desired sequence of the probe 130 and the complementary sequence of the probe are hybridized, if the stem structure portion is longer than the distance from the complementary sequence to the substrate, it is difficult to obtain favorable hybridization, A structural failure is caused by the target stem-loop structure portion 131b. As indicated by a cross in the figure, this is not a preferred hybridization condition.

  Further, for example, a case as shown in FIG. 11 (11C), that is, a case where a desired arrangement is in the stem structure portion. In this case, even if the loop structure portion is on the substrate side or in the direction opposite to the substrate, there is a high possibility that a structural failure due to the stem-loop structure portion 131c occurs. Therefore, unfavorable hybridization conditions are marked with a cross in FIG.

  Still further, by using the embodiment of the present invention, it is possible to obtain a desired transcription product nucleic acid from a specific sequence of an amplification product nucleic acid obtained by the first nucleic acid production method, for example, a LAMP product. Such a transcript nucleic acid can be conveniently used as a desired single-stranded target nucleic acid composed of RNA (denoted as “target sequence” in the figure).

  As a result, it is possible to reduce the influence of steric hindrance of the LAMP product structure, which has been a problem in the past, and as a result, hybridization between the probe and the target nucleic acid has been successfully achieved, thereby achieving good detection sensitivity. Detection can be performed.

  Furthermore, according to an embodiment of the present invention, a transcript that can be used as a target molecule by performing the second nucleic acid production method using a single molecule of amplification product nucleic acid, for example, a LAMP product, as a template. An amplification effect is provided in which a plurality of nucleic acids can be obtained in one transcription reaction.

  As shown in FIG. 12 (12A), for example, in the case of a stem-loop nucleic acid structure portion 140 such as an amplification product nucleic acid conventionally used as a target, for example, a LAMP product, a plurality of targets are included in one amplification product nucleic acid. Although the sequence 141 is present, in fact, the target sequence that can be preferably used for hybridization with the probe is only the target sequence 142 present in the loop nucleic acid structure portion.

  On the other hand, in the embodiment of the present invention, unlike the conventional method, an amplification product nucleic acid, for example, a LAPM product is not directly used as a target. That is, by performing the second nucleic acid production method using the amplification product nucleic acid 150 as a template, the target sequence 150 (this was conventionally directly used as a “target sequence”. Then, an RNA molecule that can be conveniently used for hybridization with a desired probe is produced. In such an aspect of the present invention, it is possible to obtain a large number of transcript nucleic acids, that is, RNA molecules, that can be used as a preferred target at one time from one amplification product nucleic acid, such as a LAPM product. Thereby, compared with the conventional method, it is possible to obtain a higher degree of freedom in the design of the probe used in the detection method and the design of the detection method itself. Accordingly, the aspect of the present invention further provides versatility that can be used for a detection method using a nucleic acid chip (generally also referred to as “nucleic acid array” and also referred to as “nucleic acid array” in this specification). it can.

6). Introducer Amplification product nucleic acid and transcription product nucleic acid obtained by the embodiment according to the present invention and a part thereof, for example, a nucleic acid containing a target sequence and / or a complementary sequence and a part thereof, etc. are introduced into a living body, and Introduced bodies introduced in this way are also included in the scope of the present invention.

  The host of such an introducer may be any host known to those skilled in the art. Preferred examples include, but are not limited to, mammals, insects, fish, plants, protozoa, bacteria, archaea, fungi, viruses, rickettsia, viroids and culture organs, tissues and cells derived therefrom. is not. The host mentioned here indicates an amplification product nucleic acid, a transcription product nucleic acid, and a target organism into which a part thereof has been introduced or a self-replicating body that can parasitize them.

  The introduction method may use any means known per se to those skilled in the art. An introducer obtained by such means, eg, an organism, eg, an organism introduced with a genomic or other genetic factor as a component, eg, a eukaryote and a prokaryote, such as a virus, eg, a retrovirus, adeno Organisms introduced into organisms, including viruses and flomoviruses, and viroids, such as the family Pospiviroid and Absinthe viroid, are all within the scope of the present invention.

Examples of introducers are given below;
i) an introduced product in which the amplification product nucleic acid or a part thereof is introduced into a host, in which case desired RNA transcription occurs in the host body;
ii) An introduced product obtained by introducing an amplification product nucleic acid or a part thereof into an infectious host such as a virus, and in this case, a desired RNA is produced in the organism to be infected by the host;
iii) An introduced product obtained by introducing an amplified product nucleic acid or a part thereof into an infectious host such as a virus. In this case, the introduced host causes further infection of the organism, thereby Gene transfer into the organism occurs resulting in the desired RNA in the infected organism;
iv) An introducer obtained by producing a transcription product nucleic acid, such as RNA, transcribed using the amplification product nucleic acid as a template, and introducing the produced transcription product nucleic acid, such as RNA, into a host;
v) An introduced product in which a transcription product nucleic acid such as RNA is transcribed using the amplification product nucleic acid as a template, and the produced transcription product nucleic acid such as RNA is introduced into an infectious host such as a virus. Yes, in this case, the introduction of the organism by the host that has been introduced results in gene transfer to the organism, resulting in the desired RNA in the infected organism;
vi) An introduced product in which a transcription product nucleic acid, such as RNA, transcribed using the amplification product nucleic acid as a template is produced, and the produced transcription product nucleic acid is introduced into an infectious host such as a virus. Infected organisms are further infected by the introduced host, thereby causing gene transfer to the organism, resulting in reverse transcription to DNA and gene transfer in the infected organism. And RNA transcription occurs in the organism.

