JP2007222010A - Method for detecting gene and carrier for detecting gene - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method by which non-specific detection is suppressed with high detection sensitivity in the method for detecting a gene by a primer elongating reaction on a prescribed substrate. <P>SOLUTION: The method for detecting the gene comprises (a) a step of immobilizing a primer chain for elongating a DNA in which a part or all of nucleotides are substituted with an LNA (locked nucleic acid acid) on a surface of the substrate having a polymer containing a first unit having a group derived from a phosphoric ester composing a hydrophilic part of a phospholipid and a second unit having a carboxylic acid derivative group in which an electron attractive substituent is bonded to a carbonyl group, (b) a step of bringing a sample solution containing a DNA fragment or an RNA fragment of the objective gene to be detected, a nucleotide monomer and an enzyme for elongating the DNA into contact with the surface of the substrate and (c) a step of elongating the primer chain for elongating the DNA immobilized on the surface of the substrate using the DNA fragment or RNA fragment in the sample solution as a template. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a gene detection method using a gene detection carrier having a primer immobilized on a substrate surface.

  Non-Patent Document 1 discloses DNA amplification by solid-phase PCR (Polymerase Chain Reaction) using a DNA microarray in which a DNA strand serving as a primer is covalently bonded to the surface of a glass substrate modified with a predetermined amino-silane reagent. A technique for performing is disclosed.

  Non-Patent Document 2 describes a hybrid property with a predetermined DNA strand and a PCR-like environment using a DNA microarray in which DNA fragments are immobilized on the surface using poly (methyl methacrylate) instead of a glass substrate. The thermostability below has been evaluated, and a description suggesting the possibility of a device that can be applied to a novel PCR technique has been made.

  Patent Document 1 describes a method of detecting a single nucleotide polymorphism (SNP) of a gene by immobilizing a probe on the surface of a solid support having a hydrogel layer and performing a probe extension reaction using a predetermined DNA strand as a template. However, there was a problem that the specificity and signal amount were low in practice.

On the other hand, Patent Document 2 describes that nucleotides containing LNA, which is a bicyclic nucleotide derivative, are highly specific for binding to complementary sequences of DNA and RNA.
Adessi, Celine et al. “Solid Phase DNA amplification: Characterisation of primer attachment and amplification mechanisms”, Nucleic Acids Research, 2000, Vol. 20, No. 20, e87 Fixe, F. et al. “Functionalization of poly (methyl methacrylate) (PMMA) as a substrate for DNA microarrays”, Nucleic Acids Research, 2004, January 12, Vol.32 No.1, e9 Japanese translation of PCT publication No. 2004-532026 JP 2002-540118 A

  The present inventors conducted a DNA chain extension reaction using a DNA microarray represented by Non-Patent Documents 1 and 2, and found that there was a problem in the affinity and specificity between the primer and the gene fragment in the sample. The present invention was completed by solving this problem by using a substrate having a predetermined polymer substance on the surface and using a primer in which some nucleotides are substituted with LNA.

That is, the present invention
(1) a first unit having a group derived from a phosphate ester constituting the hydrophilic part of the phospholipid and a second unit having a carboxylic acid derivative group in which an electron-withdrawing substituent is bonded to a carbonyl group; A substrate having a polymer material containing
(A) a step of immobilizing a DNA extension primer strand in which a part or all of the nucleotides are replaced with LNA (Locked Nucleic Acid) on the surface of the substrate;
(B) a step of bringing a sample solution containing a DNA fragment or RNA fragment of a target gene to be detected, a nucleotide monomer, and a DNA extension enzyme into contact with the substrate surface;
(C) using the DNA fragment or the RNA fragment in the sample solution as a template, and extending the primer strand for DNA extension immobilized on the substrate surface,
(2) The method for detecting a gene according to (1), wherein the LNA-substituted nucleotide of the DNA extension primer strand is introduced at a position including the 3 ′ end of the primer strand,
(3) The method for detecting a gene according to (1) or (2), wherein in the primer strand for DNA extension, one base of the base sequence including the characteristic sequence of the gene of interest is replaced with another base ,
(4) The method for detecting a gene according to (3), wherein the replacement of the single base is performed at the 3 ′ end,
(5) In the method for detecting a gene according to any one of (1) to (4),
The group derived from the phosphate ester contained in the first unit of the polymer substance is any one of phosphorylcholine group, phosphorylethanolamine group, phosphorylserine group, phosphorylinositol group, phosphorylglycerol group, and phosphatidylphosphorylglycerol group. A gene detection method characterized by
(6) In the method for detecting a gene according to any one of (1) to (5),
A method for detecting a gene, wherein any of the nucleotide monomers is labeled;
(7) In the method for detecting a gene according to (6),
A method for detecting a gene, wherein the label is a fluorescent dye,
(8) In the method for detecting a gene according to (6),
(D) introducing a redox enzyme into the label of the nucleotide monomer, adding a substrate that develops color by oxidation or reduction reaction, and causing the substrate to develop color;
A method for detecting a gene, comprising:
(9) In the method for detecting a gene according to any one of (1) to (8),
A method for detecting a gene, wherein the enzyme for extending a DNA chain is a DNA polymerase or a DNA ligase;
(10) In the method for detecting a gene according to any one of (1) to (9),
The gene detection method, wherein the DNA extension primer strand is covalently bonded at a site of a second unit having a carboxylic acid derivative group in which the electron-withdrawing substituent is bonded to a carbonyl group ,
(11) In the method for detecting a gene according to any one of (1) to (10),
A method for detecting a gene, wherein the polymer substance has a third unit containing a butyl methacrylate group,
(12) In the method for detecting a gene according to any one of (1) to (11),
In addition to the polymer substance, the substrate includes a second unit having a first unit having a group derived from a phosphate ester constituting the hydrophilic part of the phospholipid and a third unit containing a butyl methacrylate group. A method for detecting a gene characterized by containing a molecular substance,
(13) In the method for detecting a gene according to any one of (1) to (12),
A method for detecting a gene, wherein the substrate is made of a plastic material;
(14) In the method for detecting a gene according to any one of (1) to (13),
The method of detecting a gene, wherein the step (c) is performed by applying a predetermined heat cycle,
(15) In the method for detecting a gene according to (14),
A method for detecting a gene, wherein the number of heat cycles is 1 or more,
(16) In the gene detection method according to (14) or (15),
The gene detection method, wherein the heat cycle includes holding at a heat denaturation temperature, holding at an annealing temperature, holding at a DNA extension temperature,
(17) In the gene detection method according to (16),
A method for detecting a gene, characterized in that the annealing temperature and the DNA extension temperature are the same temperature;
(18) A first unit having a group derived from a phosphate ester constituting a hydrophilic part of a phospholipid, the carrier for gene detection used in the method for detecting a gene according to any one of (1) to (17) And a part of or all of the nucleotides on a substrate having a polymer substance on the surface containing a second unit having a carboxylic acid derivative group in which an electron-withdrawing substituent is bonded to a carbonyl group, and LNA (Locked Nucleic Acid) A carrier for gene detection in which the primer strand for DNA extension substituted in (1) is immobilized on the substrate surface,
It is.

