JP2007089524A - SYSTEM FOR SELECTING delta-ENDOTOXIN VARIANT HAVING IMPROVED EFFECT ON TARGET INSECT - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a system for selecting a δ-endotoxin variant having improved effect on a target insect. <P>SOLUTION: The method for selecting a toxin protein variant having increased insecticidal activity to the target insect comprises the preparation of a toxin presentation phage to express an insecticidal toxin protein by a T7 phage in the form bindable to its receptor, the selection of a toxin presentation phage having a binding affinity to a carrier by using a carrier bound with the receptor, and the selection of a variant having increased binding affinity to the receptor by using the system. An insecticidal composition contains the variant as an active body, and a vermin-resisting plant contains a gene encoding the variant and introduced into the plant in an expressible manner. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a method for selecting an insecticidal toxin protein, a toxin protein selected by the method, and an application technique thereof, and more specifically, an insecticidal toxin protein mutant that specifically acts on a target insect. Selection method, toxin protein mutant having increased binding affinity for a receptor obtained by using the selection method, gene encoding the mutant, and insecticidal composition comprising the mutant as an active body And a pest-resistant recombinant plant into which the mutant gene has been introduced.

BT bacteria ( Bacillus thuringiensis bacteria) are gram-positive soil bacteria and produce δ endotoxin, an insecticidal protein that is harmless to the human environment. Until now, humans have developed BT bacteria δ endotoxin, which is practically used as the active body of insecticides and insect-resistant recombinant crops, isolated thousands of BT bacteria from soil, and used them as target pests for their lethal activity Has been conducted through bioassay (Non-patent Document 1). As a result of such operations being carried out all over the world since the 1940s, a considerable number of useful BT strains were discovered among hundreds of thousands of strains, some of which were used as microbial insecticides. It has been applied. In addition, a part of the BT fungal δ endotoxin is a genetic material for imparting pest resistance to recombinant crops (Non-patent Document 2).

  On the other hand, by constructing a mutant library in which antibody mutants are expressed on phage and selecting mutants having binding properties to the antigen, antibodies that bind better to the antigen are selected. Evolved molecular engineering techniques have achieved great results (Non-Patent Documents 3 and 4). As a result, not only naturally occurring antibody proteins can be used, but also humans can cultivate themselves by using antibody proteins that have acquired the desired properties as antibody utilization technologies.

  Experience has shown that synthetic insecticides are found to be marketed as insecticides at a rate of one in tens of thousands of specimens, and companies can pre-calculate development costs. However, for example, in the case of BT bacterium or its δ endotoxin, not only does it take a great deal of labor, time and cost to isolate BT bacterium from soil, but there is no guarantee that BT bacterium that works well for the target pest will be found. The development cost cannot be read. Therefore, the birth of other methods is desired for the development of BT bacteria. Moreover, even if BT bacteria effective for target pests were found, most of them were less effective than synthetic insecticides, and they could not make good products for high development and production costs. . Therefore, a technique for increasing the specific activity of δ endotoxin, which is the main body of the activity of BT bacteria, is desired.

  On the other hand, evolutionary molecular engineering, which has been successful with antibody proteins, has reached a practical position for the first time by expressing antibody proteins on M13 phage using a technique called phage display method. By the way, it is considered that this technique can be used to improve the binding affinity of various binding proteins. Thus, this technique should have potential applications in principle for improving the binding affinity of δ endotoxin to insect receptors.

  However, in reality, no laboratory in the world has been able to realize phage display of δ endotoxin that satisfies the conditions that can be used in evolutionary molecular engineering because δ endotoxin is bad for E. coli. Non-Patent Documents 5 and 6), evolutionary molecular engineering of δ endotoxin has not been realized.

  If the use of the phage display method becomes possible, the “less effective BT fungal δ endotoxin” obtained relatively easily will be used as a starting material, and it will be improved in terms of evolutionary molecular engineering. It would be possible to construct a system that produces a δ endotoxin that binds well to the pest and consequently works well against the pest. However, in reality, the use of such a functional phage display method has not been realized, and the phages necessary for carrying out the evolutionary molecular engineering for the receptor of the digestive tract of insects as a binding target. And the “selection system” for toxin protein variants remains unfinished.

  On the other hand, the δ endotoxin produced by BT bacteria has a very high insecticidal specificity for target insects, and is decomposed in the environment and has no possibility of becoming a source of contamination. Has been. However, the BT δ endotoxin has problems such as the emergence of resistant insects and a narrow bactericidal spectrum, and there is a demand for improvement thereof. In particular, a toxin protein mutant having a high binding property to a receptor is required. Development has become an important issue.

  As conventional techniques, for example, an antibody that specifically reacts with a binding protein (BP) to a BT fungal δ endotoxin present on the brush border membrane of a pest midgut and a BT fungus δ that recognizes BP using the antibody An endotoxin identification method has been proposed (Patent Document 1). In addition, an insecticidal composition containing a BT δ endotoxin mutant or derivative suitable for oral application to insects has been proposed (Patent Document 2).