  Examples of the introduction body as described above are also within the scope of the present invention.

7). Reagent Kit According to a further aspect of the present invention, a reagent kit for carrying out the method of the present invention is provided. Examples of such reagent kits include primers, nucleic acid amplification enzymes, test nucleic acids, eg, DNA molecules or RNA that can serve as a template for RNA synthesis, amplification and amplification required for carrying out any method according to the present invention. / Or substrates necessary for transcription, restriction enzymes, RNA synthetases, RNA molecules produced therefrom, and nucleic acid probes for hybridization, solid phase carriers on which they are immobilized, containers and buffers such as reaction buffers The reagent kit may be any reagent kit including at least one component selected from the group consisting of an agent, and more preferably includes a primer according to an embodiment of the present invention. The reagent kit preferably includes at least the primer, an enzyme for nucleic acid amplification, and an RNA synthetase. In addition, the reagent kit may be the above-described reagent kit for producing the first nucleic acid or the reagent kit for producing the second nucleic acid. Still further, according to an embodiment of the present invention, the LAMP reaction and transcription can proceed simultaneously in one tube by using a heat-resistant polymerase.

  As described above, for example, a primer for producing an amplification product nucleic acid such as a LAMP product, which can serve as a template for RNA production, an amplification product nucleic acid structure such as a LAMP product structure produced using the primer, and its Production method, for example, transcription product nucleic acid produced using amplification product nucleic acid structure such as LAMP product structure as template, for example, RNA, and the structure thereof, target sequence detection method using the same, target production kit for detection, and An assay kit for target sequence detection is also within the scope of the present invention.

  According to the embodiments of the present invention as described above, a primer for nucleic acid production with a high degree of freedom in its design is provided. Furthermore, nucleic acid synthesis is performed by using the primer to provide a versatile nucleic acid.

  Also, any nucleic acid obtained by the method according to an embodiment of the present invention is provided as a primer and / or probe. Also provided are nucleic acid synthesis methods using them. Furthermore, by using the nucleic acid obtained by such a method, it is possible to detect a nucleic acid chip with higher sensitivity than before.

  Furthermore, according to the aspect of the present invention, it is possible to improve the design flexibility of the target of the nucleic acid chip. Further, according to the aspect of the present invention, it is possible to provide high sensitivity detection of the nucleic acid chip.

By using the method according to the embodiment of the present invention, a desired RNA nucleic acid structure can be easily and economically produced, and the degree of freedom in designing a target nucleic acid that can be used for hybridization is improved and the sensitivity of hybridization is high. Is provided. Still further, nucleic acids obtained by the methods according to embodiments of the invention are provided as primers and / or probes.

[Example]
Examples according to the present invention will be described below.

Example 1
Using the primer set and template DNA as shown in FIG. 13 (13A), nucleic acid was produced.

First, a test nucleic acid containing the sequence shown in SEQ ID NO: 1 and five kinds of primers having the following base sequences were prepared;
SEQ ID NO: 1 (Human-NAT2 gene, partial sequence)
GTGGGCTTCATCCTCACCTATAGAAAATTCAATTATAAAGACAATACAGATCTGGTCGAGTTTAAAACTCTCACTGAGGAAGAGGTTGAAGAAGTGCTGAAAAATATATTTAAGATTTCCTTGGGGAGAAATCTCGTGCCCAAACCTGGTGATGGATCCCTTACTATTTAGAATATATACATTTACTATTTAGATCTAACTACTTGTGTATGTCATC
SEQ ID NO: 2; (F3 primer)
GTGGGCTTCATCCTCAC
SEQ ID NO: 3; (FIP primer)
AGCACTTCTTCAACCTCTTCCTC * TAAAGACAATACAGATCTGGTCG
SEQ ID NO: 4 (BIP-primer, for comparison, a sequence not containing T7promoter)
GGGGAGAAATCTCGTGCCCAA * GGGTTTATTTTGTTCCTTATTC
SEQ ID NO: 5; (BIP primer; B1C-T7promoter + Leader-B2)
GGGGAGAAATCTCGTGCCCAA * TAATACGACTCACTATAGGGC * GGGTTTATTTTGTTCCTTATTC.

SEQ ID NO: 6; (B3 primer)
TGATAATTAGTGAGTTGGGTGAT
“*” In the above array represents the boundary between the constituent elements.

SEQ ID NO: 1 is a partial sequence of the human NAT2 gene. Array 2 is a third forward arbitrary array.

