JP2007259750A - Method for preparing sample for detection usable for detecting methylation of dna, method for detecting methylation of dna, sample-treating liquid and kit - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for preparing a sample for detection by which an analyzing time can be shortened by simplifying a pretreatment method of a biosample usable for detecting the methylation of a DNA, and further to provide a method for detecting the methylation of the DNA, a sample-treating liquid and a kit. <P>SOLUTION: The method for preparing the sample for the detection usable for detecting the methylation of the DNA includes a step for mixing a biosample containing a cell with the sample-treating liquid containing a surfactant for solubilizing the cell, and a step for adding a converting agent for converting an unmethylated cytosine contained in the DNA to other bases. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

  The present invention relates to a method for preparing a sample (detection sample) used for detecting DNA methylation, a method for detecting DNA methylation, and a sample treatment solution and kit used in these methods.

  In chromosomal DNA of higher eukaryotes, the 5th position of C (cytosine) among the bases constituting the DNA may be methylated. Unlike in prokaryotes, DNA methylation in higher eukaryotes functions as a mechanism for suppressing the expression of genetic information. For example, if a region (CpG island, CG island) containing a large amount of CpG of a gene is methylated, transcription of that gene is suppressed. In contrast, if the CpG island is not methylated, a transcription factor can bind to the promoter region, and the gene can be transcribed. Thus, DNA methylation is one of the regulatory mechanisms of gene expression, including early embryogenesis, tissue-specific gene expression, genetic imprinting, which is characteristic of mammals, and improper X chromosomes. It plays an important role in various physiological and pathological phenomena such as activation, chromosome stabilization, and the timing of DNA replication. Furthermore, in recent years, it has become clear that this DNA methylation is strongly involved in cancer and other diseases.

As a method for analyzing DNA methylation, methylation specific PCR (Methylation Specific Polymerase Chain Reaction, hereinafter referred to as “MS-PCR”) is generally used (see Non-Patent Document 1). This conventionally used method (hereinafter referred to as “standard method”) is usually 1) genomic DNA extraction from a biological sample (about 3 hours), 2) bisulfite treatment of the extracted genomic DNA (about 16 Time), 3) purification of the modified genomic DNA (about 1 hour), and 4) PCR (about 2 hours) were performed in 4 steps, which was very time consuming (total of about 22 hours). In particular, the pretreatment (preparation of the detection sample) of the biological sample up to the PCR is complicated, and the pretreatment (1 to 3) alone takes about 20 hours.
In order to shorten the pretreatment time which takes a long time, a method of performing the bisulfite treatment of 2) above with a high concentration of bisulfite has been proposed (see Non-Patent Document 2).
According to the method of Non-Patent Document 2 (hereinafter referred to as “rapid method”), the bisulfite treatment, which took about 16 hours in the standard method, can be performed in about 0.3 hours. The time is reduced from 20 hours to about 4 hours. However, even with this rapid method, the pretreatment takes about 4 hours.
James G. HERMAN et al. , Methylation-specific PCR: A novel PCR assay for methylation status of CpG islands, Proc. Natl. Acad. Sci. USA, Vol. 93, pp. 9821-9826, September 1996 Masahiko SHIRAISHI and Hikoya HAYATSU, High-Speed Conversion of Cytosine to Uracil in Bisulfite Genomic Sequencing 4

  The present invention has been made in view of such circumstances, and preparation of a detection sample capable of reducing analysis time by simplifying a biological sample pretreatment method for detecting DNA methylation. It is an object to provide a method, a DNA methylation detection method, a sample treatment solution, and a kit.

In order to achieve the above object, the present invention takes the following technical means.
The present invention relating to a detection sample preparation method is a detection sample preparation method used for detection of DNA methylation,
A step of mixing a biological sample containing cells and a sample treatment solution containing a surfactant that solubilizes the cells; and the non-methylated cytosine contained in DNA is mixed with other bases in the mixture obtained in the step Adding a conversion agent that converts to
It is characterized by including.
According to this method for preparing a sample for detection, a biological sample containing cells and a sample treatment solution are mixed and a conversion agent may be added thereto, so that the step of extracting genomic DNA from the biological sample can be omitted. . For this reason, it is possible to prepare a sample for detection in a short time, and the DNA methylation detection time can be shortened. Further, this method is suitable for automation of sample preparation for detection using an apparatus or the like because complicated DNA extraction is not necessary.

