JP2007097547A - Method for screening obesity-treating agent or obesity-preventing agent - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for screening a new obesity-treating agent and obesity-preventing agent. <P>SOLUTION: This method for screening the obesity-treating agent or obesity-preventing agent is characterized by selecting a TUSC5 gene expression inhibitory substance or a TUSC5 protein expression inhibitory substance as the obesity-treating agent or obesity-preventing agent based on the expression inhibitory activities of a test substance on the TUSC5 gene or TUSC5 protein. The method is based on a knowledge that on enhancing heat production, the TUSC5 gene expression is inhibited. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a screening method for a therapeutic agent for obesity or a preventive agent for obesity.

  Obesity is one of the main causes causing diabetes, hypertension, hyperlipidemia, arteriosclerosis, ischemic heart disease and the like. In recent years, as a treatment and prevention method, the target is changing from adjustment of intake energy to adjustment of energy consumption. In particular, brown adipocytes have recently attracted attention as related to energy consumption.

  Brown fat cells (i) create heat, protect the heart and liver from the cold, maintain body temperature, and (ii) work to burn excess energy taken from the diet by stimulation from the satiety center of the brain The two functions are known. In addition, the heat producing protein (UCP: uncoupling protein) in brown fat cells in brown fat cells can directly take in fat and dissipate heat locally (heat production) based on this. is there. Therefore, it is believed that increasing the expression of this heat-producing protein can increase energy consumption, and as a result, eliminate or prevent obesity.

  It is known that when adrenaline binds to the β3 adrenergic receptor present on the surface of the brown fat cells, the brown fat cells are activated and the expression of the heat-producing protein is increased, resulting in the burning of fat. Yes. From the viewpoint of this mechanism, it has been suggested that a β3 adrenergic receptor agonist works as a therapeutic agent for obesity (for example, see Patent Document 1).

Thus, development of an obesity therapeutic agent and an obesity preventive agent based on the mechanism of activating the brown adipocytes has been studied, but no effective agent has been found so far. .
JP 2004-323519 A

  Accordingly, an object of the present invention is to provide a method for screening for a novel anti-obesity agent and anti-obesity agent.

  As a result of intensive studies to identify a gene that regulates heat production in brown adipocytes, the present inventors have found that the expression of the TUSC5 gene is suppressed when heat production is enhanced. The present invention has been completed based on this finding. That is, the screening method for the first anti-obesity agent or anti-obesity agent of the present invention is a screening method characterized by including a step of searching for a substance that suppresses the expression of the TUSC5 gene in the presence of a test substance. The second screening method for an obesity therapeutic agent or obesity preventing agent of the present invention is a screening method characterized by including a step of searching for a substance that suppresses the expression of TUSC5 protein in the presence of a test substance.

  The gene sequence of TUSC5 (Tumor suppressor candidate 5) is also called LOST1, and is registered in GenBank for humans and mice. This TUSC5 gene is known to reduce TUSC5 expression in 69% of lung cancer samples, suggesting that TUSC5 expression plays an important role in lung cancer ( Hiroyuki Konishi et al., “Detailed characterization of a homozygously deleted region corresponding to a candidate tumor suppressor locus at distal 17p13. 3 in human lung cancer) ”, Oncogene, 2003, 22, 1892-1905). The TUSC5 protein is also reported in International Publication WO02 / 096355 pamphlet, International Publication WO02 / 097036 pamphlet and the like.

  The present inventors have found that the TUSC5 gene is highly expressed only in adipose tissue in normal rat tissues. Therefore, the present inventors examined the expression of the TUSC5 gene in 3T3-L1 cells, and found that the expression increased with the differentiation of 3T3-L1 cells into mature adipocytes. Furthermore, the present inventors have strongly expressed the TUSC5 gene in each adipose tissue of rats in visceral tissues excluding mesenteric adipose tissue in healthy rats, whereas in obese rats, the mesenteric adipose tissue is expressed. It was found to be strongly expressed in the visceral tissues. Based on these findings, when rats were subjected to cold exposure, the expression of TUSC5 gene in brown adipose tissue decreased in healthy rats, while the expression of TUSC5 gene in brown adipose tissue changed in obese rats. The inventors have found that they do not.

  Rats exposed to cold are believed to promote heat production in brown adipocytes to maintain body temperature. Therefore, the present inventors have found a relationship between promotion of heat production and suppression of TUSC5 gene expression based on the above finding that the expression of TUSC5 gene was reduced by exposure to cold in healthy rats. In addition, as described above, when heat production is promoted, obesity is treated or prevented. Therefore, the present inventors have found that it is possible to screen an anti-obesity agent or an anti-obesity agent by using the expression level of the TUSC 5 gene or TUSC 5 protein as an index.