  Nucleic acid amplification was performed with the composition shown in Table 1 at a temperature of 63 ° C. and a time of 1 hour. At this time, a negative control was prepared by adding sterilized water instead of the nucleic acid sample. As a result of confirming the amplified LAMP product by agarose gel electrophoresis, a typical ladder-like pattern appears in the LAMP product, and the amount of the product and the molecular weight composition of the product are determined using a normal LAMP primer that does not contain a promoter region. There was no inferiority to that used for amplification. On the other hand, no amplification is observed when no template DNA is contained. When the obtained LAMP product was subjected to dideoxy base sequence analysis according to a general method, amplification of the expected base sequence was confirmed.

  From the above, it was confirmed that sequence-specific LAMP amplification becomes possible when a primer including a promoter proposed in the present invention is used.

  The sequence of the basic unit of LAMP amplification is the nucleotide shown in SEQ ID NO: 7.

SEQ ID NO: 7;
AGCACTTCTTCAACCTCTTCCTCTAAAGACAATACAGATCTGGTCGAGTTTAAAACTCTCACTGAGGAAGAGGTTGAAGAAGTGCTGAAAAATATATTTAAGATTTCCTTGGGGAGAAATCTCGTGCCCAAACCTGGTGATGGATCCCTTACTATTTAGAATAAGGAACAAAATAAACCCGCGCTCTAGTGAGTCGTATTTC

  To the LAMP product obtained here, a T7 promoter, RNase-inhibitor and a buffer required for the enzyme reaction were added, and the mixture was incubated at 37 ° C. for 5 minutes to 1 hour to thereby transcribe RNA from the LAMP product. I did it. At this time, RNA samples were also prepared using the existing method (method as shown in FIG. 5) and subjected to simultaneous evaluation.

  When only RNA was purified by DNase I treatment and electrophoresed, it was found that the method according to the present invention clearly synthesizes a large amount of RNA compared to the existing method.

  In this example, an example was used in which a BIP primer in which a promoter was connected between the B1C and B2 regions was used. However, in the form shown in FIGS. 4 and 6, the promoter was reversely inserted between the B1C and B2 regions. Efficient template DNA production and RNA synthesis regardless of whether the promoter is connected to the FIC and F2C regions of the FIP primer, or the primer is inserted into both the BIP and FIP primers. I confirmed that I was able to. Moreover, although the example using the combination of LAMP / T7 promoter / T7 polymerase was shown here, even if it is the combination of other promoter / RNA synthetase, and also when RT-RANP is used, it is carried out similarly. It was possible. Moreover, it was also possible to use the obtained RNA product as functional RNA molecules such as pre-miRNA, RNA catalyst and siRNA.

Example 2
Nucleic acid production was performed using a primer and a template nucleic acid as shown in FIG.

Four types of primers having the following sequences were prepared, and the compositions shown in Table 1 were used.

SEQ ID NO: 2; (F3 primer)
GTGGGCTTCATCCTCAC
SEQ ID NO: 8; (FIP primer; F1C-EcoRV recognition sequence-F2)
AGCACTTCTTCAACCTCTTCCTC * GATATC * taaagacaatacagatctggtcg
SEQ ID NO: 5; (BIP primer; B1C-T7promoter + Leader-B2)
GGGGAGAAATCTCGTGCCCAA * TAATACGACTCACTATAGGGC * GGGTTTATTTTGTTCCTTATTC
SEQ ID NO: 6; (B3 primer)
TGATAATTAGTGAGTTGGGTGAT.

  “*” In the above array represents the boundary between each component.

  Nucleic acid amplification was performed at a temperature of 63 ° C. and a time of 1 hour. At this time, a negative control was prepared by adding sterilized water instead of the nucleic acid sample. As a result of confirming the amplified LAMP product by agarose gel electrophoresis, a ladder-like pattern typical of the LAMP product appeared. On the other hand, no amplification was observed when no template DNA was contained. When the obtained LAMP product was subjected to dideoxy base sequence analysis according to a general method, amplification of the expected base sequence was confirmed. From the above results, it was confirmed that sequence-specific LAMP amplification is possible even when a primer including a promoter proposed in the present invention is used.

  The sequence of the basic unit of LAMP amplification was the nucleotide shown in SEQ ID NO: 9.

SEQ ID NO: 9;
AGCACTTCTTCAACCTCTTCCTCGATATCTAAAGACAATACAGATCTGGTCGAGTTTAAAACTCTCACTGAGGAAGAGGTTGAAGAAGTGCTGAAAAATATATTTAAGATTTCCTTGGGGAGAAATCTCGTGCCCAAACCTGGTGATGGATCCCTTACTATTTAGAATAAGGAGCATTCATTAGTCGCTCATT

  The LAMP product obtained here is treated with the restriction enzyme EcoRV under appropriate conditions, and then added with a T7 promoter, an RNase-inhibitor and a buffer necessary for the enzyme reaction, and incubated for 1 hour. As a result, RNA transcription from the LAMP product was performed.