The detection sample preparation method may include a step of cleaving the DNA before the step of adding the conversion agent.
In this case, since the DNA contained in the biological sample is too large to analyze the base sequence as it is, the subsequent steps can be smoothly proceeded by cutting in advance to an appropriate length.
In the detection sample preparation method, the conversion agent is preferably bisulfite.
In the method for preparing a detection sample, the cell is preferably a tumor cell.

Furthermore, the present invention relating to a method for detecting DNA methylation is a method for detecting methylation in a predetermined region of DNA,
A step of mixing a biological sample containing cells and a sample treatment solution containing a surfactant that solubilizes the cells,
The step of adding a conversion agent for converting unmethylated cytosine contained in the region into another base to the mixed solution obtained in the step, and the other base converted from the unmethylated cytosine Detecting methylation in the region using a polynucleotide that hybridizes to the region and a polynucleotide that hybridizes to the region before conversion to the other base,
It is characterized by including.

  According to this DNA methylation detection method, the step of extracting genomic DNA from a biological sample can be omitted, so that the pretreatment method is simplified and the time required for the pretreatment is shortened. Thereby, DNA methylation detection time can be shortened. Further, this method is suitable for automating methylation detection using an apparatus or the like because complicated DNA extraction is not necessary.

In the DNA methylation detection method, the predetermined region of the DNA is preferably a region containing a CpG island of a gene.
Furthermore, in the DNA methylation detection method, the gene is preferably at least one selected from the group consisting of a tumor suppressor gene, an oncogene, and a gene encoding a tumor marker.

The present invention relating to a sample treatment liquid is a sample treatment liquid for preparing a detection sample used for detection of DNA methylation from a biological sample containing cells,
It is a sample processing liquid containing a surfactant that solubilizes the cells.
By using this sample processing solution, the step of extracting genomic DNA from a biological sample can be omitted.

The sample processing solution preferably has a pH of 7 to 10. In this case, when the biological sample and the sample treatment liquid are mixed, degradation of RNA that is not a measurement target can be promoted.
The sample processing solution preferably further includes a cleaving agent that cleaves the DNA. In this case, the cells can be solubilized and the DNA can be cleaved only by mixing the biological sample and the sample treatment solution, so that the pretreatment time can be further shortened.

The present invention relating to a kit for preparing a detection sample used for detection of DNA methylation comprises the above sample treatment solution and a conversion agent that converts unmethylated cytosine contained in DNA into another base. It is said.
If this kit is used, a sample for detection can be prepared in a short time.
The kit may further include a cleaving agent that cleaves DNA.

  According to the present invention, pretreatment of a biological sample for detecting DNA methylation can be performed easily and in a short time.

  The detection sample preparation method of the present invention is a detection sample preparation method used for detection of DNA methylation, and includes a biological sample containing cells and a sample treatment solution containing a surfactant that solubilizes the cells. And a step (second step) of adding a conversion agent that converts unmethylated cytosine contained in DNA into another base, to the mixed solution obtained in the above step (first step). Contains.

In the first step, a biological sample containing cells and a sample treatment solution containing a surfactant that solubilizes the cells are mixed.
Examples of the biological sample include lymph nodes collected from animals such as humans, tissues such as blood, plasma, serum, urine, saliva, body fluid, and nipple discharge. Further, tissues collected from animals such as humans, cultured tissues and cultured cells obtained by culturing the cells, and samples derived from non-animals such as plants may be used.

  The sample processing solution is for preparing a detection sample used for detection of DNA methylation from a biological sample containing cells, and includes a surfactant that solubilizes the cells. As the surfactant, any one of an anionic surfactant, a cationic surfactant, an amphoteric surfactant and a nonionic surfactant may be used as long as it can solubilize the cells. Of these, anionic surfactants are preferred. Examples of the anionic surfactant include sodium dodecyl sulfate (SDS), sodium tetradecyl sulfate, sodium dodecyl sulfonate, sodium tetradecyl sulfonate, sodium cholate (CHO), sodium deoxycholate (DOC), sodium taurocholate, Examples include sodium taurodeoxycholate. Among these, sodium dodecyl sulfate (SDS) having high affinity for proteins is preferable. As for the concentration of the surfactant contained in the sample processing solution, it is desirable to select a suitable concentration according to the type of the surfactant to be used. For example, the concentration of the anionic surfactant contained in the sample processing solution is preferably 0.1 to 10% by volume, and more preferably 0.5 to 5% by volume.

  Moreover, the pH of the sample treatment solution may be in the pH range in which the above surfactant can be dissolved, but it is also neutral in order to promote the degradation of RNA contained in cells when mixed with a biological sample. Weak alkalinity, especially pH 7-10 is preferred. Furthermore, in order to keep the pH constant, the sample processing solution may contain a known buffer solution.

