JP2007190013A - Method for establishing cell strain of human malignant ovarian germ tumor, human malignant ovarian germ tumor cell strain and its utilization - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for establishing cell strain derived from human malignant ovarian germ cell tumor and to provide the cell strain and to provide a method or the like for screening an antineoplastic agent by utilizing the cell strain. <P>SOLUTION: The present invention provides a tumor cell strain obtained by passing through a step for culturing human malignant ovarian germ cell tumor cell in a culture medium containing a serum, insulin and epidermal growth factor (EGF), its carboplatin and cisplatin-resistant cell strain and provides a method for screening a compound effective in human yolk sac tumor using a transfer factor Nkx 2.5 as a target molecule by using the cell strain. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a method for establishing a cell line derived from a human malignant ovarian germ cell tumor, a cell line derived from a human malignant ovarian germ cell tumor, and a technique for using a cell line derived from a human malignant ovarian germ cell tumor.

  Yolk sac tumors are germ cell malignant ovarian tumors (malignant ovarian germ cell tumors), mostly occurring in young women under the age of 35, with overall 5-year survival rates of around 70%, but III, IV In advanced stage cancers, the prognosis is very poor at 20-30% (Non-Patent Documents 1-3). Also, since it develops in young women, fertility-preserving surgery is often performed, and recurrence is often observed. Chemotherapy centered on cisplatin is performed as a postoperative treatment for advanced stage cancer, and certain effects are obtained (Non-Patent Document 4), but the effect on advanced cancer is still not sufficient, and recurrent cases Has a very poor prognosis due to the acquisition of resistance to cisplatin (Non-patent Document 5).

Nawa A, Obata N, Kikkawa F, Kawai M, Nagasaka T, Goto S, Nishimori K, Nakashima N. Prognostic factors of patients with yolk sac tumors of the ovary. Am J Obstet Gynecol 2001; 184: 1182-1188. Gershenson DM, del Junco GD, Copeland LJ, Rutledge FN.Mixed germ cell tumors of the ovary.Obstet Gynecol 1984; 64: 200-206. Morris HHB, La Vecchia C, Draper GJ.Endodermal sinus tumor and embryonal carcinoma of the ovary in children.Gynecol Oncol 1985; 21: 7-17. Gershenson DM. Update on malignant ovarian germ cell tumors. Cancer 1993; 71: 1581-1590. Jevakumar A, Chalas E, Hindenburg A. Sustained complete remission in a patient with platinum-resistant ovarian yolk sac tumor.Gynecol Oncol 2001; 82 (3): 578-580. Williams S, Blessing JA, Liao SY, Ball H, Hanjani P. Ajuvant therapy of ovarian germ cell tumors with cisplatin, etoposide, and bleomycin: a trial of the Gynecol Oncology Group.J Clin Oncol 1994; 12: 701-706. Mitchell PL, Al-Nasiri N, A'Hern R, Fisher C, Horwich A, Pinkerton CR, Shepherd JH, Gallagher C, Slevin M, Harper P, Osborne R, Mansi J, Oliver T, Gore ME.Treatment of nondysgerminomatous ovarian germ cell tumors. Cancer 1999; 85: 2232-2244. Apergis GA, Crawford N, Ghosh D, Steppan CM, Vorachek WR, Wen P, Locker J. A novel nk-2-related transcription factor associated with human fetal liver and hepatocellular carcinoma.J Biol Chem. 1998 Jan 30; 273 (5 ): 2917-25.

As described above, clinical reports of yolk sac tumors are scattered, but there is no basic research and development of treatments that support them. The biggest cause is that the establishment of a cell line derived from yolk sac tumor has not been established. This contrasts with the fact that many cell lines have been established for epithelial ovarian cancer among malignant ovarian tumors, and that many basic studies have been conducted for the development of therapeutic methods.
On the other hand, not only yolk sac tumor but also undifferentiated germ cell tumor with the most cases among malignant ovarian germ cell tumors, there is no report that the cell line has been successfully established. Thus, it is considered very difficult to establish a cell line derived from a malignant ovarian germ cell tumor.
Therefore, the present invention aims to provide a method for establishing a cell line derived from a malignant ovarian germ cell tumor, a cell line derived from a malignant ovarian germ cell tumor, a screening method using a cell line derived from a malignant ovarian germ cell tumor, and the like. And Once a cell line derived from a malignant ovarian germ cell tumor is obtained, basic and applied research using it will be possible, opening the way to elucidation of the onset mechanism and development of appropriate treatments.
Another object of the present invention is to provide a target molecule (target molecule) and use thereof for the establishment of a treatment method for yolk sac tumor, which is one of malignant ovarian embryonic tumors.