  When RNA was purified only by DNAseI treatment and electrophoresis was performed, the obtained RNA was reversed into cDNA. After that, base sequence analysis was performed to examine the primary structure of the transcript by the method according to the embodiment of the present invention. As a result, it was found that the expected RNA was obtained in large quantities.

  Here, one structure shown in FIG. 8 in the form of the RNA production method in which the method described in Example 1 is combined with template cleavage by a restriction enzyme is shown (see FIG. 8). Similarly, even with the design described in FIG. 7 in which promoters are connected in the reverse direction, RNA can be effectively produced in the same manner.

  Moreover, although not described in detail, an experiment was conducted in which a promoter was connected between the first priming sequence of the first primer corresponding to the forward arbitrary sequence and the first stem-loop sequence. As a result, it was confirmed that efficient RNA synthesis was possible even with the use of such designed primers. In this example, the LAMP method, the restriction enzyme EcoRV, the T7 promoter, and the T7 polymerase were used in combination. However, experiments were also conducted with other promoters, enzymes that catalyze the nucleic acid cleavage reaction, and RNA synthase. . Furthermore, an experiment using the RT-LAMP method was also conducted. As a result, in all cases, results showing that the method is very useful were obtained. It was also possible to use the RNA product with functional RNA molecules such as Pre-miRNA, RNA catalyst or siRNA.

Example 3
Diffusion production was performed using a primer and a template nucleic acid as shown in FIG. As the test nucleic acid, a nucleic acid containing the sequence described in SEQ ID NO: 1 was used, and four types of primers of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 10 and SEQ ID NO: 6 were prepared, and the composition as shown in Table 1 was prepared. An amplification reaction was performed.

Sequence number 2 (F3 primer)
GTGGGCTTCATCCTCAC
SEQ ID NO: 3 (FIP primer)
AGCACTTCTTCAACCTCTTCCTC * TAAAGACAATACAGATCTGGTCG
SEQ ID NO: 10 (BIP primer; B1C- SmaI recognition sequence-T7promoter + Leader-B2)
GGGGAGAAATCTCGTGCCCAA * TCGCCCTATAGTGAGTCGTATTA * CCCGGG * TTTATTTTGTTCCTTATTC
Sequence number 6 (B3 primer)
TGATAATTAGTGAGTTGGGTGAT
“*” In the above array represents the boundary between each component.

  Nucleic acid amplification was performed at a temperature of 63 ° C. and a time of 1 hour. At this time, a negative control was prepared by adding sterilized water to the foam of the nucleic acid sample. As a result of confirming the amplified product nucleic acid, which was an amplified LAMP product, by agarose gel electrophoresis, a ladder-like pattern typical of the LAMP product appeared. On the other hand, when no template DNA was contained, no amplification was observed. When the obtained LAMP product was subjected to dideoxy base sequence analysis according to a general method, amplification of the expected base sequence was confirmed. From the above, it was confirmed that sequence-specific LAMP amplification was possible even when a primer including a promoter proposed in the present invention was used. That is, it was confirmed that sequence-specific nucleic acid production can be performed by the method according to the embodiment of the present invention.

  The sequence of the basic unit of LAMP amplification was the nucleic acid represented by SEQ ID NO: 11.

SEQ ID NO: 11 (sequence of LAMP amplification basic unit)
AGCACTTCTTCAACCTCTTCCTCTAAAGACAATACAGATCTGGTCGAGTTTAAAACTCTCACTGAGGAAGAGGTTGAAGAAGTGCTGAAAAATATATTTAAGATTTCCTTGGGGAGAAATCTCGTGCCCAAACCTGGTGATGGATCCCTTACTATTTAGAATAAGGAACAAAATAAACCCGGGGAATAATTACTACTACTCTAGCG
By subjecting the LAMP product obtained here to a restriction enzyme treatment under appropriate conditions, a T7 promoter, an RNase-inhibitor and a buffer necessary for the enzyme reaction are added, and the mixture is incubated for 1 hour. RNA transcription from the LAMP product was performed.

  Only RNA was purified by DNase treatment, and electrophoresis was performed. At the same time, the stem loop structure was confirmed by the RNase A protection assay. The obtained RNA was reverse transcribed into cDNA. The base sequence was then analyzed, and the primary and secondary structures of the transcripts by the method according to the embodiment of the present invention were examined. As a result, although not shown in the data, it was confirmed that a large amount of the expected stem-loop RNA could be formed.

  Here, although one example (ie, the design shown in FIG. 9) of the stem-soup RNA production method in which the method described in Example 1 is combined with template cleavage by a restriction enzyme was used. Experiments were also conducted on the design shown in FIG. As a result, an effective stem-loop RNA structure could be created similarly. In this example, the third primer in which a T7 promoter is connected between the second priming sequence of the third primer corresponding to the backward arbitrary sequence and the second stem-loop forming sequence is used. An experiment was also conducted in which a promoter was connected between the first priming sequence of the first primer, ie, the primer corresponding to the forward arbitrary sequence, and the first stem-loop forming sequence. Although not shown in the data, as a result, similar to the result described in this example, an effective stem-loop RNA structure could be created.

