JP2007097588A - Ecdysone receptor derived from insect of order hemiptera and ultraspiracle and utilization thereof - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for especially detecting a compound (an ecdysone activity regulator) regulating the ecdysis of an insect of the order Hemiptera, especially Nilaparuata lugens which is one species of insect pests of the order Hemiptera. <P>SOLUTION: A protein composed of the following amino acid sequence (a) or (b) is provided: (a) a protein composed of an amino acid sequence represented by a specific sequence or (b) a protein composed of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by the specific sequence and having functions as an ecdysone receptor. Furthermore, the compound regulating the ecdysis is detected by using the protein or a cell system derived from the Nilaparuata lugens. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a novel ecdysone receptor and ultraspiracle derived from Hemiptera, DNA encoding them, a recombinant vector containing the DNA, a transformant expressing them, and an insecticide screening system using them About.

  Ecdysons in insects are known as molting hormones (Non-patent Document 1). 20-hydroxyecdysone is representative and acts as a molting hormone in almost all insects. The essence of the molting hormone activity of ecdysones has been elucidated to be the activation of target genes via ecdysone receptor and ultraspiracle, which are ligand-dependent transcription factors present in insect cells (non-patent literature) 2).

  Non-Patent Document 3 compares the structures of the ecdysone receptor genes derived from the arthropods of Lepidoptera, Diptera, Coleoptera, and Mite, and the structure of the receptor varies among insects. It has become clear. The ecdysone receptor and ultraspiracle both belong to the nuclear receptor superfamily. The ecdysone receptor consists of an A / B region, a C region, a D region, an E region, and an F region. The region involved in binding to DNA (DNA binding region) is the C region, and the region involved in binding to ligands such as ecdysone (ligand binding region) is the E region (Non-patent Document 3). The ultraspiracle is composed of an A / B area, a C area, a D area, and an EF area. The DNA binding region is the C region, and the ligand binding region is the EF region. The ecdysone receptor and ultraspiracle form heterodimers, bind to ecdysone response elements on DNA, and are involved in activation of transcription of target genes in response to chemical substances such as ecdysones (Non-patent Document 4). .

  While 20-hydroxyecdysone acts as a molting hormone in almost all insects, some nonsteroidal ecdysone agonists show high selectivity reflecting the difference in receptor structure. For example, dibenzoylhydrazine derivatives such as chromaphenozide (N′-tert-butyl-N ′-(3,5-dimethylbenzoyl) -5-methyl-6-chlorobenzenehydrazide) exhibit high molting hormone activity against lepidopterous insects. It does not show activity against other insects (Non-patent Document 5).

  Non-Patent Document 6 mentions the difference in the amino acid sequence of the ecdysone receptor as one reason why the dibenzoylhydrazine derivative exhibits high selectivity among insects. From these facts, in order to detect an ecdysone activity-regulating substance that acts specifically on the target type of insect, it is necessary to use an ecdysone receptor derived from that insect.

  The amino acid sequences of many ecdysone receptors have been revealed from other insect species. For example, EcR (gi: 4405799, non-patent document 7) derived from the straight-eyed insect Locusta migratoria can be mentioned.

  The amino acid sequences of many ultraspiracles have been clarified from other insect species, for example, Ultraspiracle (gi: 3393178) derived from the locust insect Locusta migratoria.

  Regarding the method of screening an ecdysone activity modulator in an in vitro system, a reporter plasmid DNA incorporating an ecdysone response element, a promoter, and a firefly luciferase gene is introduced into an insect cell, and luciferase expressed by the ecdysone active substance is detected. Patent Document 1 describes a method for detecting a substance having activity with high sensitivity and simplicity. However, in order to detect an ecdysone activity-regulating substance that specifically acts on the target type of insect, it is necessary to use a cell line derived from that insect.

Recent Prog. Horm. Res. , 22, 473-502 (1966) Nature, 366, 476-479 (1993) Insect Biochemistry and Molecular Biology, 29, 915-930 (1999) Dev. Genes Evol. , 209, 564-571 (1999) Annual Report of Sankyo Research Laboratories, 53, 1-49 (2001) Nature, 426, 91-96 (2003) Mol. Cell Endocrinol. , 143, 91-99 (1998) JP 2002-291489 A

  As described above, in order to detect ecdysone activity modulators that act specifically on the target insect type, use the ecdysone receptor from that insect, or use the cell line from that insect. There is a need to.

  An object of the present invention is to provide a system for detecting a compound (ecdysone activity-regulating substance) that regulates molting of a hemiptera insect, in particular, a brown planthopper, which is one of the Hemiptera pests. Currently, ecdysone receptors and ultraspiracle derived from planthopper are not known, and there are no cell lines derived from planthopper. Therefore, an object of the present invention is to clarify the ecdysone receptor gene derived from brown planthopper and the ultraspiracle gene that is a heterodimer thereof, and to construct a screening system using them.

  As a result of diligent research to solve the above-mentioned problems, the present inventors succeeded in cloning a new ecdysone receptor gene and a novel ultraspiracle gene from a brown planthopper, and further used a screening system for compounds that regulate molting. Successfully built. By carrying out this screening system, it was found that an ecdysone activity-regulating substance in brown planthopper can be detected, and the present invention has been completed.

That is, the present invention relates to the following (1) to (30).
(1) a protein comprising the following amino acid sequence (a) or (b):
(A) a protein comprising the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing;
(B) A protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing, and having a function as an ecdysone receptor.
(2) A partial polypeptide of the protein according to (1) above, which contains a partial amino acid sequence corresponding to a region necessary for binding to ecdysones,
(3) In the above (2), a partial polypeptide whose partial amino acid sequence corresponding to a region necessary for binding to ecdysones is the following amino acid sequence (a) or (b):
(A) a partial sequence of positions 332 to 689 of the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing;
(B) an amino acid sequence in which one or several amino acids are deleted, substituted or added in the partial sequence from the 332th to the 689th amino acid sequence represented by SEQ ID NO: 1 in the sequence listing, and binds to ecdysones Amino acid sequence.
(4) a fusion polypeptide in which the partial polypeptide according to (2) or (3) and a GAL4 activation region comprising the following amino acid sequence (a) or (b) are bound directly or indirectly:
(A) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing;
(B) A polypeptide comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 in the Sequence Listing.
(5) a fusion polypeptide in which a GAL4 DNA binding region consisting of the following amino acid sequence (a) or (b) is bound directly or indirectly to the partial polypeptide of (2) or (3) above:
(A) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 3 in the sequence listing;
(B) A polypeptide comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 3 in the sequence listing.
(6) DNA encoding the protein according to (1),
(7) DNA comprising any of the following base sequences (a) to (c):
(A) DNA encoding a novel ecdysone receptor consisting of the base sequence represented by SEQ ID NO: 4 in the sequence listing;
(B) DNA encoding a novel ecdysone receptor in which one or several bases have been deleted, substituted or added in the base sequence represented by SEQ ID NO: 4 in the sequence listing;
(C) DNA encoding a novel ecdysone receptor that hybridizes with a base sequence complementary to the base sequence represented by SEQ ID NO: 4 under stringent conditions.
(8) DNA encoding the partial polypeptide according to (2),
(9) DNA comprising any of the following base sequences (a) to (c):
(A) DNA encoding a partial polypeptide having the ability to bind to ecdysone consisting of a partial sequence from position 1413 to position 2489 of the base sequence represented by SEQ ID NO: 4 in the sequence listing;
(B) a partial poly having the ability to bind to ecdysones in which one or several bases have been deleted, substituted or added in the partial sequence from the 1413th position to the 2489th position of the base sequence represented by SEQ ID NO: 4 in the sequence listing DNA encoding the peptide;
(C) a partial polypeptide having the ability to bind to ecdysones that hybridize under stringent conditions with a base sequence complementary to the partial sequence 1413 to 2489 of the base sequence represented by SEQ ID NO: 4 in the sequence listing DNA encoding.
(10) A GAL4 activation region consisting of any one of the following base sequences (a) to (c) is bound directly or indirectly to the partial polypeptide of the protein according to (2) or (3) above: DNA encoding a fusion polypeptide,
(A) DNA comprising the base sequence represented by SEQ ID NO: 5 in the sequence listing;
(B) DNA in which one or several bases are deleted, substituted or added in the base sequence represented by SEQ ID NO: 5 in the sequence listing;
(C) DNA that hybridizes under stringent conditions with a base sequence complementary to the base sequence represented by SEQ ID NO: 5 in the sequence listing.
(10) The GAL4 DNA binding region comprising the base sequence of any of the following (a) to (c) is bound directly or indirectly to the partial polypeptide of the protein according to (2) or (3). DNA encoding a fusion polypeptide,
(A) DNA comprising the base sequence represented by SEQ ID NO: 6 in the sequence listing;
(B) DNA in which one or several bases are deleted, substituted or added in the base sequence represented by SEQ ID NO: 6 in the sequence listing;
(C) DNA that hybridizes under stringent conditions with a base sequence complementary to the base sequence represented by SEQ ID NO: 6 in the sequence listing.
(12) a protein comprising the following amino acid sequence (a) or (b):
(A) a protein comprising the amino acid sequence represented by SEQ ID NO: 7 in the sequence listing;
(B) a protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 7 in the sequence listing, and having a function as an ultraspiracle;
(13) A partial peptide of the protein according to (12) above, comprising a partial amino acid sequence corresponding to a region necessary for complex formation with an ecdysone receptor,
(14) The partial polypeptide according to (13), wherein the partial amino acid sequence corresponding to the region necessary for complex formation with the ecdysone receptor is the following amino acid sequence (a) or (b):
(A) a partial sequence from the 149th position to the 400th position of the amino acid sequence represented by SEQ ID NO: 7 in the Sequence Listing;
(B) consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the partial sequence from the 149th to the 400th amino acid sequence represented by SEQ ID NO: 7 in the sequence listing, and is combined with the ecdysone receptor Amino acid sequence that forms the body.
(15) a fusion polypeptide in which the GAL4 activation region comprising the following amino acid sequence (a) or (b) is bound directly or indirectly to the partial polypeptide of (13) or (14) above:
(A) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing;
(B) A polypeptide comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 in the Sequence Listing.
(16) a fusion polypeptide in which a GAL4 DNA binding region comprising the following amino acid sequence (a) or (b) is bound directly or indirectly to the partial polypeptide of (13) or (14) above:
(A) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 3 in the sequence listing;
(B) A polypeptide comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 3 in the sequence listing.
(17) DNA encoding the protein according to (12),
(18) DNA comprising any of the following base sequences (a) to (c):
(A) DNA encoding a novel ultraspiracle consisting of the base sequence represented by SEQ ID NO: 8 in the sequence listing;
(B) DNA encoding a novel ultraspiracle in which one or several bases have been deleted, substituted or added in the base sequence represented by SEQ ID NO: 8 in the sequence listing;
(C) DNA encoding a novel ultraspiracle that hybridizes under stringent conditions with a base sequence complementary to the base sequence represented by SEQ ID NO: 8 in the sequence listing.
(19) DNA encoding the partial polypeptide according to (13),
(20) DNA comprising any of the following base sequences (a) to (c):
(A) DNA encoding a partial polypeptide having the ability to form a complex with an ecdysone receptor comprising a partial sequence from the 603rd to 1361th of the base sequence represented by SEQ ID NO: 8 in the sequence listing;
(B) has the ability to form a complex with an ecdysone receptor in which one or several bases have been deleted, substituted or added in the partial sequence from the 603rd to 1361th of the base sequence represented by SEQ ID NO: 8 in the sequence listing DNA encoding a partial polypeptide;
(C) a partial poly having the ability to form a complex with an ecdysone receptor that hybridizes under stringent conditions with a nucleotide sequence complementary to the nucleotide sequence 603 to 1361 of the nucleotide sequence represented by SEQ ID NO: 8 in the sequence listing DNA encoding a peptide.
(21) A GAL4 activation region consisting of any of the following base sequences (a) to (c) is bound directly or indirectly to the partial polypeptide of the protein according to (13) or (14) above: DNA encoding a fusion polypeptide,
(A) DNA consisting of SEQ ID NO: 5 in the sequence listing;
(B) DNA in which one or several bases are deleted, substituted or added in the base sequence represented by SEQ ID NO: 5 in the sequence listing;
(C) DNA that hybridizes under stringent conditions with a base sequence complementary to the base sequence represented by SEQ ID NO: 5 in the sequence listing.
(22) The GAL4 DNA binding region consisting of the base sequence of any of the following (a) to (c) is bound directly or indirectly to the partial polypeptide of the protein according to (13) or (14). DNA encoding a fusion polypeptide,
(A) DNA consisting of SEQ ID NO: 6 in the sequence listing;
(B) DNA in which one or several bases are deleted, substituted or added in the base sequence represented by SEQ ID NO: 6 in the sequence listing;
(C) DNA that hybridizes under stringent conditions with a base sequence complementary to the base sequence represented by SEQ ID NO: 6 in the sequence listing.
(23) A recombinant vector containing the DNA according to any one of (6) to (11),
(24) A recombinant vector containing the DNA according to any one of (17) to (22),
(25) A transformant obtained by transforming the recombinant vector according to (23) and the recombinant vector according to (24) simultaneously or using either one of them,
(26) A screening method for a compound that regulates molting of Hemiptera using the transformant according to (25),
(27) A screening method for a compound that regulates the molting of hemiptera insects using the protein or partial polypeptide or fusion polypeptide according to any one of (1) to (5) above,
(28) Screening of compounds that control molting of Hemiptera insects using the protein or partial polypeptide according to (1) or (3) and the protein or partial polypeptide according to (12) or (14) Method,
(29) A compound or a salt thereof that controls molting of a hemiptera insect obtained by the screening method according to any one of (26) to (28),
(30) An insecticide comprising, as a main component, a compound that controls molting of a hemiptera insect according to (29),
About.