In order to solve the above-mentioned problems, the present inventors first tried to establish a cell line from a yolk sac tumor for which provision of the cell line was desired among malignant yolk germ cell tumors. The present inventors believe that the reason why the yolk sac tumor cell line has not been established so far is that the ability of yolk sac tumor cells to have low proliferative ability at the stage of establishment compared to epithelial ovarian cancer. It was. In addition, since yolk sac tumors are often enlarged and necrotic inside, it is difficult to collect cells suitable for the establishment of cell lines (that is, cells having sufficient viability and division ability). This also seems to have made it difficult to establish the cell line.
In view of the above points, the present inventors considered that selection of a medium for primary culture of yolk sac tumor cells isolated from a living body was important, and performed culture experiments using various media. As a result, it was found that yolk sac tumor cells survive and divide well by adding specific components to the medium at an early stage of culture, and the cell line was successfully established. Moreover, it was considered that performing the initial stage of culture in the presence of serum at a lower concentration than usual would effectively act on the establishment of cell lines.
On the other hand, instead of culturing after separating the cells with trypsin treatment, etc., the cells are cultured in the state of tissue pieces (yolk sac tumor cells) separated from the living body, and the target cells migrate from the tissue pieces to colony It was found that the formation of a cell line is important for the establishment of a cell line. Furthermore, fibroblasts were extremely dominant in the initial stage of culture, and the growth of the target cells was not observed. However, the fibroblasts gradually increased by continuing the culture for a long time in a medium containing a specific component. The number of cells and the number of target cells were reversed, and a colony consisting essentially of only the target cells was successfully formed. From this, it was found that in the establishment of a cell line, it is important to continue the culture using a medium containing a specific component found by the present inventors for a long period of time. Furthermore, even in subculture after collecting cells from the formed colonies, good cell growth was obtained for a while by using a medium equivalent to the medium used at the beginning of the culture. That is, even in the initial stage of subculture after collecting cells from a colony, the use of a medium containing specific components found by the present inventors effectively acts on the establishment of cell lines. It became clear.
On the other hand, when the characteristics of the established cell line (NOY1) were verified, the expression of α-fetoprotein (AFP) and cytokeratin was confirmed, and it was confirmed that the cells were derived from yolk tumor cells.
In addition, a novel culture found by the present inventors was also found in the establishment of a cell line of an undifferentiated embryonic cell type that is classified into the same malignant yolk tumor as the yolk sac tumor cell and is similar in its origin and characteristics to the yolk sac tumor cell The condition was expected to be valid.
Further studies were conducted, and an anticancer drug resistant strain was successfully established based on the established cell line (NOY1). Of note, one of the resistant strains acquired approximately 10-fold resistance to cisplatin.
On the other hand, in the established cell line (NOY1), it was confirmed that the transcription factor Nkx2.5 involved in AFP transcription was highly expressed, and the suppression of Nkx2.5 expression significantly increased the ability of NOY1 to proliferate. It was found to be suppressed.
The present invention is mainly based on the above knowledge or achievement, and provides the following establishment method and the like.
[1] A method for establishing a human malignant ovarian germ cell tumor cell line, which comprises culturing human malignant ovarian germ cell tumor cells in a medium containing serum, insulin, and epidermal growth factor.
[2] The establishment method according to [1], wherein the content of the serum in the medium is about 5% (v / v).
[3] The establishment method according to [1] or [2], including the following steps (1) to (3):
(1) culturing a tissue piece containing human malignant ovarian germ cell tumor cells in a medium containing serum, insulin and epidermal growth factor;
(2) culturing cells migrated from the tissue piece in a medium containing serum, insulin and epidermal growth factor;
(3) A step of subculturing the proliferated cells.
[4] The establishment method according to [3], wherein the culture in step (2) is continued until the number of mixed fibroblasts decreases and the human malignant ovarian germ cell tumor cells become predominant.
[5] The culture in step (2) is continued until a colony consisting essentially only of human malignant ovarian germ cell tumor cells is formed. Cells are collected from the formed colonies, and the collected cells are collected in step (3). The establishment method according to [3], wherein the method is subjected to subculture.
[6] In step (3), the first generation of subculture is performed in a medium containing serum, insulin and epidermal growth factor (EGF), and subsequent subculture is performed with insulin and epidermal growth factor (EGF). The establishment method according to any one of [3] to [5], which is performed in a medium not containing EGF).
[7] In the step (3), the third to fifth passages of the subculture are performed in a medium containing serum, insulin and epidermal growth factor (EGF). [6] The establishment method described.
[8] The establishment method according to any one of [1] to [7], wherein the human malignant ovarian germ cell tumor cell is a human yolk sac tumor cell or a human undifferentiated germ cell tumor cell.
[9] The establishment method according to any one of [1] to [7], wherein the human malignant ovarian germ cell tumor cell is a human yolk sac tumor cell.
[10] A human yolk sac tumor cell line that is established by the method according to [9] and is positive for α-fetoprotein and cytokeratin.
[11] The human yolk sac tumor cell line according to [10], wherein the accession number is FERM P-21055.
[12] A resistant human cell that has acquired resistance to the anticancer agent by exposing the human yolk sac tumor cell line according to [10] or [11] to the anticancer agent.
[13] A resistant human cell that has acquired resistance to cisplatin or carboplatin by exposing the human yolk sac tumor cell line according to [10] or [11] to cisplatin or carboplatin.
[14] The resistant human cell according to [13], wherein the cisplatin concentration in the culture medium can be maintained at 3 μ / ml.
[15] The resistant human cell according to [13], wherein the resistance to cisplatin is about 10 times that of the human yolk sac tumor cell line according to [11].
[16] In the presence of a test substance, the human yolk sac tumor cell line according to [10] or [11] or the resistant human cell according to any of [12] to [15] is cultured, and the cell A method for screening a substance effective against a human yolk sac tumor, characterized by measuring and evaluating the survival rate of the human yolk sac.
[17] A screening method for a compound effective against human yolk sac tumor, which comprises using transcription factor Nkx2.5 as a target molecule.

(Cell line establishment method)
In the cell line establishment method of the present invention, when the collected human malignant ovarian germ cell tumor cells are cultured, a specific medium is used at least in the initial stage.
Human malignant ovarian germ cell tumor cells can be collected by biopsy from the tumor tissue of a patient suffering from a malignant ovarian germ cell tumor. Malignant ovarian germ cell tumors are classified as undifferentiated germ cell tumors, yolk sac tumors, immature teratomas, and other tumors. Among these, the cell line establishment method of the present invention particularly targets anaplastic germoma or yolk sac tumor. Since these two are similar in their origins and characteristics, the cell line establishment method effective for one is naturally considered effective for the other.

  In the present invention, the medium used in the initial stage of culture contains serum, insulin, and epidermal growth factor (EGF). The type of the basic medium is not particularly limited. Therefore, the medium used in the present invention can be prepared by adding serum, insulin and EGF to a basic medium for mammalian cell culture containing inorganic salts, carbohydrates, amino acids or vitamins. . A medium supplemented with antibiotics such as penicillin and streptomycin may be used. As a basic medium for mammalian cell culture, for example, RPMI 1640 medium (Nacalai Tesque, Sigma, Gibco, etc.), Dulbecco's Modified Eagle (D-MEM) medium (Nacalai Tesque, Sigma, Gibco, etc.) SmGM medium (CAMBREX) and SmGM-2 medium (CAMBREX) can be used.

  As serum added to the medium, human serum, fetal bovine serum (FBS), sheep serum, and the like can be used. From the viewpoint of easy availability, it is preferable to employ FBS. FBS can be easily obtained from GIBCO, for example. The serum concentration can be set in the range of about 1% to about 10%. In the method of culturing cancer cells, a medium having a serum concentration of about 10% is generally used. In contrast, the present inventors have succeeded in establishing a human yolk sac tumor cell line by a method of initial culture in the presence of serum at a low concentration of 5%. Considering this fact, it is considered preferable to set the serum concentration to a low concentration, for example, about 5%. As a result of setting the serum concentration at the time of primary culture low, the growth of the mixed fibroblasts was suppressed, and as a result, the proliferation of the target yolk sac tumor cells was promoted, and it was expected that the cell line was successfully established. The

As insulin, recombinant human insulin (CHEMICON), recombinant insulin (Cell Science Laboratories) can be used. The concentration of insulin added to the medium is, for example, 1 mg / l to 40 mg / l, preferably 2 mg / l to 10 mg / l, more preferably about 5 mg / l.
As EGF, recombinant human EGF (hEGF) (CHEMICON, Yunaga Pharmaceutical, R & D Systems, etc.), human recombinant EGF (Pepro Tech EC), etc. can be used. The concentration of EGF added to the medium is, for example, 0.2 μg / l to 20 μg / l, preferably 1 μg / l to 10 μg / l, and more preferably about 4 μg / l.