  The gene detection method according to the present invention comprises a carboxylic acid derivative comprising a first unit having a group derived from a phosphate ester constituting a hydrophilic part of a phospholipid and an electron-withdrawing substituent bonded to a carbonyl group. A target gene to be detected by immobilizing a DNA extension primer chain in which a part of nucleotides are substituted with LNA (Locked Nucleic Acid) on a substrate having a polymer substance containing a second unit having a group on the surface and detecting the DNA. The DNA chain or RNA fragment of the DNA template is used as a template, and the DNA chain elongation enzyme system and the liquid phase system into which the sample containing the nucleotide monomer has been introduced are preferably subjected to heat denaturation temperature (hereinafter referred to as “thermal denaturation treatment temperature”). And the temperature of the reaction system is lowered to the annealing temperature (hereinafter referred to as “annealing temperature”), and the DNA elongation temperature By maintaining the temperature, the DNA strand immobilized on the substrate is subjected to elongation reaction, and all treatments are performed in the same liquid phase system.

  By replacing part or all of the nucleotides of the DNA strand immobilized on the substrate with LNA, a highly specific gene with high specificity can be obtained.

  In addition, conventionally, after the annealing treatment and before the extension reaction, a washing treatment was required to remove the DNA fragments that did not form double strands, but there were no DNA fragments adsorbed nonspecifically on the substrate. In addition, it is considered that the enzyme reaction related to DNA chain extension functions effectively, and the substrate is not required to be washed before the extension reaction.

In this DNA chain extension method, the group derived from the phosphate ester contained in the first unit of the substrate is phosphorylcholine group, phosphorylethanolamine group, phosphorylserine group, phosphorylinositol group, phosphorylglycerol group, phosphatidylphosphorylglycerol group. Can be either.
Thus, by providing an environment similar to that of phospholipids on the surface of the substrate, the DNA chain elongation reaction occurring on the surface of the substrate can be performed in an environment equivalent to that in the cell, the enzyme reaction efficiency is high, and DNA Chain extension can be performed more efficiently under milder conditions.

  According to the present invention, a gene can be detected with high specificity and high accuracy.

Hereinafter, embodiments of the present invention will be described in detail.
The surface of the substrate used here is a carboxylic acid formed by bonding a first unit having a group derived from a phosphate ester constituting the hydrophilic part of a phospholipid and an electron-withdrawing substituent to a carbonyl group. There exists a polymer substance containing a second unit having a derivative group.

  It has a first unit containing a group derived from a phosphate ester constituting the hydrophilic part of this phospholipid and a second unit having a carboxylic acid derivative group in which an electron-withdrawing substituent is bonded to a carbonyl group. The polymer substance is a polymer having both the property of suppressing nonspecific adsorption of DNA strands and the property of immobilizing DNA strands. In particular, a group derived from a phosphate ester constituting the hydrophilic part of the phospholipid contained in the first unit plays a role in suppressing nonspecific adsorption of the template DNA fragment, and the carboxylic acid-derived group contained in the second unit. Serves to chemically immobilize the primer. That is, the primer is covalently bonded at the site of the carboxylic acid derivative group of the coating layer made of the polymer material and immobilized on the surface of the substrate.

The first unit is, for example, a (meth) acryloyloxyalkyl phosphorylcholine group such as a 2-methacryloyloxyethyl phosphorylcholine group, a 6-methacryloyloxyhexyl phosphorylcholine group;
(Meth) acryloyloxyalkoxyalkylphosphorylcholine groups such as 2-methacryloyloxyethoxyethyl phosphorylcholine group and 10-methacryloyloxyethoxynonylphosphorylcholine group;
Alkenylphosphorylcholine groups such as allylphosphorylcholine group, butenylphosphorylcholine group, hexenylphosphorylcholine group, octenylphosphorylcholine group, and decenylphosphorylcholine group;
And a phosphorylcholine group is included in these groups.

  Of these groups, 2-methacryloyloxyethyl phosphorylcholine is preferable. By adopting a configuration in which the first unit has 2-methacryloyloxyethyl phosphorylcholine, nonspecific adsorption of the template DNA fragment on the substrate surface can be more reliably suppressed.