  Moreover, the BT fungal insecticidal structural gene is incorporated into the rice plant genome so that δ endotoxins such as the BT strain or the full-length CrylII toxin and Cyt toxin derived therefrom are expressed in plant tissues infested by rice weevil. There has been proposed a method of administering BT fungal δ endotoxin from the plant body to the rice weevil by insertion (Patent Document 3). In addition, an agrochemical composition having an agrochemical activity against dipterous pests and containing at least about 0.05% / g BT δ endotoxin has been proposed (Patent Document 4). In addition, a chimeric toxin comprising a CrylF core N-terminal toxin moiety and a heterologous C-terminal protoxin moiety derived from a CrylAb toxin or a CrylAc / CrylAb chimeric toxin is used to remodel the gene encoding BT fungal endotoxin Thus, a method for improving the expression of BT endotoxin in Pseudomonas has been proposed (Patent Document 5).

JP-A-5-202099 JP-T-2001-5080329 Japanese National Patent Publication No. 11-501318 Japanese National Patent Publication No. 10-504451 Japanese National Patent Publication No. 10-500292 Edited by Masao Okada et al., Research methods of natural enemy microorganisms, 222p. , Japan Plant Protection Association (1993) Ryoichi Sato, Materialization of insect pathogenic bacteria, pp194-214, (Microbial materialization: Research front: Takahito Suzuki, Saio Okada, Hirohisa Kunimi, Takahiro Makino, Masanori Saito, Kiyotaka Miyashita, 364pp.) (2000) Schier R, Bye J, Apell G, McCallA, Adams GP, Malmqvist M, Weiner LM, Marks JD.Isolation of high-affinity monomerichuman anti-c-erbB-2 single chain Fv using affinity-driven selection.J Mol Biol. 1996 Jan 12; 255 (1): 28-43 Thompson J, Pope T, Tung JS, ChanC, Hollis G, Mark G, Johnson KS.Affinity maturation of a high-affinity human monoclonalantibody against the third hypervariable loop of human immunodeficiency virus: useof phage display to improve affinity and broaden strain reactivity. J Mol Biol. 1996 Feb 16; 256 (1): 77-88 Kasman LM, Lukowiak AA, GarczynskiSF, McNall RJ, Youngman P, Adang MJ. Phage display of a biologically active Bacillusthuringiensis toxin. Appl Environ Microbiol. 1998 Aug; 64 (8): 2995-3003 Marzari R, Edomi P, Bhatnagar RK, Ahmad S, Selvapandiyan A, Bradbury A. Phage display of Bacillus thuringiensis CryIA (a) insecticidal toxin. FEBS Lett. 1997 Jul 7; 411 (1): 27-31

  Under such circumstances, the present inventor has established a new “selection system” that makes it possible to carry out evolutionary molecular engineering targeting receptors in the digestive tract of insects in view of the above-mentioned conventional techniques. As a result of intensive research as a goal, we succeeded in expressing BT fungal endotoxin on T7 phage in a form binding to cadherin-like protein, a receptor on the digestive tract of insects. Using this, the present inventors have succeeded in establishing a method for selecting a toxin-displaying phage that binds to the above-described carrier bound to the receptor, and further researched to complete the present invention. It came.

  An object of the present invention is to provide a method for selecting a mutant of an insecticidal toxin protein that is more effective against a target insect. The present invention also includes selecting a mutant having increased binding affinity for a receptor from various mutants, and thereby selecting a mutant having increased insecticidal activity against a target insect. It is an object of the present invention to provide a method for selecting novel insecticidal toxin protein mutants that can be selected. Furthermore, an object of the present invention is to provide an insecticidal composition comprising the mutant as an active body, and a pest-resistant recombinant plant into which the gene encoding the mutant is introduced so that the gene can be expressed. Is.

The present invention for solving the above-described problems comprises the following technical means.
(1) A method for selecting a mutant of a toxin protein having increased insecticidal activity against a target insect,
1) producing a toxin-displaying phage in which an insecticidal toxin protein is expressed on T7 phage in a form binding to its receptor;
2) Using the carrier to which the receptor is bound, a toxin-displaying phage having binding affinity for them is selected.
3) Using the above system, select mutants with increased binding affinity for the receptor.
A method for selecting mutants.
(2) The method according to (1) above, wherein a toxin-displaying phage expression vector is obtained by infecting a host with a toxin-displaying phage expression vector, allowing the host to propagate, and cloning a phage clone.
(3) The method according to (1) above, wherein a mutant library is constructed using the above system, and mutants having increased binding affinity for the receptor are selected from the mutants. .
(4) The method according to (1) above, wherein δ endotoxin is used as an insecticidal toxin protein, and cadherin-like protein, δ endotoxin binding molecule, or receptor substitute is used as a receptor.
(5) The target mutant having increased binding affinity is obtained by repeatedly selecting a mutant using a mutant obtained by mutating an existing insecticidal toxin protein. the method of.
(6) The method according to (1) above, wherein the carrier is a plate, gel, membrane, fiber or bead.
(7) The method according to (1) above, wherein in the step of selecting a mutant, the operation of concentrating the toxin-displaying phage using magnetic beads to which the receptor is bound is repeated to obtain a concentrated toxin-displaying phage. .
(8) A mutant obtained by the selection method according to any one of (1) to (7), having increased binding affinity for a receptor, or a gene encoding the mutant.
(9) An insecticidal composition comprising the mutant according to (8) as an active body.
(10) A pest-resistant recombinant plant, wherein the gene encoding the mutant according to (8) is introduced into a plant so that the gene can be expressed.
(11) The insect-resistant recombinant plant according to (10), wherein the plant is an edible crop.