  First, the screening method for a first anti-obesity agent or anti-obesity agent of the present invention is a screening method characterized by including a step of searching for a substance that suppresses the expression of the TUSC5 gene in the presence of a test substance.

In the first screening method of the present invention, the step of searching for the substance preferably includes the following steps (I) to (III).
(I) a step of contacting a cell capable of expressing a TUSC5 gene with the test substance,
(II) measuring the expression level of the TUSC5 gene in the cell contacted with the test substance, and (III) comparing the expression level with the expression level of the TUSC5 gene in a control cell not contacted with the test substance. And selecting a test substance that decreases the expression level of the TUSC5 gene.

  Under the present circumstances, it is preferable that the said TUSC5 gene is a gene which consists of a base sequence of sequence number 1, 3, 5 or 6.

  In the first screening method of the present invention, it is preferable that the therapeutic agent for obesity or the preventive agent for obesity is a heat production promoter.

  The screening kit of the present invention is a screening kit for a therapeutic agent for obesity or an obesity preventive agent used in the first screening method of the present invention, and is a screening kit containing a polynucleotide encoding a TUSC5 protein.

  In addition, the second screening method for an obesity therapeutic agent or obesity preventing agent of the present invention is a screening method characterized by including a step of searching for a substance that suppresses the expression of TUSC5 protein in the presence of a test substance.

In the second screening method of the present invention, the step of searching for the substance preferably includes the following steps (I) and (II).
(I) a step of bringing the TUSC5 protein into contact with the test substance;
(II) A step of detecting the binding between the TUSC5 protein and the test substance and selecting a test substance that binds to the TUSC5 protein.

In the second screening method of the present invention, the step of searching for the substance preferably includes the following steps (I) to (III).
(I) contacting the test substance with a cell capable of expressing a TUSC5 protein or a cell fraction prepared from the cell;
(II) a step of measuring the expression level of the TUSC5 protein in the cell or cell fraction contacted with the test substance, and (III) a control cell or the control cell in which the expression level is not contacted with the test substance Selecting a test substance that reduces the expression level of the TUSC5 protein compared to the expression level of the TUSC5 protein in the control cell fraction prepared from the above.

  In this case, the TUSC5 protein is preferably a protein consisting of the amino acid sequence set forth in SEQ ID NO: 2, 4 or 7.

  In the second screening method of the present invention, the obesity treatment agent or obesity prevention agent is preferably a heat production inhibitor.

  The screening kit of the present invention is a screening kit for an obesity therapeutic agent or an obesity preventive agent used in the second screening method of the present invention, and is a screening kit containing a TUSC5 protein.

  In the present invention, the human TUSC5 gene shown in SEQ ID NO: 1, the mouse TUSC5 gene shown in SEQ ID NO: 3, and the rat TUSC5 gene shown in SEQ ID NO: 5 are known, and GenBan Accession Nos. Are NM_172376.1, NM_177709. 2 and XM_340855. For example, S. Katayama et al., Science, 2005, 309, pages 1564-6, and the mouse TUSC5 gene shown in SEQ ID NO: 3 can be obtained by, for example, H. Konishi. , Oncogene, 2003, 22, 1892-1905, and the like.

  The rat TUSC5 gene of SEQ ID NO: 6 in the sequence listing is a novel gene found by the present inventors.

The TUSC5 gene in the present invention includes not only the gene represented by a specific base sequence (SEQ ID NOs: 1, 3, 5 and 6) but also a protein having a biological function equivalent to the protein encoded by these (for example, , Homologues, etc.). Specifically, the TUSC5 gene includes the following genes.
(A) Gene represented by any one of the nucleotide sequences of SEQ ID NOs: 1, 3, 5 and 6 (B) In the nucleotide sequence of (A), 1 to 30, preferably 1 to 10, more preferably Is a gene encoding a TUSC5 protein having a base sequence in which 1 to 5 bases are deleted, substituted or added, and having heat production inhibitory activity (C). It consists of a base sequence in which 30 bases, preferably 1 to 10 bases, more preferably 1 to 5 bases are deleted, substituted or added, and hybridizes with the DNA of (A) under stringent conditions. Gene (D) consisting of a base sequence in which 1 to 30, preferably 1 to 10, more preferably 1 to 5 bases are deleted, substituted or added in the base sequence of (A), SEQ ID NO: 1, A gene having homology with the nucleotide sequences of 5 and 6 of at least 60% or more, preferably 80% or more, more preferably 95% or more (E) Complementary to any of the genes (A) to (D) In (C), the stringent conditions for hybridization include, for example, standard conditions in the technical field. For example, the temperature conditions are indicated by each sequence number. The Tm value of the base sequence is ± 5 ° C., preferably ± 2 ° C., more preferably ± 1 ° C. Specific examples of conditions include: 5 × SSC solution, 10 × Denhardt solution, 100 μg / ml salmon sperm DNA and 1% SDS, hybridization at 65 ° C., 0.2 × SSC and 1% SDS, 65 ° C., 30 Washing for 2 minutes (2 times) followed by washing for 30 minutes at 65 ° C. in 0.2 × SSC and 0.1% SDS (2 times).