  In addition, although the example which is the phosphorylcholine group shown to following formula (a) as a basic skeleton was given here, this phosphorylcholine is phosphorylethanolamine group of following formula (b), phosphorylinositol group of following formula (c), following formula The phosphorylserine group in (d), the phosphorylglycerol group in the following formula (e), and the phosphate group such as the phosphatidylphosphorylglycerol group in the following formula (f) may be substituted (the same applies to the following).

  The carboxylic acid derivative is a carboxylic acid in which the carboxyl group of the carboxylic acid is activated and has a leaving group via C═O. Specifically, the carboxylic acid derivative is a compound in which a nucleophilic reaction is activated by bonding a group having higher electron withdrawing property than an alkoxyl group to a carbonyl group. The carboxylic acid derivative group is a compound having reactivity with an amino group, a thiol group, a hydroxyl group and the like.

More specifically, carboxylic acid derivatives include carboxyl groups such as acrylic acid, methacrylic acid, crotonic acid, maleic acid, and fumaric acid, which are carboxylic acids, in acid anhydrides, acid halides, active esters, and activated amides. Examples include converted compounds. Carboxylic acid-derived groups are activated groups derived from such compounds, for example, active ester groups such as p-nitrophenyl groups and N-hydroxysuccinimide groups;
-Halogen such as Cl, -F;
And the like.

  The carboxylic acid derivative group can be a group represented by the following formula (1).

（ただし、上記式（１）において、Ａは水酸基を除く脱離基である。）

(In the above formula (1), A is a leaving group excluding a hydroxyl group.)

  The monovalent group represented by the above formula (1) can be, for example, any group selected from the following formula (p) or formula (q).

(However, in the above formulas (p) and (q), R ¹ and R ² are each independently a monovalent organic group, which may be linear, branched, or cyclic. In Formula (p), R ¹ may be a divalent group that forms a ring with C. In Formula (q), R ² is a divalent group that forms a ring with N. It may be a group of

  Examples of the group represented by the formula (p) include groups represented by the following formulas (r), (s), and (w). Moreover, as group shown by the said formula (q), group shown by following formula (u) is mentioned, for example.

The group represented by the above formula (1) is, for example, a group derived from an acid anhydride represented by the following formula (r), formula (s) or the like;
A group derived from an acid halide represented by the following formula (t);
A group derived from an active ester represented by the following formula (u) or formula (w); or a group derived from an activated amide represented by the following formula (v).

  Of the carboxylic acid-derived groups, an active ester group is preferably used because of its excellent reactivity under mild conditions. The mild conditions include, for example, neutral or alkaline conditions, specifically pH 7.0 or more and 10.0 or less, more specifically pH 7.6 or more and 9.0 or less, and more specifically pH 8.0. It can be.

  In addition, the definition of “active ester group” as defined in this specification is not strictly defined. However, as a conventional technical expression, an electron withdrawing property having high acidity on the alcohol side of the ester group. An ester group having a group and activating a nucleophilic reaction, that is, an ester group having a high reaction activity, is commonly used in various chemical synthesis fields such as polymer chemistry and peptide synthesis. is there. In the field of peptide synthesis, as described in Nobuo Izumiya, Tetsuo Kato, Toshihiko Aoyagi, Noriaki Waki, “Basics and Experiments of Peptide Synthesis”, published in 1985, Maruzen, It is used as one of the methods for activating the C-terminus of amino acids or peptides.

  Actually, the ester group has an electron-attracting group on the alcohol side of the ester group and is activated more than the alkyl ester. The active ester group has reactivity with groups such as amino group, thiol group, and hydroxyl group. More specifically, an active ester group in which phenol esters, thiophenol esters, N-hydroxyamine esters, cyanomethyl esters, esters of heterocyclic hydroxy compounds, etc. have much higher activity than alkyl esters etc. Known as.

  Here, the case where the activated carboxylic acid derivative group in the polymer substance is an active ester group will be described as an example. Examples of the active ester group include p-nitrophenyl group, N-hydroxysuccinimide group, succinimide group, phthalimide group, 5-norbornene-2,3-dicarboximide group, and the like. A nitrophenyl group is preferably used.

  In the case of a substrate on which a primer is immobilized on the surface, a more specific combination of the first unit and the second unit includes, for example, a group containing a group derived from a phosphate ester constituting the hydrophilic part of the phospholipid. One unit may have a 2-methacryloyloxyethyl phosphorylcholine group and the active ester group may be a p-nitrophenyl group.

  In addition, the polymer substance used for the coating layer of the substrate of the present embodiment may contain other groups in addition to the group derived from the phosphate ester and the carboxylic acid derived group constituting the hydrophilic part of the phospholipid. The polymer substance can be a copolymer. Specifically, the polymer substance is preferably a copolymer containing a butyl methacrylate group. By so doing, the polymer substance can be appropriately hydrophobized, and the adsorptivity of the polymer substance to the substrate surface can be more suitably ensured.

  Specifically, the polymer substance is composed of a first monomer having a 2-methacryloyloxyethyl phosphorylcholine (MPC) group and a second monomer having a p-nitrophenyloxycarbonyl polyethylene glycol methacrylate (NPMA) group. , And a copolymer with a third monomer having a butyl metallate (BMA) group. These copolymers, poly (MPC-co-BMA-co-NPMA) (PMBN), are schematically represented by the following general formula (2).

  However, in the said General formula (2), a, b, and c are respectively independently a positive integer. In the general formula (2), the first to third monomers may be block copolymerized, or these monomers may be copolymerized randomly.