In a preferred embodiment of the present invention, the following steps (1) to (4) are performed.
1. step 1)
In this step, a tissue piece containing human malignant ovarian germ cell tumor cells is cultured in a medium containing serum, insulin and epidermal growth factor (EGF). As a tissue piece containing human malignant ovarian germ cell tumor cells, one obtained from a part of tumor tissue of a patient suffering from malignant ovarian germ cell tumor can be used. One of the features of the present invention is that the collected tumor tissue pieces are directly subjected to culture. That is, instead of culturing the collected tumor tissue pieces after trypsinization or the like to dissociate the cells, culturing is started in the state of the tissue pieces. This can prevent the target human malignant ovarian germ cell tumor cell from being damaged by trypsin treatment or the like. Here, “directly subjected to primary culture” means that the culture is started without undergoing an operation that damages the target human malignant ovarian germ cell tumor cell such as trypsin treatment. . Therefore, it does not interfere with the operations that are usually performed when culturing the tissue piece, such as washing the tissue piece or excising the adhering matter, before culturing.
When the culture of the tissue piece is started, a phenomenon in which cells migrate from the tissue piece is observed. After sufficient cell migration from the tissue piece is observed, the tissue piece may be removed. Usually, tissue pieces are removed after about 5 days to 1 week from the start of culture.

2. Step (2)
In step (2) following step (1), cells migrated from the tissue piece are cultured in a medium containing serum, insulin and epidermal growth factor (EGF). Usually, the culture in the step (2) is performed using the same medium as that used in the step (1). However, this does not prevent the use of a medium different from that used in step (1). That is, as long as the condition of containing serum, insulin, and epidermal growth factor (EGF) is satisfied, step (2) can be performed using any medium.

  The cells that migrated from the tissue pieces contain many fibroblasts in addition to the target human malignant ovarian germ cell tumor cells. As a result of examination using a tissue fragment collected from a human yolk sac tumor, fibroblasts were extremely dominant in the initial stage of culture, and there was almost no proliferation of the target human malignant ovarian germ cell tumor cells. A phenomenon was observed in which the number of fibroblasts and the number of target human malignant ovarian germ cell tumor cells were gradually reversed by culturing for a long period of time. For this reason, it is preferable to continue the step (2) for a relatively long period of time until the number of mixed fibroblasts decreases and the target human malignant ovarian germ cell tumor cells become predominant. As a result, the target human malignant ovarian germ cell tumor cell can be selectively subjected to subsequent subculture (step (3)). The culture period until the target human malignant ovarian germ cell tumor cell becomes a main component varies depending on the type and culture environment of the human malignant ovarian germ cell tumor cell to be used. Expected to be a week.

  More preferably, the step (2) is continued until a colony consisting essentially only of human malignant ovarian germ cell tumor cells is formed. In this case, cells are collected from the formed colonies, and the collected cells are used for subsequent subculture (step (3)). By subculturing the cell population after purification in this way, it becomes easy to establish a target human malignant ovarian germ cell tumor cell. The culture period until a colony consisting essentially of human malignant ovarian germ cell tumor cells is formed varies depending on the type of human malignant ovarian germ cell tumor cells used and the culture environment, but in the case of yolk sac tumor cells Approximately 5 to 8 weeks are expected. Note that the fibroblasts and human malignant ovarian germ cell tumor cells are remarkably different in morphology, so that they can be easily identified by observation under an optical microscope.

  During the culture in step (2), the medium is changed as necessary. For example, the medium may be changed once every 2 to 5 days. In addition, subculture is performed as necessary.

3. Step (3)
In this step, the cells grown in step (2) are subcultured. Subculture can be performed by a conventional method. That is, when the cells become sub-confluent or confluent in the culture container, the cells are collected, and a part of the collected cells is seeded in another culture container and the culture is continued. Cells are collected using trypsin or a cell scraper. The subculture is repeated and the cells are maintained for a long period. For example, it is passaged once every 1 to 2 weeks. After a sufficient period (for example, 2 months or more from the start of subculture), it is confirmed that the cell is composed of a uniform cell population and maintains sufficient proliferation ability.

In a preferred embodiment of the present invention, a medium containing serum, insulin and epidermal growth factor (EGF) is used for the first few generations of the subculture, and then switched to a medium normally used for culturing mammalian cells. . Specifically, for example, the third to seventh passages of subculture are performed in a medium containing serum, insulin and epidermal growth factor (EGF). That is, in order to reduce the proliferation of fibroblasts and make the target cells (human malignant ovarian germ cell tumor cells) dominant, the medium as described above is used at a time when the proliferation ability of the target cells exceeds the proliferation ability of fibroblasts. Perform the switching. In this embodiment, the initial subculture is performed in a medium equivalent to the medium used in the previous culture (a medium containing a specific component). As a result, the culture environment does not change abruptly at the initial stage where the state of the cells is unstable, and certain components such as insulin act on the cells, resulting in the effect of achieving good cell growth and maintenance. can get. Examples of the medium after the medium switching include RPMI 1640 medium containing 10% FBS, D-MEM medium containing 10% FBS, and the like.
A medium containing serum, insulin and epidermal growth factor (EGF) may be used throughout the entire subculture.

(Cell line)
Another aspect of the present invention relates to a human yolk sac tumor cell line established by the method of the present invention. The human yolk sac tumor cell line of the present invention exhibits α-fetoprotein (AFP) and cytokeratin positivity as one of its characteristics. Being positive for AFP is, for example, a Western blot method using an anti-human AFP antibody as a detection reagent using a protein recovered from a cell culture supernatant as a sample, or a cell immunostaining method using an anti-human AFP antibody. Can be confirmed. On the other hand, cytokeratin positivity can be confirmed by, for example, a cell immunostaining method using an anti-human cytokeratin antibody.
One human yolk sac tumor cell line (NOY1) obtained by the establishment method of the present invention is deposited with a predetermined depository as follows.
Depositary Institution: National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center (Central 6th, 1-1 1-1 Higashi 1-chome, Tsukuba, Ibaraki, Japan 305-8566)
Deposit date (Receipt date): October 6, 2006 Deposit number: FERM P-21055

The present invention further provides a mutant strain (that is, resistant human cells) that has acquired resistance to the anticancer drug by exposing the human yolk sac tumor cell line established by the method of the present invention to the anticancer drug. The resistant human cells of the present invention are more resistant to certain anticancer agents (eg cisplatin and carboplatin) compared to the parent strain from which they are derived. The resistant human cell of the present invention may be resistant to two or more agents. As an exposure method for producing the resistant human cells of the present invention, for example, a method of adding an anticancer agent to a cell line medium and continuously exposing it is simple. Alternatively, the test compound or a solution containing the test compound may be directly brought into contact with the cells.
The amount of exposure can be set arbitrarily. For example, the amount is such that at least a part (for example, 10% to 30%) of cells can remain viable in one exposure. Usually kept exposed at all times.
Viable cells are collected after exposure to the anticancer agent. Usually, by repeating the above exposure and recovery operations, a mutant strain (resistant human cell) that exhibits resistance to a specific anticancer agent can be obtained.
Cisplatin, carboplatin, etoposide, paclitaxel, bleomycin (including bleomycin hydrochloride and bleomycin sulfate) can be used as an anticancer agent. These may be used in any combination.
As shown in the Examples described later, the present inventors performed the above-described method using a cisplatin resistant strain (IC50 = 12.5 μg / ml, approximately 5 times resistant) and a carboplatin resistant strain (IC50 = 18 μg / ml, approximately 5 times resistant). Has been successfully established. After further studies, we succeeded in establishing a cisplatin resistant strain (NOY1CR3.0) that can maintain the cisplatin concentration in the culture medium at 3 μg / ml. Compared to cell line NOY1, cell line NOY1CR3.0 is about 10 times more resistant to cisplatin. The assessment of resistance here is based on the IC50 of cisplatin.