  In the present invention, the protein of SEQ ID NO: 2 in the sequence listing is encoded by the gene of SEQ ID NO: 1 in the sequence listing, and the protein of SEQ ID NO: 4 in the sequence listing has SEQ ID NO: 3 in the sequence listing, respectively. The protein of SEQ ID NO: 7 in the sequence listing is encoded by the genes of SEQ ID NO: 5 and 6 in the sequence listing.

In the present invention, the term “protein” includes not only a protein represented by a specific amino acid sequence, but also fragments, homologues, derivatives, and mutants having biological functions equivalent to these. For example, the TUSC5 protein includes not only the proteins shown in SEQ ID NOs: 2, 4 and 7, but also homologues and mutants thereof. Specifically, the TUSC5 protein includes the following proteins.
(A) a protein comprising the amino acid sequence of any one of SEQ ID NOs: 2, 4 and 7 (B) in the amino acid sequence of (A), 1 to 30, preferably 1 to 10, more preferably 1 A protein having an amino acid sequence in which 5 amino acids are deleted, substituted or added, and having a heat production inhibitory activity (C) 1-30, preferably 1 in the amino acid sequence of (A) It consists of an amino acid sequence in which 10 amino acids, more preferably 1 to 5 amino acids are deleted, substituted or added, and the homology with the amino acid sequences of SEQ ID NOs: 1, 3, 5 and 6 is at least 60% or more, A protein that is preferably 80% or more, more preferably 95% or more A human TUSC5 protein consisting of the amino acid sequence shown in SEQ ID NO: 2 That mice TUSC5 consisting proteins and amino acid sequence shown in SEQ ID NO: 7 rats TUSC5 proteins are known, GenBank Accession No., respectively, NP_758955.1, a NP_808377.1 and XP_340856. The method for obtaining the human TUSC5 gene shown in SEQ ID NO: 2 is, for example, S. Katayama et al., Science, 2005, 309, pages 1564-6. The method for obtaining the mouse TUSC5 gene shown in SEQ ID NO: 4 is, for example, H. Konishi. , Oncogene, 2003, 22, 1892-1905, and the like.

  The method for preparing the protein is not particularly limited. For example, a polynucleotide encoding the protein is incorporated into an appropriate expression vector, and prokaryotic cells such as E. coli, eukaryotic cells such as yeast, insect cells, and mammalian cells, Or the method of expressing and isolating the said protein in vitro is mentioned. Those skilled in the art can appropriately select and implement these methods.

  Below, an example of the screening method of this invention is demonstrated concretely.

(1) Screening Method for Obesity Treatment Agent or Obesity Inhibitor Using TUSC5 Gene Expression Suppression Activity as an Index First, the first screening method of the present invention will be described. As described above, the first screening method is a screening method including a step of searching for a substance that suppresses the expression of the TUSC5 gene in the presence of a test substance.

In the screening method, the step of searching for the substance preferably includes the following steps (I) to (III).
(I) a step of contacting a cell capable of expressing a TUSC5 gene with the test substance,
(II) measuring the expression level of the TUSC5 gene in the cell contacted with the test substance, and (III) comparing the expression level with the expression level of the TUSC5 gene in a control cell not contacted with the test substance. And selecting a test substance that decreases the expression level of the TUSC5 gene.

  As described above, the TUSC5 gene used in the screening method is preferably a gene consisting of the nucleotide sequence set forth in SEQ ID NO: 1, 3, 5 or 6.

  The cells used for the screening are not particularly limited as long as they can express the TUSC5 gene, and examples thereof include cells prepared from adipose tissue. Examples of the adipose tissue include brown adipose tissue, subcutaneous adipose tissue, accessory testicular adipose tissue, perirenal adipose tissue, and mesenteric adipose tissue.