  The copolymer represented by the general formula (2) is more suitable for the balance between moderate hydrophobicity of the polymer substance, the property of suppressing nonspecific adsorption of the template DNA fragment, and the property of immobilizing the primer. It is an even better configuration. For this reason, by using such a copolymer, the surface of the substrate is more reliably coated with the polymer material, and nonspecific adsorption of the template DNA fragment onto the substrate coated with the polymer material is suppressed. However, the primer can be more reliably immobilized by covalent bonding and introduced onto the substrate.

  The copolymer represented by the general formula (2) can be obtained by mixing MPC, BMA, and NPMA monomers and using a known polymerization method such as radical polymerization. When the copolymer represented by the general formula (2) is prepared by radical polymerization, solution polymerization can be performed, for example, in an inert gas atmosphere such as Ar under a temperature condition of 30 ° C. or higher and 90 ° C. or lower.

  The solvent used for the solution polymerization is appropriately selected. For example, alcohols such as methanol, ethanol and isopropanol, ethers such as diethyl ether, and organic solvents such as chloroform can be used alone or in combination. Specifically, a mixed solvent in which diethyl ether and chloroform are in a volume ratio of 8 to 2 can be obtained.

Moreover, what is used normally can be used as a radical polymerization initiator used for radical polymerization reaction. For example, azo initiators such as azobisisobutyronitrile (AIBN) and azobisvaleronitrile;
Oil-soluble organic peroxides such as lauroyl peroxide, benzoyl peroxide, t-butylperoxyneodecanoate, t-butylperoxypivalate;
Etc. are used.

  More specifically, polymerization can be carried out in Ar at 60 ° C. for about 2 to 6 hours using a mixed solvent of diethyl ether and chloroform in a volume ratio of 8 to 2 and AIBN.

  In this embodiment, an example in which the high molecular substance has a third unit containing a butyl methacrylate group has been described. However, the first unit containing a group derived from a phosphate ester constituting the hydrophilic part of the phospholipid and a carboxylic acid A polymer substance having a second unit containing an acid-derived group as a first polymer substance, and in addition to this, a first unit containing a group derived from a phosphate ester constituting the hydrophilic part of the phospholipid; A second polymer substance having a third unit containing a butyl methacrylate group may be included.

  The first unit of the first polymer substance and the first unit of the second polymer substance may have the same structure or different structures. In addition, when the first polymer substance includes a third unit containing a butyl methacrylate group, the third unit of the first polymer substance and the third unit of the second polymer substance have the same structure. There may be a different structure.

  Such a second polymer substance is used as a polymer that suppresses nonspecific adsorption of the template DNA fragment. As such a polymer, for example, an MPC polymer (manufactured by NOF Corporation) containing 30 mol% phosphorylcholine groups and 70 mol% butyl methacrylate groups can be used.

  In addition, when a high molecular substance consists of said 1st high molecular substance and 2nd high molecular substance, it can be set as the structure by which these high molecular substances are mixed. Since the polymer of each polymer substance can be dissolved in, for example, an ethanol solution, a mixed polymer can be easily obtained by mixing the respective polymer solutions.

  The substrate including the coating layer made of the polymer material as described above is obtained by applying a liquid containing the polymer material to the surface of the substrate processed into a predetermined shape and drying it. Further, the substrate may be immersed in a liquid containing a polymer substance and dried.

  In addition, when a plastic material is used as the substrate, flexibility in changing the shape and size is secured, and it is preferable from the viewpoint that it can be provided at a lower cost than that of a glass substrate. As such a plastic material, a thermoplastic resin can be used from the viewpoint of easy surface treatment and mass productivity.

As a thermoplastic resin, a thing with little fluorescence generation amount can be used. By using a resin with a small amount of fluorescence generation, the background in the detection reaction of the DNA strand can be lowered, and therefore the detection sensitivity can be further improved. Examples of the thermoplastic resin with a small amount of generated fluorescence include linear polyolefins such as polyethylene and polypropylene;
Cyclic polyolefin;
Fluorine-containing resin;
Etc. can be used. Among the above resins, saturated cyclic polyolefin is particularly excellent in heat resistance, chemical resistance, low fluorescence, transparency and moldability, and is therefore suitable for optical analysis and is preferably used as a substrate material.

  Here, the saturated cyclic polyolefin refers to a saturated polymer obtained by hydrogenating a polymer having a cyclic olefin structure or a copolymer of a cyclic olefin and an α-olefin. Examples of the former are produced by hydrogenating norbornene monomers represented by, for example, norbornene, dicyclopentadiene, and tetracyclododecene, and polymers obtained by ring-opening polymerization of these alkyl-substituted products. It is a saturated polymer. The latter copolymer is composed of α-olefin such as ethylene, propylene, isopropylene, 1-butene, 3-methyl-1-butene, 1-pentene, 3-methyl-1-pentene, 1-hexene and 1-octene. It is a saturated polymer produced by hydrogenating a random copolymer of cyclic olefin monomers. As the copolymer, a copolymer with ethylene is most preferable. These resins may be used alone, or two or more copolymers or a mixture may be used. Further, not only a saturated cyclic polyolefin obtained by ring-opening polymerization of a monomer having a cyclic olefin structure, but also a saturated cyclic polyolefin obtained by addition polymerization of a monomer having a cyclic olefin structure can be used.

  A substrate made of a plastic material including a polymer substance as described above can be obtained by applying a liquid containing the polymer substance to the surface of the substrate processed into a predetermined shape and drying it. Further, the substrate may be immersed in a liquid containing a polymer substance and dried.

  When the base material is plastic, the shape is not limited to a plate shape, and may be a film shape or a sheet shape, for example. Specifically, the substrate can be a flexible plastic film. Moreover, the base body may be composed of one member or a plurality of members.

