JP2007225348A - Method of detecting plurality of adjacent micro particles, and method of detecting examining substance using the same - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method of detecting an examining substance, which detects the examining substance highly sensitively compared with a known method, and a measuring method for a label used therefor. <P>SOLUTION: In this method of detecting the two or more of micro particles positioned adjacently, a linear polarization light is emitted to an examined sample containing the plurality of micro particles, so as to measure a polarization light component contained in a scattered light from the examined sample, and generated owing to the fact that the two or more of micro particles are positioned adjacently. In the method of detecting the examined substance, the examined substance is brought into contact with one or more kinds of selective coupling substances labelled with the micro particles and coupled selectively to the examining substance, so as to detect the two or more of adjacent micro particles by the coupling of the examining substance to the selective coupling substance. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a method for detecting a plurality of adjacent fine particles and a method for detecting a test substance using the same.

  Conventionally, an immunoassay has been widely used as a method for measuring an antigen or antibody capable of antigen-antibody reaction with high sensitivity. In conventional immunoassay methods, it is widely used to label an antibody or antigen that immunoreacts with a test substance (antigen or antibody), and to measure the label bound to the antibody or antigen bound to the test substance by the immune reaction. Has been done. As the label, gold fine particles (gold colloid), fluorescent dyes, enzymes, biotin, radioactive substances and the like are used. On the other hand, when the test substance is a nucleic acid, a labeled probe having a base sequence complementary to the test nucleic acid is contacted with the test nucleic acid, and the label of the probe hybridized with the test nucleic acid is widely measured. It has been broken.

JP-A-9-5326

  In a conventional immunoassay method or a method for measuring a test nucleic acid using a probe, the label cannot be detected unless a certain amount of the label is present. If a smaller amount of label can be detected than in the conventional measurement method, the detection sensitivity can be improved, which is advantageous.

  An object of the present invention is to provide a method for measuring a test substance and a method for measuring a label used therein, which can be detected with higher sensitivity than known methods.

  As a result of diligent research, the inventors of the present application find that when two or more fine particles are located close to each other, when linearly polarized light is irradiated to the two or more fine particles, a polarization component is generated due to the two or more fine particles located close to each other. By utilizing this fact, it was found that two or more adjacent fine particles can be detected. Then, using this method for detecting two or more adjacent fine particles, it was conceived that a test substance in a test sample can be detected with extremely high sensitivity, and experimentally confirmed to complete the present invention. .

  That is, the present invention is caused by irradiating a test sample containing a plurality of microparticles with linearly polarized light, and two or more microparticles included in the scattered light from the test sample are located close to each other. And a method for detecting two or more fine particles located close to each other, comprising measuring a polarization component generated in the above. In addition, the present invention provides a method of contacting one or more selective binding substances labeled with fine particles, which selectively bind to a test substance, with the test substance, and the test substance and the selective binding substance. Provided is a method for detecting a test substance, which comprises detecting two or more fine particles that are closer to each other by the method of the present invention.

  The present invention provides a method capable of detecting adjacent microparticles with very high sensitivity, ie, as few as two microparticles, as specifically described in the examples below. Then, by using this method, a method capable of detecting a test substance such as a nucleic acid, an antigen or an antibody, or a receptor or a ligand with extremely high sensitivity has been provided. According to the method of the present invention, it is possible to detect a test substance of only one molecule, and it is possible to detect a test substance with a much higher sensitivity than known methods.

  Fine particles used in the method of the present invention include metals such as gold, platinum, silver, copper, lead, tin, nickel, iron, zinc, and aluminum; semiconductors such as silicon and germanium; gallium, indium, cadmium, silicon, and zinc Compound semiconductors containing: fine particles made of optically opaque materials such as polymers such as polystyrene and latex can be used. Among these, metal fine particles are preferable because the polarization component due to the adjacent fine particles becomes large. Among metal microparticles, gold microparticles can easily bind thiol (-SH), and can also bind to biomolecules such as desired proteins and nucleic acids using this thiol group. It is preferable because it is stable. In addition, gold microparticles are widely used as gold colloids in the field of immunoassay, and gold microparticles with various particle sizes are commercially available in a form in which thiol groups are bonded, so that various commercially available products can be used. This is also advantageous.