Solubilization of the cells contained in the biological sample can be performed by mixing the biological sample and the sample treatment liquid and stirring, for example, at 10 to 40 ° C. for 5 to 15 minutes. Further, the cells contained in the biological sample may be physically disrupted before or after mixing the biological sample and the sample treatment liquid. For example, when a cell mass such as excised tissue is used as the biological sample, it is preferable to homogenize the cell mass after mixing the cell mass and the sample treatment solution.
The amount of the sample treatment solution added can be appropriately adjusted according to the number of cells contained in the biological sample. For example, when the biological sample contains 1 × 10 ⁶ cells, the cells can be solubilized by adding 300 to 500 μl of the sample treatment solution, but the present invention is not limited to this.

In the second step, a conversion agent that converts unmethylated cytosine contained in DNA into another base is added to the mixed solution obtained in the first step.
The converting agent converts unmethylated cytosine contained in DNA into another base, that is, converts unmethylated cytosine into a base other than cytosine (uracil, thymine, adenine or guanine). As such a conversion agent, bisulfite is preferably used. As the bisulfite, sodium bisulfite, potassium salt, calcium salt, magnesium salt and the like can be used. When DNA is treated with any one or more of these, unmethylated cytosine in the DNA is converted to uracil by deamination. On the other hand, the converting agent as described above does not act on methylated cytosine in DNA, and conversion does not occur. This conversion agent is preferably dissolved in a solvent and used as a solution.

  When bisulfite is used as the conversion agent, the amount added to the mixed solution obtained in the first step is not particularly limited as long as it can sufficiently convert unmethylated cytosine of DNA in the sample, but preferably 1 -10 mmol, more preferably 4-8 mmol. For example, when 6 mmol of sodium bisulfite is added to the mixed solution, unmethylated cytosine can be converted to uracil by incubating at 50 to 80 ° C. for 10 to 30 minutes. Further, when bisulfite is used at a low concentration (for example, 520 μl of 3M sodium bisulfite solution) as in the standard method described above, the conversion may be performed at a time and temperature that can sufficiently convert unmethylated cytosine. . The conversion agent is not limited to bisulfite, and other conversion agents that selectively convert non-methylated cytosine instead of methylated cytosine to other bases can also be used.

  By preparing a sample for detection used for DNA methylation detection in the first step and the second step described above, extraction of genomic DNA, which has been conventionally required, can be omitted. For this reason, it is possible to prepare a sample for detection in a short time. In addition, since pretreatment can be performed in one container, dispensing is not necessary. Accordingly, it is possible to reduce the loss of the sample that occurs during dispensing, and to increase the detection sensitivity. Furthermore, since this method can be easily performed with few steps, it is very suitable for automation of sample preparation for detection by an apparatus or the like. In addition, when this method is used, the conversion from unmethylated cytosine to uracil can be performed with the same or higher efficiency as when non-methylated cytosine is converted to uracil over a long period of time by the standard method. .

  In the detection sample preparation method, it is preferable to include a step of cleaving DNA before performing the second step. By cutting the DNA contained in the biological sample into an appropriate length and fragmenting it in advance, the conversion of unmethylated cytosine in the second step can be performed efficiently. The DNA can be cleaved by physical treatment such as ultrasonic treatment (sonication), chemical treatment such as alkali treatment, enzyme treatment using a restriction enzyme or the like. Of these, it is preferable to use substances (cleaving agents) that can cleave DNA such as sodium hydroxide and restriction enzymes. For example, when using sodium hydroxide as a cleaving agent, add 5 to 15 μl of 5 to 15 N sodium hydroxide solution to the mixed solution obtained in the first step, and incubate at 10 to 40 ° C. for 5 to 15 minutes. The DNA can be cleaved by

  When the above chemical treatment or enzyme treatment is performed for DNA cleavage, a substance used for alkali treatment (for example, sodium hydroxide) or an enzyme (for example, restriction endonuclease) is added as a cleaving agent to the sample treatment solution. It is also possible. In this case, the sample solubilization and the cutting step can be performed by a single operation only by mixing the biological sample and the sample treatment solution, so that the detection sample preparation time (pretreatment time) is further increased. It can be shortened. When using sodium hydroxide, the sodium hydroxide concentration in the sample treatment solution is preferably 0.1 to 1N, more preferably 0.2 to 0.5N. The DNA cleavage may be performed at any point before the addition of the conversion agent.