  There are important parameters such as GC content, base length, Tm, and 3 ′ end base sequence for designing primer strands. Therefore, usually dedicated primer design software such as OLIGO Primer Analysis Software (manufactured by Takara Bio Inc.) is used. It is preferable to perform the design. Although all the parameters described above are important, it is the nucleotide sequence at the 3 'end that particularly affects the extension reaction. In the extension reaction, since the primer strand extends from the sample DNA fragment as a template and the 3 'end as the starting point, the base sequence at the 3' end of the primer strand is particularly important.

  If the complementary binding force between the base sequence at the 3 'end of the primer strand and the DNA fragment serving as a template is not sufficient, it is expected that the primer strand and the template DNA fragment will bind nonspecifically to cause an extension reaction. In this case, as a result, non-specific signal detection occurs, and the accuracy of gene detection decreases. For the above reason, the accuracy of gene detection is improved by devising such that the primer strand and the template DNA fragment are more specifically and specifically bound.

  As a method for improving the complementary binding force of DNA-DNA or DNA-RNA, there is a method of substituting nucleotides of DNA with LNA. LNA is a nucleotide having two cyclic structures in which the oxygen atom at the 2 ′ site of the ribonucleotide and the carbon atom at the 4 ′ site are bonded via methylene, and the molecular structure is stabilized compared to DNA. In addition, the binding force with a complementary nucleotide increases, while the binding strength with a non-complementary nucleotide decreases.

  In the present embodiment, a primer strand for DNA extension in which a part or all of the nucleotides of the primer strand are replaced with LNA is used. Although all the nucleotides may be substituted with LNA, only the nucleotide at the 3 ′ end of the primer strand that strongly affects the extension reaction may be substituted with LNA.

  For the above reasons, LNA can be easily detected even with a single base mismatch compared to DNA. Therefore, LNA is effective for single nucleotide polymorphism (SNP) analysis.

  When SNP is detected by the gene detection method of the present invention, the SNP position is set at the end of the primer chain. By setting LNA at the SNP position, it is possible to perform SNP analysis with higher detection sensitivity than in the case of DNA.

Next, a method for immobilizing primer chains on the surface of the substrate will be described.
For example, (i) among the plurality of active ester groups contained in the polymer substance on the substrate, at least some of the active ester groups react with the primer chain to form a covalent bond, thereby forming a primer chain on the substrate surface. Followed by (ii) deactivating the active ester groups on the surface of the substrate other than the immobilized primer strands, i.e. deactivating the remaining active ester groups. Can be fixed. Hereinafter, each process will be described.

  In the above step (i), when the primer strand to be annealed with the template DNA fragment is immobilized on the substrate, a method of spotting a liquid in which the primer strand is dissolved or dispersed is preferable. A part of the active ester group contained in the polymer substance reacts with the primer chain, and a covalent bond is formed between the primer chains.

  The liquid in which the primer strand is dissolved or dispersed can be, for example, neutral to alkaline, for example, pH 7.6 or higher.

  Further, after the spotting, in order to remove the primer chain that is not immobilized on the surface of the substrate, it may be washed with pure water or a buffer solution.

  Further, as shown in the above step (ii), after the washing, the inactive treatment of the active ester on the surface of the plastic substrate other than the immobilized primer chain is performed with an alkali compound or a compound having a primary amino group.

  Examples of the alkali compound include sodium hydroxide, potassium hydroxide, sodium carbonate, sodium bicarbonate, disodium hydrogen phosphate, calcium hydroxide, magnesium hydroxide, sodium borate, lithium hydroxide, and potassium phosphate. it can.

  Examples of the compound having a primary amino group include glycine, 9-amino aquadine, aminobutanol, 4-aminobutyric acid, aminocaprylic acid, aminoethanol, 5-amino2,3-dihydro-1,4-pentanol, aminoethanethiol Hydrochloride, aminoethanethiolsulfuric acid, 2- (2-aminoethylamino) ethanol, 2-aminoethyl dihydrogen phosphate, aminoethyl hydrogensulfate, 4- (2-aminoethyl) morpholine, 5-aminofluorescein, 6- Aminohexanoic acid, aminohexyl cellulose, p-aminohippuric acid, 2-amino-2-hydroxymethyl-1,3-propanediol, 5-aminoisophthalic acid, aminomethane, aminophenol, 2-aminooctane, 2-amino Octanoic acid, 1-amino-2-propanol, 3-amino-1-propyl Lopanol, 3-aminopropene, 3-aminopropionitrile, aminopyridine, 11-aminoundecanoic acid, aminosalicylic acid, aminoquinoline, 4-aminophthalonitrile, 3-aminophthalimide, p-aminopropiophenone, aminophenylacetic acid , Aminonaphthalene and the like can be used. Of these, aminoethanol and glycine are preferably used.

  In addition, an amino group is preferably introduced into the primer chain to be immobilized on the substrate in order to increase the reactivity with the active ester group. Since the amino group has excellent reactivity with the active ester group, the primer chain can be efficiently and firmly immobilized on the surface of the substrate by using the primer chain into which the amino group has been introduced. The introduction position of the amino group may be the end of the primer chain or the side chain, but it is introduced at the end of the molecular chain so that annealing with a complementary template DNA fragment can be performed more efficiently. Is preferable.

  As described above, a DNA microarray having a primer strand immobilized thereon can be obtained.

  A sample containing a template DNA fragment or template RNA fragment of the gene of interest to be detected to be annealed to the immobilized primer strand, a DNA strand extension enzyme system, and a nucleotide monomer is introduced onto the surface of the DNA microarray prepared as described above. The

  As the reaction system comprising the introduced sample, the DNA chain elongation enzyme system uses either DNA polymerase or DNA ligase, and uses a buffer containing nucleotide monomers (dATP, dCTP, dGTP, dTTP, etc.). Can do.