  Furthermore, in this example, the LAMP method, the restriction enzyme Smal, the combination of the T7 promoter and T7 polymerase was used, but the experiment was conducted using a combination of an RNA synthase and an enzyme that catalyzes a nucleic acid cleavage reaction with another promoter. In addition, experiments using RT-LAMP showed that the method according to the embodiment of the present invention can be carried out effectively in the same manner. Furthermore, experiments were conducted using the obtained RNA product as a functional RNA molecule such as Pre-miRNA, RNA catalyst or siRNA. The results, like the other results, showed that their use can be carried out advantageously. It was done.

Example 4
An example of using a template nucleic acid having a terminator sequence as shown in FIG. 10 was performed according to an embodiment of the present invention.

First, a test nucleic acid containing the sequence represented by SEQ ID NO: 12, and four types of primers consisting of SEQ ID NO: 6, SEQ ID NO: 13, SEQ ID NO: 14 and SEQ ID NO: 2 were prepared. SEQ ID NO: 12 (artificial synthetic DNA partial sequence)
GTGGGCTTCATCCTCACCTATAGAAAATTCAATTATAAAGACAATACAGATCTGGTCGAGTTTATATCTCTCACTGAGGAAGAGGTTGAAGAAGTGCTGATTAATATATTTAAGATTTCCTTGGGGAGAAATCTCGTGCCCAAACCTGGTGATGGATCCCTTACTATTTAGAACCTACTACTTGTGTCATC
Sequence number 6 (F3 primer) TGATAATTAGTGAGTTGGGTGAT
SEQ ID NO: 13 (FIP primer; F1C-terminator -F2)
GGGGAGAAATCTCGTGCCCAA * AAAA * GGGTTTATAATGTTCCTTATTC
SEQ ID NO: 14 (BIP primer; B1C-hU6 promoter-B2)
AGCACTTCTTCAACCTCTTCCTC * CTTGTGGAAAGGACGAAACACCG * TAAAGACAATACAGATCTGGTCG
SEQ ID NO: 2 (B3 primer)
GTGGGCTTCATCCTCAC
Nucleic acid amplification was carried out with the composition shown in Table 1 above at a temperature of 63 ° C. and a time of 1 hour. At this time, a negative control was prepared by adding sterilized water instead of the nucleic acid sample.

  As a result of confirming the amplified LAMP product by agarose gel electrophoresis, a ladder-like pattern typical of the LAMP product was obtained. On the other hand, no amplification was observed when no template DNA was contained. When the obtained LAMP product was subjected to dideoxy base sequence analysis according to a general method, amplification of the expected base sequence was confirmed. It was the sequence of SEQ ID NO: 15 as the basic unit of LAMP amplification.

SEQ ID NO: 15 (sequence of LAMP amplification basic unit)
GGGGAGAAATCTCGTGCCCAAAAAAGGGTTTATAATGTTCCTTATTCTAAATAGTAAGGGATCCATCACCAGGTTTGGGCACGAGATTTCTCCCCAAGGAAATCTTAAATATATTAATCAGCACTTCTTCAACCTCTTCCTCAGTGAGAGATATAAACTCGACCAGATCTGTATTGTCTTGAGGTGTTTCGTCCTTCATG
From the above, it has been clarified that sequence-specific LAMP amplification is possible even when a primer including a promoter and terminator proposed in the present invention is used.

  The LAMP product obtained here was introduced into HeLa cells by the cationic liposome method according to a conventional method, and after culturing under appropriate conditions, RNA was extracted from the cells by the guanidine thiocyanate / SDS-phenol method. The extracted RNA sample was subjected to electrophoresis by purifying only RNA by DNase treatment. At the same time, the obtained RNA was reverse transcribed into cDNA, followed by base sequence analysis, and the primary structure of the product by the method in this example was examined. As a result, it was found that a large amount of RNA having the expected structure was produced.

  In addition, although the result of having experimented using the design thing by the combination shown to FIG. 10 (10D) was shown here, it reacts using one or more primers as shown to FIG. 10 (10A) and FIG. An experiment was also conducted. The experiment was conducted by designing several combinations in which the terminator sequence corresponding to the RNA polymerase used for RNA synthesis was included in the LAMP product prepared using these primers. As a result, it was revealed that a desired RNA structure can be created effectively and simply.

  The same effect was obtained regardless of whether the terminator sequence was designed inside the primer or included in the target sequence for LAMP amplification.

  In addition, although the experimental result performed using the primer designed by the combination shown in FIG. 10 (10D) is shown here, the LAMP prepared using the primer 1 or more as shown in FIG. 10 (10A) and FIG. Several combinations designed to include a terminator sequence corresponding to the RNA polymerase used for RNA synthesis in the product were also tested. As a result, it was possible to create a desired RNA structure effectively and simply.

  Similar results were obtained whether the terminator sequence was designed inside the primer or included in the target sequence for LAMP amplification.