  The size of the fine particles used in the method of the present invention is not particularly limited, but fine particles having a diameter (longer diameter other than spherical) of about 10 nm to 400 nm (but smaller than the measurement wavelength) are preferable, and further, a diameter of 20 nm Those of about ~ 200 nm are preferred. The shape of the fine particles is preferably spherical. As described above, the spherical gold fine particles of the size described above are called “gold colloid” and are widely used as labels in immunoassays, and various types are commercially available. In the present invention, such a commercially available gold colloid can be used as fine particles.

  As described above, when the two or more fine particles are located close to each other in the test sample, the inventors of the present application have two or more fine particles (hereinafter referred to as “close”) when the test sample is irradiated with linearly polarized light. For the sake of convenience, this phenomenon is referred to as “proximity microparticles”), and it is possible to detect the proximity microparticles separately from the microparticles that exist alone by utilizing the phenomenon that a polarization component is generated in the scattered light. I came up with it. The present invention provides a method for detecting adjacent fine particles using this principle. In other words, when a single particle is present, when it is irradiated with linearly polarized light, the scattered light always has the same polarization as the irradiated polarized light, whereas when two particles are located close to each other, scattering from the particle pair The light always has a polarization parallel to the arrangement (alignment direction) of the fine particle pairs regardless of the irradiation polarization. In the method of the present invention, polarized light caused by the fine particle pair is measured. When three or more fine particles are located close to each other, it is considered as a combination of two fine particles. Therefore, polarized light having a polarization plane with an angle different from the polarization plane of irradiated polarized light due to the three or more adjacent fine particles. Measure this as it occurs.

  The polarized light caused by the adjacent fine particles can be detected by observing and comparing the angle relationship between the irradiated polarized light and the polarized light of the scattered light detected on the measurement side under two or more different angle conditions. For example, it is possible to measure by measuring the polarized light whose polarization plane and the polarization plane are not shifted from each other, rotating the polarization plane of the polarized polarized light, and measuring with the analyzer (polarizing plate) fixed as it is on the measurement side. it can. Or, conversely, it is possible to obtain the polarization characteristics of the test sample by fixing the plane of polarization of the irradiated polarized light and rotating the polarization of the scattered light to be detected.

  More specifically, in the method of the present invention, for example, the test sample is irradiated with the first linearly polarized light, the polarization of the scattered light from the test sample is measured, and then the first linearly polarized light is measured. Can be performed by irradiating the test sample with the second linearly polarized light having different polarization plane angles, and measuring the polarization in the scattered light from the test sample. This can be done, for example, as follows. First, using a light source that emits linearly polarized light such as a He-Ne laser, the sample is irradiated with linearly polarized light under total reflection conditions (evanescent irradiation), and the scattered light is imaged with an inverted microscope using a CCD camera. . Next, the test sample is irradiated with second linearly polarized light having a polarization plane angle different from that of the first linearly polarized light, and the polarized light in the scattered light from the test sample is measured. In this case, the angle of the polarization plane can be arbitrarily changed by arranging a half-wave plate between the light source and the test sample and irradiating the polarized light that has passed through the half-wave plate. The difference in angle between the planes of polarization of the first linearly polarized light and the second linearly polarized light is not particularly limited, but it is preferably 10 ° to 90 °, more preferably 30 ° to 90 °, on the acute angle side.

  Said method can be performed using the optical measuring system shown in FIG. 1 which used the inverted microscope, for example. In FIG. 1, 10 is a He-Ne laser as a light source, 12 is a half-wave plate, 14 is a condenser lens, 16 is a Dove prism, 18 is a sample to be tested, 20 is an objective lens, and 22 is an analyzer (polarized light). Plate), 24 is a condenser lens, and 26 is a CCD camera. The linearly polarized light from the He-Ne laser is reflected by the two mirrors and guided to the half-wave plate 12 and further guided to the side surface of the Dove prism 16 through the condenser lens. A test sample 18 is placed on the lower surface of the Dove prism 16, and the test sample 18 is irradiated with linearly polarized light through the Dove prism 16 under total reflection conditions. Scattered light from the test sample 18 is guided to the objective lens 20 of the inverted microscope, reflected by a mirror via an analyzer (polarizing plate) 22 and then guided to a condenser lens 24, and an image is taken with a CCD camera. In FIG. 1, the portion surrounded by a broken line is an inverted microscope. Next, the angle of the plane of polarization of linearly polarized light is changed by changing the angle of the half-wave plate 12, and the sample 18 is irradiated in the same manner as described above, and the polarized light in the scattered light is measured. Note that “polarization measurement” includes imaging with a CCD camera, observing an image with a CCD camera, measuring polarization with a polarization detector without using a CCD camera, and measuring light intensity without using a CCD camera. And direct observation with the naked eye without using a CCD camera.