  Examples of the test substance that can be used include, but are not limited to, nucleic acids, peptides, proteins, organic compounds, and inorganic compounds. The screening can be performed by contacting a sample (test sample) containing a substance that can be a test substance with the cell. Although it does not restrict | limit especially as said test sample, A cell extract, the expression product of a gene library, a synthetic low molecular weight compound, a synthetic peptide, a natural compound etc. are mentioned.

  In the step (I), the TUSC5 gene can be brought into contact with an expressible cell, for example, at 37 ° C. for 5 minutes to 720 hours at an optimal temperature.

  The contact between the cell and the test substance can be performed while culturing the cell under conditions that allow the cell to grow. The conditions for bringing the cells into contact with the test substance are not particularly limited, but the culture conditions (pH, temperature, medium, etc.) can be selected so that the cells do not die.

The number of cells when contacting with the test substance is, for example, 1.0 × 10 ^{3 to} 1.0 × 10 ⁴ cells / well, preferably 1.0 × 10 ⁴ when a 98-well plate is used. It is -1.0 * 10 < ⁵ > piece / well, More preferably, it is 1.0 * 10 < ⁵ > -1.0 * 10 < ⁶ > piece / well.

  The control cell means a cell that can express the TUSC5 gene used in the step (I) when the test substance is not contacted. The case where the test substance is not contacted includes the case where a solvent (blank) of the same amount as the test substance is added instead of the test substance, and the case where a control substance which does not affect the expression of the TUSC5 gene is added.

  Methods for measuring the expression level of the TUSC5 gene used in the screening include RNA prepared from the cells or complementary polynucleotide transcribed from RNA, in situ hybridization, Northern blotting, dot plot, RNase protection. In addition to assays, methods using microarrays, methods using PCR such as real-time PCR, and methods capable of rapid measurement such as methods for directly measuring the RNA strands can be mentioned.

  Based on the expression level of the TUSC5 gene detected and quantified as described above, a TUSC5 gene expression inhibitor can be selected. That is, the expression of the TUSC5 gene in the cells to which the test substance is added is 70% or less, preferably 50% or less, more preferably 10% or less compared to the expression level in the control cells to which the test substance is not added. For example, the test substance can be selected as an expression inhibitor.

(2) Screening Method for Obesity Treatment Agent or Obesity Inhibitor Using TUSC5 Protein Expression Suppression Activity as an Index Next, the second screening method of the present invention will be described. As described above, the second screening method is a screening method including a step of searching for a substance that suppresses the expression of TUSC5 protein in the presence of a test substance.

In the second screening method of the present invention, the step of searching for the substance preferably includes the following steps (I) and (II).
(I) a step of bringing the TUSC5 protein into contact with the test substance;
(II) A step of detecting the binding between the TUSC5 protein and the test substance and selecting a test substance that binds to the TUSC5 protein.

  Examples of the method for detecting the binding between the TUSC5 protein and the test substance include an immunological measurement method using an antibody specific for the TUSC5 protein. Examples of the immunological measurement method include Western blot, ELISA, and sandwich ELISA. The antibody can be prepared by a conventionally known method using the TUSC5 protein, and may be polyclonal or monoclonal. The method for preparing the TUSC5 protein is not particularly limited. For example, the polynucleotide encoding the TUSC5 protein is incorporated into an appropriate expression vector, and prokaryotic organisms such as E. coli, yeast, insect cells, mammalian cells, and other eukaryotic organisms. Examples thereof include a method for expressing and isolating the polypeptide in cells or in vitro. Those skilled in the art can appropriately select and implement these methods.

In the second screening method of the present invention, the step of searching for the substance preferably includes the following steps (I) to (III).
(I) contacting the test substance with a cell capable of expressing a TUSC5 protein or a cell fraction prepared from the cell;
(II) a step of measuring the expression level of the TUSC5 protein in the cell or cell fraction contacted with the test substance, and (III) a control cell or the control cell in which the expression level is not contacted with the test substance Selecting a test substance that reduces the expression level of the TUSC5 protein compared to the expression level of the TUSC5 protein in the control cell fraction prepared from the above.

  The cells used in the screening method are not limited as long as they can express the TUSC5 protein. Specifically, the cells described in (1) above can be used.

  As described above, the TUSC5 protein used in the screening method is preferably a protein having the amino acid sequence set forth in SEQ ID NO: 2, 4 or 7.

  The expression of the TUSC5 protein can be confirmed by detecting a protein that is an expression product of the TUSC5 gene.