  In this example, the third primer with the hU6 promoter connected in the reverse direction was used as the primer corresponding to the backward arbitrary sequence, but the third primer with the promoter connected in the forward direction was used. Even when the same promoter was connected to the primer corresponding to the forward arbitrary sequence, the same good results were obtained. In addition, even when a promoter was connected to both of the two types of primers, good and efficient RNA synthesis was achieved. In addition, here, the LAMP method was tested in a system combining hU6 promoter and U6 polymerase, but in addition, a system combining RT-LAMP method, other promoter, other terminator, and other RNA synthase. However, it was tested in the same manner, and in that case, good results were obtained. In this example, LAMP products were introduced into cells, and an experimental example on a method using intracellular RNA transcription reaction was shown, but the transcription reaction shown in this experiment is not only in vivo but also in in vitro experiments. It has been confirmed that good results can be obtained even in the system. Moreover, the obtained RNA product could be effectively used as a functional RNA molecule such as Pre-miRNA, RNA catalyst or siRNA.

  Example 5 Nucleic acid production was performed using primers as shown in FIG.

  First, two types of test nucleic acid containing the sequence shown in SEQ ID NO: 1 and test nucleic acid containing the sequence shown in SEQ ID NO: 16, and further, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID NO: 6 Were prepared as four types of primers.

SEQ ID NO: 16 G857A, mutant type (A type) (* lowercase letter is the position of mutant SNP)
GTGGGCTTCATCCTCACCTATAGAAAATTCAATTATAAAGACAATACAGATCTGGTCGAGTTTAAAACTCTCACTGAGGAAGAGGTTGAAGAAGTGCTGAAAAATATATTTAAGATTTCCTTGGGGAGAAATCTCGTGCCCAAACCTGGTGATGACTATCCCTTACTATTTAGAATAAGGAACAAAATATCATTCTTGTGTCTCTC
SEQ ID NO: 2 (F3 primer)
GTGGGCTTCATCCTCAC
SEQ ID NO: 3 (FIP primer)
AGCACTTCTTCAACCTCTTCCTC * TAAAGACAATACAGATCTGGTCG
SEQ ID NO: 5 (BIP primer; B1C-T7promoter + Leader-B2)
GGGGAGAAATCTCGTGCCCAA * TAATACGACTCACTATAGGGC * GGGTTTATTTTGTTCCTTATTC
SEQ ID NO: 6 (B3 primer)
TGATAATTAGTGAGTTGGGTGAT
“*” In the above array represents the boundary between each component.

  Nucleic acid amplification was performed with the composition shown in Table 1 described above at a temperature of 63 ° C. and a time of 1 hour. At this time, a negative control was prepared by adding sterilized water instead of the nucleic acid sample. As a result of confirming the amplified LAMP product by agarose gel electrophoresis, a ladder-like pattern typical of the LAMP product appeared. On the other hand, no amplification was observed when no template DNA was contained.

  When the obtained LAMP product was subjected to dideoxy base sequence analysis according to a general method, amplification of the expected base sequence was confirmed.

  From the above, it was confirmed that sequence-specific LAMP amplification can be achieved by using a primer including a promoter proposed in the present invention.

  The TAMP promoter, RNAse-inhibitor and a buffer required for the enzyme reaction were added to the LAMP product obtained here, and the RNA was transferred from the LAMP product by incubating for 1 hour. After the reaction, 1/9 amount of 20 × SSC buffer was added, added to a nucleic acid probe-immobilized chip prepared in advance, and hybridization was carried out at 55 ° C. for 10 minutes. In this case, as the target area, the LAMP product was simultaneously evaluated as an example of the target nucleic acid prepared by the existing method. The nucleic acid probe immobilization chip used here was prepared by introducing the nucleic acids shown in SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19 immobilized on a gold electrode provided on the substrate by introducing a thiol group at the 3 ′ end. Used as a nucleic acid probe.

SEQ ID NO: 17 (NAT2, G857A-SNP, A type detection probe)
ACCTGGTGATGAATCCCTTACTATTT
SEQ ID NO: 18 (NAT2, G857A-SNP, probe for G type detection)
CCTGGTGATGGATCCCTTACTAT
SEQ ID NO: 19 (Probe for negative control)
SEQ ID NO: 19 was used as a negative control probe for detecting the background current value. Sequence number 17 is a probe which detects the A type polymorphism of NAT2 gene G857A-SNP. Sequence number 18 is a probe which detects the G type polymorphism of NAT2 gene G857A-SNP.

  After hybridization, the plate was washed with 0.2 × SSC at 45 ° C. for 20 minutes. Finally, the current response of Hoechst 33258 was measured, and the results as shown in FIGS. 16, 17, and 18 were obtained for the increase in the current value.

  The detection of the transcript obtained according to the embodiment of the present invention as shown in FIG. 17 was measured with twice or more sensitivity than the result of the control sample shown in FIG. Moreover, as shown in FIG. 18, it became clear that SNP can be detected more accurately by the method according to the embodiment of the present invention.