  According to the present invention, a novel ecdysone receptor gene and a novel ultraspiracle gene derived from brown planthopper are provided. Furthermore, a screening system constructed using them is useful for detecting an ecdysone activity-regulating substance that acts on the brown planthopper. There are no ecdysone activity modulators (non-steroidal compounds) that act on brown planthoppers yet, and activity modulators selected using this screening system have potential as novel insecticides.

  Hereinafter, the present invention will be described more specifically.

  The ecdysone receptor (EcR) of the present invention is a novel protein represented by SEQ ID NO: 1 in the sequence listing. This protein is derived from one species of the Hemiptera insect, Nilaparvata lugens. The one with the highest homology is EcR (gi: 4405799) derived from the straight insect, Locusta migratoria, and the amino acid sequence homology of the E region is 80.9%.

  The ecdysone receptor of the present invention is an amino acid sequence in which one or several amino acids are deleted, substituted or added from the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing and the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing. Includes proteins consisting of sequences. Here, “1 or several” is usually 1 to 30, preferably 1 to 15. This amino acid deletion, insertion, and substitution does not cause loss of protein activity or function. Judgment as to whether a protein has a function as an ecdysone receptor can be evaluated by the screening system of the present invention. That is, the ability of the receptor to bind to the ligand, interact with DNA, interact with ultraspiracle or activate transcription can be assessed.

  The partial polypeptide of the present invention containing a partial amino acid sequence corresponding to the region necessary for binding to ecdysones is at least the E region of the ecdysone receptor of the present invention (from 438 to 662 of SEQ ID NO: 1 in the sequence listing). The polypeptide may be a partial polypeptide of the amino acid sequence shown in SEQ ID NO: 1 including the amino acid sequence, or a polypeptide capable of binding to ecdysones without completely including the E region. The determination of whether or not the ecdysone can be bound can be evaluated by the screening system included in the present invention. That is, it can be assessed by the ability of the receptor to bind to a ligand, interact with DNA in the presence of Ultraspiracle, interact with Ultraspiracle, or activate transcription. The ecdysone refers to a group of compounds having a steroid skeleton such as 20-hydroxyecdysone, ponasterone A and muristerone A and having insect molting hormone activity.

  Other specific examples of the partial polypeptide of the present invention include, for example, the CDEF region of the ecdysone receptor of the present invention (No. 266 to 689 of SEQ ID No. 1 in the sequence listing), the DEF region (No. 332 of SEQ ID No. 1 of the sequence listing). -689), EF region (SEQ ID NO: 1 438-689), DE region (SEQ ID NO: 1 332-662), CDE region (SEQ ID NO: 1 266 of the sequence listing) No. 662). Of these, partial polypeptides containing a DEF region and an EF region are preferred.

  In the fusion polypeptide of the partial polypeptide of the present invention and the GAL4 activation region, the partial polypeptide to be used is, for example, the E region of the ecdysone receptor of the present invention (amino acid sequences from 438 to 662 of SEQ ID NO: 1 in the sequence listing) ), CDEF region (SEQ ID NO: 1 266 to 689), DEF region (SEQ ID NO: 1 332 to 689), EF region (SEQ ID NO: 1 438 to 689) No.), DE region (No. 332 to 662 of SEQ ID No. 1 in the Sequence Listing), and CDE region (No. 266 to 662 of SEQ ID No. 1 in the Sequence Listing). Of these, partial polypeptides containing a DEF region and an EF region are preferred. A specific example of the GAL4 activation region is the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing. In the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing, a polypeptide consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added can be used, but it loses the function of transcriptional activation. is not. The partial polypeptide of the present invention and the GAL4 activation region may be directly bonded, or 1 to 50 amino acids may be bonded therebetween. A specific example of the amino acid of the linking moiety is GGSNQTSLYKKAGSAAAPFT.

  In the fusion polypeptide of the partial polypeptide of the present invention and the GAL4 DNA binding region, the partial polypeptide of the present invention to be used is, for example, the E region of the ecdysone receptor of the present invention (from 438 to 662 of SEQ ID NO: 1 in the Sequence Listing). Amino acid sequence), CDEF region (266 to 689 in SEQ ID NO: 1 in the sequence listing), DEF region (332 to 689 in SEQ ID NO: 1 in the sequence listing), EF region (# 438 in SEQ ID NO: 1 in the sequence listing) -689), DE region (No. 332 to 662 of SEQ ID No. 1 in the sequence listing), CDE region (No. 266 to 662 of SEQ ID No. 1 in the sequence listing). Of these, partial polypeptides containing a DEF region and an EF region are preferred. A specific example of the GAL4 DNA binding region is the amino acid sequence represented by SEQ ID NO: 3 in the sequence listing. In the amino acid sequence represented by SEQ ID NO: 3 in the sequence listing, a polypeptide that consists of an amino acid sequence in which one or several amino acids are deleted, substituted, or added can use a sequence that binds to the GAL4-UAS sequence. The partial polypeptide of the present invention and the GAL4 DNA binding region may be directly bonded, or 1 to 50 amino acids may be bonded therebetween. A specific example of the amino acid at the linking moiety is SNQTSLYKKAGSAAAPFT.

  The DNA of the present invention is a DNA encoding the amino acid sequence represented by SEQ ID NO: 1, consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 1, DNA encoding a protein having a function as an ecdysone receptor. This DNA is derived from one species of the Hemiptera insect, Nilaparvata lugens. The one having the highest homology is EcR (gi: 4405799) derived from the straight insect, Locusta migratoria, and the homology of the base sequence of the E region is 70.8%. Specific examples thereof include DNA represented by the nucleotide sequence of SEQ ID NO: 4 in the sequence listing. The DNA represented by SEQ ID NO: 4 corresponds to the open reading frame (ORF) of the full-length cDNA sequence (SEQ ID NO: 9 in the sequence listing) of the ecdysone receptor derived from brown planthopper. The DNA of the present invention comprises a base sequence represented by SEQ ID NO: 4, wherein one or several bases are deleted, substituted or added, and which encodes a protein having a function as an ecdysone receptor, Also included is a novel DNA shown as DNA that hybridizes under stringent conditions with a base sequence complementary to the base sequence represented by SEQ ID NO: 4.

  Regarding the degree of base deletion, substitution or addition, those having a homology with the original base sequence of 80% or more, preferably 90% or more, more preferably 95% or more are acceptable.

  DNA that hybridizes with a base sequence complementary to the base sequence represented by SEQ ID NO: 4 in the sequence listing under stringent conditions and encodes a protein having a function as an ecdysone receptor includes site-specific mutagenesis and mutation Examples thereof include random mutations due to agent treatment, partial DNA sequence changes due to DNA fragment mutations, deletions, linkages, etc. due to restriction enzyme cleavage. The extent to which these DNA variants hybridize with the DNA shown in SEQ ID NO: 1 is, for example, under stringent conditions, for example, a hybridization solution (50 mM Tris-HCl (pH 7.5), 1 M NaCl, 1% sodium dodecyl sulfate). (10% dextran sulfate, 0.2 mg / mL yeast RNA, 0.2 mg / mL sperm DNA), the membrane to which the gene was bound was incubated at 65 ° C. for 4 hours, and prehybridization was performed. Then, the radiolabeled gene fragment was added so as to have a radioisotope amount of 1 million dpm / mL, and kept at 65 ° C. for 16 hours to perform hybridization. The membrane was diluted with 2 × SSC solution (300 mM NaCl, 30 mM) containing 0.1% sodium dodecyl sulfate. Ene in trisodium) in, at 65 ° C., washed for 30 minutes, O - autoradiography - when analyzed in one in which hybridizes is seen on X-ray film.

  Further, the present invention refers to DNA encoding the partial polypeptide of the present invention, the fusion polypeptide of the present invention, and all of the proteins of the present invention, the partial polypeptide of the present invention and the fusion polypeptide of the present invention can be encoded. Of DNA. Furthermore, one or several bases may be deleted, substituted or added in the base sequences constituting these DNAs, and the base sequences complementary to the base sequences constituting these DNAs are stringent. DNA that hybridizes under conditions is also included. The degree of base deletion, substitution or addition and stringent conditions are the same as described above.

  When the partial polypeptide of the present invention and the GAL4 activation region are indirectly bound, the nucleotide of the linking portion may be any as long as it does not cause a frame shift or encodes a stop codon. The number of connecting portions is 3 to 150. Specific examples of the polynucleotide of the linking moiety include GGTGGGGTCGAATCAAACAAGTTTGTACAAAAAAAGCAGCTCCCGCGGCCGCCCCCTCTCAC.

  When the partial polypeptide of the present invention and the GAL4 DNA binding region are indirectly bound, the nucleotide of the linking portion may be any as long as it does not cause a frame shift or encodes a stop codon. The number of connecting portions is 3 to 150. Specific examples of the linking moiety polynucleotide include TCGAATCAAACAAGTTTGTACAAAAAACAGCGCTCCCGCGGCCGCCCCCCTTCACC. However, specific examples thereof include DNA represented by the nucleotide sequence of SEQ ID NO: 3.

  The ultraspiracle of the present invention is a novel protein represented by SEQ ID NO: 7 in the sequence listing. This protein is derived from one species of the Hemiptera insect, Nilaparvata lugens. The one with the highest homology is the Ultraspiracle (gi: 3393178) derived from the straight insect, Locusta migratoria, and the amino acid sequence homology of the EF region of the Ultraspiracle of the present invention is 76.0%.

  The ultraspiracle of the present invention includes a protein comprising an amino acid sequence in which one or several amino acids have been deleted, substituted or added from the amino acid sequence shown in SEQ ID NO: 7 in the sequence listing. Here, “1 or several” is usually 1 to 30, preferably 1 to 15. This amino acid deletion, insertion, and substitution does not cause loss of protein activity or function. Judgment as to whether a protein has a function as an ultraspiracle can be evaluated by the screening system of the present invention. That is, the protein can be evaluated by its ability to interact with DNA in the presence of an ecdysone receptor, interact with an ecdysone receptor, or activate transcription.

  The partial polypeptide of the present invention is a partial amino acid sequence corresponding to a region necessary for complex formation with a normal ecdysone receptor, and is at least the EF region of the Ultraspiracle of the present invention (of SEQ ID NO: 9 in the Sequence Listing). Or a polypeptide that can form a complex with a normal ecdysone receptor without completely containing the EF region. Determination of whether a protein can form a complex with a normal ecdysone receptor can be evaluated by the screening system of the present invention. That is, the partial polypeptide can be evaluated by the ability to interact with DNA in the presence of ecdysone receptor, interact with ecdysone receptor, or activate transcription.

  Other specific examples of the partial polypeptide of the present invention containing at least a partial amino acid sequence corresponding to a region necessary for complex formation with a normal ecdysone receptor include, for example, the CDEF region (of the sequence listing) of the ultraspiracle of the present invention. And the DEF region (the number 169 to the number 432 of the sequence number 7 in the sequence list). A partial polypeptide containing a DEF region is preferred.

  In the fusion polypeptide of the partial polypeptide of the present invention and the GAL4 activation region, the partial polypeptide of the present invention used is, for example, the EF region of the ultraspiracle of the present invention (No. 172 to 400 of SEQ ID NO: 7 in the Sequence Listing). No. amino acid sequence), CDEF region (83 to 400 in SEQ ID NO: 9 in the sequence listing), and DEF region (149 to 400 in SEQ ID NO: 9 in the sequence listing). . Of these, partial polypeptides containing a DEF region and an EF region are preferred. A specific example of the GAL4 activation region is the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing. In the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing, a polypeptide consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added can be used, but it loses the function of transcriptional activation. is not. The partial polypeptide of the present invention and the GAL4 activation region may be directly bonded, or 1 to 50 amino acids may be bonded therebetween. A specific example of the amino acid of the linking moiety is GGSNQTSLYKKAGSAAAPFT.

  In the fusion polypeptide of the partial polypeptide of the present invention and the GAL4 DNA binding region, the partial polypeptide of the present invention used is, for example, the EF region (corresponding to the amino acid sequence of Nos. 172 to 400 of SEQ ID No. 7 in the Sequence Listing), Examples include a CDEF region (No. 83 to 400 in SEQ ID No. 7 in the sequence listing) and a DEF region (No. 149 to 400 in SEQ ID No. 7 in the sequence listing). Of these, partial polypeptides containing a DEF region and an EF region are preferred. A specific example of the GAL4 DNA binding region is the amino acid sequence represented by SEQ ID NO: 3 in the sequence listing. In the amino acid sequence represented by SEQ ID NO: 3 in the sequence listing, a polypeptide that consists of an amino acid sequence in which one or several amino acids are deleted, substituted, or added can use a sequence that binds to the GAL4-UAS sequence. The partial polypeptide of the present invention and the GAL4 DNA binding region may be directly bonded, or 1 to 50 amino acids may be bonded therebetween. A specific example of the amino acid at the linking moiety is SNQTSLYKKAGSAAAPFT.