  In order to carry out the method of the present invention, a detection sample preparation kit containing the sample treatment solution and the conversion agent can be used. By using this kit, a detection sample can be prepared in a short time. This kit may further contain the above-mentioned cleavage agent. The sample processing liquid, the conversion agent, and the cutting agent may be stored in separate containers, or the sample processing liquid and the cutting agent may be stored in the same container, and the conversion agent may be stored in separate containers.

The DNA methylation detection method of the present invention is a method for detecting methylation in a predetermined region of DNA, and is a sample treatment solution containing a biological sample containing cells and a surfactant that solubilizes the cells. And a step of adding a conversion agent for converting unmethylated cytosine contained in the region into another base (second step), Using the polynucleotide that hybridizes to the region having the other base converted from the unmethylated cytosine and the polynucleotide that hybridizes to the region before the conversion to the other base, in the region A step of detecting methylation (third step).
This method preferably includes the above-described DNA cutting step before the second step. Further, as described above, by performing the first step using the sample treatment solution containing a cleaving agent, cell solubilization and DNA cleavage can be performed in a single operation.

  The DNA methylation detection method of the present invention is a method of preparing the above-described detection sample in the first step and the second step, and detecting methylation in the detection sample in the third step. Since the first step and the second step are the same as the first step and the second step of the method for preparing the detection sample, description thereof is omitted.

The detection sample prepared by the above method is a sample obtained by adding a conversion agent to a mixed solution of a biological sample and a sample processing solution, in which a conversion agent is converted from unmethylated cytosine by the conversion agent. There are other bases and 5-methylcytosine. In order to distinguish this converted other base from 5-methylcytosine, DNA amplification and / or detection may be performed on the detection sample to determine the methylation state of a predetermined region of DNA. it can.
DNA methylation detection is carried out by using a polynucleotide that specifically hybridizes to a sequence when unmethylated cytosine is converted to another base (hereinafter referred to as a converted sequence) and a sequence before conversion (that is, methylated cytosine). (Hereinafter, referred to as a non-converted sequence). Methylation can be detected by nucleic acid amplification such as PCR using these polynucleotides as primers. Alternatively, methylation detection may be performed using a DNA chip having these polynucleotides immobilized on a substrate.
For example, methylation specific PCR (MS-PCR) using PCR primers that specifically hybridize to DNA that has been converted to either methylated or unmethylated, bisulfite genome sequencing, COBRA (Combined Bisulfite Restriction Analysis) ), Ms-SNuPE (Methylation-sensitive Single-Nucleotide Primer Extension) and the like. Alternatively, methylation may be detected by performing the LAMP method (see USP 6410278) using the above-described polynucleotide.
Specifically, when MS-PCR is used, methylation can be detected as follows.
1) Dispensing a detection sample prepared from a biological sample into two tubes (referred to as detection sample 1 and detection sample 2).
2) A polynucleotide, DNA polymerase, and dNTPs (dATP, dGTP, dTTP, and dCTP) that specifically hybridize to the conversion sequence are added to the detection sample 1 to prepare a PCR reaction solution 1.
3) A polynucleotide, DNA polymerase, and dNTPs (dATP, dGTP, dTTP, and dCTP) that specifically hybridize to the non-converted sequence are added to the detection sample 2 to prepare a PCR reaction solution 2.
4) Perform PCR using PCR reaction solutions 1 and 2.
5) Check whether the target sequence is amplified by a detection method described later, such as agarose gel electrophoresis.
As a result of 5), when the amplification of DNA is confirmed in the PCR reaction solution 1 and the amplification of DNA is not confirmed in the PCR reaction solution 2, it can be seen that the region to which the polynucleotide hybridizes is not methylated. Conversely, when amplification of DNA is not confirmed in PCR reaction solution 1 and amplification of DNA is confirmed in PCR reaction solution 2, it can be seen that the region to which the polynucleotide hybridizes is methylated.

  The method for detecting the amplified DNA is not particularly limited, and can be detected by a known method. For example, agarose gel electrophoresis, real-time detection using a probe using a fluorescent label (in this case, 4) and 5) can be performed at the same time), by-products (magnesium pyrophosphate) during DNA synthesis The turbidity measuring method for measuring the turbidity (turbidity) of), the confirmation of the cleavage pattern by an enzyme as necessary, the method of determining the base sequence by direct sequence analysis, and the like can be used. If there are many non-specific amplification bands and it is difficult to discriminate the specific band, the specific band can be confirmed by Southern blotting using a probe in the target amplification region.