Next, the present invention will be described in more detail.
The present invention relates to a method for selecting a mutant of a toxin protein that has increased insecticidal activity against a target insect, and (1) a T7 phage having a binding property to the receptor of the insecticidal toxin protein. Producing an expressed toxin-displaying phage; (2) selecting a toxin-displaying phage having a binding affinity to the receptor using the carrier bound to the receptor; (3) receiving using the system described above; Using the above system, a mutant library is constructed by selecting mutants having increased binding affinity for the body, and using the above system. The method is characterized by the above-described method for selecting a mutant having increased binding affinity for a receptor.

  In addition, the present invention includes a mutant having increased binding affinity for a receptor obtained by the above selection method, or a gene encoding the mutant, and the above mutant as an active body. And a pest-resistant recombinant plant characterized by introducing a gene encoding the above-described mutant into a plant so that the gene can be expressed. is there.

  In the present invention, examples of the insecticidal toxin protein include δ endotoxin of BT which is an insecticidal toxin protein that is harmless to the human environment, and mutants or derivatives obtained by adding any mutation to the protein. However, the present invention is not limited to these, and the present invention is not limited to these types as long as it has the same or similar functionality as those of the present invention. Examples thereof include other insecticidal toxin proteins produced by bacteria or toxin proteins produced by plants. In the present invention, like the above-mentioned δ endotoxin, by selecting a mutant which is an existing insecticidal toxin protein and has increased binding affinity with a receptor present on the digestive tract of insects, etc. It would be desirable to use an insecticidal toxin protein variant that results in the selection of variants that have increased insecticidal activity against the target insect. Further, in the present invention, as the receptor, a toxin protein-binding molecule, a receptor candidate molecule, or the like that is shown to be functional in a physiological sense, such as a receptor for the toxin protein, aminopeptidase N, and the like. Any suitable receptor substitute can be used. Hereinafter, in the present specification, as an insecticidal toxin protein, a method using a BT bacterium δ endotoxin protein and a variant thereof will be described as an example.

  In the present invention, for example, a T7 phage expression vector is preferably constructed for displaying, for example, the BT bacterial δ endotoxin protein on the capsid protein of T7 phage. In this case, commercially available products (such as Novagen T7Select10-3b) can be used as the T7 phage expression vector. As the gene for δ endotoxin, for example, an arbitrary gene region such as Cry1Aa toxin and Cry1Ab toxin is used, and this is amplified by PCR using an arbitrary primer. The obtained amplified fragment was digested with a restriction enzyme and then inserted into a T7 phage expression vector digested in the same manner. The completed toxin-displaying phage expression vector was packaged with Pakagin Kit to obtain phage particles. The host is infected and propagated, and the phage clone is cloned to obtain a toxin-displayed phage.

  In this case, the host is preferably exemplified by, for example, E. coli, but is not limited thereto, and any host can be used as long as it can clone a phage clone capable of expressing the predetermined gene region of the δ endotoxin. Any suitable host can be used. According to the above-described method, δ endotoxin protein is displayed on the phage by the process of creating a gene-inserted phage clone encoding a protein of δ endotoxin (each of the toxins of δ endotoxin subclass including 100 Cry1Aa toxin, Cry1Ab toxin, etc.). In addition, a δ endotoxin-displaying phage in which the protein is expressed as a fusion protein with capside protein 10B can be obtained.

  Next, in the present invention, a mutant library is constructed using the above system, and mutants having increased binding affinity for the receptor are selected from these mutants. In this case, the target mutant with increased binding affinity is obtained by repeating selection of the mutant using a mutant in which an existing insecticidal δ endotoxin protein is mutated. Arbitrary methods can be used as a method for introducing mutation into the δ endotoxin protein, and a mutant having an arbitrary sequence can be used. In the present invention, in the mutant selection step, a concentration operation for concentrating the δ endotoxin-displaying phage can be performed using magnetic beads to which the receptor is bound. By repeating this concentration operation, a concentrated δ endotoxin-displaying phage can be obtained.

  Next, whether or not the δ endotoxin gene-inserted phage has the original receptor-binding ability of binding to the δ endotoxin receptor was determined. The δ endotoxin-displayed phage was found to have binding affinity for the receptor. It was also revealed that the binding affinity differs depending on the type of δ endotoxin and receptor. That is, in the present invention, by combining various δ endotoxins and receptor types arbitrarily, for example, even if a phage that does not bind to a receptor or a δ endotoxin is expressed, the binding is low. Phage expressing a δ endotoxin and having a high binding affinity for a receptor can be selected from the phage, thereby establishing a selection system for a δ endotoxin-displaying phage.

In the present invention, the difference in the binding affinity between the δ endotoxin-displaying phage and the wild-type phage is increased by using the carrier bound to the receptor. It is possible to construct a new phage selection system that can efficiently select phages with high binding affinity. In the present invention, for example, a plate or a bead is used as the carrier, and examples thereof include Corning, Coster 9018 Micro-well Plate, and Promega's Magne GST ^™ Glutathione Particle.