  The DNA of the present invention is a DNA encoding the amino acid sequence represented by SEQ ID NO: 7 in the sequence listing, and one or several bases are deleted, substituted or added in the base sequence represented by SEQ ID NO: 7. It also includes DNA encoding a protein consisting of a base sequence and having a function as an ultraspiracle. This DNA is derived from one species of the Hemiptera insect, Nilaparvata lugens. The one with the highest homology is the Ultraspiracle (gi: 3393178) derived from the straight insect, Locusta migratoria, and the base sequence homology of the EF region is 65.6%, which is not so high. Specific examples thereof include DNA represented by the nucleotide sequence of SEQ ID NO: 8 in the sequence listing. The DNA represented by SEQ ID NO: 8 in the sequence listing corresponds to the open reading frame (ORF) of the full-length cDNA sequence (SEQ ID NO: 10) of the yellow spiral plant. The DNA of the present invention encodes a protein comprising a base sequence in which one or several bases are deleted, substituted or added in the base sequence represented by SEQ ID NO: 8 in the sequence listing, and having a function as an ecdysone receptor And a novel DNA shown as a DNA that hybridizes under stringent conditions with a base sequence complementary to the base sequence represented by SEQ ID NO: 8 in the Sequence Listing.

Regarding the degree of deletion, substitution or addition of these bases, homology with the original base sequence is 80% or more, preferably 90% or more, more preferably 95% or more.
Tobiro planta

  A DNA that hybridizes under stringent conditions with a base sequence complementary to the base sequence represented by SEQ ID NO: 8 in the sequence listing and that expresses a protein having a function as an ultraspiral is within the scope of the present invention. belongs to. Such hybridizing DNA mutants include those in which partial DNA sequences are changed by site-directed mutagenesis, random mutation by treatment with a mutagen, mutation, deletion, or ligation of DNA fragments by restriction enzyme cleavage. . The degree of hybridization of these DNA variants with the DNA shown in SEQ ID NO: 1 is, for example, a hybridization solution (50 mM Tris-HCl (pH 7.5), 1 M NaCl, 1% dodecyl sulfate) under stringent conditions. Sodium, 10% dextran sulfate, 0.2 mg / mL yeast RNA, 0.2 mg / mL sperm DNA), the membrane to which the gene was bound was incubated at 65 ° C. for 4 hours, and prehybridase- Then, the radiolabeled gene fragment was added so as to have a radioisotope amount of 1 million dpm / mL, and kept at 65 ° C. for 16 hours to perform hybridization. This membrane was added to a 2 × SSC solution (300 mM NaCl, 30 mM) containing 0.1% sodium dodecyl sulfate. Ene in trisodium) in, at 65 ° C., washed for 30 minutes, O - autoradiography - when analyzed in one in which hybridizes is seen on X-ray film.

  The present invention also refers to DNA encoding the partial polypeptide of the present invention and the fusion polypeptide of the present invention. The protein of the present invention, the partial polypeptide of the present invention, and the fusion polypeptide of the present invention Includes all codeable DNA. Furthermore, one or several bases may be deleted, substituted or added in the base sequences constituting these DNAs, and the base sequences complementary to the base sequences constituting these DNAs are stringent. DNA that hybridizes under conditions is also included. The degree of base deletion, substitution or addition and stringent conditions are the same as described above.

  When the partial polypeptide of the present invention and the GAL4 activation region are indirectly bound, the nucleotide of the linking portion may be any as long as it does not cause a frame shift or encodes a stop codon. The number of connecting portions is 3 to 150. Specific examples of the polynucleotide of the linking moiety include GGTGGGGTCGAATCAAACAAGTTTGTACAAAAAAAGCAGCTCCCGCGGCCGCCCCCTCTCAC.

  When the partial polypeptide of the present invention and the GAL4 DNA binding region are indirectly bound, the nucleotide of the linking portion may be any as long as it does not cause a frame shift or encodes a stop codon. The number of connecting portions is 3 to 150. Specific examples of the linking moiety polynucleotide include TCGAATCAAACAAGTTTGTACAAAAAACAGCGCTCCCGCGGCCGCCCCCCTTCACC.

  The protein of the invention is obtained from a cell or insect that naturally expresses it, obtained from a cell that has been modified to express it (ie, a recombinant), obtained by cell-free protein synthesis, or the art. And can be synthesized using well-known protein synthesis techniques. Preferably, it is produced by a method obtained from recombinant cells, cell-free protein synthesis. These methods will be described later.

  The protein synthesized from the recombinant vector of the present invention includes the protein encoded by the DNA of the present invention, the partial polypeptide of the present invention, and the fusion polypeptide of the present invention. These proteins, partial polypeptides and fusion polypeptides may be operably linked or not operably linked. An example of an operable linkage is an in-frame fusion such that a single protein is produced upon translation. Such a fusion protein facilitates, for example, purification of the recombinant protein. In another embodiment, the fusion protein can include an N-terminal heterologous signal sequence that facilitates its secretion from a particular host cell. Protein expression and secretion can be increased through the use of heterologous signal sequences. Further, a fusion protein with the DNA binding region of GAL4 and a fusion protein with the activation region of GAL4 are also included.

  By constructing a recombinant plasmid containing the DNA of the present invention, it is possible to stably hold the DNA in Escherichia coli and the like. In this case, all commonly used vectors can be used. For example, there are pBluescript KS (+), pGEM-T vector, pGEM-Teasy vector, pENTR TOPO vector and the like. In the examples described below, examples using pGEM-T vector, pGEM-Teasy vector, and pENTR TOPO vector are shown. These plasmids are cleaved with an appropriate restriction enzyme as necessary, and then connected to an appropriate vector, and used for insect cells, yeast, animal cells, cell-free protein synthesis, transgenic animal production, transgenic It can be used as a vector for producing insects, transgenic plants, and the like.

  Examples of vectors that can be used in the present invention include plasmids derived from E. coli (eg, pBR322, pBR325, pUC12, pUC13), plasmids derived from Bacillus subtilis (eg, pUB110, pTP5, pC194), plasmids derived from yeast (eg, pSH19, pSH15), bacteriophage such as λ-phage, animal viruses such as retrovirus, vaccinia virus, baculovirus, etc., pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo, etc. It is done.

  The promoter that can be used in the present invention may be any promoter that is appropriate for the host used for gene expression. For example, when animal cells are used as the host, SRα promoter, SV40 promoter, LTR promoter, CMV promoter, HSV-TK promoter and the like can be mentioned. Of these, the CMV promoter, SRα promoter and the like are preferably used. When the host is yeast, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, etc. are preferable. When the host is an insect cell, examples of the polyhedrin promoter and P10 promoter include OpIE2 promoter, metallothionein promoter, heat shock promoter, fibroin gene promoter, sericin gene promoter, actin gene promoter, and myosin gene promoter. Among them, the heat shock promoter, OpIE2 promoter, and actin gene promoter are preferable.

  In addition to the above, the expression vector contains an enhancer, a splicing signal, a poly A addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40ori) and the like as necessary. Can be used. As a selection marker, for example, a dihydrofolate reductase gene, an ampicillin resistance gene, a neomycin resistance gene, a hygromycin B resistance gene, a blasticidin resistance gene, a zeocin resistance gene, and the like can be used. Commercially available vectors can also be used.

  For insect cells, pMT / V5-His vector, pMT / Bip / V5-His vector, pMT / BioEase-DEST vector, pAc5.1 / V5-His vector, pIB / V5-His vector, pIZ / V5-His Examples include vectors, pIZT / V5-His vectors, pIB / V5-His-TOPO vectors, pIZT / V5-His-DEST vectors (manufactured by Invitrogen).

  Examples of yeast include pDEST22 vector, pDEST32 vector (manufactured by Invitrogen), pGBKT7 vector, pGADT7 vector (manufactured by Clontech).

  Examples of animal cells include pSI vector, pCI vector (Promega), pcDNA-DEST40 vector, pcDNA3.1 / V5-His-TOPO vector, pCR3.1 vector (Invitrogen).

  Examples of the cell-free protein synthesis include pTNT vector (Promega), pBluescript KS (+) (Stratagene).

  The transformant of the present invention can be produced using the vector containing the DNA of the present invention thus constructed. As the host of the transformant of the present invention, for example, Escherichia coli, yeast, insect cells, insects, animal cells and the like are used according to the plasmid to be used.

  Specific examples of transforming Escherichia coli that can be used as a host include JM103 strain, DH5α strain, JA221 strain, HB101 strain, and JM109 strain.

Examples of yeasts that can be used include Saccharomyces cerevisiae AH22, AH22R ⁻ , NA87-11A, DKD-5D, 20B-12, MaV103, MaV203, YRG-2, Y190, and SFY526. When considered as an assay host, MaV103, MaV203, YRG-2, Y190, and SFY526 are preferred.

  Examples of insect cells include Sf9 cells derived from Spodoptera frugiperda, Sf21 cells, Trichoplusia niMG1 cells, High FiveTM cells, BmN cells derived from Bombyx mori, and Drosophila melancocytes, such as Drosophila melansoma cells.

  Examples of insects include silkworm larvae.

Examples of animal cells include monkey cell COS-7, Vero, Chinese hamster cell CHO (hereinafter abbreviated as CHO cell), and dhfr gene-deficient Chinese hamster cell CHO (hereinafter abbreviated as CHO (dhfr ⁻ ) cell). ), Mouse L cells, mouse AtT-20, mouse myeloma cells, rat GH3, human FL cells, HeLa cells, and 293 cells.

  For transforming E. coli, see, for example, Proc. Natl. Acad. Sci. USA, Vol. 69, 2110 (1972) and Gene, Vol. 17, 107 (1982).

  For transformation of yeast, see Methods in Enzymology, 194, 182-187 (1991), Proc. Natl. Acad. Sci. USA, Vol. 75, 1929 (1978).

  Insect cells or insects can be transformed, for example, according to the method described in Bio / Technology, 6, 47-55 (1988).

  In order to transform animal cells, for example, cell engineering separate volume 8 new cell engineering experiment protocol. 263-267 (1995) (published by Shujunsha), Virology, Vol. 52, 456 (1973). Among the methods for transforming insect cells or animal cells, the lipofection method is preferred because it is easy to operate and does not require special equipment, and exhibits high transfection efficiency and high reproducibility. As a transfection reagent that can be used, a commercially available positively charged lipid reagent or the like can be used. For example, Tfx-20 (Promega), Transfast (Promega), LipofectAMINE (Invitrogen), Lipofectin (Invitrogen) ), Cellfectin (manufactured by Invitrogen), TRANSFECTAM (Seikagaku Corporation), and the like, preferably Tfx-20 (manufactured by Promega), and Cellfectin (manufactured by Invitrogen).

  In this way, the transformant of the present invention is obtained.

  When cultivating a transformant whose host is Escherichia coli, a liquid medium is suitable as a medium used for the culture, including a carbon source, a nitrogen source, an inorganic substance and the like necessary for the growth of the transformant. Contains. Examples of the carbon source include glucose, dextrin, soluble starch, and sucrose. Examples of the nitrogen source include ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean cake, and potato extract. Examples of the inorganic or organic substance and inorganic substance include calcium chloride, sodium dihydrogen phosphate, and magnesium chloride. In addition, yeast extract, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5-8.

  Examples of the medium for culturing Escherichia coli include M9 medium containing glucose and casamino acid, LB medium, and SOC medium. Culture is usually performed at about 15 to 43 ° C. for about 3 to 24 hours. Aeration and agitation can also be added.

  When cultivating a transformant whose host is yeast, for example, a YPAD medium or an SC medium can be used as the medium. The SC medium can be made an auxotrophic medium by removing specific amino acids. The pH of the medium is preferably adjusted to about 5-8. The culture is usually performed at about 20 ° C. to 35 ° C. for about 24 to 72 hours, and aeration and agitation are added as necessary.

  When culturing a transformant whose host is an insect cell or an insect, for example, Grace medium, IPL-41 medium, Schneider's Drosophila medium, TC-100 medium, TC-10 medium, IPL-41 medium, TMN-FH Medium, MM medium, MGM443 medium, MGM448 medium, EX-CELL405 medium, M3 (BF) medium, etc. can be used, and 1-30%, preferably 3-20% fetal bovine serum (FBS) is used as necessary. ) Can be added. In addition, it is also possible to use a serum-free medium such as SF-900IISFM medium, Drosophila SFM medium, and Express Five SFM medium. Moreover, it is also possible to add various nutrients, such as amino acids, saccharides, salts, yeast, and lactalbumin hydrolyzate, as necessary. Furthermore, it is possible to add antibiotics such as gentamicin, ampicillin, amphotericin B, penicillin, streptomycin and the like. The pH of the medium is preferably adjusted to about 6-7. The culture is usually performed at about 27 ° C. for about 3 to 5 days, and aeration and agitation are added as necessary.

  When culturing a transformant whose host is an animal cell, examples of the medium include MEM medium, DMEM medium, RPMI 1640 medium, and 199 medium containing about 5 to 20% fetal bovine serum. The pH is preferably about 6-8. The culture is usually performed at about 30 ° C. to 40 ° C. for about 15 to 60 hours, and aeration and agitation are added as necessary.

  As described above, the protein of the present invention can be produced inside or outside the transformant.

  The protein of the present invention can be produced by using a cell-free protein synthesis system. Cell-free protein synthesis is a method in which an expression plasmid is added in a solution having a transcription / translation function in a cell-free system, and the protein is synthesized in the solution. Examples of the solution having a transcription / translation function include rabbit reticulocyte lysate and wheat germ lysate. Rabbit reticulocyte lysate is preferable. Examples of commercially available products include TNT T7 Quick-coupled Transcription / Translation System (manufactured by Promega), TNT SP6 Quick-coupled Transcription System (manufactured by Promega IN), P An expression plasmid can be constructed, for example, by inserting a DNA encoding the target protein into the aforementioned pTNT vector (Promega), pBluescript KS (+) (Stratagene), or the like.