  Here, the above-mentioned polynucleotide can act as a primer, and linear or single-stranded oligomer DNA or RNA capable of sequence-specific hybridization (annealing) with a complementary strand of modified or unmodified DNA. Having the appropriate sequence and sufficient length to provide for the initiation of a specific and efficient polymerization reaction (primer extension) during the amplification process. Although it does not specifically limit as length of a primer, When using for PCR, 5-50mer is preferable and 10-30mer is more preferable. The primer is preferably single stranded, but it is also possible to use double stranded if the strands are first separated. Primers can be prepared using any suitable method, such as conventional phosphotriester and phosphodiester methods or automated embodiments commonly known in the art.

  The primer used in the method of the present invention is preferably designed so as to be substantially complementary to a predetermined region of the above-mentioned DNA and to have an appropriate GC content. That is, the polynucleotide distinguishes, among other things, untreated or unmodified DNA, methylated DNA, and unmethylated DNA after the second step. Since there will be no C in the sense primer and no G in the antisense primer, the oligonucleotide primer used in the method of the present invention typically has a relatively small amount of C in its sequence. Or G is included.

  Here, the case where bisulfite is used as the conversion agent in the second step will be described. In the second step, unmethylated cytosine is converted to uracil by bisulfite, but 5-methylcytosine remains unconverted. Therefore, amplification product is generated by performing nucleic acid amplification using genomic DNA having converted uracil (unmethylated) as a template and a polynucleotide that hybridizes to a region having uracil. A polynucleotide that hybridizes to a region containing cytosine is not amplified and a product cannot be obtained. On the other hand, (methylated) genomic DNA having 5-methylcytosine is not amplified without amplification with a polynucleotide that hybridizes to a region having uracil, but hybridizes to a region containing 5-methylcytosine. Amplified by the polynucleotide to give the product. By detecting this product by, for example, agarose gel electrophoresis, it is possible to analyze whether or not a predetermined region of DNA has been methylated.

  The predetermined region of DNA is preferably a CpG island of a gene. This region is a DNA sequence involved in gene transcription. CpG islands exist mainly in the upstream region (promoter region) of gene exons, and may exist in introns and exons. When the CpG island is methylated, it indicates that the transcription of the gene is suppressed. When the CpG island is not methylated, a transcription factor can be bound to the promoter region, so that this gene is transcribed. Alternatively, it indicates that transfer is possible.

The gene is preferably at least one selected from the group consisting of a tumor suppressor gene, a cancer gene, and a gene encoding a tumor marker (hereinafter referred to as a tumor marker gene). The tumor suppressor gene includes RB1 (retinoblastoma protein) gene, RRCA1 gene, APC (Adenomatous polyosis of the colon) gene, p53 gene, p16 gene, p15 gene, ERα (estrogen) Receptor 1: Estrogen Receptor 1) gene, E-cad (E cadherin) gene, VHL (von Hipple-Lindau disease) gene, RASSF1A (RAS
association domain family protein) gene and the like, and examples of oncogenes include RAS gene, RAF gene, MYC gene and the like. As tumor marker genes, CEA (Carcinoembryonic antigen-related cell adhesion molecule 5) gene, PSA (Prostate specific antigen) gene, CA15-3 gene, EpCAM (Epithelial cellular adhesion molecule) gene, etc. Is mentioned.

By detecting the methylation of CpG islands of these genes using the method of the present invention, it can be applied to genetic tests such as prediction of risk of disease and drug sensitivity.
For example, if a CpG island of a tumor suppressor gene of a given tumor cell is methylated and / or if the CpG island of an oncogene is not methylated, the tumor cell may be predicted to be malignant. it can.
In addition, when a CpG island of a gene that discharges a specific drug such as an anticancer drug or the like or a gene that degrades the drug is methylated, the cell has low resistance to the drug, that is, the drug Can be determined to be sensitive.
It is also possible to specify the type of tumor (specify the primary lesion) by detecting the methylation of the CpG island of the tumor marker gene of a given tumor cell.
In addition, by detecting the methylation of the CpG island of the above gene using a biological sample in which the presence or absence of cancer cells is unknown, it can be determined whether this biological sample contains tumor cells, Early detection of tumors and determination of risk of suffering from tumors can be performed.

Although the conventional methylation detection method requires about 4 hours to prepare a detection sample even by a rapid method, it has been difficult to apply clinically. However, the detection sample preparation method of the present invention and DNA methylation are difficult. Since the detection method can be performed in a short time and with a simple operation, it can be suitably used for clinical tests such as genetic tests as described above.
In addition, the speed of research on DNA methylation can be improved by using the quick and simple method of the present invention.