  The method for detecting the TUSC5 protein is not particularly limited, and examples thereof include an immunological measurement method using an antibody specific for the TUSC5 protein. Examples of the immunological measurement method include Western blot, ELISA, and sandwich ELISA. The antibody can be prepared by a conventionally known method using the TUSC5 protein, and may be polyclonal or monoclonal. The method for preparing the TUSC5 protein is not particularly limited. For example, the polynucleotide encoding the TUSC5 protein is incorporated into an appropriate expression vector, and prokaryotic organisms such as E. coli, yeast, insect cells, mammalian cells, and other eukaryotic organisms. Examples thereof include a method for expressing and isolating the polypeptide in cells or in vitro. Those skilled in the art can appropriately select and implement these methods.

  Examples of the test substance include the same substances as in (1) above. Moreover, the said control cell is synonymous with said (1).

  Next, the screening kit of the present invention will be described. The kit of the present invention is a kit used for screening for a therapeutic agent for obesity or a preventive agent for obesity.

  First, the kit of the present invention is a kit for screening for an obesity therapeutic agent or an obesity preventive agent used in the screening method of the first aspect, and includes a kit containing a polynucleotide encoding a TUSC5 protein. The kit can be used, for example, when the microarray is produced by selectively using the probes included in the kit, or when detecting by a real-time PCR method.

  Moreover, the kit of the present invention is a screening kit for an obesity therapeutic agent or an obesity preventive agent used in the screening method, and includes a kit containing a TUSC5 protein. The kit may further contain an antibody specific for the TUSC5 protein.

  The present invention will be further described below using examples.

(Cloning of rat-derived TUSC5 gene)
Male Wistar rats aged 3-5 weeks were anesthetized with ether and decapitated. Brain tissue was extracted from the skull and minced. Next, the cells were suspended in a 50% isotonic percoll solution. A fraction that is contained in the intermediate third layer separated by ultracentrifugation and exhibits high activity for γGTP is a cerebral vascular endothelial cell. γGTP activity was measured with an Iatroset kit (Iatron). The cells were collected, washed several times with PBS, and cultured in DMEM medium supplemented with 20% FBS, 150 μg / ml ECGF, penicillin-streptomycin mixture (50 U / ml) and porcine heparin (10 U / ml).

On the other hand, aortic endothelial cells were isolated from the thoracic aorta of male Wistar rats aged 3-5 weeks. The thoracic aorta was removed and cut into a sheet. The lumen was scraped off in a dispase and collagenase solution to collect endothelial cells. The cells were cultured in M199 medium supplemented with 10% FBS, 50 μg / ml Endothelial growth supplement, penicillin-streptomycin mixture (50 U / ml), and porcine heparin (10 U / ml). All the cells were cultured under the conditions of 37 ° C. and 5% CO ₂ .

  Hereinafter, a method for detecting a gene that is predominantly expressed in cerebral vascular endothelial cells by the Suppression Subtractive Hybridization (SSH) method and the detected rat BEC-1 gene fragment will be described.

  The Suppression subtractive hybridization (SSH) method was selected to analyze genes that are predominantly expressed in cerebral vascular endothelial cells (Diatchenko L et al, 1996).

  Cerebrovascular endothelial cells and aortic endothelial cells separated and cultured by the above method were prepared. Total RNA was extracted from both by ISOGEN (Nippongene). Poly A + RNA was extracted with Oligotex-dT30 (TaKaRa). 5 μg of poly A + RNA was subjected to reverse transcription reaction with SuperScript II reverse transcriptase (Gibco) to prepare a cDNA library. PCR-Select cDNA subtraction kit (Clontech) was used for SSH. Using cerebrovascular endothelial cDNA as a tester and aortic endothelial cDNA as a driver, both were digested with the restriction enzyme RsaI and digested into short blunt-ended DNA fragments.

  Next, the tester was divided into equal amounts, and adapter 1 and adapter 2R were added to each. The adapter 1 addition tester and a sufficient amount of driver were hybridized (98 ° C 1.5 minutes, 68 ° C 8 hours). Similarly, an adapter 2R addition tester and a sufficient amount of driver were hybridized. Furthermore, both testers and a sufficient amount of driver were hybridized (68 ° C., 16 hours). This completed the Subtracted cDNA library.

  By using this as a template, first PCR 30 cycles (94 ° C 30 seconds, 66 ° C 30 seconds, 72 ° C 1.5 minutes) and Second PCR 14 cycles (94 ° C 30 seconds, 68 ° C 30 seconds, 72 ° C 1.5 minutes) Only genes that are predominantly expressed in cerebral vascular endothelial cells were amplified. LA-Taq (TaKaRa) was used as the enzyme. The PCR product was subcloned with pCR2.1-TOPO (Invitrogen), transformed into TOP10F 'competent cell (Invitrogen), and LacZ non-expressing cells (vector positive in which gene fragments expressed predominantly in cerebral vascular endothelium were incorporated) Cells) were detected by X-gal and picked up. Large-scale culture was performed in LB medium, and plasmid extraction was performed using BioRobot (QIAGEN).