  When extracting the protein of the present invention from cultured cells or cells, after culturing, the cells or cells are collected by a known method, suspended in an appropriate buffer, and subjected to ultrasound, lysozyme and / or freeze-thaw, etc. For example, a method of obtaining a crude extract of the protein of the present invention by centrifugation or filtration after destroying cells or cells by the method is appropriately used. The buffer solution may contain a protein denaturant such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100. Purification of the crude protein extract of the present invention thus obtained can be performed by appropriately combining known separation and purification methods. These known separation and purification methods include mainly molecular weights such as methods utilizing solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis. Method using difference in charge, method using difference in charge such as ion exchange chromatography, method using specific affinity such as affinity chromatography, and difference in hydrophobicity such as reverse phase high performance liquid chromatography A method using a difference in isoelectric point, such as a method, isoelectric focusing method, or the like is used. For protein purification, for example, “Protein Experiment Handbook” (Yodosha) is described.

  The screening method for the compound that controls molting of Hemiptera using the transformant of the present invention may be any screening method that can be performed using the transformant, and includes, for example, reporter gene assay, two-hybrid assay, etc. It is.

  The reporter gene assay in the screening method of the present invention can be used as a screening system for insecticides using transcription activation and transcription repression by an ecdysone activity modulator as an index. For example, by introducing a vector expressing ecdysone receptor, a vector expressing ultraspiracle and a reporter vector simultaneously into a host cell, then administering the compound and measuring the activity of the expressed reporter protein after a certain time, Like activity regulators can be discovered. When the host cell is an insect cell, the vector expressing the ecdysone receptor and the reporter vector are simultaneously introduced into the host cell, then the compound is administered, and the activity of the expressed reporter protein is measured after a certain time. An ecdysone-like activity regulator can be discovered. It is also possible to use only cells containing a screening vector by culturing transformed cells prepared by introducing the expression vector into a host cell in advance together with a selective agent. These cells may be used for screening as they are, or may be used for screening after being prepared as a single cell line by cloning. The host cell is preferably an insect cell or an animal cell. In this embodiment, an example using insect cells is shown.

  When an insect cell is used as a host cell, the insect cell may also produce an ecdysone receptor derived from the insect cell. Even in this case, since the ecdysone receptor derived from the introduced expression vector (that is, from brown planthopper) is expressed more, the insect cell can be used for the reporter gene assay. It can also be determined by comparing with the reporter protein activity when only the reporter vector is introduced into the insect cells used.

  As a reporter vector that can be used in the screening method of the present invention, for example, a vector having an ecdysone response element (EcRE), a promoter and a reporter gene as described in JP-A-2002-291489 can be used. As the reporter gene, β-galactosidase, luciferase and the like can be used, but luciferase having high detection sensitivity is preferred. The ecdysone response element refers to a DNA sequence that can be recognized by a complex composed of ecdysone-ecdysone receptor-ultraspiracle. For example, GGTTCA-A-TGCACT, and a DNA fragment containing this sequence can be easily synthesized by a known synthesis method.

  The compound that can be used for this screening may be, for example, a synthesized compound or a microbial secondary metabolite. Moreover, a low molecular compound may be sufficient and a high molecular compound like polypeptide may be sufficient.

  The two-hybrid assay in the screening method of the present invention is a screening system for compounds that control the molting of hemiptera insects using as an index the influence of the ecdysone activity modulator on the interaction between the ecdysone receptor and ultraspiracle. For example, yeast, insect cells, and animal cells can be used as host cells. For example, ProQuest Two-Hybrid System with Gateway Technology (manufactured by Invitrogen), MATCHMAKER GAL4 Two-Hybrid System 3 (manufactured by Clontech), HybridZAD 2.1Ty 2.1 The assay system can also be constructed using commercially available kits such as (Stratagene), DupLEX-A yeast Two-Hybrid System (Takara Bio). In the Example described below, the example which uses yeast as a host cell is shown. The yeast two-hybrid assay can be performed by following the method described in “Protein Experiment Handbook” (Yodosha) and “Two-Hybrid that can be used in Bio Experiment Illustrated 7” (Shyujun).

Specifically, the following examples can be given.
(A) the GAL4 DNA binding region and the DEF region (No. 332 to 689 of SEQ ID NO. 1) or the EF region (No. 438 to No. 689 of SEQ ID NO. 1), which is a partial polypeptide of the ecdysone receptor of the present invention, or A vector that expresses a fusion protein with the DE region (No. 332 to 662 of SEQ ID No. 1) or the E region (amino acid sequence of Nos. 438 to 662 of SEQ ID No. 1) is constructed. (For example, it can be constructed by incorporating DNA encoding the partial polypeptide into pDEST32 (Invitrogen));
(B) Fusion protein of GAL4 activation region and Ultraspiracle DEF region (SEQ ID NO: 7 from 149 to 400) or EF region (corresponding to amino acid sequence from SEQ ID NO: 172 to 400) A vector that expresses is constructed. (For example, it can be constructed by incorporating DNA encoding the partial polypeptide into pDEST22 (Invitrogen));
(C) The expression vector of (A) or (B) is introduced into a host yeast (for example, MaV103, MaV203 (both manufactured by Invitrogen)) into which a GAL4-inducible reporter gene is incorporated to produce a transformed yeast. The plasmid introduction method includes a protoplast method, a lithium acetate method, an electroporation method and the like, and the lithium acetate method is desirable.
(D) An ecdysone-like activity-regulating substance can be found by measuring the activity of the expressed reporter protein after culturing the transformed yeast of (C) for a certain period of time in the presence of a test compound. As the reporter gene, β-galactosidase, luciferase and the like can be used. ;

(E) Fusion protein of DNA binding region of GAL4 and Ultraspiracle DEF region (SEQ ID NO: 7 from No. 149 to 400) or EF region (corresponding to amino acid sequence of SEQ ID NO: 7 from No. 172 to 400) A vector that expresses is constructed. (For example, it can be constructed by incorporating DNA encoding the partial polypeptide into pDEST32 (Invitrogen));
(F) the activation region of GAL4 and the DEF region (the number 332 to 689 of SEQ ID NO: 1) or the EF region (the number 438 to 689 of SEQ ID NO: 1) which is a partial polypeptide of the ecdysone receptor of the present invention, or A vector that expresses a fusion protein with the DE region (No. 332 to 662 of SEQ ID No. 1) or the E region (amino acid sequence of Nos. 438 to 662 of SEQ ID No. 1) is constructed. (For example, it can be constructed by incorporating DNA encoding the partial polypeptide into pDEST22 (Invitrogen));

(G) The expression vectors of (A) and (B) are introduced into a host yeast (for example, MaV103 and MaV203 (both manufactured by Invitrogen)) into which a GAL4-inducible reporter gene has been incorporated to produce a transformed yeast. The plasmid introduction method includes a protoplast method, a lithium acetate method, an electroporation method, etc., but the lithium acetate method is desirable;
(H) An ecdysone-like activity-regulating substance can also be found by measuring the activity of the expressed reporter protein after culturing the transformed yeast of (C) for a certain period of time in the presence of a test compound. The compound that can be used for this screening may be, for example, a synthesized compound or a microbial secondary metabolite. Moreover, a low molecular compound may be sufficient and a high molecular compound like polypeptide may be sufficient.

  Further, instead of the above-described two-hybrid system using the GAL4 system, the LexA-B42 system can be used in the same manner.

  Examples of the screening method for compounds that control molting of hemiptera using the ecdysone receptor, the partial peptide or fusion polypeptide of the ecdysone receptor of the present invention include a ligand binding assay. Ligand binding assays are described, for example, in Eur. J. et al. Biochem. 270, 4095-4104 (2003). Examples of radioisotope-labeled ligands that compete with test compounds include ecdysone labeled with radioisotopes, 20-hydroxyecdysone, ponasterone A, muristerone A, and the like. For example, ponasterone A labeled with tritium is used. Is possible.

  Examples of the screening method for compounds that control molting of Hemiptera using the protein and partial polypeptide of the present invention include gel shift assay.

  The protein and partial polypeptide of the present invention used in the screening method of the present invention can be obtained by the above-mentioned cell-free protein synthesis, extraction from transformed host cells, extraction from leafhopper plant bodies, and the like. The crudely purified product may be used as it is, or the purified protein or polypeptide may be used.

  The gel shift assay can be performed, for example, by the method described in “Protein Experiment Handbook” (Yodosha), Nature, 366, 476-479 (1993). Moreover, LightShift Chemiluminescent EMSA Kit (made by PIERCE) can also be used. In the gel shift assay of the present invention, an ecdysone receptor or a partial polypeptide thereof is allowed to interact with ultraspiracle or a partial polypeptide thereof in a buffer, and then a labeled ecdysone response element, and in some cases, an unlabeled ecdysone response element at the same time. In addition, a binding reaction is performed, followed by fractionation by electrophoresis, and the labeled ecdysone response element is detected. When an ecdysone response element binds to a protein, migration by electrophoresis becomes slow, and a band shift appears there.

  Any of the ecdysone receptor or a partial polypeptide thereof can be used in the gel shift assay, but the ecdysone receptor is preferably used. Any of Ultraspiracle or a partial polypeptide thereof can be used in the gel shift assay, but Ultraspiracle is preferably used.

  The ecdysone response element used in the gel shift assay may be any sequence that binds to the ecdysone receptor-ultraspiracle complex. For example, hsp27, Pal-1, and DR-4 shown below can be used. These ecdysone responsive elements can be labeled with a radioisotope for detection or labeled with biotin.

hsp27: ACGCGGTGACAAGTGCATTTGAACCCTTGTC
Pal-1: GATCTAGAGAGGTCAATGACCTCGTCC
DR-4: GATCCGTAGGGGTCACGAAAGGTCACTCGA

  The compound obtained by using the screening method of the present invention or a salt thereof is a compound having an action of changing the expression level of gene expression induced by ecdysone in an insect body. Specifically, (a) Compounds that control the growth of insects such as molting by increasing the expression level of gene expression induced by ecdysones; (b) Insects such as molting by reducing the expression level of gene expression induced by ecdysones It is a compound that controls the growth of

  Examples of the compound include peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products and the like, and these compounds may be novel compounds or known compounds.

By using the protein, partial polypeptide, partial peptide, DNA, and vector of the present invention, a method for regulating the expression of a target exogenous gene or endogenous gene in a host organism can be provided. For example,
(I) a vector comprising an ecdysone response element and an exogenous gene or an endogenous gene;
(Ii) a vector expressing either the ecdysone receptor of the present invention, or a partial polypeptide comprising the DNA binding region and the ligand binding region thereof, and (iii) ultraspiracle, or the DNA binding region and the ligand binding region thereof. A method for regulating the expression of an exogenous gene or an endogenous gene of interest by introducing a vector that expresses any of the partial polypeptides comprising a host organism and administering a compound that acts on the ecdysone receptor. When a compound that acts on an ecdysone receptor is administered to a host organism, it is expressed in the host organism by the introduced vectors (ii) and (iii), or (II) an ecdysone receptor, or a DNA binding region and a ligand binding region thereof. A complex of the partial polypeptide and (III) ultraspiral, or a partial polypeptide comprising its DNA binding region and its ligand binding region binds to and activates the administered compound. The activated complex increases the expression of an exogenous gene or an endogenous gene existing downstream of the ecdysone response element by binding to the ecdysone response element on the vector (i) introduced in that state. Although there is no restriction | limiting in particular as this compound, A peptide, protein, a non-peptidic compound, a synthetic compound, a fermentation product etc. are mention | raise | lifted, These compounds may be a novel compound, Even if it is a well-known compound, Good.

  Furthermore, when a compound that specifically acts on the ecdysone receptor of the present invention or a partial polypeptide containing its DNA binding region and ligand binding region is used, a specific gene regulation system dependent on the ecdysone receptor of the present invention is provided. can do. Although there is no restriction | limiting in particular as this compound, A peptide, protein, a non-peptidic compound, a synthetic compound, a fermentation product etc. are mention | raise | lifted, These compounds may be a novel compound, Even if it is a well-known compound, Good.

  When using the compound of the present invention that controls the molting of hemiptera insects, the compound of the present invention may be used as it is, but a carrier generally used for formulation as a pesticide adjuvant, a surfactant, Emulsions, suspensions, powders, granules, tablets, wettable powders, water solvents, liquids, flowable powders, granule wettable powders, aerosols, pastes, oils, emulsions It can be formulated in various forms. These compounding ratios are usually 0.1 to 9.0 parts by mass of the active ingredient and 10 to 99.9 parts by mass of the agrochemical adjuvant.

  Carriers used in the formulation herein are classified into solid carriers and liquid carriers. Examples of solid carriers include animal and vegetable powders such as starch, activated carbon, soybean powder, wheat flour, wood powder, fish powder, and milk powder, minerals such as talc, kaolin, bentonite, calcium carbonate, zeolite, diatomaceous earth, white carbon, clay, and alumina. A powder is mentioned. Examples of the liquid carrier include water, alcohols such as isopropyl alcohol and ethylene glycol, ketones such as cyclohexane and methyl ethyl ketone, ethers such as dioxane and tetrahydrofuran, aliphatic hydrocarbons such as kerosene and light oil, xylene, trimethylbenzene, Aromatic hydrocarbons such as tetramethylbenzene methylnaphthalene and solvent naphtha, halogenated hydrocarbons such as chlorobenzene, acid amides such as dimethylacetamide, esters such as glycerol ester of fatty acid, nitriles such as acetonitrile dimethyl sulfoxide, etc. And sulfur-containing compounds.

  Examples of the surfactant include alkylbenzene sulfonic acid metal salt, dinaphthylmethane disulfonic acid metal salt, alcohol sulfate ester salt, alkylaryl sulfonate, lignin sulfonate, polyoxyethylene glycol ether, polyoxyethylene alkylaryl ether, Examples include polyoxyethylene sorbitan monoalkylate.