  In the present invention, a library of δ endotoxin protein variants into which various mutations have been introduced is constructed using the above-mentioned δ endotoxin-displaying phage, and among these, mutations that have increased binding affinity for the receptor. The body can be selected. In that case, as described above, it is possible to perform a concentration operation by the magnetic bead method. By continuously performing the concentration operation, for example, a specific δ endotoxin-displayed phage is about 200 to 130,000 times larger. It is possible to concentrate. As described above, in the present invention, it is possible to efficiently concentrate a desired clone having a high binding affinity for the receptor by repeating the above enrichment operation from a mutant library using δ endotoxin-displaying phages. is there.

  Next, in the present invention, a desired δ endotoxin protein mutant is recovered from the δ endotoxin-displaying phage clone by a conventional method, and a gene encoding a specific mutant designed based on the amino acid sequence of the mutant is obtained. It can be used to produce large quantities of mutants by appropriate genetic recombination techniques. The obtained mutant having high binding affinity for the receptor can be used as the active body of the insecticidal composition, and the gene encoding the mutant can be appropriately treated. It is possible to produce a pest-resistant plant by introducing it into the plant so as to allow expression. In the present invention, a desired insecticide and pest-resistant crop are selected according to the above-described method using various mutants having increased binding affinity for the receptor and genes thereof selected by the above-described method. , Can be arbitrarily designed and manufactured.

  When ingested by insects, δ endotoxin is solubilized by alkaline conditions in the midgut, processed by proteases in the midgut, and becomes an active toxin that has insecticidal activity against the target insect. This active toxin binds to a receptor present on the midgut cell membrane of insects, causes a structural change on the membrane, and by forming pores, the osmotic pressure balance is disrupted, causing lysis and swelling of epithelial cells, The cell ruptures, thereby impairing the target insect's ability to absorb nutrients in the gut. To death. The present invention has designed and produced various mutants of such δ endotoxin, and a new selection for selecting a specific mutant having an increased binding affinity for a receptor from these mutants. It is useful for providing a system, and provides an insecticide having such a mutant as an active body, and a pest-resistant crop in which a gene encoding such a mutant is introduced into a crop body. Useful as something to do.

  As described above, the present invention has been specifically explained by taking the δ endotoxin protein of BT bacteria as an example, but the present invention is not limited to the case of the above-mentioned δ endotoxin protein. The present invention can be similarly applied to any mutants, derivatives thereof, and all kinds of toxin proteins, mutants and derivatives thereof having functions and action mechanisms equivalent or similar to these. In the present invention, the present invention can be applied to all kinds of insecticidal toxin proteins and receptors by using the method for constructing the toxin-displaying phage, the method for constructing the mutant library using the phage, and the selection system for the mutant. A variety of plants, such as pesticides applicable to the desired target insects corresponding to them, and food crops that have imparted pest resistance can be established. It can be realized.

The following effects are exhibited by the present invention.
(1) By constructing a mutant library using a toxin-displaying phage in which a mutant of an insecticidal toxin protein is expressed on a phage and selecting it against the receptor, the receptor is better It is possible to select mutants that bind.
(2) By using such evolutionary molecular engineering techniques, we can break away from simply using naturally occurring genes and their expression products, and nurture proteins that have acquired the desired properties by themselves. It is possible to obtain a desired mutant.
(3) Based on the same principle, for example, a delta endotoxin library prepared from a cadherin-like protein that is a receptor molecule prepared from a target insect and a δ endotoxin gene having a weak activity in the insect is constructed. It is possible to produce δ endotoxin with increased binding affinity for the insect cadherin-like protein by using the panning method or bead method, which is a selection method. .
(4) Further, by using the mutant δ endotoxin library prepared from the gene of δ endotoxin having a strong insecticidal activity against the target insect, the above selection is repeated, so that the cadherin-like protein of the insect is protected. Furthermore, it is possible to obtain δ endotoxin having a high binding affinity.
(5) Speaking pharmacologically, a mutant substance having increased binding affinity for the receptor will act at a lower concentration than the starting substance, resulting in increased activity. That is, by using the method of the present invention, it becomes possible to produce a δ endotoxin that is more effective against target insects in terms of evolutionary molecular engineering. Furthermore, by using the above-mentioned δ endotoxin library and cadherin-like protein, etc., to select mutants having increased binding affinity to the receptor, natural δ endotoxins effective so far are completely known. It is also possible to produce δ endotoxins that are active against insects that were not.
(6) The variety of δ endotoxins so produced can be easily found in nature and far beyond the number that humans can realistically find. Moreover, they are proteins having the same folding as that of natural δ endotoxin, and it is considered that they are not chemically different from many natural mutant δ endotoxins produced by BT bacteria.
(7) According to the present invention, a safe protein for human animals and the global environment is created by evolutionary molecular engineering just like natural δ endotoxin, and a novel insecticide and pest-resistant crop using the same are provided. it can.
(8) It is also possible to generate δ endotoxin that kills insects through the use of the second and third receptors that may be revealed in the future as substitutes for cadherin-like protein. It is.

  EXAMPLES Next, although this invention is demonstrated concretely based on an Example, this invention is not limited at all by the following Examples.