  When the image is picked up by the above method, the same image is obtained when the first linearly polarized light is irradiated and when the second linearly polarized light is irradiated when the fine particles are present alone. On the other hand, in the case of the proximity fine particles, a polarization component is generated by the proximity fine particles, so that the image is different between the first linearly polarized light irradiation and the second linearly polarized light irradiation. For example, an image can be seen when the first linearly polarized light is irradiated, but no image can be seen when the second linearly polarized light is irradiated, and vice versa. Therefore, when the images are different between the first linearly polarized light irradiation and the second linearly polarized light irradiation, that is, when they are visible or invisible, or appear dark or thin, the particles are adjacent fine particles. . The observation of an image of a certain particle is performed by changing the direction of the half-wave plate 12 continuously while observing the image by the CCD camera 26 in the above method, thereby polarizing the polarized light irradiated on the sample 18 to be examined. This can also be done by continuously rotating the surface. In this case, since the change in the appearance of the image can be observed continuously, the adjacent fine particles can be identified more easily.

  The polarized light component caused by the adjacent fine particles can also be detected by detecting the polarized light in the scattered light with a balanced polarization detector. Here, the “balance detection method” means that signal light is measured by dividing it into two linearly polarized components orthogonal to each other, and the signal light is generated so that the light intensity of the two polarized components is the same in the reference signal light. In this method, the angle of the polarization plane is adjusted later with a wave plate or the like, and only the change in the polarization of the signal light that changes depending on the observation point of the test sample is measured. This method is preferable because only the change in polarization of the signal light can be detected with high accuracy. The balance detection method itself is well known in the optical field.

  The balance detection method can be performed using, for example, an optical measurement system shown in FIG. In FIG. 2, the same components as those in FIG. 1 are denoted by the same reference numerals. Reference numeral 10 is a He-Ne laser, 28 is a beam expander, 12 is a half-wave plate, 29 is a beam splitter, 20 is an objective lens, 18 is a sample to be tested, 30 is a stage scanner, 24 is a condenser lens, 26 is a CCD camera, 32 is a second half-wave plate, 34 is an analyzer, and 36 is a balance detector. In the optical measurement system shown in FIG. 2, the CCD camera 26 and the condensing lens 24 are also arranged so as to be able to pick up images with the CCD camera, as in the optical measurement system shown in FIG. These are not necessary for this purpose.

  When the optical measurement system shown in FIG. 2 is used, the beam diameter of the linearly polarized light from the He-Ne laser 10 is expanded by the beam expander 28 (if the beam system is thin as it is, the numerical aperture of the objective lens may not be fully utilized. For this reason, the spread irradiation light passes through the half-wave plate 12 and the beam splitter 29, enters the inverted microscope, and is focused on the surface of the sample 18 through the objective lens 20. Scattered light from the test sample 18 is collected using the same objective lens 20 as that used for irradiation, and taken out to the polarization detection system by the beam splitter 29. In the balanced type polarization detection system, the polarization of the signal light is shifted by about 45 degrees with the half-wave plate 32 immediately before the analyzer 34, and the analyzer 34 divides the polarization into two of the longitudinal polarization and the lateral polarization, and measures the light intensity of each. Then, the difference between the two last measured light intensity signals is recorded. First, the half-wave plate 32 is adjusted so that the difference in light intensity between longitudinally polarized light and laterally polarized light becomes zero in a certain signal light. In this way, only the change in the polarization of the signal light can be detected with high accuracy thereafter. In the arrangement shown in FIG. 2 in which the irradiated light is focused by the objective lens 20 and irradiated to the test sample 18, only one point on the surface of the test sample 18 can be irradiated at a time. Therefore, it is preferable that the test sample 18 be configured to be scanned using a stage scanner 30 or the like with a built-in piezo. Such a stage scanner 30 makes it possible to observe a wide area of several tens to several hundreds μm square.