  Other adjuvants include, for example, carboxydimethylcellulose, gum arabic, sodium alginate, guar gum, tragacanth gum, polyvinyl alcohol and other sticking agents or thickeners, metal soap and other antifoaming agents, fatty acids, alkyl phosphates, silicones Further, physical property improvers such as paraffin, colorants, and the like can be used.

  In actual use of these preparations, they can be used as they are or after diluting to a predetermined concentration with a diluent such as water. Various preparations containing the compound of the present invention, or the application of the diluent thereof, are usually applied in general, that is, spraying (for example, spraying, misting, atomizing, dusting, dusting, water surface Application, box application, etc.), soil application (for example, mixing, irrigation, etc.), surface application (for example, application, dressing, coating, etc.), immersion, poison bait, and the like. It is also possible to give the above-mentioned active ingredients to livestock in a mixed manner to control the occurrence and growth of harmful insects, particularly harmful insects, in their excreta. It can also be applied by the so-called ultra-high concentration small quantity spraying method. In this method, it is possible to contain 100% of the active ingredient.

  The compound of the present invention for controlling the molting of hemiptera insects is generally applied at an active ingredient concentration of 0.1 to 50000 ppm, preferably 1 to 10000 ppm.

  The active ingredient concentration can be appropriately changed according to the form of the preparation and the application method, purpose, time, place and occurrence of pests. For example, in the case of aquatic pests, the active ingredient concentration in water is less than or equal to the above because it can be controlled by spraying a chemical solution in the above concentration range to the generation site. Although 0.1 to 5000 g, preferably 1 to 1000 g is used as an active ingredient compound per 10 alarms, it is not limited thereto.

  Needless to say, the compound of the present invention alone is sufficiently effective, but if necessary, other fertilizers and agricultural chemicals such as insecticides, acaricides, nematicides, bactericides, and antiviral agents. These can be used in combination with or in combination with attractants, herbicides, plant regulators, and the like, and in this case, a more excellent effect may be exhibited.

  The compounds of the present invention include, for example, hemiptera pests, lepidopterous pests, coleopterous pests, diptera pests, hymenopterous pests, straight pests, termite pests, thrips pests, spider mites, and plant parasitic Excellent control effect against nematodes. The compound of the present invention exhibits an excellent control effect against other harmful animals, unpleasant animals, sanitary pests and parasites, and can be used as an insecticide.

  Examples of the Hemiptera pests include Riptortus clavatus, Neraza viridula, Lygus sp., Phellinus sect. Leafhoppers (Heteroptera), leafhoppers (Nilaparvata lugens), leafhoppers (Empoasca sp., Erythronafera sp.) triatellus) planthoppers such as, Psylla sp. Whitefly (Bemisia tabaci), whitefly (Trialeurodes vapariorium), whitefly, Vineusvitifosii, peach aphid Aphis, Bacillus aphid (Aphicorthum solani), Aphis sect. and other scale insects such as Oplastesrubens, Santoze scale insects (Comstockcaspis perniciosa), and scale insects (Rondnius sp.).

  As Lepidoptera, for example, Chahamaki (Homona magnanima), Kokakumonhamaki (Adoxophyes orana), Tenguhamaki (Sparganothis pilleriana), oriental fruit moth (Grapholita molesta), soybean pod borer, Leguminivora glycinivorella (Leguminivora glycinivorella), codling moth (Laspeyresiapomonella), Eucosma sp. , Lobesia botrana, etc., Grape lobster (Eupoecilia ambiguella), etc., Bambalina sp. Minoga, such as Nempogon granellus, Hirosukoga such as Tineapellionella, Clamidae such as Lyonetia prunifoliella, Phyllonarycter, etc. Stag beetles such as scallops, Plutella xylostella, and Plays citri, Nokona vegale, Synanthedon sp. Such as Sashiba, Cotton worm (Pectinophora gossypiella), Potato moth (Phthromaeaoperculella), Stomopteryx sp. Mosquito, such as Carposina nipponensis, moths such as Monema flavescens, Chilo suprasisalis haisariis, nascent moths, Hellula undalis) Honey moth (Galleria melonella), Elasmopalpus lignosellus, Loxostige typalis, etc., White butterflies (Pieris rapae), etc. narcia, etc., octopus moth (Malacosomananeustria), suzumegas such as Manduca sexta, eudocis uridae, Lymantria sp. Tobacco budworm (Heliothis virescens), Borwaum (Helicoverpa zea), Sirodomora sasa (Spodoptera armigera), Helicoverpa armigera (Agrotis ipsilon), Agayoto (Pseudaletia sepata), and nettles (Trichoplusia ni) and other moths.

  Coleoptera, for example, Anomala cuprea, Popularia japonica, Anomala rubocoupres, N. sp., Euthelarugicus sp. Click beetle such etc., the beetle, Epilachna vigintioctopunctata (Epilachna vigintioctopunctata), Ladybug such as kidney ladybird (Epilachna varivestis), mealworm such as red flour beetle (Tribolium castaneum), Gomadarakamikiri (Anoplophora malasiaca), Japanese pine sawyer (Monochamus alternatus), etc. Longhorn beetles, bean weevil (Acanthoscelides obectus), beetle weevil (Callosobrchuchus chinensis), etc., Colorado potato beetle (Leptinotarsa dece Mlineta), corn iabrotica sp.), Inedorooimushi (Oulema oryzae), Ten site bi potato beetle (Chaetocnema concinna), Phaedon cochlearias, Oulema melanopus, beetle such as Dicladispa armigera, bombardier Cu Chi weevils such as Apion godmani, rice water weevil (Lissorhoptrus oryzophilus), boll weevil Examples include weevil such as (Anthonymus grandis), weevil such as weevil (Sitophilus zeamais), bark beetles, cutworm worms, and beetles.

  Diptera pests include, for example, Tipura aino, Chironus oryzae, eu kiri, eu sigma flies (Orseolia oryzae), eu sigma flies Fritz fries (Oscineella frit), rice flies (Chlorops oryzae), common beetle (Ophiomyia phaseioli), bean winged flies (Liriomyza trifolii), papaver moth (Pegomae) Fly (Atherigona soccata), housefly (Musca domestica), stable flies (Gastrophilus sp.), Stable fly (Stomoxys sp.), Aedes aegypti (Aedes aegypti), Culex (Culex pipiens), Anopheles sinensis (Anopheles slnensis) and Culex (Culex tritaeniorhynchus) is Can be mentioned.

  Examples of Hymenoptera include Caspus sp., Harmolita sp., Athala rosae, Vespa mandrina and fire ant.

  Examples of the straight insects include German cockroaches (Blatella germanica), American cockroaches (Periplaneta americana), Kera (Gryllotalpa africana), Grasshoppers and Locusta migratory migratory migratory migratory.

  As Thysanoptera, for example, yellow tea thrips (Scirtothrips dorsalis), Thrips palmi (Thrips palmi), Croton thrips (Heliothrips haemorrhoidalis), western flower thrips (Frankliniella occidentalis) and rice Kuda thrips (Haplothripsaculeatus) and the like.

Tick mites (Tetanychus urticae), Kanzawa spider mite (Tetranychus kanzawai), citrus spider mite (Pananychus citrus), tick mite (Pananychus ulmiet), yellow-tick (Etetrancite) Pelekassi, Polyphagotarsonemus latus, Scarlet mite (Brevipalpus sp.), Robin tick (Rhizoglyphus robini), and Tyrophagus putresenta. .

  Examples of plant parasitic nematodes include, for example, Meloidogyne incognita, Pratylenchus sp. Can be mentioned.

  Other pests, unpleasant animals, sanitary pests and parasites include, for example, gastropods such as Pomacea canalicula, slugs (Inciliaria sp.), Achatina falica, armadillium (Armadillidium) sp.), Isopoda such as Warabimushi and Centipede (Isopoda), Liposcelis sp. Chatteramushi such as Ctenolepisma sp. Stains such as Pulex sp. Ctenocephalides sp. Fleas such as Trichodes sp. Lice, etc., Cimex sp. And other animal parasitic mites, leopard mites, and the like, such as bed bugs such as Bophilus microplus and Haemaphysalis longicornis.

  Hereinafter, the present invention will be described in more detail with reference to examples. In Examples, “part” means “part by weight” and “%” means “% by weight”. Primers were obtained from Invitrogen. In the primer sequences, Y represents C or T, R represents A or G, N represents any of the four bases, K represents A or C, and I represents an inosine residue.

Example 1 Determination of full-length sequence of ecdysone receptor (EcR) derived from green planthopper (Nilaparvata lugens) From Japanese planthopper (Nilaparavata lugens), Quick Prep micro mRNA Purification Kit (manufactured by Amersham Biosciences, Inc., using its protocol) did. From this mRNA solution, according to the protocol of SMART RACE cDNA Amplification kit (Clontech), cDNA synthesis was performed using 3′-CDS attached to the kit as a primer to obtain 3′-RACE Ready cDNA. Using this 3′-RACE Ready cDNA as a template, PCR was carried out using a degenerate primer of an EcRf1 primer (encoding the amino acid sequence QEELCLV) and an EcRr2 primer (encoding the amino acid sequence CSSEVMM in the reverse direction). PCR uses EX Taq polymerase (manufactured by Takara Bio Inc.) as an enzyme, and after heating at 95 ° C for 1 minute, 95 ° C (30 seconds), 52 ° C (30 seconds), 72 ° C (1 minute 30 seconds) One cycle was performed under the condition that 35 cycles were amplified. The obtained PCR product was purified by gel filtration using Sephacryl S-300HR (manufactured by Amersham Biosciences), and PCR was performed again using this as a template. PCR uses an EcRf3 primer (encoding the amino acid sequence SGYHYNA) and an EcRr5 primer (encoding the amino acid sequence CQECRLKKC in the reverse direction) and using EX Taq polymerase (manufactured by Takara Bio Inc.) as an enzyme. The sample was heated at 95 ° C. for 1 minute and then subjected to amplification under 35 cycles, with 95 ° C. (30 seconds), 48 ° C. (30 seconds) and 72 ° C. (1 minute 30 seconds) as one cycle. This DNA solution was fractionated by 2.5% agarose electrophoresis, and a portion of about 100 to 200 bp was extracted and purified. Purification was performed using QIAquick Gel Extraction Kit (manufactured by Qiagen) according to the protocol. This purified DNA was subjected to TA cloning using pGEM-T Vector System I (manufactured by Promega) according to the protocol, and the nucleotide sequence (corresponding to the number 870 to number 981 of the entire nucleotide sequence (SEQ ID NO: 9 in the sequence listing)) It was determined. Next, primers are designed in the determined base sequence, 5′RACE and 3′RACE are performed using SMART RACE cDNA Amplification Kit (Clontech), and pGEM-T Vector SystemI (Promega) is used. According to the protocol, TA cloning was performed, and the base sequence (No. 1260 to No. 1370 of the full-length sequence (SEQ ID No. 9 in the sequence listing)) was determined. The base sequence was determined as follows. Direct PCR was performed using EX13q polymerase (manufactured by Takara Bio Inc.) as an enzyme using M13 forward primer and M13 reverse primer as colonies of transformed Escherichia coli obtained after cloning, and 95 ° C (30 after heating at 90 ° C for 10 minutes). Second), 55 ° C. (30 seconds), 72 ° C. (2 minutes) for 30 cycles), and the resulting PCR product was purified by gel filtration using Sephacryl S-300HR (Amersham Biosciences), Furthermore, using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), sequencing reaction was performed under the conditions described in the kit, and ABI PRISM 3700 DNA Analyzer (Applied Biosis) And the nucleotide sequence was determined by made by James, Inc.). The sequences of the degenerate primer, M13 forward primer, and M13 reverse primer used are as shown below.

EcRf1: CARGARGARTTRTGYYTNCT
EcRr2: CATCATNACYTCRCTNGARCA
EcRf3: TCSGGNTAYCAYTAYAAYGC
EcRr5: CAYTYTTIARICGRCAYTCYTGRCA

  3'RACE was performed under the following conditions. That is, in the first PCR, the above-mentioned 3′-RACE Ready cDNA was used as a template, NlEcRf1 primer (corresponding to 1263 to 1282 of the entire base sequence (SEQ ID NO: 9 in the sequence listing)) as a primer, and a kit Using UPM primer, LA Taq polymerase (manufactured by Takara Bio Inc.) as an enzyme, heating at 95 ° C for 1 minute, then 95 ° C (30 seconds), 58 ° C (30 seconds), 72 ° C (5 minutes) One cycle was performed under the condition of 35 cycles of amplification. Nested PCR was performed by gel filtration purification using Sephacryl S-300HR (manufactured by Amersham Biosciences) as a template, and NlEcRf2 primer (all 1307 to 132 of the base sequence (SEQ ID NO: 9 in the sequence listing) No.) and the NUP primer attached to the kit. After heating at 95 ° C for 1 minute, 95 cycles (95 ° C (30 seconds), 58 ° C (1 minute), 72 ° C (5 minutes)) are performed for 35 cycles I went under the condition of doing. This DNA solution was fractionated by 1.5% agarose electrophoresis, and a portion of about 1400 to 1600 bp was extracted and purified. Purification was performed using QIAquick Gel Extraction Kit (manufactured by Qiagen) according to the protocol. This purified DNA was subjected to TA cloning according to the protocol using pGEM-T Vector System I (Promega), and the nucleotide sequence (corresponding to Nos. 1327 to 2842 of the entire nucleotide sequence (SEQ ID No. 9 in the sequence listing)) It was determined. The method for determining the base sequence is as described above. The primer sequences used are shown below.