  Furthermore, the plasmid was blotted onto Hybond N + (Amersham) using a 96 well dot-blot system (BIO-RAD). Using a PCR-Select Differential Screening kit (Clontech), the membrane was hybridized with a 32P-labeled tester and a driver cDNA probe. Hot spots were quantified with a STORM imaging analyzer (Amersham), and gene fragments that were expressed more than 3 times in the cerebral vascular endothelium were selected as positive. The nucleotide sequence of the gene fragment was determined using 3700 Sequencing system (Applied Biosystems), and homology search was performed using BLAST (NCBI, NIH).

  As described above, 24 genes with known functions, 20 sequences with unknown functions including 7 ESTs, and a novel gene fragment G6 were detected.

For the novel gene fragment G6 detected from rat brain vascular endothelial cells, the unknown portion on the 5 ′ side was cloned by 5′-RACE using Marathon-Ready rat Kidney cDNA (Clontech) as a template.
(5'-RACE)
cDNA: Marathon-Ready cDNA rat Kidney (Clontech)
primer (5 '→ 3')
G6-R4 tcaagtcccgataaggataacgtgc (SEQ ID NO: 8)
G6-R2 ctgggttggccatgttgact (SEQ ID NO: 9)
Anchor primer (5 '→ 3')
AP1 ccatcctaatacgactcactatagggc (SEQ ID NO: 10)
AP2 actcactatagggctcgagcggc (SEQ ID NO: 11)
PCR was performed with a combination of AP1 and G6-R2, and nested PCR was performed with AP2 and G6-R4 using the PCR product as a template, and the nucleotide sequence of the obtained fragment was determined. On the other hand, the 3 ′ side was cloned using Rat Adipose Tissue 3′-RACE cDNA (Biochain) as a template.
(3'-RACE)
cDNA: 3'-RACE cDNA rat Adipose (Biochain)
primer (5 '→ 3')
G6-F12 tggagcagaatggtcacagcctac (SEQ ID NO: 12)
LOST1-F1 gatcctggcttcagactgttag (SEQ ID NO: 13)
Anchor primer (5 '→ 3') ggatccactgcagtggaattc (SEQ ID NO: 14)
PCR was performed with a combination of G6-F12 and Anchor primer, and a poly A sequence was confirmed in a fragment obtained by nested PCR with a combination of LOST1-F1 primer and Anchor primer. As a result, a sequence having a total length of 3410 bp was obtained (SEQ ID NO: 6). The ORF was complete in the sequence and was 522 bp. The deduced amino acid sequence was 173 amino acid residues. This gene showed very high homology with the human TUSC5 gene (GenBank Accession Number: NM_172367) in BLAST (Identity 85%). This ORF was determined to be a rat TUSC5 gene, together with the fact that it could be amplified by PCR from the above-mentioned two types of cDNA libraries. In addition, since a poly A site was also detected at the 3 ′ end of 3410 bp, it was confirmed that the sequence was highly likely to be the full length of rat TUSC5 mRNA.

(Expression of TUSC5 gene in normal rat tissue)
1. Primer set
As GAPDH, a primer set enclosed with TaqMAN Rodent GAPDH Control Reagents (Applied Biosystems) was used.

  For TUSC5, primers for real-time quantitative PCR were selected based on SEQ ID NO: 6 (rat TUSC5) using the probe search software Primer Express (Applied Biosystems). The primer sets of SEQ ID NO: 15 and SEQ ID NO: 16 (manufactured by Amasham Pharmacia) were used as PCR primers for TUSC5.

2. TaqMAN Probe
TaqMAN Probe was modified with a quencher substance (TAMRA) at the end.

  For GAPDH, a probe enclosed with TaqMAN Rodent GAPDH Control Reagents (Applied Biosystems) was used. VIC was used as a reporter.

  TUSC5 used a probe of SEQ ID NO: 17 (manufactured by Applied Biosystems) designed by Primer Express. FAM was used as a reporter.

3. cDNA
As a fat cell, 3'-RACE cDNA Rat Tissue Adipose (Biochain) was used.

  As the brain, heart, kidney liver, lung, skeletal muscle, spleen and testis cells, RAT MTC Panel I (manufactured by CLONTECH) was used.