  In addition, although the present Example showed the experimental result performed using the current detection type | mold DNA chip, the detection by other detection systems, ie, nucleic acid chips, such as a DNA chip, specifically a fluorescence detection system or chemical It was also applicable to coloring systems and bead arrays.

  Moreover, although the result which performed NAT2 gene and its SNP determination as a measuring object was shown, the use of the present invention is not limited to this, detection of microorganisms and viruses, detection of gene invention limitation method, etc. Can also be used.

  From the above results, it was shown that by using the method of the present invention, the sensitivity of sequence detection by hybridization can be increased as compared with the existing method. At the same time, it was shown that the degree of freedom in designing the target nucleic acid could be improved.

The schematic diagram which shows the probe and test nucleic acid which are 1 aspect of this invention. 1 is a scheme showing an amplification method that is one embodiment of the present invention. 1 is a scheme showing an amplification method that is one embodiment of the present invention. 1 is a schematic diagram showing a part of a nucleic acid in an amplification method that is one embodiment of the present invention. The schematic diagram of template DNA obtained by the conventional method. The schematic diagram which shows the probe and template nucleic acid which are 1 aspect of this invention. The schematic diagram which shows the probe and template nucleic acid which are 1 aspect of this invention. The schematic diagram which shows the probe and template nucleic acid which are 1 aspect of this invention. The schematic diagram which shows the probe and template nucleic acid which are 1 aspect of this invention. The schematic diagram which shows the template nucleic acid which is 1 aspect of this invention. The schematic diagram which shows the mode of the detection by the chip | tip of a LAMP product. The schematic diagram which shows the detection by a stem loop nucleic acid and a nucleic acid chip. The schematic diagram which shows the probe which is 1 aspect of this invention. The schematic diagram which shows the probe and test nucleic acid which are 1 aspect of this invention. The schematic diagram which shows the probe and test nucleic acid which are 1 aspect of this invention. The graph which shows the result according to the conventional method. The graph which shows the result of the Example according to this invention. The graph which shows the result of the Example according to this invention.

Explanation of symbols

  1. Test nucleic acid 2. Target sequence First forward arbitrary sequence 4. Second forward arbitrary sequence 5. Third forward arbitrary sequence 6. 6. First backward arbitrary sequence Second backward arbitrary sequence 8. Third backward arbitrary sequence 9. First primer 10. First priming sequence 11. Functional area 12. First stem-loop forming sequence 13.56. Second primer 21. Complementary strand of test nucleic acid 22. Complementary sequence of target sequence 23. Complementary strand of first forward arbitrary sequence 24. Complementary strand of second forward arbitrary sequence 25. Complementary strand of third forward sequence 26. Complementary strand of first backward arbitrary sequence 27. Complementary strand of second backward arbitrary sequence 28. Complementary strand of the third backward arbitrary sequence 29.49. Third primer 30. Second priming sequence 31. Second functional area 32. Second stem-loop forming sequence 33. Fourth primer 41.42.444.47. Elongation chain 43. Nucleic acid 48.51. Loop nucleic acid 45. Double-stranded nucleic acid 46.55. Template nucleic acid 53.54. Intermediate 55.60.70.81.91.101.131.140. LAMP product (nucleic acid) 61.71a. 71b. 102a. 102b. Promoter 62.72a. 72b. Transcript 80.90.160.170.180. Primer 83a. 83b. 93a. 93b. 103a. 104a. 104b. 113a. 113b. 123a. 123b. 194a. 194b. Transcribed RNA 91.101.101.110.120.191. Amplified product nucleic acid 92a. 92b. 92C. 103a. 103b. 103c. 193a. 193b. 193c. Restriction enzyme site 100.190. Third primer 102a. 102b. Promoter sequence 105a. Intramolecular structure 105b. 114.195a. 195b. Stem-loop structure 106.196. Amplified nucleic acid 112.121a. 121b. Terminator sequence 113. Transcript nucleic acid 130. Probe 131.140. Stem-loop nucleic acid structural part 141.142.152. Target sequence 153. RNA molecule 161.162.171.172.1 single-stranded nucleic acid

Claims (21)