  When two or more fine particles that can be detected by the method of the present invention have a space distance (shortest distance) between the particles of 10 nm or less or less than the radius of the fine particles and are positioned in contact with each other (between particles) It is possible to detect a distance of 0). Therefore, in the method of the present invention, “closely located” means that the space distance (shortest distance) between particles is 10 nm or less or less than the radius of the fine particle, whichever is greater, which is less than the larger one. Are also included.

  As specifically described in the examples described later, according to the method of the present invention, it is possible to detect only two adjacent fine particles, and naturally, three or more fine particles are close to each other. Cases can also be detected. The upper limit of the number of adjacent fine particles is not particularly limited, but the power of the detection method of the present invention with extremely high sensitivity is exhibited when measuring about 2 to 10 adjacent fine particles.

  It is possible to detect a desired test substance with extremely high sensitivity by using the above-described method for detecting a close particle of the present invention. That is, as described above, in the present invention, one or more selective binding substances labeled with fine particles that selectively bind to a test substance are brought into contact with the test substance, and the test substance and the selection are contacted. There is also provided a method for detecting a test substance, which comprises detecting two or more microparticles closer to the binding substance by the method of the present invention.

Here, the test substance is a substance in which a substance that selectively binds to this substance exists, and includes single-stranded nucleic acids, antigens and antibodies, receptors and ligands, and the like. That is, when the test substance is a single-stranded nucleic acid, the single-stranded nucleic acid has a base sequence complementary or nearly complementary to at least a partial region of the single-stranded nucleic acid, preferably a region having a size of about 10 bases or more. Nucleic acids correspond to selective binding substances. When the test substance is an antigen, an antibody or an antigen-binding fragment thereof (Fab fragment, F (ab ′) ₂ fragment, etc.) that reacts with the antigen with an antigen corresponds to the selective binding substance. When the test substance is an antibody, an antigen that reacts with the antibody by an antigen antibody corresponds to a selective binding substance. When the test substance is a receptor, the ligand that specifically binds to the receptor corresponds to the selective binding substance. Conversely, when the ligand is the test substance, the receptor that specifically binds to the ligand becomes the selective binding substance. Applicable. The combination of the test substance and the selective binding substance is not limited to these, and any pair of substances that selectively bind may be used.

  As described above, according to the proximity particle detection method of the present invention, it is possible to detect only 2 proximity particles. For this reason, when two or more molecules of the selective binding substance bind to a single molecule of the test substance, it is possible to detect two or more selective binding substances bound to the single molecule. It is possible to detect a single molecule of the test substance, and it is possible to detect the test substance with extremely high sensitivity. However, when a plurality of molecules of the test substance exist in close proximity, even if the number of molecules of the selective binding substance that can bind to a single molecule of the test substance is one, the labeled fine particles are close to each other. Therefore, it is possible to measure the adjacent fine particles and consequently the test substance by the method of the present invention described above.

  One or two or more selective binding substances may be used. When two or more selective binding substances are bound to a single molecule of the test substance, it is usually preferable to use two or more selective binding substances that selectively bind to different regions in the molecule of the test substance. For example, when the test substance is a single-stranded nucleic acid, a first microparticle-labeled single-stranded nucleic acid having a base sequence complementary to the first region in the test substance molecule, and the first in the test substance molecule A second particulate labeled single-stranded nucleic acid having a base sequence complementary to the region 2 is bound to a test single-stranded nucleic acid, and the first and second particulate labeled single-stranded nucleic acids are detected. Thus, one molecule of test single-stranded nucleic acid can be detected. Similarly, when the test substance is an antigen protein molecule having a plurality of exposed epitopes, a first microparticle-labeled monoclonal antibody that specifically binds to the first epitope on the test antigen protein molecule, Binding a second particulate labeled monoclonal antibody that specifically binds to a second epitope on the antigen protein molecule to a test antigen protein and detecting the particulates of the first and second particulate labeled monoclonal antibodies, One molecule of the test antigen protein can be detected. In addition, when a plurality of selectively binding substance molecules bind to one molecule of the test substance, the molecules of the selective binding substance are often two or more kinds of molecules as described above. In the case where a plurality of subunits are combined, one type of a plurality of selective binding substance molecules can bind to a single molecule of the test substance.