  By including at least 2 mmol / L, preferably 2 mmol / L to 6 mmol / L magnesium ions in the buffer, the gene detection sensitivity is improved.

  Among DNA polymerases, Taq DNA polymerase, Tth DNA polymerase, Pfu DNA polymerase, and the like, which are DNA polymerases derived from heat-resistant bacteria, can also be used.

  In addition, at least one of these nucleotide monomers can be labeled. For example, by using Cy3-dUTP fluorescently labeled at position 3 of the base of dTTP as a nucleotide monomer, Cy3-dUTP is inserted at a position on the extension (primer) side corresponding to adenine (A) of the template DNA fragment. Thereby, the DNA fragment formed from the primer in which the extension reaction has occurred is fluorescently stained with Cy3-dUTP, and this DNA fragment can be detected.

Other nucleotide monomers may be labeled, and a plurality of types of nucleotide monomers may be labeled. In addition to also label Methods of introduction of the phosphor, a method of introducing light absorbing method of radiolabeled ^{(P 32 -ATP, P 32 -dATP} ), by a method of non-radioactive labels such as enzyme labels DNA The strand can be detected.

  In this enzyme labeling method, a nucleic acid (for example, biotin-dUTP, DIG-dUTP) bound to biotin (biotin) or digoxigenin (DIG: steroidal natural product) is used to extend the primer, and then fluorescence. DNA can be detected by labeling or treating with alkaline phosphatase or alkaline phosphatase and reacting in nitroblue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP) for several hours. it can.

  The temperature of the reaction system into which the sample is introduced is increased to a temperature higher than the heat denaturation temperature (Tm) of the DNA strand, for example, 90 ° C to 95 ° C. By this heat denaturation treatment, a template DNA fragment or primer having a folded structure found in a self-complementary strand or the like becomes a linear single strand.

  Subsequently, the temperature of the reaction system is lowered to a temperature at which the primer and the template DNA fragment anneal (annealing temperature), for example, 4 ° C. to 72 ° C., preferably 50 ° C. to 72 ° C. By this annealing treatment, a primer strand having a sequence complementary to a part of the template DNA fragment and the template DNA fragment become a double strand. The reaction system is directly subjected to a DNA extension reaction without washing. Further, in the annealing step, the temperature may be raised to the annealing temperature after passing through the step of quenching from the heat denaturation temperature or higher to, for example, 4 ° C. to room temperature.

  Here, conventionally, a washing treatment was required to remove the DNA fragments that did not form a double strand after the annealing treatment and before the extension reaction. Since there is no DNA fragment to be adsorbed on the surface and the substrate surface environment is suitable for an enzymatic reaction related to DNA chain elongation, the substrate is not required to be washed. In this way, the same liquid phase system from the sample introduction to the DNA chain extension reaction, that is, the reaction system can be used as it is.

  In DNA elongation, it is preferable to control the temperature of the reaction system subjected to the annealing treatment so as to keep the temperature constant.

  Here, an example in which a heat-resistant DNA polymerase is used for a template DNA fragment is shown, but there is no particular limitation as long as it is an enzyme that synthesizes a new DNA strand using a DNA strand as a template. Examples of such a DNA polymerase include pol I type DNA polymerase (such as colonic bacterial DNA polymerase I and Klenow fragment), α type DNA polymerase (Pyrococcus furiosus-derived DNA polymerase, VENT DNA polymerase, KOD DNA polymerase, DEEP VENT DNA polymerase). And non-α non-pol I type DNA polymerase (DNA polymerase described in WO 97/24444 pamphlet) and the like.

  Since the DNA chain elongation reaction can be carried out using a DNA ligase instead of the DNA polymerase, the DNA chain can be amplified.

  For this DNA strand amplification, it is preferable to provide a plurality of spots in a fixed section on the substrate, immobilize the primer DNA strands in each spot, and form a microarray.

  Further, the length of the DNA extension primer DNA chain to be immobilized on the surface of the substrate can be arbitrarily determined according to the detection target, for example, 5 to 50 bases.

  After the DNA extension reaction, the reaction solution is removed, and the DNA microarray is washed with, for example, a 0.1 wt% TWEEN20 solution, and the process is terminated.

  Hereinafter, the flow of the gene detection method according to this embodiment will be described.

  Selection of the primer to be immobilized on the substrate surface is designed based on a sequence specific to the gene to be detected. The length of the primer chain is preferably 20 to 30 bases because of the ease of DNA elongation reaction. is there.

  The designed primer strand is amino-modified at the 5 'end, reacts with the active ester group on the substrate surface, and is firmly immobilized on the substrate.

  An example of a gene detection method using the present invention will be described. However, it is not limited to this description example.

  First, DNA is extracted from collected human blood or the like. An example of the extraction method is to use a commercially available DNA extraction kit.

  Next, the extracted DNA is fragmented. Since the extracted DNA strand is long, a fragmentation step is required. One method of fragmentation, that is, excision, is PCR. The primer is designed so as to amplify a part including the gene-specific sequence, and a part of the DNA strand is cut out by PCR amplification. The length of the DNA strand to be cut out is about 100 to 1000 bases. In this way, the primer is designed.

In addition to PCR, fragmentation of DNA strands can be disrupted by ultrasonic waves. However, regarding the crushing conditions, care must be taken that the DNA strand is not fragmented. In addition, fragmentation with restriction enzymes is also possible.

  After DNA strand fragmentation, a DNA extension reaction is performed on the substrate on which the primer strand is fixed.