Example 1
Using the DNA methylation detection method of the present invention (hereinafter referred to as “the present method”), rapid method and standard method, the ERα gene and E-cad gene of MCF-7 and MDA231, which are cultured cells derived from human breast cancer. The methylation status of CpG islands was determined and the results of both were compared.
The operating procedure of this method is as follows. First, 400 μl of sample treatment solution containing 1% SDS, 100 mM NaCl, 10 mM Tris · HCl (pH 8.0) and 25 mM EDTA is added to cultured cells (1 × 10 ⁶ cells) of MCF-7 cell line or MDA231 cell line. And stirred at room temperature for 10 minutes (cell solubilization). Next, 12 μl of 10N NaOH was added and incubated at room temperature for 10 minutes (genomic DNA cleavage). Thereto was added 600 μl of 10M sodium bisulfite solution and incubated at 70 ° C. for 20 minutes (conversion of unmethylated cytosine). Then, the bisulfite-treated genomic solution (detection sample) was recovered using a DNA purification kit (Qiaquik (trade name) manufactured by Qiagen) (genomic DNA purification step).

  The cell solubilization step took about 30 minutes, the genomic DNA cleavage step took about 10 minutes, the unmethylated cytosine conversion step took about 20 minutes, and the genomic DNA purification step took about 30 minutes. It took about 1.5 hours from the start of the experiment to the preparation of the detection sample used for PCR.

Next, 2.0 μl of the collected detection sample and the following substances were mixed to prepare a PCR reaction solution.
10x PCR buffer (2.5 μl)
dNTP (0.5 μl)
10 μM sense primer (1.0 μl)
10 μM antisense primer (1.0 μl)
FastStart Taq DNA polymerase (0.2 μl, Roche 12032902001)
Water (17.8 μl)

As a primer for detecting methylation of ERα gene CpG island, a primer set specific to the following conversion sequence (hereinafter referred to as an unmethylated primer set) and a primer set specific to an unconverted sequence (hereinafter referred to as a methylated primer set) Was used).
<Unmethylated primer set>
Sense primer: TTGTGTATAATTATTTTGAGGGTG (SEQ ID NO: 1)
Antisense primer: CCAAACCATTAAAACCAAACACCA (SEQ ID NO: 2)
<Methylated primer set>
Sense primer: TTTTGGGATTGTATTTGTTTTCGTC (SEQ ID NO: 3)
Antisense primer: AAACAAAATACAAACCGTATCCCCG (SEQ ID NO: 4)

PCR was performed under the following conditions using a PCR reaction solution prepared for detection of methylation of the ERα gene CpG island.
40 cycles of steps i) to iii) at 95 ° C. and 4.5 minutes or less;
i) 95 ° C, 30 seconds
ii) 60 ° C, 30 seconds
iii) 72 ° C, 30 seconds

The following unmethylated primer set and methylated primer set were used as primers for detecting methylation of the E-cad gene CpG island.
<Unmethylated primer set>
Sense primer: 5'-TAATTTTAGGTTAGAGGGTTATTGT-3 '(SEQ ID NO: 5)
Antisense primer: 5'-CACAACCAATCAACAACACA-3 '(SEQ ID NO: 6)
<Methylated primer set>
Sense primer: 5'-TTAGGTTAGAGGGTTATCGCGT-3 '(SEQ ID NO: 7)
Antisense primer: 5'-TAACTAAAAATTCACCTACCGAC-3 '(SEQ ID NO: 8)

PCR was performed under the following conditions using a PCR reaction solution prepared for detection of methylation of the E-cad gene CpG island.
40 cycles of steps i) to iii) at 95 ° C. and 4.5 minutes or less;
i) 95 ° C, 30 seconds
ii) When using an unmethylated primer set, 53 ° C for 30 seconds, when using a methylated primer set, 57 ° C for 30 seconds
iii) 72 ° C, 30 seconds

As a negative control (NC), PCR was performed using 2.0 μl of purified water instead of the DNA solution.
The reaction solution after the PCR reaction performed using the primer set of the ERα gene and the negative control (NC) were each accommodated in a well of a 2% agarose gel and subjected to electrophoresis.
The reaction solution after the PCR reaction using the primer set of the E-cad gene and the negative control were respectively accommodated in wells of 2% agarose gel and subjected to electrophoresis.
The agarose gel after electrophoresis was stained with ethidium bromide, and each band of ERα gene and E-cad gene was confirmed.