(Use of cell lines)
A further aspect of the present invention relates to a screening method using the human yolk sac tumor cell line or the resistant human cells. A compound selected by a screening method using a human yolk sac tumor cell line is expected to be effective for treatment or prevention of human yolk sac tumor (hereinafter collectively referred to as “treatment etc.”). That is, the selected compound is a promising candidate (lead compound) of an active ingredient of a medicine for human yolk sac tumor. When the selected compound has a sufficient medicinal effect, it can be used as an active ingredient of a drug as it is. On the other hand, when it does not have a sufficient medicinal effect, it can be used as an active ingredient of a drug after it has been modified by chemical modification to enhance its medicinal effect. Of course, even if it has a sufficient medicinal effect, the same modification may be applied for the purpose of further increasing the medicinal effect.
Compounds selected by the above-described screening method using resistant human cells can also be regarded as potential candidates (lead compounds) of active pharmaceutical ingredients for human yolk sac tumors. Since the substance selected in this case has activity against resistant human cells, it is a lead compound particularly effective for cases that have acquired drug resistance, and its value is high.

In the screening method of the present invention, it is evaluated whether or not the cell viability (growth rate) is changed by exposure to the test substance. Specifically, for example, the human yolk sac tumor cell line of the present invention is cultured for a predetermined time in the presence of the test substance (for example, a state in which the test substance is added to the medium), and the number of cells is measured. The number of cells obtained is compared with the number of cells when the human yolk sac tumor cell line of the present invention is cultured for the same time in the absence of the test substance (comparative control), and how much the test substance affects the survival rate. Evaluate whether or not If a decrease in survival rate is observed due to the presence of the test substance, it can be determined that the test substance has activity against human malignant yolk sac tumor.
For test substances selected in the same way in the screening method using a mutant (resistant human cell) that has acquired resistance to a specific anticancer drug, it is determined that the test substance is effective for cases in which the anticancer drug has become ineffective be able to.

  The amount of exposure can be set arbitrarily, but it is preferable to set the amount of exposure within a range that does not have a fatal effect when similar exposure is performed on normal cells. The exposure time is not particularly limited. For example, the exposure time can be set within a range of 1 minute to 1 month. Exposure may be continuous at intervals.

  Test substances used in the screening method of the present invention include organic compounds of various molecular sizes (nucleic acids, peptides, proteins, lipids (simple lipids, complex lipids (phosphoglycerides, sphingolipids, glycosylglycerides, cerebrosides, etc.), prostaglandins) ), Isoprenoids, terpenes, steroids, vitamins, hormones, etc.)) or inorganic compounds. The test substance may be derived from natural products or may be synthetic. In the latter case, an efficient screening system can be constructed using, for example, a combinatorial synthesis technique. In addition, you may use a cell extract, a culture supernatant, etc. as a test substance. Further, existing drugs (including anticancer drugs) may be used as test substances.

(Therapies targeting the transcription factor Nkx2.5)
The investigation by the present inventors revealed that the transcription factor Nkx2.5 is promising as a target molecule in the treatment of human yolk sac tumor. Based on this finding, the present invention provides, as a further aspect, a method for treating a human yolk sac tumor characterized by reducing the expression level or the action level of the transcription factor Nkx2.5. For example, Nkx2.5 expression can be inhibited (suppressed) by antisense method, RNA interference, or by using a ribozyme, thereby reducing the expression level or action level of Nkx2.5.

In the case of performing expression inhibition by an antisense method, for example, an antisense construct that generates RNA complementary to a unique part of mRNA encoding Nkx2.5 when transcribed in a target cell is used. . Such an antisense construct is introduced into a target cell, for example, in the form of an expression plasmid. On the other hand, as an antisense construct, an oligonucleotide probe that hybridizes with an mRNA / or genomic DNA sequence encoding Nkx2.5 and inhibits its expression when introduced into a target cell can also be employed. . As such an oligonucleotide probe, one that is resistant to endogenous nucleases such as exonuclease and / or endonuclease is preferably used.
When a DNA molecule is used as an antisense nucleic acid, an oligodeoxyribonucleotide derived from a region containing a translation initiation site (for example, a region of −10 to +10) of mRNA encoding Nkx2.5 is preferable.

  The complementarity between the antisense nucleic acid and the target nucleic acid is preferably strict, but there may be some mismatch. The ability of an antisense nucleic acid to hybridize to a target nucleic acid generally depends on both the degree of complementarity and the length of both nucleic acids. Usually, the longer the antisense nucleic acid used, the more stable duplexes (or triplexes) can be formed with the target nucleic acid, even if the number of mismatches is large. One skilled in the art can ascertain the degree of acceptable mismatch using standard techniques.

The antisense nucleic acid may be DNA, RNA, or a chimeric mixture thereof, or a derivative or modified form thereof. Moreover, it may be single-stranded or double-stranded. By modifying the base moiety, sugar moiety, or phosphate skeleton moiety, the stability, hybridization ability, etc. of the antisense nucleic acid can be improved. In addition, antisense nucleic acids can be used to promote cell membrane transport (eg, Letsinger et al., 1989, Proc. Natl. Acad. Sci. USA 86: 6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. 84: 648-652; PCT Publication No. W088 / 09810, published December 15, 1988) or substances that enhance affinity for specific cells may be added.
The antisense nucleic acid can be synthesized by a conventional method, for example, using a commercially available automatic DNA synthesizer (for example, Applied Biosystems). For example, Stein et al. (1988), Nucl. Acids Res. 16: 3209 and Sarin et al., (1988), Proc. Natl. Acad. Sci. USA 85: 7448- 7451 etc. can be referred to.

Strong promoters such as pol II and pol III can be used to enhance the action of antisense nucleic acids in target cells. That is, when a construct containing an antisense nucleic acid arranged under the control of such a promoter is introduced into a target cell, a sufficient amount of the antisense nucleic acid can be transcribed by the action of the promoter.
Expression of the antisense nucleic acid can be performed by any promoter (inducible promoter or constitutive promoter) known to function in mammalian cells (preferably human cells). For example, the SV40 early promoter region (Bernoist and Chambon, 1981, Nature 290: 304-310), the promoter from the 3 ′ end region of Rous sarcoma virus (Yamamoto et al., 1980, Cell 22: 787-797), herpes zoster thymidine A promoter such as a kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. USA 78: 1441-1445) can be used.