(1) Construction of Cry1Aa Toxin-Displaying Phage and Cry1Ab Toxin-Displaying Phage Expression Vector Two types of δ endotoxins (Cry1Aa toxin and Cry1Ab toxin) were constructed to display on the capsid protein of T7 phage. The outline of the construction method of Cry1Aa and Cry1Ab expression phage vectors is shown in FIG. Novagen T7Select10-3b was used as the T7 phage expression vector. First, a gene region (amino acids at positions 29 to 618) containing domains 1 to 3 of Cry1Aa toxin and Cry1Ab toxin was amplified by PCR.

  Act-As-s-Bam (5'-TGGGGATCCAATAGAAACTGGTTACCACCCCAAT-3 ') and act-Aa-as-Not (5'-TCATTCACCGCCCGCCGCGGCTCTTTCTATCATCTCATCTCTCATCTCT CTCTACTCTGCTCT) which introduced a restriction enzyme cleavage site were used. The obtained amplified fragments were digested with BamHI or NotI and then inserted into T7Select10-3b vector digested with BamHI and NotI. The completed Cry1A toxin-expressing phage vector was packaged with a T7 Select Packaging Kit to form phage particles, propagated by infecting E. coli, and a phage clone was cloned.

(2) Confirmation of δ Endotoxin Expression on T7 Phage For the purpose of confirming that the obtained Cry1Aa toxin and Cry1Ab toxin gene-inserted phage clones are actually displaying the respective toxin proteins on the phage, Two experiments were performed.

  First, each phage clone was mixed with Escherichia coli and then spread on a plate to make a large number of plaques, which were placed on a nitrocellulose membrane to transfer phage particles. After blocking the membrane with calf serum albumin (BSA), Cry1Aa toxin-specific mouse monoclonal antibody (2F9) or anti-Cry1Aa toxin mouse serum as the primary antibody, and FITC-labeled anti-mouse IgG antibody as the secondary serum It was made to react and it was investigated whether each toxin was expressing on the phage with the ECL detection reagent. The results are shown in FIGS.

  As a result, for the monoclonal antibody 2F9, T7 phage (wild type phage) that did not express anything and Cry1Ab toxin gene insertion phage did not react at all (FIGS. 2B and C), but Cry1Aa toxin gene insertion phage did not react. A strong signal was obtained (FIG. 2A).

  On the other hand, the wild type phage did not react at all against the anti-Cry1Aa toxin mouse serum (FIG. 2F), whereas the Cry1Aa toxin gene insertion phage reacted strongly (FIG. 2D). In addition, a slightly weaker signal was obtained with the Cry1Ab toxin gene insertion phage than with the Cry1Aa toxin gene insertion phage (FIG. 2E).

  Anti-Cry1Aa toxin mouse serum used as the primary antibody was prepared against Cry1Aa toxin. On the other hand, Cry1Ab toxin differs from Cry1Aa toxin by 60 amino acid residues. Therefore, it was considered that this primary antibody reacted with Cry1Ab toxin slightly weaker than Cry1Aa toxin.

  Next, prepare a large number of Cry1Aa toxin gene insertion phage and Cry1Ab toxin gene insertion phage, dissolve each in SDS-PAGE sample buffer, perform SDS-PAGE, and transfer the obtained protein band to nitrocellulose membrane Then, using the anti-Cry1Aa toxin serum or the like, the same operation as the above experiment was performed, and Western blotting was performed. The result is shown in FIG. 2G.

  As a result, no band was observed from the wild type phage, but a band of about 105 kDa was observed from the Cry1Aa toxin gene inserted phage and the Cry1Ab toxin gene inserted phage (FIG. 2G). Each δ endotoxin is expressed in a form bound to the C-terminus of 10B, which is a capside protein of T7 phage, so it should theoretically be a protein of 103 kDa. It was considered to be a fusion protein displayed on the T7 phage.

  From the above two experimental results, it was shown that, in the Cry1Aa toxin gene insertion phage and the Cry1Ab toxin gene insertion phage, each toxin protein is expressed as a fusion protein with 10B which is a capside protein.

(3) Confirmation of binding ability of δ endotoxin-displaying phage to the receptor Whether δ endotoxin-displaying phage has the ability to bind to the receptor of the toxin, in other words, the δ endotoxin thus displayed For the purpose of confirming whether or not it has the original receptor binding ability, an experiment was conducted using cadherin-like protein (BtR175), which is one of the receptors in the silkworm midgut, as a binding target. In this experiment, to examine the binding of Cry1Aa toxin-displayed phage and Cry1Ab toxin-displayed phage to the receptor molecule BtR175, the phage was mixed with a control plate or magnetic beads with or without BtR175 binding. After stirring, they were washed 5 times with PBST. Next, the phages bound to the magnetic beads were eluted with 1% SDS PBST, infected with E. coli, and the plaque forming unit was calculated.

  That is, first, the binding ability of Cry1Aa toxin-displaying phage and Cry1Ab toxin-displaying phage to BtR175 was compared with wild-type phage by biopanning. That is, an ELISA plate coated with BtR175 and a non-coated one were prepared, and phages were added and shaken. After washing, the number of phages bound to the plate was measured.

In the case of Cry1Aa toxin-displaying phage, 1.4 × 10 ⁷ out of 2.8 × 10 ¹⁰ phages to which BtR175 was added in the coating plate bound to the plate (FIG. 3A). In addition, when “the number of phages after biopanning / the number of phages before biopanning” was defined as a binding index (BI), it was 4.9 × 10 ⁻⁴ .