  Supply the solution containing the fragmented DNA strand, DNA extension enzyme, and nucleotide monomer onto the substrate on which the primer DNA strand is fixed, cover it with a cover glass if necessary, place it in a sealed container, and perform the prescribed heat cycle. The DNA strand is subjected to an elongation reaction by heating with.

  If a fluorescent dye such as Cy3 is labeled on any of the nucleotide monomers, the spot can be confirmed with a fluorescent scanner.

Alternatively, biotin is labeled on any nucleotide monomer, and after the DNA extension reaction, alkaline phosphatase is labeled on the extended DNA by reacting with avidin labeled with alkaline phosphatase, and then BCIP / NTB or the like. By allowing the coloring reagent to act, it is possible to visualize a spot where DNA has been extended. The visualized spot can be recognized by the eyes, and the spot intensity can be analyzed by using an image processing software or the like by recognizing an image with a digital camera or an OA scanner.

Examples will be described below.

(Experimental example 1)
By the following method, a primer strand made of a DNA sequence specific to a gene and a primer strand not made of LNA are immobilized on the surface of a plastic substrate corresponding to this embodiment, and each primer-immobilized substrate is immobilized on each primer-immobilized substrate. A DNA chain extension reaction was performed to detect the DNA chain extension reaction of the primer, and the gene detectability was evaluated. At this time, the position of the nucleotide converted to LNA was one at the 3 ′ end of the primer strand. In this example, Escherichia coli, Staphylococcus aureus, Salmonella and Pseudomonas aeruginosa 23S ribosomal DNA were used as genes.

(Manufacture of plastic substrates)
Saturated cyclic polyolefin resin (hydrogenated ring-opening polymer of 5-methyl-2-norbornene (MFR (Melt flow rate): 21 g / 10 min, hydrogenation rate: substantially 100%, heat distortion temperature 123 ° C.)) A glass-shaped substrate was obtained by injection molding, and the substrate was 2-methacryloyloxyethyl phosphorylcholine-butylmethacrylate-p-nitrophenyloxycarbonylpolyethyleneglycol methacrylate copolymer (each group in mol% at 25:74: A polymer substrate having a phosphorylcholine group and an active ester group was introduced onto the substrate surface by dipping in a 0.5 wt% ethanol solution of 1) to obtain a plastic substrate.

(Primer fixation)
Each microbe 23S ribosomal DNA sequence-specific oligo DNA strand modified with an amino group at the 5 ′ end was dissolved using 0.25 M carbonate buffer (pH 9.0) to prepare a 10 μM oligo DNA solution. At this time, both the oligo DNA strand having LNA at the 3 ′ end and the oligo DNA strand not having LNA were prepared. These solutions were spotted on the surface of a plastic substrate using a spotter (Marks-I manufactured by Hitachi Software Engineering Co., Ltd.) with a 100 μm diameter cross cut pin. The substrate on which the oligo DNA was spotted was heated at 80 ° C. for 1 hour to immobilize the oligo DNA (primer).
The chain sequences of the spot and immobilized E. coli detection primers are shown below.
Staphylococcus aureus: agtaggataggcgaagcgtgcgatt SA
agtaggataggcgaagcgtgcgatt SA-LNA
E. coli: ctgatatgtaggtgaagcgacttgctcg ECO
ctgatatgtaggtgaagcgacttgctcg ECO-LNA
Green bacterium: gttaatcgacgcagggttagtcggtt PA
gttaatcgacgcagggttagtcggtt PA-LNA
Salmonella: tgtgtgttccaggtaaatccggttc SAL
tgtgtgttccaggtaaatccggttc SAL-LNA
Positive control: gacagccaggatgttggcttagaagcagc POS

(Bacteria culture)
The following strains were cultured.
Strain name Staphylococcus aureus used: Staphylococcus aureus ATCC 25923
Escherichia coli ATCC 25922
Pseudomonas aeruginosa: Pseudomonas aeruginosa ATCC 27853
Salmonella:
Salmonella enterica subsp. Enterica serovar Typhimurium ATCC 14028
Salmonella enterica subsp.enterica serovar Enteritidis IID 604
Using an agar medium, it was performed at 37 ° C. for a whole day and night (14-18 hours). The medium used was "Normal Bouillon Eiken" which is an instant medium, the liquid medium was dissolved in the indicated amount of "Normal Bouillon Eiken" in demineralized water, 1.6% agar was added to the agar medium, and each was used after autoclaving. .

(Extraction of 23S ribosomal DNA)
One colony in the above bacterial culture was dispersed in 200 μl of PBS (−), and 3 μl of DNA extract was obtained using a DNA extraction kit (Invitrogen).
(23S ribosomal DNA chain amplification reaction by PCR)
23S ribosomal DNA was amplified by PCR reaction using a universal primer of 23S ribosomal DNA.
The sequences of primers used for amplification by PCR are shown below.
Primer sequence:
Sense: 5'-gacagccaggatgttggcttagaagcagc
Antisense: The same amount of the following was used.
5'-ggaatttcgctaccttaggaccgttatagttacg
5'-ggaatttcgctaccttaggatggttatagttacc
12.5 pmol of each of the above primers in 25 μL, 200 μM dATP, dCTP, dGTP, dTTP, 0.5 U of DNA polymerase (Ex Taq manufactured by Takara Bio Inc.) was dissolved in the PCR buffer,
A thermal cycler was used for 10 cycles of heat denaturation at 95 ° C. for 1 minute, annealing at 75 ° C. for 2 minutes, and DNA strand extension reaction at 72 ° C. for 5 minutes to obtain a PCR product.

