JP2007202546A - Pcr primer for detecting mutation of epithelial growth factor receptor gene - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for genetic diagnosis by which a mutation of a tyrosine kinase portion of an EGFR (epidermal growth factor receptor) recognized in human lung cancer at a high frequency can specifically and rapidly be detected. <P>SOLUTION: A primer for a PCR (polymerase chain reaction) specifically amplifies only a DNA having a genetic abnormality recognized in the tyrosine kinase portion of the EGFR at the high frequency. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

The present invention relates to a PCR primer for detecting an abnormality in a tyrosine kinase site of an EGFR gene in a human malignant tumor, DNA as a PCR amplification product, and various detection methods using the primer.

Since gefitinib, an EGFR inhibitor, is effective in the treatment of lung cancer, it has already been used in clinical settings in Japan. At this time, it has been reported that gefitinib is more effective in a case having a mutation in the tyrosine kinase site of the target EGFR gene than in a case without a mutation (see, for example, Non-Patent Document 1). On the other hand, gefitinib has been reported to cause fatal pulmonary fibrosis as a side effect and has become a social problem. Therefore, it is important to detect the presence or absence of EGFR mutation and administer only to cases that are expected to be effective in order to maximize the therapeutic effect / side effect ratio. In the reports to date, the frequency of EGFR gene mutations is particularly high in East Asian countries including Japan, and it seems necessary to investigate the presence or absence of EGFR gene mutations in lung cancer cases in order to increase the efficacy of gefitinib. .

Conventionally, the direct sequencing method has been mainly used to detect EGFR gene mutations, but in clinical specimens, normal cells may be missed due to contamination with normal cells, the procedure is complicated, and special equipment is required. There were drawbacks such as high cost. There are other reports that single-strand conformation polymorphism and real-time PCR methods can be applied, but these are more powerful than direct sequencing in terms of detection power, but the universality of the equipment and the simplicity of the technology (For example, refer nonpatent literature 2).
Marchetti A, et al. Journal of Clinical Oncology, 23: 857-65 (2005). Sasaki H, et al. Clinical Cancer Research, 11: 2924-9 (2005).

Problems to be solved by the invention

We noticed that EGFR gene mutations are concentrated in a specific part, and most of them are one of three types of gene abnormalities. It was thought that a simple mutation detection method was possible. These three types are 1) deletion of 15 base pairs in exon 19 (base pair numbers 2481 to 2495) (EGFR19deltype1), 2) 15 base pairs in exon 19 (base pair numbers 2482 to 2496) ) Deletion (EGFR19deltype2), 3) a tyrosine to guanine point mutation (EGFR21L858R) of base pair # 2819 in exon 21. In order to apply this method and put it to practical use, it was necessary to prepare a primer capable of specifically amplifying the EGFR gene having any of these three types of mutations at the tyrosine kinase site.

Means for solving the problem

Therefore, the present inventor can prepare primers specific to the above-mentioned three types of EGFR tyrosine kinase site mutations and detect specific mutations in these three types of EGFR tyrosine kinase sites quickly and specifically. Scrutinized and verified whether a simple genetic diagnosis was possible.

That is, the present inventor created a primer capable of specifically amplifying a part (gene fragment) of the EGFR gene having mutations in these three specific tyrosine kinase sites, and completed the present invention. Furthermore, by carrying out PCR using these primers, the above specific gene fragment could be amplified.

That is, the present invention relates to a PCR primer that can detect any of the three types of EGFR gene abnormalities.
As a suitable example of such a primer, there is a primer having “tgcatcgctggtaacat (EGFR19S4) (SEQ ID NO: 1)” and “cggagagtgtttgatagcg (EGFR19ASD1)” (SEQ ID NO: 2) as a base sequence. The latter is a sequence complementary to a sequence obtained by removing the base pairs numbered 2481 to 2495 from the base pair number 2472 to number 2505 of the EGFR gene.

Another example of such a primer is a primer having “atgtcaagatcacagattttggggcg (EGFR21SM1)” (SEQ ID NO: 3) and “ctggctgacctaagac (EGFR21AS4)” (SEQ ID NO: 4) as the base sequence.

As shown in the Examples of the present specification, by using the primer of the present invention, a part of the base sequence of the abnormal EGFR gene is amplified by PCR only in the DNA having the abnormality of the above three types of EGFR genes. I can do it. Therefore, a PCR product having such a base sequence is not amplified in DNA having none of the three types of EGFR gene abnormalities. PCR itself is a reaction well known to those skilled in the art, and those skilled in the art can appropriately set and carry out reaction conditions. Suitable conditions for such PCR are those described in the Examples herein.