NlEcRf1: ACTTGGTGAAGGGTGCAAAGG
NlEcRf2: GAACCGCGTCTACCAATGCA

  5'RACE was performed under the following conditions. First, using NlEcRr1 primer (corresponding to the reverse strand of No. 1342 to No. 1366 of the entire base sequence (SEQ ID No. 9 in the sequence listing)) as a template, using the mRNA solution prepared from the brown planter as a template, in the presence of SMARTII oligonucleotide attached to the kit Then, 5′-RACE Ready cDNA was synthesized using SuperScript II reverse transcriptase (manufactured by Invitrogen) as the enzyme. Using this as a template, NlEcRr2 primer (corresponding to the reverse strands of Nos. 1310 to 1334 of the entire base sequence (SEQ ID No. 9 in the sequence listing)) and UPM primer attached to the kit as primers, and LA Taq polymerase as the enzyme (TAKARA BIO INC.) 1 minute under the condition that 35 cycles are amplified with 95 ° C (30 seconds), 55 ° C (1 minute), 72 ° C (4 minutes) as one cycle after heating at 95 ° C for 1 minute. The first PCR was performed, and the nested PCR was performed by gel filtration purification using Sephacryl S-300HR (manufactured by Amersham Biosciences) as a template, and NlEcRr3 primer (total nucleotide sequence (sequence of sequence listing) was used as a primer. No. 9) corresponding to the reverse chain of Nos. 1290 to 1314) and the NUP plastic attached to the kit With Ma, after 1 minute heating at 95 ° C., 95 ° C. (30 sec), 55 ° C. (1 minute), 72 ° C. (4 minutes) as one cycle, it was conducted on the condition that the 35 cycles of amplification. This DNA solution was fractionated by 1.5% agarose electrophoresis, and a portion of about 400 bp was extracted and purified. Purification was performed using QIAquick Gel Extraction Kit (manufactured by Qiagen) according to the protocol. This purified DNA was subjected to TA cloning using pGEM-T Vector System I (manufactured by Promega) according to the protocol, and the base sequence (corresponding to the 929th to 1289th positions of the entire base sequence (SEQ ID NO: 9 in the sequence listing)) It was determined. The method for determining the base sequence is as described above. The primer sequences used are shown below.

NlEcRr1: CTCCGCATATACATGTCGATCTGC
NlEcRr2: GCCGTTATTGCATTGGTAGACCGCG
NlEcRr3: CCCGCGTTCTTTGTTATCCTTCTCCG

  Since the 5 ′ end could not be analyzed, 5 ′ RACE was performed again. That is, 5'-RACE Ready cDNA was used as a template, and the NlEcRr2 primer (corresponding to the reverse strand of Nos. 1310 to 1334 of the entire base sequence (SEQ ID No. 9 in the sequence listing)) and the UPM primer attached to the kit were used as primers. Using LA Taq polymerase (manufactured by Takara Bio Inc.) as an enzyme, heating at 95 ° C. for 1 minute, then 95 ° C. (30 seconds), 46 ° C. (30 seconds), 72 ° C. (2 minutes) as one cycle 3 Cycle, then 95 ° C. (30 seconds), 48 ° C. (30 seconds), 72 ° C. (2 minutes) as 3 cycles, then heated at 95 ° C. for 1 minute, then 95 ° C. (30 seconds), 50 ° C. 30 seconds), 72 ° C. (2 minutes) as one cycle and 20 cycles, amplification is performed for the first time, and nested PCR is used as a template for Sephacryl. Using the first PCR product purified by gel filtration using -300HR (manufactured by Amersham Biosciences), NlEcRr4 primer (primary nucleotide sequence (SEQ ID NO: 9 in the sequence listing)) from the 1091st to 1110th reverse strands Equivalent) and the NUP primer attached to the kit, after heating at 95 ° C. for 1 minute, 95 ° C. (30 seconds), 46 ° C. (30 seconds), 72 ° C. (2 minutes) as 1 cycle, 3 cycles, C. (30 seconds), 48.degree. C. (30 seconds), 72.degree. C. (2 minutes) as 3 cycles, then heated at 95.degree. C. for 1 minute, then 95.degree. C. (30 seconds), 50.degree. C. (30 seconds), 72. The test was carried out under the condition that amplification was carried out for 20 cycles, with the cycle of 2 ° C. This DNA solution was purified by gel filtration using Sephacryl S-300HR (Amersham Biosciences). This purified DNA was subjected to TA cloning according to the protocol using pGEM-T Vector System I (Promega), and the nucleotide sequence (corresponding to Nos. 1 to 1090 of the entire nucleotide sequence (SEQ ID No. 9 in the Sequence Listing)) It was determined. The method for determining the base sequence is as described above. The primer sequences used are shown below.

NlEcRr4: GCGAACTGGGGGGGTGACAGG

  The four clones obtained as described above were overlapped (Geneticx ver. 7) to determine the full-length sequence of the eddyson receptor cDNA derived from the brown planthopper (SEQ ID NO: 9 in the sequence listing).

Example 2 Preparation of the ecdysone receptor (EcR) gene derived from the leafhopper planthopper (Nilaparvata lugens) From the determined full-length eddyson receptor cDNA sequence from the planthopper planthopper, the amino acid sequence of other insect ecdysone receptors (for example, the ecdysone from the locust migratoriaceptor (the ecdysone derived from Locusta migratoria ceptor) : 4405799)), an open reading frame (ORF) was estimated, and the primers described below were designed and subjected to two rounds of PCR, followed by ORF of the ecdysone receptor (EcR) derived from Nilaparvata lugens. -I got.

  That is, the first PCR uses 3′-RACE Ready cDNA described in Example 1 as a template, NlEcRORFf1 primer (corresponding to 322 to 337 of the entire base sequence (SEQ ID NO: 9 in the sequence listing)) as a primer, and Using NlEcRORFr1 primer (corresponding to the reverse strands of 2510 to 2527 of the entire base sequence (SEQ ID NO: 9 in the sequence listing)), KODplus polymerase (manufactured by Toyobo Co., Ltd.) as an enzyme, and heated at 95 ° C. for 1 minute , 95 ° C. (30 seconds), 57 ° C. (30 seconds), 68 ° C. (2 minutes), with one cycle being performed under the condition that amplification is performed for 30 cycles, and nested PCR is Sephacryl S-300HR (manufactured by Amersham Biosciences) as a template. The first PCR product purified using RORFf2 primer (added base sequence corresponding to positions 420 to 436 of the entire base sequence (SEQ ID NO: 9 of the sequence listing) downstream of CACC) and NlEcRORFr2 primer (total base sequence (SEQ ID NO: 9 of the sequence listing) of GCGGCCGC) ) No. 2473 to No. 2489, and a KODplus polymerase (manufactured by Toyobo Co., Ltd.) as an enzyme, heated at 95 ° C. for 1 minute, 95 ° C. (30 seconds), 57 cycles (57 seconds (30 seconds) and 68 ° C. (2 minutes)) were performed under the condition that amplification was performed for 30 cycles. This DNA solution was treated at 95 ° C. for 20 minutes, and after cooling, 2 mM dATP solution and EX Taq polymerase (manufactured by Takara Bio Inc.) were added and reacted at 70 ° C. for 15 minutes to add an adenine residue. Thereafter, gel filtration purification was performed using Sephacryl S-300HR (manufactured by Amersham Bioscience). The primer sequences used are shown below.

NlEcRORFf1: CTCCACAAGTTATAG
NlEcRORFr1: GTTAACAAGTCTTTACAC
NlEcRORFf2: CACCATGGAGCTAAAATGGC
NlEcRORFr2: GCGGCCGTTTATGAAGTCGATGATG

  Subsequently, TA cloning was performed according to the protocol of pGEM-Teasy Vector System I (manufactured by Promega), the base sequence was confirmed, and a pGEM-Teasy / NlEcRORF vector containing the green plant ecdysone receptor ORF sequence was obtained. The method for determining the base sequence is the same as in Example 1.

Example 3 Determination of full-length sequence of ultraspiracle (USP) derived from leafhopper plant (Nilaparvata lugens) USPf1 primer (encoding YPPNHPL of amino acid sequence) and EcRr1 primer using 3′-RACE Ready cDNA described in Example 1 as a template PCR was performed using a degenerate primer (encoding the amino acid sequence EAVQEER in the reverse direction). PCR uses EX Taq polymerase (manufactured by Takara Bio Inc.) as an enzyme, and after heating at 95 ° C. for 1 minute, 95 ° C. (30 seconds), 48 ° C. (30 seconds), 72 ° C. (1 minute 30 seconds) One cycle was performed under the condition that 35 cycles were amplified. The obtained PCR product was purified by gel filtration using Sephacryl S-300HR (manufactured by Amersham Biosciences), and PCR was performed again using this as a template. PCR uses a degenerate primer of USPf2 primer (encoding amino acid sequence GKHYGVY) and EcRr2 primer (encoding amino acid sequence YCRYQKC in the reverse direction), and using EX Taq polymerase (manufactured by Takara Bio Inc.) as an enzyme. The sample was heated at 95 ° C. for 1 minute and then subjected to amplification under 35 cycles, with 95 ° C. (30 seconds), 48 ° C. (30 seconds) and 72 ° C. (1 minute 30 seconds) as one cycle. This DNA solution was fractionated by 2% agarose electrophoresis, and a portion of about 100 to 200 bp was extracted and purified. Purification was performed using QIAquick Gel Extraction Kit (manufactured by Qiagen) according to the protocol. The purified DNA was subjected to TA cloning using pGEM-T Vector System I (Promega) according to the protocol, and the nucleotide sequence was determined (No. 453 to No. 566 of the entire nucleotide sequence (SEQ ID No. 10 in the sequence listing)). Equivalent). The method for determining the base sequence is the same as in Example 1. The sequence of the degenerate primer used is shown below. Next, a primer was designed in the determined base sequence, 5′RACE and 3′RACE were performed using SMART RACE cDNA Amplification Kit (CLONTECH), and further according to pGEM-T Vector SystemI (Promega), TA cloning was performed and the nucleotide sequence was determined.

USPf1: TAYCCNCCCNAAYCAYCCIYT
USPr1: CKYTCYTCYTGNAGICYCYTC
USPf2: GGNAARCAYTAYGGNGTITAY
USPr2: CAYTYTGGRTAICKRCARTA

  3'RACE was performed under the following conditions. That is, in the first PCR, the aforementioned 3′-RACE Ready cDNA was used as a template, NlUSPf1 primer (corresponding to Nos. 485 to 505 of the entire base sequence (SEQ ID No. 10 in the sequence listing)) as a primer, and UPM attached to the kit. Using a primer, LA Taq polymerase (manufactured by Takara Bio Inc.) as an enzyme, heating at 95 ° C. for 1 minute, 95 ° C. (30 seconds), 50 ° C. (1 minute), 72 ° C. (4 minutes) 1 As a cycle, nested PCR was performed under the condition that amplification was performed. Nested PCR was performed by using a first PCR product purified by gel filtration using Sephacryl S-300HR (manufactured by Amersham Biosciences) as a template, and NlUSPf2 primer (all bases) was used as a primer. It is in phase 505 to 524 of the sequence (SEQ ID NO: 10 in the sequence listing) ) And kits using the NUP primer accessories, 95 ° C. (30 sec), 55 ° C. (1 minute), 72 ° C. (4 minutes) as one cycle, was conducted on the condition that the 35 cycles of amplification. . This DNA solution was fractionated by 1.5% agarose electrophoresis, and a portion of about 1200 bp was extracted and purified. Purification was performed using QIAquick Gel Extraction Kit (manufactured by Qiagen) according to the protocol. The obtained DNA solution was subjected to TA cloning according to pGEM-T Vector System I (manufactured by Promega), and the base sequence (corresponding to the 525th to 1816th of the total base sequence (SEQ ID NO: 10 in the sequence listing)) was determined. The method for determining the base sequence is the same as in Example 1. The primer sequences used are shown below.

NlUSPf1: GACAGTGAGAAAAGACTTATC
NlUSPf2: CATACGCCCTGTCGAGAAGAG

  5'RACE was performed under the following conditions. First, using NlUSPr1 primer (corresponding to the reverse strand of Nos. 533 to 554 of the entire base sequence (SEQ ID No. 10 in the sequence listing)) as a template, using the mRNA solution prepared from the brown planter as a template, in the presence of SMARTII oligonucleotide attached to the kit Then, 5′-RACE Ready cDNA was synthesized using SuperScript II reverse transcriptase (manufactured by Invitrogen) as the enzyme. Using this as a template, NlUSPr2 primer (corresponding to the reverse strands of 516 to 536 of the entire base sequence (SEQ ID NO: 10 in the sequence listing)) and the UPM primer attached to the kit, and LA Taq polymerase (enzyme) The first time under the condition that 35 cycles are amplified with 1 cycle of 95 ° C (30 seconds), 50 ° C (1 minute), 72 ° C (3 minutes) after heating at 95 ° C for 1 minute. The nested PCR was carried out using the first PCR product purified using Sephacryl S-300HR (manufactured by Amersham Biosciences) as a template, and the NlUSPr3 primer (total nucleotide sequence (SEQ ID NO: 10 in the sequence listing)) as a primer. 9) using the NUP primer attached to the kit. 1 minute after heating at ° C., 95 ° C. (30 sec), 50 ° C. (1 minute), 72 ° C. and (3 minutes) as one cycle, was conducted on the condition that the 35 cycles of amplification. This DNA solution was purified by gel filtration using Sephacryl S-300HR (manufactured by Amersham Bioscience), TA-cloned according to pGEM-T Vector System I (manufactured by Promega), and the nucleotide sequence (total nucleotide sequence (sequence table)) No. 1 to No. 497 of SEQ ID NO: 10). The method for determining the base sequence is the same as in Example 1. The primer sequences used are shown below.