4). Preparation of TaqMAN reaction solution
For each of GAPDH and TUSC5, reaction solutions having the compositions shown in Table 1 were prepared. This reaction solution was treated at 50 ° C. for 2 minutes and at 95 ° C. for 2 minutes, and then subjected to 40 cycles of reaction at 95 ° C. for 15 seconds and 60 ° C. for 1 minute to obtain a PCR product from this reaction solution. PCR reaction and fluorescence measurement were performed with ABI PRISM 7000 Sequence Detection System (Applied Biosystems).

  The expression results of the TUSC5 gene in each cell are shown in FIG. The graph of FIG. 1 shows the expression level of TUSC5 corrected with GAPDH as a relative value (ΔCt (GAPDH−TUSC5)). In real-time quantitative PCR, it was confirmed that only one kind of target was amplified by electrophoresis and melting curve of the amplified product. As shown in FIG. 1, TUSC5 mRNA expression was unevenly distributed in normal rat tissues, but a markedly high expression was confirmed particularly in adipose tissues.

(Expression of TUSC5 gene during differentiation induction of 3T3-L1 cells)
3T3-L1 cells were seeded in 6-well plates and cultured until 100% confluent. As the culture solution, Dulbecco's Modified Eagle Medium (D-MEM) containing 10% bovine serum was used. Thereafter, the culture medium was replaced with a culture medium (D-MEM, 10% fetal bovine serum, 0.25 nM dexamethasone, 0.5 mM IBMX, 10 μg / ml insulin) for induction of differentiation into adipocytes. After a period of time, the cells were replaced with a cell maintenance medium (D-MEM, 10% fetal bovine serum, 5 μg / ml insulin) to maintain the cultured cells.

  The collection of RNA from cultured cells for TUSC5 mRNA measurement was performed 48 hours, 72 hours, 96 hours, 120 hours, and 144 hours after 0 hours immediately before induction of differentiation. The result is shown in FIG.

  As shown in FIG. 2, a marked increase in the expression of TUSC5 mRNA was observed 48 hours after differentiation induction, and it was confirmed that the increase lasted up to 144 hours.

(Expression of TUSC5 gene in each adipose tissue of rat)
Expression of TUSC5 mRNA in adipose tissue of Wistar rats
TUSC5 mRNA of brown fat (BAT), subcutaneous fat (Subcutaneous), epididymal fat (Perirenal), perirenal fat (Perirenal), and mesenteric fat (Mesenteric) of 10 week old male Wistar rats was measured. Rats were killed by decapitation and each adipose tissue was collected. The tissue was frozen on dry ice and stored at −80 ° C. until assayed. Measurement of mRNA was performed as follows. First, each adipose tissue was homogenized with polytron, and then mRNA was extracted with an RNA extraction kit. Subsequently, TUSC5 and β-actin mRNA were measured by real-time PCR. The measurement result was displayed as the difference between the number of cycles (β-actin−TUSC5) (FIG. 3). As shown in FIG. 3, high expression of TUSC5 mRNA was observed in brown fat, subcutaneous fat, epididymal fat and perirenal fat, while the expression level in mesenteric fat was low compared to these sites. It was confirmed that.

(Expression of TUSC5 gene in adipose tissue of healthy and obese rats)
Expression of TUSC5 mRNA in adipose tissue of Zucker lean and Zucker fatty rats
The aforementioned adipose tissues were collected from 10-week-old male Zucker lean rats and Zucker fatty rats, and mRNA in the tissues was measured in the same manner as the mRNA measurement method in each adipose tissue of rats. The measurement results were expressed as a ratio of TUSC5 mRNA / β-actin mRNA (FIG. 4). As shown in FIG. 4, the difference in the expression level of TUSC5 mRNA in brown fat, subcutaneous fat, accessory testicular fat, perirenal fat and pericardial fat could not be confirmed between lean and fatty rats. However, as shown in FIG. 4, the expression level of TUSC5 mRNA in fatty rat mesenteric fat (Mesenteric) confirmed a clear increase compared to lean rats.

(Expression of TUSC5 gene in brown adipose tissue of healthy and obese rats)
Expression of TUSC5 mRNA in brown adipose tissue of Zucker lean and Zucker fatty rats
Ten-week-old male Zucker lean rats and Zucker fatty rats were exposed to cold (4 ° C., 6 hours), brown adipose tissue was collected, and TUSC5 mRNA in the tissue was measured by the method described above. The result is shown in FIG. As shown in FIG. 5, it was confirmed that the TUSC5 mRNA was significantly decreased in the lean rats by cold exposure. In fatty rats, TUSC5 mRNA decreased. Furthermore, it was confirmed that the expression of TUSC5 mRNA in fatty rats was significantly higher than that in lean rats after cold exposure.