On the other hand, in the uncoated plate, 1.7 × 10 ⁵ out of the added 2.8 × 10 ¹⁰ phages were bound to the plate (BI = 6.1 × 10 ⁻⁶ ). The binding index of the Cry1Aa toxin-displaying phage to the BtR175 coated plate was about 80 times the binding affinity to the uncoated plate. In the Cry1Ab toxin-displaying phage, 6.5 × 10 ⁵ out of 4.3 × 10 ⁹ phages added to the BtR175 coated plate were bound to the plate (BI = 1.5 × 10 ⁻⁴ ) ( FIG. 3A).

In the uncoated plate, 1.3 × 10 ⁴ of the added 4.3 × 10 ⁹ phages were bound to the plate (BI = 3.2 × 10 ⁻⁶ ). The binding affinity of the Cry1Ab toxin-displaying phage to the BtR175 coated plate was about 47 times that of the uncoated plate. In the wild-type phage, 1.4 × 10 ⁵ out of 7.1 × 10 ⁹ phages bound to the BtR175 coated plate (BI = 2.0 × 10 ⁻⁵ ) (FIG. 3A).

In addition, in the uncoated plate, 4.8 × 10 ⁴ out of the added 7.1 × 10 ⁹ phages were bound to the plate (BI = 6.8 × 10 ⁻⁶ ). In the case of Wild-type phage, there was little difference in binding affinity between BtR175 coated and uncoated plates. The binding affinity (BI) of Cry1Aa toxin-displaying phage and Cry1Ab toxin-displaying phage to BtR175 was about 25 times and 8 times that of wild-type phage, respectively.

Next, the binding ability of Cry1Aa toxin-displaying phage and Cry1Ab toxin-displaying phage was compared with wild-type phage using magnetic beads. That is, magnetic beads coated with BtR175 and those not coated were prepared, phages were added, stirred, and washed, and the number of phages bound to the magnetic beads was measured. In BtR175 coated beads, 4.1 × 10 ^{8 of} Cry1Aa toxin-displayed phage were bound to magnetic beads out of the added 2.2 × 10 ¹⁰ phages (BI = 1.9 × 10 ^−2). (FIG. 3B).

On the other hand, in the uncoated beads, 4.6 × 10 ⁶ out of the added 2.2 × 10 ¹⁰ phages were bound to the magnetic beads (BI = 2.1 × 10 ⁻⁴ ) ( FIG. 3B). The binding index of Cry1Aa toxin-displaying phage to BtR175 coated beads was about 90 times that of uncoated beads. In the BtR175 coated beads, out of 1.1 × 10 ¹⁰ Cry1Ab toxin-displaying phages added, 6.5 × 10 ⁷ were bound to the magnetic beads (BI = 5.9 × 10 ⁻³ ) (FIG. 3B).

In the uncoated beads, 1.5 × 10 ⁷ out of the added 2.2 × 10 ¹⁰ phages were bound to the magnetic beads (BI = 6.8 × 10 ⁻⁴ ). The binding index of Cry1Ab toxin-displaying phage to BtR175 coated beads was about 9 times the binding affinity to uncoated beads. In the case of the wild-type phage, 1.3 × 10 ^{6 of} the 7.5 × 10 ⁹ phages added to the BtR175 coated beads were bound to the magnetic beads (BI = 1.7 × 10 ^{−). 4} ) (FIG. 3B).

In addition, in the uncoated beads, 4.5 × 10 ⁶ out of the added 7.5 × 10 ⁹ phages were bound to the magnetic beads (BI = 6 × 10 ⁻⁴ ). In the case of the wild-type phage, there was little difference in the number of bindings between the BtR175 coated beads and the uncoated beads. The binding index of Cry1Aa toxin-displaying phage and Cry1Ab toxin-displaying phage to BtR175 was about 112 times and 35 times that of Wild-type phage, respectively.

  From the above results, it was considered that the Cry1Aa toxin-displaying phage and the Cry1Ab toxin-displaying phage have binding properties to BtR175. It was also revealed that Cry1Aa toxin-displaying phage has a higher binding affinity for BtR175 than Cry1Ab toxin-displaying phage. Furthermore, using such a system, Cry1A toxin is expressed from a phage that does not bind to BtR175 or from a phage that has low binding ability even if Cry1A toxin is expressed. It was suggested that phages with high binding ability can be selected. Similarly, especially in magnetic beads, the difference in binding between Cry1Ab toxin-displaying phage or Cry1Ab toxin-displaying phage and wild-type phage is large, and it is excellent as a selection system using the difference in binding affinity. It was revealed.

(4) Evaluation of magnetic bead method as a δ endotoxin-displaying phage screening system The magnetic bead method is based on a phage-displayed mutagenesis ScFV (single chain fragment variable from the antibody: single chain antibody) binding affinity. It is one of the most powerful methods for selecting high clones. Therefore, it was examined whether the magnetic bead method can be applied to evolutionary molecular engineering for improving the binding affinity of Cry1A toxin for BtR1751 using the phage display method.