  The test substance can be labeled with gold fine particles by a well-known method commonly used in the field of immunoassay. For example, gold is called self-assembled monolayer (SAM). On the other hand, it can be performed by a method in which a molecule having a thiol group (-SH) forms a monomolecular film.

  The binding reaction between the test substance and the selective binding substance itself can be performed by a conventional method. That is, for example, when the test substance is a single-stranded nucleic acid, the binding reaction between the test substance and the selective binding substance itself is a labeled nucleic acid such as, for example, Southern blotting or gene detection using a DNA array. The detection can be performed in the same manner as a well-known method for detecting a single-stranded nucleic acid using a probe. When the test substance and the selective binding substance undergo an immunoreaction, the binding reaction between the test substance and the selective binding substance itself can be performed in the same manner as in a normal immunoassay method.

  After the binding reaction, the test substance can be detected by detecting the adjacent fine particles by the method of the present invention described above. According to the method of the present invention, two adjacent fine particles can be detected as described above. In other words, one molecule of a test substance can be detected, and extremely sensitive detection is possible. is there.

  Hereinafter, the present invention will be described more specifically based on examples. However, the present invention is not limited to the following examples.

Detection of close gold particles (part 1)
A commercially available gold fine particle suspension in which gold fine particles having an average particle diameter (diameter) of 100 nm are suspended in water at a concentration of about 5.9 billion particles / mL is spin-coated on a cover glass and dried to be examined. Used as a sample.

  Measurement was performed using the above-described optical measurement system shown in FIG. From the back surface of the cover glass 18, total reflection illumination was performed via the Dove prism 16, and the scattered light was condensed by the objective lens 20 and observed by the CCD camera 26.

  3A and 3B show the results when the linearly polarized light whose polarization plane angle is different by 30 degrees is irradiated. FIG. 4 (a) shows the result of observing the bright spots having different appearances in (a) and (b) in FIG. 3 with an electron microscope. As shown in FIG. 4 (a), it was found that a bright spot having a different appearance when irradiated with linearly polarized light having different angles of polarization plane is in contact with two gold fine particles. On the other hand, the bright spots that look the same in FIGS. 3 (a) and 3 (b) were observed with an electron microscope and were found to consist of a single gold fine particle as shown in FIG. 4 (b). Accordingly, it has been clarified that the method described above can detect adjacent gold fine particles by detecting bright spots that are different in appearance when irradiated with linearly polarized light having different polarization plane angles.

Detection of close gold particles (part 2)
The test sample prepared in Example 1 was measured by a balance detection method using the above-described optical measurement system shown in FIG. As the irradiation polarized light, two types of linearly polarized light having different polarization plane angles of 90 degrees were used.

  The results are shown in (a) and (b) of FIG. In (a) and (b) of FIG. 5, a remarkably different appearance such as a bright spot surrounded by a circle is observed, indicating that only a gold fine particle pair can be discriminated with high contrast.

Detection of test DNA Preparation of gold microparticle-labeled oligonucleotide probe The same as that used in Example 1 via sulfur (-S-) at the 5 'end of a chemically synthesized oligonucleotide A having the base sequence of atgctcaactct (SEQ ID NO: 1) Gold fine particles having an average particle diameter of 100 nm were bonded. Specifically, this bonding method was performed as follows. Prepared oligonucleotide A with a thiol (-SH) modified OD concentration of 0.02 at the 5 'end and suspended gold fine particles with an average particle size of 100 nm at a concentration of about 5.9 billion particles / mL. It was mixed with the turbid solution and reacted at room temperature for 16 hours to bind. Similarly, the same average particle diameter of 100 nm as that used in Example 1 via sulfur (-S-) is attached to the 5 'end of oligonucleotide B having the base sequence of taggacttacgc (SEQ ID NO: 2) synthesized chemically. Of gold fine particles. These gold fine particle labeled oligonucleotide probes were designated as an aqueous solution A and an aqueous solution B, respectively. On the other hand, an aqueous solution C was prepared by dissolving a test single-stranded DNA having a base sequence of chemically synthesized tacgagttgagaatcctgaatgcg (SEQ ID NO: 3) in water at a concentration of 10 nmol / mL. As shown in FIG. 6, oligonucleotide A and oligonucleotide B have complementary base sequences in different regions of the test single-stranded DNA, and simultaneously hybridize to the test single-stranded DNA. Is possible.