In one embodiment of the present invention, Nkx2.5 expression is inhibited by RNA interference (RNAi). RNAi is a sequence-specific post-transcriptional gene repression process that can occur in eukaryotic cells. In RNAi for mammalian cells, a short double-stranded RNA (siRNA) having a sequence corresponding to the sequence of the target mRNA is used. Usually, siRNA is 21-23 base pairs. By the way, it is known that mammalian cells have two pathways (sequence-specific pathway and sequence non-specific pathway) that are affected by double-stranded RNA (dsRNA). In sequence-specific pathways, relatively long dsRNAs are split into short interfering RNAs (ie siRNAs). On the other hand, a sequence non-specific pathway is considered to be caused by an arbitrary dsRNA regardless of the sequence as long as it has a predetermined length or more. In this pathway, dsRNA becomes an active form, namely PKR, which stops all protein synthesis by phosphorylating the translation initiation factor eIF2 and 2 ', 5' involved in the synthesis of RNAase L activation molecules. Oligoadenylate synthase is activated. To minimize the progression of this non-specific pathway, it is preferable to use double stranded RNA (siRNA) shorter than about 30 base pairs (Hunter et al. (1975) J Biol Chem 250: 409-17 Manche et al. (1992) Mol Cell Biol 12: 5239-48; Minks et al. (1979) J Biol Chem 254: 10180-3; and Elbashir et al. (2001) Nature 411: 494-8. Wanna)
RNAi has been confirmed to be an effective means for reducing gene expression in various cell types (eg, HeLa cells, NIH / 3T3 cells, COS cells, 293 cells, etc.). In general, the expression can be inhibited more effectively than the antisense method.

  The siRNA used for RNAi can be prepared by chemical synthesis or in vitro or in vivo using an appropriate expression vector. In designing siRNA, a sequence unique to a target nucleic acid (continuous sequence) is usually used. Note that programs and algorithms for selecting an appropriate target sequence have been developed.

In another embodiment of the present invention, Nkx2.5 expression is inhibited by a ribozyme. Although ribozymes that cleave mRNA at site-specific recognition sequences can be used to destroy mRNA encoding Nkx2.5, hammerhead ribozymes are preferably used. For the construction method of the hammerhead ribozyme, for example, Haseloff and Gerlach, 1988, Nature, 334: 585-591 can be referred to.
As in the case of the antisense method, a ribozyme may be constructed using a modified oligonucleotide, for example, for the purpose of improving stability and target ability. In order to generate an effective amount of ribozyme in a target cell, for example, a nucleic acid construct in which DNA encoding the ribozyme is placed under the control of a strong promoter (eg, pol II or pol III) may be used. preferable.

  Drugs (antisense nucleic acid, siRNA, ribozyme, compounds using the cell line of the present invention or screening methods targeting the transcription factor Nkx2.5 used in the therapeutic method of the present invention Etc.) can be formulated according to a conventional method. In the case of formulating, other pharmaceutically acceptable ingredients (for example, carriers, excipients, disintegrants, buffers, emulsifiers, suspending agents, soothing agents, stabilizers, preservatives, preservatives, physiological Saline solution and the like). As the excipient, lactose, starch, sorbitol, D-mannitol, sucrose and the like can be used. As the disintegrant, starch, carboxymethylcellulose, calcium carbonate and the like can be used. Phosphate, citrate, acetate, etc. can be used as the buffer. As the emulsifier, gum arabic, sodium alginate, tragacanth and the like can be used. As the suspending agent, glyceryl monostearate, aluminum monostearate, methyl cellulose, carboxymethyl cellulose, hydroxymethyl cellulose, sodium lauryl sulfate and the like can be used. As the soothing agent, benzyl alcohol, chlorobutanol, sorbitol and the like can be used. As the stabilizer, propylene glycol, diethylin sulfite, ascorbic acid or the like can be used. As preservatives, phenol, benzalkonium chloride, benzyl alcohol, chlorobutanol, methylparaben, and the like can be used. As preservatives, benzalkonium chloride, paraoxybenzoic acid, chlorobutanol and the like can be used.

The dosage form for formulation is not particularly limited, and can be prepared as, for example, tablets, powders, fine granules, granules, capsules, syrups, injections, external preparations, and suppositories.
In the treatment of yolk sac tumor, the above-mentioned drug is administered to a subject (patient) having yolk sac tumor cells. The drug can be applied to the subject (patient) by oral administration or parenteral administration (intravenous, intraarterial, subcutaneous, intramuscular, intraperitoneal injection, direct introduction into target cells, etc.) depending on the form.
The dose of the drug varies depending on symptoms, patient age, sex, weight, and the like, but those skilled in the art can appropriately set an appropriate dose. For example, the dose can be set so that the amount of active ingredient per day is about 0.001 mg to about 100 mg for adults (body weight about 60 kg). As the administration schedule, for example, once to several times a day, once every two days, or once every three days can be adopted. In setting the administration schedule, it is possible to take into account the patient's medical condition and the duration of the drug effect.

(Screening method targeting transcription factor Nkx2.5)
The inventors' studies have revealed that the transcription factor Nkx2.5 is promising as a drug target molecule for yolk sac tumors. Based on this finding, the present invention provides, as a further aspect, a screening method for a compound effective against human yolk sac tumor, characterized by using transcription factor Nkx2.5 as a target molecule. Compounds selected by this screening method are expected to be effective for treatment of human yolk sac tumors. That is, the selected compound is a promising candidate (lead compound) of an active ingredient of a medicine for human yolk sac tumor. When the selected compound has a sufficient medicinal effect, it can be used as an active ingredient of a drug as it is. On the other hand, when it does not have a sufficient medicinal effect, it can be used as an active ingredient of a drug after it has been modified by chemical modification to enhance its medicinal effect. Of course, even if it has a sufficient medicinal effect, the same modification may be applied for the purpose of further increasing the medicinal effect.
In the screening method of the present invention, for example, the binding property of the test substance to the Nkx2.5 protein, the action (influence) of the test substance on the expression level or action amount of Nkx2.5 is used as an index.
The test substance to be used in the screening method of the present invention is the same as in the case of the screening method described in the above (Method of using cell lines).