NlUSPr1: CCTTTGTCTTTTATCGATGAGG
NlUSPr2: GAGGCAACTTTTCTCTCTCCG
NlUSPr3: CGACAGGCGTATGATAAGTC

  The three clones obtained as described above were overlapped (Genetix ver. 7) to determine the full-length sequence (SEQ ID NO: 10) of the fly-spira-derived ultraspiracle cDNA.

Example 4 Acquisition of Ultraspiracle (USP) ORF Clone from Niloparva lagens From the determined full length sequence of the Ultraspiracle cDNA derived from the brown planthopper, an open reading frame (ORF) was obtained from other insects. Primers were designed by inferring the amino acid sequence (eg, Ultraspiracle from Locusta migratoria (gi: 3393178)). After undergoing two rounds of PCR, an Ultraspiracle (USP) ORF clone derived from Nilaparvata lugens was obtained.

  That is, in the first PCR, 3′-RACE Ready cDNA described in Example 1 was used as a template, NlUSPORFf1 primer (corresponding to Nos. 68 to 83 of the entire base sequence (SEQ ID NO: 10 in the sequence listing)) as a primer, and NlUSPORFr1 primer (corresponding to the reverse strand of Nos. 1367 to 1382 of the entire base sequence (SEQ ID NO: 10)), KODplus polymerase (manufactured by Toyobo Co., Ltd.) as an enzyme, heated at 95 ° C for 1 minute, then 95 ° C (30 seconds), 57 ° C. (30 seconds), 68 ° C. (2 minutes) are performed under the condition that amplification is performed for 30 cycles, and nested PCR uses Sephacryl S-300HR (manufactured by Amersham Bioscience) as a template. NlUSPOR as a primer using the first PCR product purified f2 primer (added base sequence corresponding to positions 159 to 175 of the entire base sequence (SEQ ID NO: 10 of the sequence listing) downstream of CACC) and NlUSPORFr2 (total base sequence (SEQ ID NO: 10 of the sequence listing) downstream of GCGGCCGC) The base sequence corresponding to the reverse strand of Nos. 1346 to 1361 is added), and after heating at 95 ° C. for 1 minute, 95 ° C. (30 seconds), 57 ° C. (30 seconds), 68 ° C. (2 minutes) One cycle was performed under the condition of amplification for 30 cycles. The obtained PCR product was purified by gel filtration using Sephacryl S-300HR (Amersham Biosciences). This purified DNA was treated at 95 ° C. for 20 minutes, and after cooling, 2 mM dATP solution and EX Taq polymerase (manufactured by Takara Bio Inc.) were added and reacted at 70 ° C. for 15 minutes to add an adenine residue. Thereafter, gel filtration purification was performed using Sephacryl S-300HR (manufactured by Amersham Bioscience). Subsequently, TA cloning was performed according to the protocol of pGEM-Teasy Vector System I (manufactured by Promega Corp.), the base sequence was confirmed, and a pGEM-Teasy / NlUSPORF vector containing the flying yellow ultraspiral ORF sequence was obtained. The method for determining the base sequence is the same as in Example 1. The primer sequences used are shown below.

NlUSPORFf1: GGCCAAACAGGTTGAC
NlUSPORFr1: GGTACCGTGTAAGTGTG
NlUSPORFf2: CACCATGGGAAGGAACTGAGCG
NlUSPORFr2: GCGGCCGCCTACTGGTCAGTAGGC

Example 5 Synthesis of a planthopper-derived ecdysone receptor protein, ultraspiracle protein (1) Construction of an expression vector for in vitro transcription and translation of planthopper EcR And then fractionated by 1.5% agarose electrophoresis, and an approximately 2000 bp fragment containing the ORF sequence of the ecdysone receptor derived from brown planthopper was extracted and purified. Purification was performed using QIAquick Gel Extraction Kit (manufactured by Qiagen) according to the protocol. (This DNA fragment is represented as NlEcRORF / EcoRI-NotI.)

  The pTNT vector (Promega) was digested with restriction enzymes EcoRI (Toyobo) and NotI (Toyobo), then fractionated by 1.5% agarose electrophoresis, and a fragment of about 2800 bp was extracted and purified. . Purification was performed using QIAquick Gel Extraction Kit (manufactured by Qiagen) according to the protocol. (This DNA fragment is expressed as pTNT / EcoRI-NotI.)

  NlEcRORF / EcoRI-NotI and pTNT / EcoRI-NotI were connected using a DNA ligation kit (Takara Bio) according to the protocol, treated on ice for 30 minutes and then at 42 ° C. for 30 seconds, and then competed with E. coli DH5α. The cells were added to a cell (manufactured by Toyobo Co., Ltd.), and competent cells of E. coli DH5α were cultured. The transformed clone was cloned by blue / white determination, and an expression vector pTNT / NlEcRORF for in vitro transcription and translation of cotton aphid EcR was obtained from the obtained clone.

(2) Construction of an expression vector for in vitro transcription / translation of the brown planthopper USP The pGEM-Teasy / NlUSPORF vector was cleaved with restriction enzymes EcoRI (Toyobo), NotI (Toyobo), and then 1.5% agarose electrophoresis And a fragment of about 1200 bp containing the USP ORF sequence derived from brown planthopper was extracted and purified. Purification was performed using QIAquick Gel Extraction Kit (manufactured by Qiagen) according to the protocol. (This DNA fragment is expressed as NlUSPORF / EcoRI-NotI.)

  The pTNT vector (Promega) was digested with restriction enzymes EcoRI (Toyobo) and NotI (Toyobo), then fractionated by 1.5% agarose electrophoresis, and a fragment of about 2800 bp was extracted and purified. . Purification was performed using QIAquick Gel Extraction Kit (manufactured by Qiagen) according to the protocol. (This DNA fragment is expressed as pTNT / EcoRI-NotI.)

  NlUSPORF / EcoRI-NotI and pTNT / EcoRI-NotI were connected according to the protocol using a DNA ligation kit (manufactured by Takara Bio Inc.) and competent cells of E. coli DH5α (manufactured by Toyobo Co., Ltd.) as in Example 5 (1) above. ) Was constructed to construct an expression vector pTNT / NlUSPORF for in vitro transcription and translation of the brown planthopper USP.

(3) Synthesis of leafhopper-derived ecdysone receptor protein TNT T7 Quick Coupled Translation / Translation System (Promega) was used. PTNT / NlEcRORF 1 μg, TNT T7 Quick Master Mix 40 μL, 1 mM methionine 1 μL, and total reaction solution 50 μL were reacted at 30 ° C. for 80 minutes to synthesize the green planthopper-derived ecdysone receptor protein.

(4) Synthesis of flying planthopper-derived ultraspiracle protein Similarly, pTNT / NlUSPORF 1 μg, TNT T7 Quick Master Mix 40 μL, 1 mM methionine 1 μL, total reaction solution 50 μL, reacted at 30 ° C. for 80 minutes. Ultraspiracle protein was synthesized.

Example 6 Yeast Two-Hybrid Assay (1) Preparation of Entry Vector Containing Tobago Planta Ecdyson Receptor DEF Region Using pGEM-Teasy / NlEcRORF vector as a template, NlEcRDEFf1 primer as a primer (all nucleotide sequences downstream of CACC (SEQ ID NO: 9 ) And NlEcRORFr2 primer (addition of a base sequence corresponding to the reverse strand of No. 2473 to No. 2489 of the entire base sequence (SEQ ID No. 9 in the sequence listing)) , Using KODplus polymerase (manufactured by Toyobo Co., Ltd.) as an enzyme, 95 ° C. (30 seconds), 54 ° C. (30 seconds), 68 ° C. (90 seconds) as one cycle, and performing 30 cycles, Tobirounkae DEF region of the Dyson receptor was amplified sequences linked. Subsequently, fractionation was performed by 1.5% agarose electrophoresis, and a fragment of about 900 to 1100 bp including the DEF region of the ecdysone receptor derived from brown planthopper was extracted and purified. Purification was performed according to the protocol using Wizard SV gel and PCR Clean-up System (Promega). The DNA fragment of about 900 to 1100 bp was connected to the pENTR TOPO vector attached to the kit according to the protocol using pENTR Directional TOPO Cloning Kits (manufactured by Invitrogen), and in the same manner as in Example 5 (1), E. coli DH5α By transforming competent cells (manufactured by Toyobo Co., Ltd.), pENTR / NlEcRDEF was obtained in which the green plant ecdysone receptor DEF region was inserted into the entry vector. The method for determining the base sequence is the same as in Example 1. The primer sequences used are shown below.

NlEcRDEFf1: CACCAGGCCTGAGTGTGTTG

(2) Preparation of Entry Vector Containing Torayouna Spiracle DEF Region Using pGEM-Teasy / NlUSPORF vector as a template, NlUSPDEFf1 primer as a primer (No. 602 to 621 of the entire base sequence (SEQ ID NO: 10 in the Sequence Listing) downstream of CACC) And a NlUSPORFr2 primer (addition of a base sequence corresponding to the reverse strand of Nos. 602 to 621 of the entire base sequence (SEQ ID No. 10 in the sequence listing) downstream of GCGGCCGC) and KODplus as an enzyme Using Polymerase (manufactured by Toyobo Co., Ltd.), 95 ° C (30 seconds), 54 ° C (30 seconds), 68 ° C (90 seconds) are performed under the conditions of 30 cycles. An array with connected regions Amplified. Next, fractionation was carried out by 1.5% agarose electrophoresis, and a fragment of about 700 to 800 bp containing the DEF region of the ecdysone receptor derived from brown planthopper was extracted and purified. Purification was performed according to the protocol using Wizard SV gel and PCR Clean-up System (Promega). The DNA fragment of about 700 to 800 bp was connected to the pENTR TOPO vector attached to the kit according to the protocol using pENTR Directional TOPO Cloning Kits (manufactured by Invitrogen), and in the same manner as in Example 5 (1), By transforming competent cells (manufactured by Toyobo Co., Ltd.), pENTR / NlUSPDEF was obtained, in which the fly planter ultraspiracle DEF region was inserted into the entry vector. The method for determining the base sequence is the same as in Example 1. The primer sequences used are shown below.

NlUSPDEFf1: CACCAAAAAGAGAGGCAGTTCAGG

(3) Preparation of a vector for expression of a fusion protein of the leafhopper ecdysone receptor DEF region and the GAL4 activation region ProQuest Two-Hybrid System with Technology (manufactured by Invitrogen) and pDEST22 (supplied with kit dragon) according to its protocol The receptor DEF region was inserted. That is, pENTR / NlEcRDEF and pDEST22 are allowed to act in LR buffer and LR clonase is allowed to act at 25 ° C. for 1 hour to transform E. coli DH5α competent cells (Toyobo Co., Ltd.) in the same manner as in Example 5 (1). As a result, a vector pDEST22 / NlEcRDEF for expressing a fusion protein of the brown planthopper ecdysone receptor DEF region and the GAL4 activation region was obtained.

(4) Preparation of a vector for expression of the fusion protein Ultraspiracle DEF region and GAL4 DNA binding region fusion protein ProQuest Two-Hybrid System with Gateway Technology (manufactured by Invitrogen) and according to its protocol The pyracle DEF region was inserted. That is, pENTR / NlUSPDEF and pDEST32 are allowed to act in LR buffer and LR clonase is allowed to act at 25 ° C. for 1 hour to transform E. coli DH5α competent cells (Toyobo Co., Ltd.) in the same manner as in Example 5 (1). As a result, a vector pDEST32 / NlUSPDEF for expression of a fusion protein of the brown planta ultraspiracle DEF region and the GAL4 DNA binding region was obtained.

(5) Preparation of transformed yeast Using ProQuest Two-Hybrid System with Gateway Technology (manufactured by Invitrogen), pDEST22 / NlEcRDEF, pDEST32 / l acetic acid in yeast MaV203 competent cell (manufactured by Invitrogen) according to the protocol. To obtain a transformed yeast MaV205 (DB-NlUSPDEF, AD-NlEcRDEF) for yeast two-hybrid assay.

(6) Implementation of yeast two-hybrid assay Sc-Trp-Leu medium (Sc-Trp-Leu (Q-BIOgene) 1.59 g, Yeast Nitrogen base w / o amino acid (Difco) 6.7 g, D -Glucose (manufactured by Kanto Chemical Co., Inc.) 20 g of distilled water was added to make 1 L (pH adjusted to 6.0) and sterilized to prepare a precultured solution at 25 ° C. with shaking for 1 day. did. The main culture was performed under the conditions of shaking culture at 25 ° C. for 16 hours by adding 20 μL of the preculture solution and 10 μL of the test sample solution to 1 mL of Sc-Trp-Leu medium. The sample was added by adding 1% of the culture solution to an ethanol solution 100 times the final concentration.