The present invention further relates to a method for detecting an abnormality in the above three types of EGFR genes, wherein one or two sets of primers selected from the primers of the present invention are used for PCR. In particular, by simultaneously using one set of primers capable of detecting EGFRdel19type1 and EGFRdeltype2 and one set of primers capable of detecting EGFR21L858R, EGFRdel19Type1 or EGFRdel19type2 and EGFR21L858R can be simultaneously detected and distinguished.

The present invention also relates to a method for detecting the three types of abnormalities of the EGFR gene in human tissues using the detection method described above. Examples of human tissues include lung cancer tissues, other cancer tissues, lungs, lymph nodes, blood, and tissues in which these are embedded in paraffin.

More specifically, the present inventor prepared specific primers based on genetic information on abnormalities of the three types of EGFR genes, EGFR19deltype1, EGFR19deltype2, EGFR21L858R reported by Non-Patent Document 1, It was examined and verified whether a genetic diagnosis method capable of specifically detecting the above three types of gene abnormalities was possible.

A set of specific primers (EGFR19S4 and EGFR19ASD1) for specifically amplifying a PCR product having a base sequence having an abnormality of EGFR19deltype1 was designed. The latter is a sequence complementary to a sequence obtained by removing the base pairs Nos. 2481 to 2495 from the base pair Nos. 2472 to 2505 of the EGFR gene. When PCR was performed using this primer, a 133 bp gene was amplified in DNA having an abnormality of EGFR19deltype1, which is a deletion of 15 bases from base pairs No. 2481 to No. 2495. On the other hand, EGFR19deltype2 with base pair numbers 2482 to 2496 differs from EGFR19deltype1 only by one base pair, but the PCR using the above primers also amplified a 133 bp gene in DNA having 19deltype2 abnormality. . It was confirmed by the direct sequencing method using the PCR product that this PCR product was indeed part of the EGFR gene having the abnormality. Hereinafter, EGFR19deltype1 and EGFR19deltype2 are collectively referred to as EGFR19del.

In addition, a set of specific primers (EGFR21SM1 and EGFR21AS4) for specifically amplifying a PCR product having a nucleotide sequence having an abnormality of EGFR21L858R shown in SEQ ID NO: 3 was designed. When PCR was performed using this primer, a 104 bp gene predicted in DNA having an abnormality of EGFR21L858R was amplified. It was confirmed by the direct sequencing method using the PCR product that this PCR product was indeed part of the EGFR gene having the abnormality.

Furthermore, these PCR products were not amplified by both test methods from normal human blood or lung cancer with EGFR gene abnormality other than the above three types. In addition, when two sets of primers were mixed and PCR was performed, EGFR19del and EGFR21L858R could be simultaneously detected and differentiated in one reaction (see FIG. 1).

EXAMPLES Hereinafter, although an Example demonstrates this invention more concretely, this invention is not limited at all by these Examples.

New primers EGFR19ASD1 and EGFR19S4 (133 bp amplification) were designed based on the nucleotide sequence of the EGFR gene having an abnormality of EGFR19deltype1. In addition, new primers, EGFR21SM1 and EGFR21AS4 (104 bp amplification) were designed based on the nucleotide sequence of the EGFR gene having an abnormality of L858R.

Next, PCR was performed in order to confirm that DNA having an abnormality in EGFR19del and EGFR21L858R can be specifically amplified with this combination of primers, EGFR19S4-EGFR19ASD1 and EGFR21SM1-EGFR21AS4. PCR was performed using 30 μl of reaction containing 1 μl of template DNA, 2.5 μl of 10 × PCR buffer (Qiagen), 667 nM of each primer, 0.2 U of Taq polymerase (Qiagen), 250 μM of each deoxynucleotide triphosphate (Amersham Pharmacia Biotech). I went there. The PCR reaction was performed at 94 ° C. for 5 minutes, followed by a single strand reaction, followed by 32 cycles of 94 ° C. for 30 seconds, 56 ° C. for 30 seconds, 72 ° C. for 30 seconds, and then 72 ° C. for 10 minutes. PCR amplification products were analyzed by agarose gel electrophoresis.

As a result, in the primer for EGFR19S4-EGFR19ASD1 specific for EGFR19del, a lung band of the lung cancer cell line NCI-H1650 in which one predicted 133 bp band has been found to have EGFR19deltype1 (for example, non-patent literature) 3) and lung cancer specimen L48, which is known to have EGFR19deltype2 by direct sequencing, but was found to have abnormalities other than EGFR19deltype1 and EGFR19deltype2 by control normal human blood cells and direct sequencing It was not amplified in the lung cancer cells. On the other hand, when EGFR21SM1-EGFR21AS4 specific for EGFR21L858R is used, a predicted 104 bp band is amplified in the lung cancer cell line NCI-H1975 (Non-patent Document 3) that is known to have the tested EGFR21L858R. However, it was not amplified in control normal human blood cells and lung cancer cells that were found to have abnormalities other than EGFR21L858R by direct sequencing. This PCR reaction could be amplified even in DNA extracted from paraffin-embedded tissue.