It is mixed with Wild-type phage so that the ratio of Cry1Aa toxin-displaying phage or Cry1Ab toxin-displaying phage is 10%, 1%, and 0.1%, and the ratio of Cry1Aa toxin-displaying phage is 2.5. A total of 10 ⁹ phage solutions mixed with Cry1Ab toxin-displaying phages were prepared so that the concentration was 0.75% and 0.75%. The phage solution was mixed with magnetic beads to which BtR175 was bound, stirred, and then washed 5 times with PBST.

  Next, the phages bound to the magnetic beads were eluted with 1% SDS PBST, and the phage mixture before and after the magnetic beads concentration was infected with E. coli to make plaques. The plaque was copied onto a nitrocellulose membrane, blocked with BSA, Cry1Aa toxin-displaying phage was detected with Cry1Aa toxin-specific monoclonal antibody 2F9, and Cry1Ab toxin-displaying phage was detected with anti-Cry1Aa toxin serum. The ratio of Cry1Ab toxin-displaying phage was calculated. The experiment was performed in duplicate.

That is, in a total of 10 ⁹ phages, after Cry1Aa toxin display phage is 10% relative to wild-type phages were mixed at a 1% or 0.1%, was stirred with BtR175 coated beads, By collecting phage bound to magnetic beads and detecting Cry1Aa toxin-displayed phage with antiserum using Cry1Aa toxin-specific monoclonal antibody against plaques made on E. coli plates in the manner of vapor (2) The ratio of Cry1Aa toxin-displaying phages in all plaques was calculated.

As a result, according to the concentration operation using magnetic beads, the average of what was 10% before the operation was 65%, the average of 1% was 42%, and the average of 0.1% was 7.4%. The Cry1Aa toxin-displaying phages were concentrated 6.5 times, 42 times, and 74 times (FIG. 4A). In addition, when Cry1Ab toxin-displayed phages are mixed to 10%, 1%, or 0.1% with respect to Wild-type phages in a total of 10 ⁹ phages, Cry1Ab toxin is obtained by concentration using magnetic beads. The ratio of display phages averaged 69%, 23%, and 3.5%, respectively, and Cry1Ab toxin-displayed phages were concentrated 6.9 times, 23 times, and 35 times, respectively (FIG. 4B).

Next, whether or not the higher affinity phages can be concentrated by the magnetic bead method from a mixture of two types of phages with small differences in binding affinity, such as Cry1Aa toxin-displaying phage and Cry1Ab toxin-displaying phage. investigated. The Cry1Aa toxin displaying phage were mixed at 2.5% or 0.75% against Cry1Ab toxin display phage, relative to total of 10 ⁹ phages, subjected to the concentration operation in BtR175 coated beads, Cry1Aa toxin specificity The ratio of Cry1Aa toxin-displayed phage and Cry1Ab toxin-displayed phage after concentration was calculated using a specific monoclonal antibody.

  As a result, the ratios of Cry1Aa toxin-displaying phages averaged 17.8% and 6.8%, respectively, and Cry1Aa toxin-displaying phages with higher binding affinity were concentrated 7.1 times and 9.0 times (FIG. 4C). ). From the above, it is clear that the concentration operation method using magnetic beads can be used for selection of phage having higher binding affinity for BtR1751, that is, it can be applied to improve the affinity of Cry1A toxin (affinity measurement). became.

(5) Concentration of Cry1Aa toxin-displaying phage from Cry1Ab toxin-displaying phage Furthermore, by repeating the concentration operation with magnetic beads, high binding affinity phages containing only a trace amount are theoretically concentrated from among low phages. In order to confirm whether it is possible, a concentration operation using a magnetic bead was performed on a total of 10 ⁹ phages in which Cry1Aa toxin-displaying phage and Cry1Ab toxin-displaying phage were mixed at a ratio of 1:10, 1:10 ³ , and 1:10 ^6. Was carried out continuously.

That is, the Cry1Aa toxin displaying phage and Cry1Ab toxin display phage 1:10 1000,: mixed at a ratio of 1000000 were prepared a total of 10 ⁹ phage solution. BtR175-bound magnetic beads were added to the phage solution, stirred for 10 minutes, washed 5 times with PBST, and the phages bound to the magnetic beads were eluted with 1% SDS PBST, and phages infected with E. coli were removed. Allowed to grow. BtR175-bound magnetic beads were added to the resulting phages for concentration.

  Phage plaques collected from the beads after the concentration operation were subjected to immunoassay using anti-Cry1Aa toxin serum and Cry1Aa toxin-specific monoclonal antibody, and the ratio of Cry1Aa toxin-displayed phage to Cry1Ab toxin-displayed phage was calculated.

  Next, this phage was infected with E. coli and allowed to grow, and this phage was further subjected to a concentration operation using magnetic beads. These steps were performed up to 9 rounds, and changes in the ratio of Cry1Aa toxin-displaying phage and Cry1Ab toxin-displaying phage were followed.

When starting with a 1:10 ratio, the ratio of Cry1Aa toxin-displaying phages reached approximately 80% by 5 rounds (FIG. 5A). When starting at 1:10 ³ , the ratio of Cry1Aa toxin-displaying phage reached 20% or more by 5 rounds, and Cry1Aa toxin-displaying phage was concentrated about 200 times (FIG. 5A).