  As described above, in the healthy rats, a relationship between the promotion of heat production and the suppression of the expression of the TUSC5 gene is recognized based on the above finding that the expression of the TUSC5 gene was reduced by exposure to cold. In addition, as described above, when heat production is promoted, obesity is treated or prevented. Therefore, an anti-obesity agent or an anti-obesity agent can be screened by using the expression level of the TUSC5 gene as an index.

  As described above, the screening method of the present invention can provide a therapeutic agent for obesity or a prophylactic agent for obesity, and is thus useful, for example, in the field of treatment and prevention of obesity.

It is the figure which showed the expression of the TUSC5 gene in a rat normal tissue. It is the figure which showed the expression of the TUSC5 gene at the time of differentiation induction of 3T3-L1 cell. It is the figure which showed the expression of the TUSC5 gene in each fat tissue of a rat. It is the figure which showed TUSC5 gene expression in each fat tissue of a healthy rat and an obese rat. It is the figure which showed the TUSC5 gene expression in the brown adipose tissue of a healthy rat and an obese rat after cold exposure.

SEQ ID NO: 1 TUSC5 gene (human)
SEQ ID NO: 2 TUSC5 protein (human)
SEQ ID NO: 3 TUSC5 gene (mouse)
SEQ ID NO: 4 TUSC5 protein (mouse)
SEQ ID NO: 5 TUSC5 gene (rat)
SEQ ID NO: 6 TUSC5 gene (rat)
SEQ ID NO: 7 TUSC5 protein (rat)
SEQ ID NO: 8 5′-RACE primer SEQ ID NO: 9 5′-RACE primer SEQ ID NO: 10 5′-RACE anchor primer SEQ ID NO: 11 5′-RACE anchor primer SEQ ID NO: 12 3′-RACE primer SEQ ID NO: 13 3'-RACE primer SEQ ID NO: 14 3'-RACE anchor primer SEQ ID NO: 15 PCR primer SEQ ID NO: 16 PCR primer SEQ ID NO: 17 Probe

Claims (11)

A method for screening an obesity treatment agent or an obesity prevention agent,
The screening method characterized by including the process of searching the substance which suppresses the expression of TUSC5 gene in presence of a test substance. The screening method according to claim 1, wherein the step of searching for the substance includes the following steps (I) to (III).
(I) a step of contacting a cell capable of expressing a TUSC5 gene with the test substance,
(II) measuring the expression level of the TUSC5 gene in the cell contacted with the test substance, and (III) comparing the expression level with the expression level of the TUSC5 gene in a control cell not contacted with the test substance. And selecting a test substance that decreases the expression level of the TUSC5 gene.   The screening method according to claim 1 or 2, wherein the TUSC5 gene is a gene consisting of the nucleotide sequence set forth in SEQ ID NOs: 1, 3, 5 or 6.   The screening method according to any one of claims 1 to 3, wherein the obesity therapeutic agent or obesity preventing agent is a heat production promoter.   A kit for screening an obesity therapeutic agent or an obesity preventive agent used in the screening method according to any one of claims 1 to 4, wherein the kit comprises a polynucleotide encoding a TUSC5 protein. A method for screening an obesity treatment agent or an obesity prevention agent,
The screening method characterized by including the process of searching the substance which suppresses the expression of TUSC5 protein in presence of a test substance. The screening method according to claim 6, wherein the step of searching for the substance includes the following steps (I) and (II).
(I) a step of bringing the TUSC5 protein into contact with the test substance;
(II) A step of detecting the binding between the TUSC5 protein and the test substance and selecting a test substance that binds to the TUSC5 protein. The screening method according to claim 6, wherein the step of searching for the substance includes the following steps (I) to (III).
(I) contacting the test substance with a cell capable of expressing a TUSC5 protein or a cell fraction prepared from the cell;
(II) a step of measuring the expression level of the TUSC5 protein in the cell or cell fraction contacted with the test substance, and (III) a control cell or the control cell in which the expression level is not contacted with the test substance Selecting a test substance that reduces the expression level of the TUSC5 protein compared to the expression level of the TUSC5 protein in the control cell fraction prepared from the above.     The screening method according to any one of claims 6 to 8, wherein the TUSC5 protein is a protein consisting of the amino acid sequence of SEQ ID NO: 2, 4 or 7.   The screening method according to any one of claims 6 to 9, wherein the anti-obesity agent or obesity-preventing agent is a heat production promoter.   A kit for screening an obesity therapeutic agent or an obesity preventing agent used in the screening method according to any one of claims 6 to 10, wherein the kit contains a TUSC5 protein.

Images