Lynch TJ, et al. New England Journal of Medicine, 350: 2129-39 (2004).

Therefore, it was found that the 133 bp and 104 bp PCR amplification products described above are EGFR19del and EGFR21L858R-specific base sequences and can be used for specific detection thereof.

In order to enable simultaneous detection and identification of EGFR19del and EGFR21L858R in a single PCR reaction, one-step duplex PCR was performed by mixing EGFR19S4-EGFR19ASD1 and EGFR21SM1-EGFR21AS4 primers. The PCR reaction conditions and program were the same as those for the specific PCR amplification reaction described above.
The results of duplex PCR are shown in FIG. By using two kinds of specific primer sets, one band of 133 bp was obtained from lung cancer cell line H1650 and lung cancer specimen L48, whereas one band of 104 bp could be observed in lung cancer cell line H197. It was. No amplification products were obtained from normal blood or other types of lung cancer specimens with EGFR gene abnormalities.

The invention's effect

In addition to being able to detect three types of EGFR gene abnormalities of EGFR19deltype1, EGFR19deltype2 and EGFR21L858R, the genetic diagnosis method by PCR using the two sets of specific primers of the present invention simultaneously distinguishes two types of abnormalities of EGFR19del and EGFR21L858R. It became possible to do. Furthermore, the time required for diagnosis can be drastically reduced as compared with the conventional direct sequencing method. Therefore, the base sequence of the new primer created this time is a method for detecting major abnormalities of the EGFR gene in paraffin-embedded clinical specimens that cannot be directly used in the future, or where there are no facilities for direct sequencing, and It is expected to be applied as a screening test method before the direct sequencing method.
That is, by providing a genetic diagnostic method for specifically and rapidly detecting and distinguishing an abnormality in the EGFR gene, which is a target for the treatment of malignant tumors such as lung cancer, Contributes greatly to treatment.
In addition, the method of detecting a gene deletion by performing PCR using a primer complementary to a partially deleted gene can be applied to abnormalities caused by deletion of other genes. It is expected to be useful as a simple method for detecting loss.

FIG. 1 is an electrophoresis photograph showing the results of specific detection of EGFR19deltype1, EGFR19deltype2, and EGFR21L858R by one-step duplex PCR in which two sets of primers are mixed. Lane M: 100 bp marker (the bottom band corresponds to a size of 100 bp) Lane 1: NCI-H1650 (having an abnormality of EGFR19deltype1) Lane 2: lung cancer sample L48 (having an abnormality of EGFR19deltype2) Lane 3: NCI- H1975 (with EGFR21L858R abnormality) Lane 4: Lung cancer specimen L54 (with EGFR21L858R abnormality) Lane 5: Lung cancer specimen L12 (with EGFR gene abnormality other than the above three types) Lane 6, 7: Normal human blood (EGFR gene) No abnormalities)

Claims (12)

Specific detection of deletion of 15 base pairs (base pairs number 2481 to 2495) in exon 19, which is one of the mutations in the tyrosine kinase part of the epidermal growth factor receptor (EGFR) gene PCR primers that can be used. A primer for PCR capable of specifically detecting a deletion of 15 base pairs (base pair numbers 2482 to 2496) in exon 19, which is one of mutations in the tyrosine kinase portion of the EGFR gene. A primer for PCR capable of specifically detecting a point mutation from tyrosine to guanine of base pair number 2819 in exon 21, which is one of mutations in the tyrosine kinase portion of the EGFR gene. A method for detecting a mutation in the tyrosine kinase portion of the EGFR gene, wherein a set of primers selected from the primers according to any one of claims 1 to 3 is used for PCR. A set of primers according to any one of claims 1 and 2 and a set of primers according to claim 3 are used simultaneously for PCR, A method to detect and identify mutations simultaneously. A method for detecting a mutation in the tyrosine kinase portion of the EGFR gene in human tissue using the detection method according to claim 4 or 5. The method according to claim 6, wherein the human tissue is a paraffin-embedded preserved tissue. The method of claim 6, wherein the human tissue is lung cancer. The method of claim 6, wherein the human tissue is lung. The method of claim 6, wherein the human tissue is a lymph node. The method of claim 6, wherein the human tissue is blood. A method for detecting a deletion of a gene by performing PCR using a primer complementary to the partially deleted gene as described in claim 1 or 2.