(A) Screening using binding to Nkx2.5 protein as index In one embodiment of the screening method of the present invention, an effective compound is selected using binding to Nkx2.5 protein as an index. For example, the following steps (1) and (2) are performed to select effective compounds.
(1) A step of bringing the Nkx2.5 protein into contact with the test substance.
(2) A step of evaluating the binding property of the test substance to the Nkx2.5 protein.
Hereinafter, the details will be described for each step. In addition, based on the three-dimensional structure of Nkx2.5 protein, it is so-called in silico that simulates the binding between Nkx2.5 protein and a test substance on a computer, or designs a compound having binding property to Nkx2.5 protein. A compound having binding ability to Nkx2.5 protein may be selected by screening.

step 1)
In step (1), the Nkx2.5 protein is brought into contact with the test substance. Specifically, for example, a test substance is brought into contact with a Nkx2.5 protein immobilized on an insoluble support such as a plate, a membrane, or a bead in a reaction solution. After a predetermined time has elapsed, the nonspecific binding component is removed by washing with an appropriate solution.
The reaction solution is not particularly limited, and a known or commercially available buffer solution, physiological saline, or the like can be used. For example, as the reaction solution, phosphate buffer, citrate buffer, Tris-HCl buffer, Tris-acetate buffer, and the like can be used, and the pH thereof is, for example, pH 6.0 to pH 8.0, preferably pH 6.5. ˜pH 7.5. The reaction temperature can be, for example, 4 ° C to 45 ° C, preferably 4 ° C to 40 ° C. The reaction time can be set, for example, in the range of 1 minute to 24 hours (specifically, for example, the reaction is performed overnight).
The test substance may be contacted with the Nkx2.5 protein competitively with the anti-Nkx2.5 antibody. That is, an experimental system in which the Nkx2.5 protein and the anti-Nkx2.5 antibody are brought into contact with each other in the presence and absence of the test substance may be employed. If the test substance has a binding activity to the Nkx2.5 protein, the presence of the test substance inhibits the binding of the anti-Nkx2.5 antibody to the Nkx2.5 protein. Therefore, the amount of anti-Nkx2.5 antibody bound to Nkx2.5 protein is contacted with anti-Nkx2.5 antibody in the presence of test substance and in the absence of test substance. In comparison, the binding activity of the test substance to the Nkx2.5 protein can be determined indirectly.

Step (2)
In step (2), the binding of the test substance to the Nkx2.5 protein is evaluated. That is, the amount of the test substance bound to Nkx2.5 protein is measured, and the binding activity is determined from the measurement result. The amount of binding to Nkx2.5 protein is measured by an appropriate method according to the type and properties of the test substance. For example, if the test substance is a protein molecule, measure the protein amount after recovering the component bound to the Nkx2.5 protein, or use an immunological technique that uses an antibody that specifically binds to the test substance. Can be used to calculate the amount of test substance bound to Nkx2.5 protein. These methods are merely examples, and any measurement method can be adopted as long as the amount of binding to the Nkx2.5 protein can be measured.
When an experimental system using an anti-Nkx2.5 antibody is employed as described above, the amount of anti-Nkx2.5 antibody bound to the Nkx2.5 protein becomes the measurement target. Then, the binding activity of the test substance is determined from the measurement result (anti-Nkx2.5 antibody binding amount).

(B) Screening using test substance action (influence) on Nkx2.5 expression level or action level as an index In another aspect of the screening method of the present invention, the test substance against Nkx2.5 expression level or action level Effective compounds are selected using the action (effect) as an index. For example, a reporter gene assay using cells capable of evaluating the expression level or action level of Nkx2.5 is performed. In the reporter gene assay, the expression level of the Nkx2.5 gene or a gene that is transcriptionally regulated by Nkx2.5 (for example, α-fetoprotein (AFP)) is evaluated based on the expression level of the reporter gene, and a test for the expression of the Nkx2.5 gene Determine the ability of the substance to inhibit (suppress), or the ability of the test substance to inhibit (suppress) the action of the Nkx2.5 gene.
As the reporter gene, CAT (chloramphenicol) gene, LUC (luciferase) gene, etc. can be used.
Examples of cells used in the reporter gene assay include HeLa cells, COS cells, and CHO cells. These cells are readily available from cell banks such as ATCC.
The reporter gene assay may be performed according to a conventional method. Details of the reporter gene assay are introduced in various publications and papers such as Molecular Cloning (Third Edition, Cold Spring Harbor Laboratory Press, New York) or Current protocols in molecular biology (edited by Frederick M. Ausubel et al., 1987), New Genetic Engineering Handbook (Yodosha) etc. can be referred to.

1. Establishment of cell lines 1-1. Methods Tumor tissue was collected from a 28-year-old patient with yolk sac tumor who underwent surgery on May 30, 2005, with the consent of establishing a cell line. After the collected tissue pieces were sufficiently washed with PBS, the tissue pieces were cut into 1 to 2 mm squares, and a large number of pieces were cultured in the following culture solution without performing trypsin treatment.
Commercial SmGM medium (CAMBREX) (500 ml), 5% FBS (Gibco), 2.5 mg insulin (Cell Science Laboratories), 2 μg hEGF (R & D Systems), and antibiotics (penicillin 100,000 units) The culture solution added with 100 mg streptomycin was used. On the 5th day from the start of the culture, the tissue piece was removed, and the medium was changed simultaneously. Thereafter, the medium exchange was repeated once every three days.
As a preliminary experiment, when the same operation was performed using RPMI 1640 medium containing 10% FBS or SmGM medium containing 10% FBS, no growth of yolk sac tumor cells was observed.

1-2. Results The formation of colonies was confirmed 2 weeks after the start of the culture. However, there was a mixture of fibroblasts. Subsequent repeated passages resulted in a decrease in fibroblasts from the 4th week after the start of culture, mainly yolk sac tumor cells. Since the tumor cells have formed colonies, 10 colonies were picked when fibroblasts almost disappeared and cultured for each colony. Cells from each colony were cultured separately and the passage was repeated. The above culture solution was used until the fifth passage, but RPMI 1640 medium containing 10% FBS was used in subsequent passage cultures. It was confirmed that sufficient proliferation ability was maintained even when 5 months or more passed from the start of subculture (passage number 25). The current passage number is 28.
The yolk sac cells (NOY1) established as described above were deposited as follows.
Depositary Institution: National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center (Central 6th, 1-1 1-1 Higashi 1-chome, Tsukuba, Ibaraki, Japan 305-8566)
Deposit date (Receipt date): October 6, 2006 Deposit number: FERM P-21055

2. 2. Analysis of cell function 2-1. Confirmation of AFP expression by Western blotting
Proteins were recovered from the disruption solution (by 1% Triton X) of cells (passage 21) of each of the 10 colonies by a conventional method. Western blotting was performed using the recovered protein (10 μg) as a sample. An anti-human α-1-fetoprotein antibody (Dako Cytomation) was used as an antibody for detection. Expression was also examined in the endometrial cancer cell line (Ishikawa) in the same manner (negative control).
The result of Western blotting is shown in FIG. In all 10 colonies, AFP expression was observed around 70 kDa. No expression was observed in the endometrial cancer cell line (Ishikawa) used as a negative control. Since the strongest expression was observed in colony No. 2, colony No. 2 was used for the following analysis.