The rapid method was performed as follows.
Genomic extraction was performed from each cell using MCF-7 cell line or MDA231 cell line cultured cells (1 × 10 ⁶ cells) (genomic DNA extraction). Genome extraction was performed using a kit (trade name: Blood & Cell Culture DNA mini Kit) manufactured by Qiagen, according to the attached protocol.
The genomic DNA extraction process took about 3 hours. It took about 4.5 hours from the start of the experiment to the preparation of the detection sample used for PCR.
Using the extracted genomic DNA, a genomic DNA cleavage step and an unmethylated cytosine conversion step were performed in the same manner as in the present method to obtain a genomic solution. Further, using this genomic solution, PCR and agarose gel electrophoresis were performed in the same manner as in the present method to confirm the band.

  In the standard method, in the step of converting unmethylated cytosine, 520 μl of 3M sodium bisulfite solution was added and incubated at 50 ° C. for 16 hours. Electrophoresis was performed to confirm the band. It took about 20.5 hours from the start of the experiment to the preparation of the detection sample used for PCR.

The results of electrophoresis obtained using this method, rapid method and standard method are shown in FIG. FIG. 1 shows the detection results of methylation of ERα gene CpG island and E-cad gene CpG island of MCF-7 cells, and the detection results of methylation of ERα gene CpG island and E-cad gene CpG island of MDA231 cells. It is.
From FIG. 1, it was found that the CpG island of the ERα gene and the CpG island of the E-cad gene of MCF-7 cells were not methylated using any of the present method, the rapid method, and the standard method.
Moreover, it was found that the CpG island of the ERα gene and the CpG island of the E-cad gene of MDA231 cells were not methylated by any of the present method, the rapid method and the standard method.
From the above, it was confirmed that by using this method, the same detection results as those conventionally used can be obtained in a short time and with a simple operation.

(Example 2)
By this method of Example 1, methylation of the E-cad gene CpG island of MCF-7 cells and MDA231 cells was detected (Example 2-1).

In addition, by including the cleaving agent NaOH in the sample treatment solution, the cell solubilization step and the cleavage step were performed in a single operation to detect methylation of the E-cad gene CpG island (Example 2- 2). That is, a genomic solution was obtained in the same manner as in this method of Example 1 except that 412 μl of sample treatment solution containing 1% SDS, 100 mM NaCl, 10 mM Tris · HCl (pH 8.0), 25 mM EDTA, and 0.3 N NaOH was used. (Sample for detection) was obtained.
It took about 30 minutes for cell solubilization and genomic DNA cleavage, about 20 minutes for unmethylated cytosine conversion, and about 30 minutes for genomic DNA purification. It took about 1 hour and 20 minutes from the start of the experiment to the preparation of the detection sample used for PCR.

  A PCR reaction solution was prepared using a methylated primer set and an unmethylated primer set for the E-cad gene, and a band was confirmed by PCR and agarose gel electrophoresis in the same manner as in Example 1.

The results of electrophoresis of Examples 2-1 and 2-2 are shown in FIG.
From FIG. 2, the methylation detection results obtained in Example 2-1 and the methylation detection results obtained in Example 2-2 were consistent.
Therefore, when the cleavage agent is added to the sample treatment solution and the cell solubilization step and the genomic DNA cleavage step are carried out in a single operation (Example 2-2), it is accurately performed in a shorter time and with a simple operation. It was confirmed that methylation could be detected.

(Example 3)
The conversion efficiency of unmethylated cytosine to uracil was compared using this method and the standard method.
A primer that hybridizes to the ERα gene CpG island shown below is added to the detection sample prepared from MCF-7 and MDA231 in Example 1, and a PCR reaction solution is prepared by the same operating procedure as described above. PCR amplification was performed.
Primer sequences are as follows.
5'-GGTTTTTGAGTTTTTTGTTTTG-3 '(SEQ ID NO: 9)
5'-AACTTACTACTATCCAAATACACCTC-3 '(SEQ ID NO: 10)
The amplified product was incorporated into a pCR-TOPO vector (invitrogen), and this plasmid was transformed into E. coli (TOP10). This E. coli was cultured (LB medium, left at 37 ° C. overnight), and 10 colonies were picked up. Ten picked colonies (clones 1 to 10) were further accommodated in separate containers and cultured (LB medium, shaken at 37 ° C. overnight), and the plasmids of these clones were purified by QIAprep Spin (Qiagen), respectively. did. Using the purified plasmid of 10 clones, the nucleotide sequence of the recombinant DNA was determined by the BigDye terminator Cycle Sequencing method using ABI Prism 3100 (Applied Biosystems) according to the attached protocol.