After completion of the main culture, OD600 value was measured, and β-galactosidase activity was measured as follows. 800 μL of the main culture was centrifuged at 12,000 rpm for 10 seconds, and the supernatant was discarded. Dissolve the residue in 800 μL of Z buffer (16.1 g Na ₂ HPO ₄ .7H ₂ O, 5.5 g NaH ₂ PO ₄ .H ₂ O, 0.75 g KCl, 0.246 g MgSO ₄ .7H ₂ O in distilled water. Thereafter, it was adjusted to pH 7.0, sterilized, and suspended, and centrifuged again at 12,000 rpm for 10 seconds, and the supernatant was discarded. To this residue, 100 μL of Z buffer and glass beads having a diameter of 0.5 mm (manufactured by Sigma) were added, and vortexed for 90 seconds. To this, 700 μL of Z buffer, 1.9 μL of 2-mercaptoethanol (manufactured by Nacalai Tesque), 160 μL of 0.4% o-nitrophenyl-β-galactopyranoside (ONPG) -containing Z buffer, and 30 The reaction was carried out at ° C. When the reaction solution became yellow, 200 μL of 1M Na ₂ CO ₃ solution was added to stop the reaction, and then the OD420 value was measured. The activity value was expressed as OD420 × 1000 / (OD600 × reaction time (minutes) × main culture solution used (mL)), and the specific activity was expressed as 1 when ethanol was added. Ponasterone A (Wako Pure Chemical) and chromafenozide (Nippon Kayaku) were used as test samples.

As a result, when ponasterone A was added at 1 × 10 ⁻⁴ M, the specific activity was 2.5. On the other hand, when chromafenozide was added at 1 × 10 ⁻⁴ M, the specific activity was 1.1. Ponasterone A enhanced the interaction between the ecdysone receptor and ultraspiracle, whereas chromafenozide showed little effect.

Example 7 Construction of Expression Vectors of Green Planthopper EcR and Planthopper EcR (1) Construction of Expression Vector of Planthopper EcR The pGEM-Teasy / NlEcRORF vector was cleaved with restriction enzymes EcoRI (Toyobo) and NotI (Toyobo), Fractionated by 1.5% agarose electrophoresis, a fragment of about 2000 bp containing the ORF sequence of ecdysone receptor derived from brown planthopper was extracted and purified. Purification was performed using QIAquick Gel Extraction Kit (manufactured by Qiagen) according to the protocol. (This DNA fragment is represented as NlEcRORF / EcoRI-NotI.)

  The pIZT / V5-His vector (manufactured by Invitrogen) was digested with restriction enzymes EcoRI (manufactured by Toyobo) and NotI (manufactured by Toyobo), then fractionated by 1.5% agarose electrophoresis, and a fragment of about 3300 bp was obtained. Extracted and purified. Purification was performed using QIAquick Gel Extraction Kit (manufactured by Qiagen) according to the protocol. (This DNA fragment is referred to as pIZT / V5-His / EcoRI-NotI.)

  NlEcRORF / EcoRI-NotI and pIZT / V5-His / EcoRI-NotI were connected according to the protocol using a DNA ligation kit (manufactured by Takara Bio Inc.), and competent cells of E. coli DH5α were obtained in the same manner as in Example 5 (1). (Toyobo Co., Ltd.) was transformed to obtain a brown planthopper EcR expression vector pIZT / NlEcRORF.

(2) Construction of an expression vector of the brown planthopper USP The pGEM-Teasy / NlUSPORF vector was cleaved with restriction enzymes EcoRI (manufactured by Toyobo), NotI (manufactured by Toyobo), and then fractionated by 1.5% agarose electrophoresis. A fragment of about 1200 bp containing the ORF sequence of the ecdysone receptor derived from brown planthopper was extracted and purified. Purification was performed using QIAquick Gel Extraction Kit (manufactured by Qiagen) according to the protocol. (This DNA fragment is expressed as NlUSPORF / EcoRI-NotI.)

  The pIZT / V5-His vector (manufactured by Invitrogen) was digested with restriction enzymes EcoRI (manufactured by Toyobo) and NotI (manufactured by Toyobo), then fractionated by 1.5% agarose electrophoresis, and a fragment of about 3300 bp was obtained. Extracted and purified. Purification was performed using QIAquick Gel Extraction Kit (manufactured by Qiagen) according to the protocol. (This DNA fragment is referred to as pIZT / V5-His / EcoRI-NotI.)

  NlUSPORF / EcoRI-NotI and pIZT / V5-His / EcoRI-NotI were connected according to the protocol using a DNA ligation kit (manufactured by Takara Bio Inc.), and competent cells of E. coli DH5α were obtained in the same manner as in Example 5 (1). (Toyobo Co., Ltd.) was transformed to obtain a brown planthopper USP expression vector pIZT / NlUSPORF.

SEQ ID NO: 1: Tobalone plant ecdysone receptor ORF amino acid sequence SEQ ID NO: 2: GAL4-activation region amino acid sequence SEQ ID NO: 3: GAL4-DNA binding region amino acid sequence SEQ ID NO: 4: DNA encoding Tobalone plant ecdysone receptor ORF
SEQ ID NO: 5: GAL4-activation region DNA
SEQ ID NO: 6: GAL4-DNA binding region DNA
SEQ ID NO: 7: Tobiirounka Ultraspiracle ORF amino acid sequence SEQ ID NO: 8: DNA encoding Tobiirounka Ultraspiracle ORF
SEQ ID NO: 9 Full-length brown ecdysone receptor full-length cDNA
SEQ ID NO: 10: Tobiirounka Ultra Spiracle Full-length cDNA

Claims (30)

A protein comprising the following amino acid sequence (a) or (b):
(A) a protein comprising the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing;
(B) A protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing, and having a function as an ecdysone receptor. A partial polypeptide of the protein according to claim 1, comprising a partial amino acid sequence corresponding to a region necessary for binding to ecdysones. The partial polypeptide according to claim 2, wherein the partial amino acid sequence corresponding to a region necessary for binding to ecdysones is the following amino acid sequence (a) or (b):
(A) a partial sequence of positions 332 to 689 of the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing;
(B) an amino acid sequence in which one or several amino acids are deleted, substituted or added in the partial sequence from the 332th to the 689th amino acid sequence represented by SEQ ID NO: 1 in the sequence listing, and binds to ecdysones Amino acid sequence. A fusion polypeptide in which the partial polypeptide according to claim 2 or 3 is bound directly or indirectly to the GAL4 activation region comprising the following amino acid sequence (a) or (b).
(A) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing;
(B) A polypeptide comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 in the Sequence Listing. A fusion polypeptide in which the GAL4 DNA binding region comprising the following amino acid sequence (a) or (b) is bound directly or indirectly to the partial polypeptide according to claim 2 or claim 3.
(A) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 3 in the sequence listing;
(B) A polypeptide comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 3 in the sequence listing. DNA encoding the protein according to claim 1. DNA comprising any of the following base sequences (a) to (c):
(A) DNA encoding a novel ecdysone receptor consisting of the base sequence represented by SEQ ID NO: 4 in the sequence listing;
(B) a base sequence encoding a novel ecdysone receptor in which one or several bases are deleted, substituted or added in the base sequence represented by SEQ ID NO: 4 in the sequence listing;
(C) DNA encoding a novel ecdysone receptor that hybridizes with a base sequence complementary to the base sequence represented by SEQ ID NO: 4 under stringent conditions. A DNA encoding the partial polypeptide according to claim 2. DNA comprising any of the following base sequences (a) to (c):
(A) DNA encoding a partial polypeptide having the ability to bind to ecdysone consisting of a partial sequence from position 1413 to position 2489 of the base sequence represented by SEQ ID NO: 4 in the sequence listing;
(B) a partial poly having the ability to bind to ecdysones in which one or several bases have been deleted, substituted or added in the partial sequence from the 1413th position to the 2489th position of the base sequence represented by SEQ ID NO: 4 in the sequence listing DNA encoding the peptide;
(C) a partial polypeptide having the ability to bind to ecdysones that hybridize under stringent conditions with a base sequence complementary to the partial sequence 1413 to 2489 of the base sequence represented by SEQ ID NO: 4 in the sequence listing NA to code. A fusion polypeptide comprising the base sequence of any of the following (a) to (c) and a GAL4 activation region directly or indirectly bound to the partial polypeptide of the protein according to claim 2 or claim 3 DNA encoding
(A) DNA comprising the base sequence represented by SEQ ID NO: 5 in the sequence listing;
(B) a base sequence in which one or several bases are deleted, substituted or added in the base sequence represented by SEQ ID NO: 5 in the sequence listing;
(C) DNA that hybridizes under stringent conditions with a base sequence complementary to the base sequence represented by SEQ ID NO: 5 in the sequence listing. A fusion polypeptide comprising a base sequence of any of the following (a) to (c) and a GAL4 DNA binding region directly or indirectly bound to the partial polypeptide of the protein according to claim 2 or claim 3 DNA encoding.
(A) DNA comprising the base sequence represented by SEQ ID NO: 6 in the sequence listing;
(B) a base sequence in which one or several bases are deleted, substituted or added in the base sequence represented by SEQ ID NO: 6 in the sequence listing;
(C) DNA that hybridizes under stringent conditions with a base sequence complementary to the base sequence represented by SEQ ID NO: 6 in the sequence listing. A protein comprising the following amino acid sequence (a) or (b):
(A) a protein comprising the amino acid sequence represented by SEQ ID NO: 7 in the sequence listing;
(B) a protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 7 in the sequence listing, and having a function as an ultraspiracle; A partial peptide of the protein according to claim 12, comprising a partial amino acid sequence corresponding to a region necessary for complex formation with an ecdysone receptor. The partial polypeptide according to claim 13, wherein the partial amino acid sequence corresponding to a region necessary for complex formation with the ecdysone receptor is the following amino acid sequence (a) or (b):
(A) a partial sequence from the 149th position to the 400th position of the amino acid sequence represented by SEQ ID NO: 7 in the Sequence Listing;
(B) consisting of an amino acid sequence in which one or several amino acids have been deleted, substituted or added in the partial sequence from the 149th to the 400th amino acid sequence represented by SEQ ID NO: 7 in the sequence listing, and complexed with the ecdysone receptor Amino acid sequence that forms the body. A fusion polypeptide in which the GAL4 activation region comprising the following amino acid sequence (a) or (b) is bound directly or indirectly to the partial polypeptide according to claim 13 or 14.
(A) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing;
(B) A polypeptide comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 in the Sequence Listing. A fusion polypeptide in which the GAL4 DNA binding region comprising the following amino acid sequence (a) or (b) is bound directly or indirectly to the partial polypeptide of claim 13 or claim 14.
(A) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 3 in the sequence listing;
(B) A polypeptide comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 3 in the sequence listing. A DNA encoding the protein according to claim 12. DNA comprising any of the following base sequences (a) to (c):
(A) DNA encoding a novel ultraspiracle consisting of the base sequence represented by SEQ ID NO: 8 in the sequence listing;
(B) a DNA encoding a novel ultraspiracle in which one or several bases are deleted, substituted or added in the base sequence represented by SEQ ID NO: 10 in the sequence listing;
(C) DNA encoding a novel ultraspiracle that hybridizes under stringent conditions with a base sequence complementary to the base sequence represented by SEQ ID NO: 10 in the sequence listing. DNA encoding the partial polypeptide according to claim 13. DNA comprising any of the following base sequences (a) to (c):
(A) DNA encoding a partial polypeptide having the ability to form a complex with an ecdysone receptor consisting of a partial sequence from the 603rd to 1361th of the base sequence represented by SEQ ID NO: 10 in the sequence listing;
(B) Complex formation with an ecdysone receptor in which one or several bases have been deleted, substituted or added in the partial sequence from the 603rd to 1361th of the base sequence represented by SEQ ID NO: 10 in the sequence listing DNA encoding a partial polypeptide having the ability;
(C) The ability to form a complex with an ecdysone receptor that hybridizes under stringent conditions with a base sequence complementary to the partial sequence from 603 to 1361 of the base sequence represented by SEQ ID NO: 10 in the sequence listing DNA encoding a partial polypeptide. 15. A fusion polypeptide comprising the GAL4 activation region bound directly or indirectly to the partial polypeptide of the protein according to claim 13 or 14 and comprising any one of the following base sequences (a) to (c): DNA encoding
(A) DNA consisting of SEQ ID NO: 5 in the sequence listing;
(B) DNA in which one or several bases are deleted, substituted or added in the base sequence represented by SEQ ID NO: 5 in the sequence listing;
(C) DNA that hybridizes under stringent conditions with a base sequence complementary to the base sequence represented by SEQ ID NO: 5 in the sequence listing. A fusion polypeptide comprising the base sequence of any of the following (a) to (c) and a GAL4 DNA binding region bound directly or indirectly to the partial polypeptide of the protein according to claim 13 or claim 14. DNA encoding.
(A) DNA consisting of SEQ ID NO: 6 in the sequence listing;
(B) DNA in which one or several bases are deleted, substituted or added in the base sequence represented by SEQ ID NO: 6 in the sequence listing;
(C) DNA that hybridizes under stringent conditions with a base sequence complementary to the base sequence represented by SEQ ID NO: 6 in the sequence listing. A recombinant vector containing the DNA according to any one of claims 6 to 11. A recombinant vector containing the DNA according to any one of claims 17 to 22. A transformant obtained by transforming the recombinant vector according to claim 23 and the recombinant vector according to claim 24 simultaneously or using one of them. A method for screening a compound that controls the molting of a Hemiptera using the transformant according to claim 25. A method for screening a compound that controls molting of a hemiptera insect using the protein or partial polypeptide or fusion polypeptide according to any one of claims 1 to 5. The molting of Hemiptera insects using the protein according to claim 1 or the partial polypeptide according to claim 2 or claim 3, and the protein according to claim 12 or the partial polypeptide according to claim 13 or claim 14. Screening method for compounds that regulate the above. A compound or a salt thereof that controls molting of a hemiptera insect obtained by the screening method according to any one of claims 26 to 28. An insecticide comprising, as a main component, a compound that regulates the molting of hemiptera insects according to claim 29.