2-2. 2. Confirmation of AFP expression and cytokeratin expression by cell immunostaining 2-1. Cell immunostaining (avidin-biotin immunoperoxidase technique) using anti-human α-1-fetoprotein antibody (Dako Cytomation) and anti-human cytokeratin antibody (Dako Cytomation) on selected cells (colony No. 2) )
The result of immunostaining is shown in FIG. Immunostaining revealed AFP staining in the cytoplasm of almost all cells, although there were differences in strength. Cytokeratin expression was also observed, and the expression of protein characteristic of yolk sac tumor was confirmed by immunostaining.

2-3. Confirmation of AFP expression by ELISA
Cells (colony 2) are cultured at 30x10 ⁴ cells / ml in a 75mm culture dish, and the culture solution after 24, 48, and 72 hours is collected, and AFP is prepared using Alfa-Fetoprotein ELISA kit (R and D SYSTEMS). Secretion was examined.
The detection result is shown in FIG. When the AFP secretion capacity of the cells is measured with an ELISA kit, it has a high APF secretion capacity of 49 ng / ml in the 24-hour culture, 146 ng / ml in the 48-hour culture, and 218 ng / ml in the 72-hour culture. Indicated.

2-4. Examination of cell proliferation ability Cell proliferation ability was examined by modified tetrazolium salt assay (MTS assay) using Cell Titer 96 Aqueous One Solution Cell Proliferation Assay kit (Promega). As a result, the cell proliferation ability was comparable to that of a typical epithelial ovarian cancer cell line (SKOV), and the doubling time was 45 hours (FIG. 4).

2-5. Examination of expression of growth factor receptor The protein collected from the cell lysate was subjected to Western blotting to examine the expression of growth factor receptors such as insulin and EGF. As a result, expression of insulin receptor α was observed (FIG. 5).

2-6. Examination of anticancer drug resistance To each cell (colony No. 2), cisplatin, carboplatin, etoposide and paclitaxel were added at various concentrations, and the IC50 of each anticancer drug was examined. As a result, the IC50 for cisplatin, carboplatin, etoposide, and paclitaxel were 2.8 μg / ml, 3.5 μg / ml, 122 μg / ml, and 150 ng / ml, respectively. Thus, the established yolk sac cell line was highly sensitive to cisplatin and carboplatin but low in sensitivity to etoposide and paclitaxel.

2-7. Establishment of anticancer drug resistant strains We tried to establish various anticancer drug resistant strains with reference to IC50 of each anticancer drug. The experimental method was as follows. In other words, exposure to cisplatin and carboplatin was started at a concentration of 0.1 μg / ml, and the exposure concentration was increased by 0.1 μg / ml every two weeks while subcultured, and a resistant strain that could be maintained at 1 μg / ml was obtained. .
As a result, a cisplatin resistant strain (IC50 = 12.5 μg / ml, approximately 5 times resistant) and a carboplatin resistant strain (IC50 = 18 μg / ml, approximately 5 times resistant) were successfully established.

3. Discussion Although the incidence of malignant ovarian germ cell tumors is not as high as 5-10% of malignant ovarian tumors, most of them develop in young women under 35 years of age, and the prognosis of advanced or recurrent cancer is extremely poor, and the treatment Law development is an important issue. As a treatment for malignant ovarian germ cell tumors, chemotherapy including cisplatin, etoposide, and bleomycin is performed in addition to surgery (Non-patent Document 6). However, this is a regimen determined by clinical data of germ cell tumor cases centering on testicular tumors, and it cannot be said that sufficient effects are still being obtained. is necessary. Establishment of cell lines is important for the development of treatments for malignant ovarian germ cell tumors. Once a cell line of a malignant ovarian germ cell tumor is established, an anticancer drug sensitivity test using the cell line can be performed. And the results of anticancer drug susceptibility tests greatly contribute to the determination of the most effective chemotherapy regimen. Furthermore, by using cell lines of malignant ovarian germ cell tumors, functional analysis such as expression of various growth factor receptors and signal transduction substances will progress, and it will be possible to apply and develop new molecular targeted therapeutic agents. In addition, for the treatment of cisplatin-resistant cases, which is currently the most important issue, if cisplatin resistance can be overcome by analyzing the function of the cisplatin-resistant cell line established this time, malignant ovarian germ cell tumors Prognosis may improve dramatically. As described above, the establishment of a human yolk sac tumor cell line is valuable for promoting basic research leading to the treatment of malignant ovarian germ cell tumors.

4). Establishment of cisplatin-resistant strains Yolk sac tumor is a disease that is largely successful with cisplatin-based chemotherapy, but relapsed patients have a very poor prognosis due to acquired cisplatin resistance. (Non-patent document 7) In addition, a case of cisplatin resistance has been reported from the beginning (Non-patent document 5). Furthermore, some patients with yolk sac tumors are allergic to cisplatin and cannot be used, resulting in poor prognosis. Based on the above, the study of the mechanism of cisplatin resistance in yolk sac tumors is an important issue, and the development of a novel molecular targeted therapy is also desired. As described above, we have already succeeded in establishing an anticancer drug-resistant strain, but we conducted the following studies with the aim of establishing a more resistant cell line.
4-1. Method Add cisplatin from 0.1μg / ml to yolk sac tumor cell line (NOY1), gradually increase the cisplatin concentration while repeating the passage (for 6 months), and can be maintained at 3μg / ml Cells (NOY1CR3.0) were established. Cisplatin IC50 in this cell line (NOY1CR3.0) was measured.
4-2. result
The cisplatin IC50 of NOY1 was 2.8 μg / ml. In contrast, cisplatin IC50 of NOY1CR3.0 was 27.5 μg / ml, which was about 10 times more resistant than NOY1 (FIG. 6). Thus, in addition to the establishment of a yolk sac tumor cell line, a 10-fold resistant strain of cisplatin was successfully established. Chemotherapy centered on cisplatin is given to advanced yolk sac tumors and cures in many cases, but the prognosis for cisplatin resistance is very poor. Analysis of the microarray and protein array of NOY1CR3.0, which was successfully established this time, makes it possible to elucidate the mechanism of resistance and to enable new molecular targeted therapies. In addition, from the data of sensitivity tests of other anticancer agents against cisplatin resistant strains, it would be possible to select drugs for second-line anticancer drug treatment.