  Similarly, after a product amplified from the detection sample obtained by the standard method was transformed into E. coli and cultured, 10 colonies (clones 11 to 20) were further cultured. The sequence of these clones was determined as described above.

Using Genetyx-win (Software Development Co., Ltd.), a sequence obtained when all unmethylated cytosines are completely replaced with uracil (hereinafter referred to as a theoretical sequence: SEQ ID NO: 11), Multiple alignment with the sequences (SEQ ID NOs: 12 to 21) of 10 clones (clone 1 to 10) obtained by the method was performed. The results are shown in FIGS. Similarly, a multiple alignment between the theoretical sequence (SEQ ID NO: 22) obtained by the standard method and the sequence (SEQ ID NO: 23 to 32) of 10 clones (clone 11 to 20) was performed. The results are shown in FIGS.
Since the nucleotide sequences in FIGS. 3 to 6 are the sequences after the PCR reaction, uracil converted from unmethylated cytosine is expressed as thymine.

3 and 4, when this method is used to convert unmethylated cytosine to uracil, the nucleotide at the 46th position of clone 1 and the 42nd nucleotide of clone 2 is converted into uracil while being cytosine. It can be seen that it was not present (indicated by an underline in the figure).
5 and 6, when the conversion from unmethylated cytosine to uracil was performed using the standard method, nucleotides at positions 90, 146, 169 of clone 12 and position 76 of clone 14 were cytosine. It turns out that it was not converted into uracil as it is (indicated by underline in the figure).
That is, in the standard method, conversion was not performed in four places, but in this method, conversion was not performed in only two places.
From the above, it was confirmed that by preparing a sample using this method, conversion of unmethylated cytosine to uracil was performed with an efficiency equivalent to or higher than that of the standard method.

It is a figure which shows the methylation detection result of ER (alpha) gene CpG island and E-cad gene CpG island performed by this method, the rapid method, and the conventional method. It is a figure which shows the methylation detection result of the E-cad gene CpG island performed by this method. It is a figure which shows the gene sequence of the ER (alpha) gene CpG island which detected methylation using this method. It is a figure which shows the gene arrangement | sequence of the ER (alpha) gene CpG island which similarly detected methylation using this method. It is a figure which shows the gene sequence of the ER (alpha) gene CpG island which detected methylation using the standard method. It is a figure which shows the gene sequence of the ER (alpha) gene CpG island which similarly detected methylation using the standard method.

Claims (13)

A method for preparing a detection sample used for detecting DNA methylation, comprising:
A step of mixing a biological sample containing cells and a sample treatment solution containing a surfactant that solubilizes the cells; and the non-methylated cytosine contained in DNA is mixed with other bases in the mixture obtained in the step Adding a conversion agent that converts to
A method for preparing a sample for detection, comprising:   The method according to claim 1, further comprising a step of cleaving the DNA before the step of adding the conversion agent.   The method according to claim 1 or 2, wherein the conversion agent is bisulfite.   The method according to any one of claims 1 to 3, wherein the cell is a tumor cell.   The method according to any one of claims 1 to 4, wherein the sample treatment solution further comprises a cleaving agent capable of cleaving DNA. A method for detecting methylation in a predetermined region of DNA, comprising:
A step of mixing a biological sample containing cells and a sample treatment solution containing a surfactant that solubilizes the cells,
The step of adding a conversion agent for converting unmethylated cytosine contained in the region into another base to the mixed solution obtained in the step, and the other base converted from the unmethylated cytosine Detecting methylation in the region using a polynucleotide that hybridizes to the region and a polynucleotide that hybridizes to the region before conversion to the other base,
A method for detecting methylation of DNA, comprising:   The method according to claim 6, wherein the predetermined region of the DNA is a region containing a CpG island of a gene.   The method according to claim 7, wherein the gene is at least one selected from the group consisting of a tumor suppressor gene, an oncogene, and a gene encoding a tumor marker. A sample treatment solution for preparing a detection sample used for detection of DNA methylation from a biological sample containing cells,
A sample processing solution comprising a surfactant that solubilizes the cells.   The sample processing solution according to claim 9, wherein the pH is 7 to 10.   The sample processing solution according to claim 9 or 10, further comprising a cleaving agent for cleaving the DNA. A kit for the preparation of a detection sample used for detecting DNA methylation,
A kit comprising the sample treatment solution according to claim 9 and a conversion agent that converts unmethylated cytosine contained in DNA into another base.   The kit according to claim 12, further comprising a cleaving agent for cleaving DNA.