2. Detection of test single-stranded DNA A mixture of equal amounts of Aqueous solution A and Aqueous solution B, or Aqueous solution A, Aqueous solution B and Aqueous solution C (Aqueous solution A: B: C = 50: 50: 1 (v / v)) After incubating at 60 ° C. for 5 minutes and then lowering to 30 ° C. over 2 hours, the test sample filled between the two cover glasses was shown in FIG. It measured using the measuring system. However, the irradiation light was measured while continuously changing the angle of the polarization plane.

  The results are shown in FIG. Each of (a) and (b) in FIG. 7 shows an observation image of a region of about 50 μm square by a CCD camera in a certain polarization when measured by continuously changing the polarization of the irradiation light, and the observation image. Appropriately selected bright spots (1) (1 in the circle) to (3) (3 in the circle) show the polarization dependence of the brightness. As shown in FIG. 7 (a), in the polarization observation of the solution obtained by mixing only the two solutions of the aqueous solution A and the aqueous solution B, the difference in appearance depending on the irradiation polarization was not observed, but as shown in FIG. 7 (b). When the aqueous solution C containing the test single-stranded DNA is further added, it can be confirmed that the appearance differs depending on the irradiation polarized light, and detection of the test single-stranded DNA by highly sensitive polarization observation of a gold fine particle pair. Was shown to be possible.

It is a figure which shows typically an example of the optical measuring system for enforcing the measuring method of the proximity microparticles of this invention. It is a figure which shows typically an example of the optical measuring system for enforcing the measuring method by the balance detection method of the proximity particle of this invention. It is the picked-up photograph by the CCD camera obtained when the gold fine particle sample was irradiated with two types of linearly polarized light with different angles of polarization planes obtained in the examples of the present invention. Electron micrographs (a) of bright spots that differ in appearance when the gold fine particle sample is irradiated with two types of linearly polarized light with different angles of polarization planes, or bright spots that have the same appearance. This is an electron micrograph (b). It is a photograph which shows the observation result of the gold fine particle by the balance detection method obtained in the Example of this invention. It is a figure which shows the base sequence of test single strand DNA (i) and two types of gold microparticle label | marker oligonucleotide probes (ii) and (iii) used in the Example of this invention, and those positional relationships. It is a figure which shows the photograph which shows the observation result of the test single strand DNA obtained in the Example of this invention with the figure which shows the polarization dependence of scattered light intensity | strength.

Explanation of symbols

10 He-Ne laser 12 1/2 wavelength plate 14 Condensing lens 16 Dove prism 18 Test sample 20 Objective lens 22 Analyzer (polarizing plate)
24 Condensing lens 26 CCD camera 28 Beam expander 29 Beam splitter 30 Stage scanner 32 Second half-wave plate 34 Analyzer 36 Balance detector

Claims (9)

  A test sample containing a plurality of fine particles is irradiated with linearly polarized light, and the polarization component generated due to the proximity of two or more fine particles contained in the scattered light from the test sample is measured. And a method for detecting two or more fine particles located in close proximity.   The method according to claim 1, wherein the fine particles are metal fine particles.   The method according to claim 2, wherein the metal fine particles are gold fine particles.   The test sample is irradiated with a first linearly polarized light, the polarization of scattered light from the test sample is measured, and then the second linearly polarized light having a polarization plane angle different from that of the first linearly polarized light is The method according to any one of claims 1 to 3, comprising irradiating the test sample and measuring the polarization of the scattered light from the test sample.   The method according to any one of claims 1 to 3, comprising continuously rotating a polarization plane of the linearly polarized light applied to the test sample and continuously measuring the polarization of the scattered light.   The method according to claim 1, wherein polarization of the scattered light is detected by a balance detection method.   Two or more selective binding substances labeled with fine particles, which selectively bind to the test substance, are brought into contact with the test substance, and two closer to each other by the binding between the test substance and the selective binding substance A method for detecting a test substance, comprising detecting the above fine particles by the method according to any one of claims 1 to 6.   The method according to claim 7, wherein two or more molecules of the selective binding substance are bound to a single molecule of the test substance. The method according to claim 7 or 8, wherein the test substance is a single-stranded nucleic acid, an antigen or an antibody, or a receptor or a ligand.

Images