5). Anti-proliferative effect of yolk sac tumor cell line targeting transcription factor Nkx2.5 Focusing on the feature of yolk sac tumor producing α-fetoprotein (AFP), there is a report that it is involved in AFP transcription Nkx2. The growth inhibitory effect of yolk sac tumor cell line targeting 5 (Non-patent Document 8) was examined.
5-1. Method First, the expression of Nkx2.5 in NOY1 was examined by Western blot. For Western blotting, an anti-Nkx2.5 antibody (Santa cruz biotechnology, sc-8697) was used, and the protein after SDS-PAGE was transferred to a nitrocellulose membrane by electrophoresis and detected with an antibody. On the other hand, the expression of Nkx2.5 in yolk sac tumor tissue was examined by immunohistochemical staining. An informed consent was performed, and a specimen collected at the time of surgery with consent was used as a sample to prepare a paraffin section. For immunohistochemical staining, an anti-Nkx2.5. Antibody (Santa cruz biotechnology, sc-8697) was used, and detection was performed by the alkaline phosphatase method. In addition, the expression of Nkx2.5. In NOY1 was knocked down with siRNA, and cell proliferation ability was examined. The siRNA used is as follows.
Sense strand: 5'AGAUCUGGUUCCAGAAUCA 3 '(SEQ ID NO: 1)
Antisense strand: 5'UGAUUCUGGAACCAGAUCU 3 '(SEQ ID NO: 2)
The following were used as control siRNA.
Sense strand: 5'ACAACAACUUCGUGAACUU 3 '(SEQ ID NO: 3)
Antisense strand: 5'AAGUUCACGAAGCACUUGAA 3 '(SEQ ID NO: 4)

5-2. Results The results of Western blotting are shown in FIG. Compared with the cell line of epithelial ovarian cancer, Nyx2.5. Was highly expressed in NOY1 (FIG. 7).
On the other hand, Nkx2.5. Immunohistochemical staining in yolk sac tumor tissue confirmed the expression of Nkx2.5. In the tumor cells (FIG. 8).
In addition, when Nkx2.5. SiRNA was introduced into NOY1 and Nkx2.5. Expression was suppressed, AFP expression was suppressed and cell proliferation ability was suppressed by about 50% after 72 hours (FIG. 9).

  As described above, when various experiments were conducted focusing on the transcription factor of AFP, it was confirmed that Nkx2.5. Was strongly expressed in NOY1, and knockdown of Nkx2.5. Using siRNA was confirmed. Inhibited cell growth by 50%. From these results, Nkx2.5. Is considered promising as a target (molecular target) for establishing a new treatment for yolk sac tumor.

  The present invention enables the establishment of a human malignant ovarian germ cell tumor cell line. By using the cell line obtained by the method of the present invention, basic and applied research on human malignant ovarian germ cell tumors becomes possible. That is, specific research and development toward the establishment of a treatment method for human malignant ovarian germ cell tumors becomes possible.

The present invention is not limited to the description of the embodiments and examples of the invention described above. Various modifications may be included in the present invention as long as those skilled in the art can easily conceive without departing from the description of the scope of claims.
The contents of papers, published patent gazettes, patent gazettes, and the like specified in this specification are incorporated by reference in their entirety.

It is the result of having analyzed the protein collect | recovered from the human yolk sac tumor cell line which was established successfully by Western blotting. AFP bands are observed in all lanes. It is an immunohistostaining image of a human yolk sac tumor cell line (colony No. 2). The left is the result of staining with an anti-human α-1-fetoprotein antibody, and the right is the result of staining with an anti-human cytokeratin antibody. It is the result of having analyzed the culture solution of the human yolk sac tumor cell line (colony No. 2) by ELISA method. It can be seen that the AFP concentration in the culture solution increases with time. It is a graph which shows the growth ability of a human yolk sac tumor cell line (colony No. 2). The human yolk sac tumor cell line (YOLK3), which was successfully established, showed the same growth ability as human ovarian cancer cells (SKOV3, Memorial Sloan-Kettering Cancer Center). It is the result of the Western blot analysis using the protein collect | recovered from the cell lysate of a human yolk sac tumor cell line (colony No. 2). It can be seen that in the human yolk sac tumor cell line, insulin receptor α is strongly expressed as compared with human ovarian cancer cells (SKOV) and human ovarian cancer cells (Hey). Results of cisplatin sensitivity test of human yolk sac cell line (NOY1) and cisplatin resistant line (NOY1CR3.0). Comparison of Nkx2.5. Expression in human yolk sac cell line (NOY1) and various ovarian cancer cell lines (result of Western blot). Results of immunohistochemical staining using yolk sac tumor tissue. The left is yolk sac tumor case 1 and the right is yolk sac tumor case 2. Change in proliferation ability of NOY1 by knockdown of Nkx2.5. by siRNA.

Claims (17)

  A method for establishing a human malignant ovarian germ cell tumor cell line, comprising culturing human malignant ovarian germ cell tumor cells in a medium containing serum, insulin and epidermal growth factor.   The establishment method according to claim 1, wherein the content of the serum in the medium is about 5% (v / v). The establishment method according to claim 1 or 2, comprising the following steps (1) to (3):
(1) culturing a tissue piece containing human malignant ovarian germ cell tumor cells in a medium containing serum, insulin and epidermal growth factor;
(2) culturing cells migrated from the tissue piece in a medium containing serum, insulin and epidermal growth factor;
(3) A step of subculturing the proliferated cells.   4. The establishment method according to claim 3, wherein the culture in step (2) is continued until the number of mixed fibroblasts decreases and human malignant ovarian germ cell tumor cells become predominant.   Continue the culture in step (2) until a colony consisting essentially of human malignant ovarian germ cell tumor cells is formed, collect cells from the formed colony, and pass the collected cells to the passage of step (3). The establishment method according to claim 3, wherein the establishment method is used for culture.   In step (3), the first generation of subculture is performed in a medium containing serum, insulin and epidermal growth factor (EGF), and subsequent subculture is performed with insulin and epidermal growth factor (EGF). The establishment method according to any one of claims 3 to 5, wherein the establishment method is performed in a medium that does not contain.   7. The establishment according to claim 6, wherein the third to fifth generations of subculture are performed in a medium containing serum, insulin and epidermal growth factor (EGF) in step (3). Method.   The establishment method according to claim 1, wherein the human malignant ovarian germ cell tumor cell is a human yolk sac tumor cell or a human undifferentiated germ cell tumor cell.   The establishment method according to claim 1, wherein the human malignant ovarian germ cell tumor cell is a human yolk sac tumor cell.   A human yolk sac tumor cell line that is established by the method according to claim 9 and is positive for α-fetoprotein and cytokeratin.   The human yolk sac tumor cell line according to claim 10, wherein the accession number is FERM P-21055.   The resistant human cell which acquired the tolerance to this anticancer agent by exposing the human yolk sac tumor cell line of Claim 10 or 11 to an anticancer agent.   A resistant human cell that has acquired resistance to cisplatin or carboplatin by exposing the human yolk sac tumor cell line according to claim 10 or 11 to cisplatin or carboplatin.   The resistant human cell according to claim 13, which can be maintained at a cisplatin concentration of 3 μ / ml in the culture medium.   The resistant human cell of claim 13, wherein the resistance to cisplatin is about 10 times that of the human yolk sac tumor cell line of claim 11.   The human yolk sac tumor cell line according to claim 10 or 11 or the resistant human cells according to any one of claims 12 to 15 is cultured in the presence of a test substance, and the survival rate of the cells is measured and evaluated. A screening method for a substance effective against a human yolk sac tumor.   A screening method for a compound effective against a human yolk sac tumor, characterized by using a transcription factor Nkx2.5 as a target molecule.