A method for producing a nucleic acid comprising the following (a), (b) and (c):
(A) preparing a test nucleic acid;
Here, the test nucleic acid has a target sequence and three arbitrary sequences on the 3 ′ side and 5 ′ side thereof,
The three forward arbitrary sequences 3 ′ to the target sequence include a first forward arbitrary sequence located closest to the target sequence and a second forward arbitrary sequence located 3 ′ to the first forward arbitrary sequence. An array and a third forward arbitrary array located on the 3 ′ side of the second forward arbitrary array;
The three backward arbitrary sequences 5 ′ to the target sequence include a first backward arbitrary sequence located closest to the target sequence and a second backward arbitrary sequence 5 ′ to the first backward arbitrary sequence. And a third backward arbitrary array located on the 5 ′ side of the second backward arbitrary array;
(B) preparing a primer for amplifying the test nucleic acid;
Here, the primer includes a first primer, a second primer, a third primer and a fourth primer,
The first primer has a first priming sequence including a sequence complementary to the second forward arbitrary sequence on the 3 ′ end side, and a sequence homologous to the first forward arbitrary sequence on the 5 ′ end side. And a first functional region that can have any function between the first priming sequence and the first stem-loop forming sequence. And
The second primer comprises a second priming sequence comprising a sequence complementary to the third forward arbitrary sequence;
The third primer has a third priming sequence including a sequence homologous to the second backward arbitrary sequence on the 3 ′ end side, and is complementary to the first backward arbitrary sequence on the 5 ′ end side. A second stem-loop forming sequence including a sequence, and a second functional region that can have any function between the third priming sequence and the second stem-loop forming sequence. And
The fourth primer comprises a fourth priming sequence comprising a sequence homologous to the third backward arbitrary sequence;
(C) The test nucleic acid prepared in (a) above is used as the first template nucleic acid, and the reaction is carried out under suitable amplifiable conditions using the first to fourth primers prepared in (b). To produce an amplification product nucleic acid containing at least one target sequence nucleic acid and its complementary strand nucleic acid. The method for producing a nucleic acid according to claim 1, further comprising the following (d), (e) and (f):
(D) using the amplification product nucleic acid obtained in the reaction of (c) as a second template nucleic acid, and performing transcription under conditions suitable for transcription;
(E) causing the functional region or a functional site derived therefrom to function;
(F) A transcript nucleic acid is produced by carrying out (d) and (e) above.   The method according to any one of claims 1 and 2, wherein the first functional region and / or the second functional region operably includes at least one promoter region.   The method according to claim 3, wherein the first functional region and / or the second functional region include the first promoter region and / or the second promoter region in a forward direction so as to be functional. Method.   The method according to claim 3, wherein the first functional region and / or the second functional region include the first promoter region and / or the second promoter region in a reverse direction so as to be functional. Method.   The method according to claim 3, wherein the first functional region and / or the second functional region has two promoter regions in one functional region, A method wherein the promoter is located between the priming sequence and the stem-loop forming sequence, and a forward promoter on the 3 ′ side and a reverse promoter on the 5 ′ side are functionally included.   The method according to any one of claims 3 to 6, wherein one of the first functional region contained in the first primer and the second functional region contained in the third primer A method wherein 1 or 2 promoter regions are present and a third functional region is present in the primer not containing the promoter region. The method according to any one of claims 3 to 7, further comprising a third functional region and / or a fourth functional region having a function other than the promoter as follows. ;
A third functional region is included between the 5 ′ end of the first primer and / or the third primer and the 5 ′ end of the promoter region; and / or a fourth functional region Included in the test nucleic acid. The method according to any one of claims 3 to 8, further comprising a third functional region and / or a fourth functional region having a function other than the promoter as follows. ;
A third functional region is included between the 3 ′ end of the first primer and the third primer and the 3 ′ end of the promoter region; and / or
The fourth functional region is included in the test nucleic acid.   The method according to any one of claims 7 to 9, wherein the third functional region and / or comprises at least one selected from the group consisting of a cleavage site sequence and a terminator sequence.   The method according to any one of claims 1 to 10, wherein the amplification is one of a LAMP method and an RT-LAMP method including an amplification cycle.   The template nucleic acid which consists of an amplification product nucleic acid obtained by manufacturing (c) in the method of any one of Claims 1-11.   The transcript nucleic acid according to claim 2, which is obtained by performing the transcription of (d) and functioning of (e) and comprising a nucleic acid corresponding to the target sequence nucleic acid and / or its complementary nucleic acid.   14. The transcript nucleic acid of claim 13 in the form of a single strand or stem loop.   A probe comprising the transcript nucleic acid according to any one of claims 13 and 14.   A primer set comprising at least a first primer and a third primer for use in the method according to any one of claims 1 to 11.   A kit for producing a nucleic acid and / or detecting a target nucleic acid by performing the method according to any one of claims 1 to 11, comprising at least the first primer and the third primer. Furthermore, optionally, a second primer and a fourth primer, and a substrate, a buffer, an enzyme, at least a part of the target sequence or its complementary strand nucleic acid as a target, or a probe for hybridizing with a transcript nucleic acid Including kit.   The kit according to claim 17, wherein the probe is immobilized on a nucleic acid array.   The method of obtaining the information regarding a detection target by hybridizing this with a test substance using the transcription | transfer product nucleic acid obtained by the method of any one of Claims 2-11 as a probe.   The method according to claim 19, wherein the probe is immobilized on a nucleic acid array.   A nucleic acid selected from the group consisting of an amplification product nucleic acid obtained by the method according to claim 1 and a transcription product nucleic acid obtained by the method according to claims 2 to 11, wherein at least a part of the nucleic acid is selected from genomic or genetic factors As an element of, an introducer introduced into a host selected from the group consisting of organisms including eukaryotes and prokaryotes, viruses, viroids and rickettsiae.

Images