(DNA elongation reaction on the substrate)
2 μl of the above PCR product, 100 μM dATP, dCTP, dGTP, Cy3-labeled dUTP, 0.5 U DNA polymerase (Takara Bio Inc.) in 25 μL of PCR buffer (10X EX Taq Buffer (Mg ²⁺ free) manufactured by Takara Bio Inc.) Ex Taq manufactured by company) 2 mmol / L magnesium ion (magnesium chloride) was dissolved to prepare a sample solution, which was used in the following examples.

  The sample solution was heat denatured at 95 ° C. for 5 minutes, dispensed on a substrate, and allowed to stand at 65 ° C. for 60 minutes to carry out a DNA chain elongation reaction.

After the DNA extension reaction, the substrate was washed with a 0.1 wt% SDS solution to finish.
The fluorescence intensity of the spot was measured with a slide scanner (manufactured by ScanArray PerkinElmer).
The DNA solution extracted from each bacterium was compared with respect to the fluorescence intensity of each spot of the primer immobilized on the substrate.

(Experimental example 2)
The other steps were performed in the same manner as in Example 1 except that the magnesium ion concentration dissolved in the sample solution described in Example 1 was 4 mmol / L.

(Example 3)
The other steps were performed in the same manner as in Example 1 except that the magnesium ion concentration dissolved in the sample solution described in Example 1 was 6 mmol / L.

  Tables 1 to 3 show a comparison of the fluorescence intensity of the spots in Examples 1 to 3.

  When a gene was detected with a primer strand converted to LNA, the detection signal amount was large and nonspecific signal detection was less likely to occur than when detected with a primer strand not converted to LNA.

Claims (18)

A high unit containing a first unit having a group derived from a phosphate ester constituting a hydrophilic part of a phospholipid and a second unit having a carboxylic acid derivative group in which an electron-withdrawing substituent is bonded to a carbonyl group. In a substrate having a molecular substance on the surface,
(A) a step of immobilizing a DNA extension primer strand in which a part or all of the nucleotides are replaced with LNA (Locked Nucleic Acid) on the surface of the substrate;
(B) a step of bringing a sample solution containing a DNA fragment or RNA fragment of a target gene to be detected, a nucleotide monomer, and a DNA extension enzyme into contact with the substrate surface;
(C) using the DNA fragment in the sample solution or the RNA fragment as a template, and extending the DNA extension primer strand immobilized on the substrate surface.   The method for detecting a gene according to claim 1, wherein the LNA-substituted nucleotide of the primer strand for DNA extension is introduced at a position including the 3 'end of the primer strand.   The method for detecting a gene according to claim 1 or 2, wherein in the primer strand for DNA extension, one base of the base sequence including the characteristic sequence of the gene of interest is replaced with another base.   The method for detecting a gene according to claim 3, wherein the substitution of the single base is carried out at the 3 'end. In the detection method of the gene in any one of Claims 1-4,
The group derived from the phosphate ester contained in the first unit of the polymer substance is any one of phosphorylcholine group, phosphorylethanolamine group, phosphorylserine group, phosphorylinositol group, phosphorylglycerol group, and phosphatidylphosphorylglycerol group. A gene detection method characterized by the above. In the detection method of the gene in any one of Claims 1-5,
A method for detecting a gene, wherein any one of the nucleotide monomers is labeled. The method for detecting a gene according to claim 6, wherein
A method for detecting a gene, wherein the label is a fluorescent dye. The method for detecting a gene according to claim 6, wherein
(D) introducing a redox enzyme into the label of the nucleotide monomer, adding a substrate that develops color by oxidation or reduction reaction, and causing the substrate to develop color;
A method for detecting a gene comprising: In the detection method of the gene in any one of Claims 1-8,
A method for detecting a gene, wherein the enzyme for extending a DNA chain is DNA polymerase or DNA ligase. In the detection method of the gene in any one of Claims 1-9,
The gene detection method, wherein the DNA extension primer strand is covalently bonded at a site of a second unit having a carboxylic acid derivative group in which the electron-withdrawing substituent is bonded to a carbonyl group . In the detection method of the gene in any one of Claims 1-10,
A method for detecting a gene, wherein the polymer substance has a third unit containing a butyl methacrylate group. In the detection method of the gene in any one of Claims 1-11,
In addition to the polymer substance, the substrate includes a second unit having a first unit having a group derived from a phosphate ester constituting the hydrophilic part of the phospholipid and a third unit containing a butyl methacrylate group. A method for detecting a gene comprising a molecular substance. In the detection method of the gene in any one of Claims 1-12,
A gene detection method, wherein the substrate is made of a plastic material. In the detection method of the gene in any one of Claims 1-13,
The gene detection method, wherein the step (c) is performed by applying a predetermined heat cycle. The method for detecting a gene according to claim 14, wherein
A method for detecting a gene, wherein the number of heat cycles is 1 or more. The method for detecting a gene according to claim 14 or 15,
The gene detection method, wherein the heat cycle includes holding at a heat denaturation temperature, holding at an annealing temperature, and holding at a DNA extension temperature. The method for detecting a gene according to claim 16, wherein
A method for detecting a gene, characterized in that the annealing temperature and the DNA extension temperature are the same.   A carrier for gene detection used in the gene detection method according to any one of claims 1 to 17, wherein the first unit has a group derived from a phosphate ester constituting a hydrophilic part of a phospholipid and an electron withdrawing property. A substrate having a polymer substance containing a second unit having a carboxylic acid-derived group formed by bonding a substituent of carbonyl group to a carbonyl group, a part or all of the nucleotides are substituted with LNA (Locked Nucleic Acid). A gene detection carrier in which a primer strand for DNA extension is immobilized on a substrate surface.