On the other hand, PCR was carried out putting Cry1Aa toxin specific primers and polymerase to the solution of different Cry1Aa toxin display phage concentrations and to amplify the inserted fragment of Cry1Aa toxin DNA, in proportion to the number of phage in the range of 10 ² 10 ⁷ A dark band was observed (FIG. 5B).

Therefore, the improvement in the ratio of Cry1Aa toxin phage when starting at 1:10 ⁶ was first evaluated using this system. As a result, the Cry1Aa toxin DNA band amplified from the round 0 to 9 phages was clearly darker with each round. That is, in round 9, it was suggested that Cry1Aa toxin-displaying phage was concentrated about 100,000 times (FIG. 5C). Thus, immunoassay was performed on plaques after the completion of rounds 6 to 9. As a result, it was revealed that the number of Cry1Aa toxin-displaying phages reached about 13% in the round 9-terminated phage, and that 130,000-fold enrichment of Cry1Aa toxin-displaying phages was achieved (FIG. 5A).

From the above, it was clarified that phages having a high binding affinity for BtR175 and containing only a small number can be concentrated by the magnetic bead method. Actually, a Cry toxin mutant library of about 10 ^{7 to} 10 ⁹ is created and amplified after about 1000 times, and then screening is performed. Therefore, if there is one clone that has a better binding affinity for the wild type toxin, repeat the concentration procedure with magnetic beads 10 to 15 times from the 10 ¹⁰ -10 ¹² library after amplification. Clones can be enriched.

  In the present invention, in particular, the following items have been clarified by the above embodiment. That is, it was possible to construct a “system for displaying a toxin mutant on a phage” that enables selection of a toxin mutant having a high binding affinity for a receptor from a toxin mutant library. In addition, by binding a receptor on the digestive tract of insects, cadherin-like protein, to a 96-well plate or a magnetic bead, We were able to build a system that can select those with high binding affinity. In addition, by combining the above methods, "through selection of toxin mutant libraries having a high binding affinity for the receptor, the result is a strong insecticidal activity on the target insect. A system has been established that can be used for the evolutionary molecular engineering of toxin mutants and the selection of various mutant libraries. Furthermore, it has become possible to arbitrarily produce mutant proteins that are effective against certain target pests, starting from toxin proteins that have only weak activity that are easily found in soil. Moreover, it has become possible to develop a more active toxin mutant using a highly effective toxin protein as a starting material.

  As described above in detail, the present invention relates to a system for selecting insecticidal toxin protein mutants that are more effective against target insects. Conventionally, the isolation of BT bacteria from soil and its response Depending on the development method based on the bioassay using insects, the genre called `` microbicide insecticide '' and the genre called `` pest-resistant recombinant food '' were born, and are still made as important products, On the other hand, according to the present invention, it has become possible to arbitrarily produce a mutant protein that works against a certain target pest, using an insecticidal toxin having a weak activity that is easily found as a starting material. In addition, it has become possible to develop a more active toxin by using a toxin that works well as a starting material. That is, it becomes possible to grow more useful proteins (molecular breeding) using easily available proteins as a material, and as a result, a “protein insecticide” that utilizes the toxin mutants thus bred. However, it will be possible to create new technologies and new product genres to society. Although the global market for insecticides is enormous, this new genre is highly expected as having the potential to grow industrially beyond antibody engineering products.

The construction method of Cry1Aa and Cry1Ab expression phage vectors is shown. The analysis result using the antibody of on-phage expression of Cry1Aa toxin or Cry1Ab toxin is shown. In the figure, AG indicates the following items. AC: Reaction of plaques of Cry1Aa toxin-displaying phage (A), Cry1Ab toxin-displaying phage (B) and wild-type phage (C) to Cry1Aa toxin-specific monoclonal antibody (2F9). DF: Reaction of plaques of Cry1Aa toxin-displaying phage (D), Cry1Ab toxin-displaying phage (E) and wild-type phage (F) to anti-Cry1Aa toxin serum. G: Reaction of each phage protein to anti-Cry1Aa toxin serum by Western blotting. Lane 1; active Cry1Aa toxin, lane 2; Cry1Aa toxin-displaying phage, lane 3; Cry1Ab toxin-displaying phage, lane 4; wild-type phage. The binding of Cry1Aa toxin-displaying phage and Cry1Ab toxin-displaying phage to the receptor molecule BtR175 is shown. In the figure, AB shows the following items. A: Evaluation of binding by biopanning. B: Evaluation of binding by magnetic beads. ●: Cry1Aa toxin-displaying phage binding in BtR175 binding group, ○: Cry1Aa toxin-displaying phage binding in control group; ◆: Cry1Ab toxin-displaying phage binding in BtR175 binding group, ◇; Cry1Ab toxin-displaying phage binding in control group, (2) Binding of wild-type phage in the BtR175 binding group, □; Binding of wild-type phage in the control group. The examination result of the selection capability of the Cry1A toxin display phage of a magnetic bead method is shown. In the figure, AC indicates the following items. A: Mixed section of Cry1Aa toxin-displaying phage and Wild-type phage. B: Mixed section of Cry1Ab toxin-displaying phage and Wild-type phage. ● and ○: Cry1A toxin-displaying phage mixture ratio at starting 10%, ◆ and ◇; Cry1A toxin-displaying phage mixing ratio 1% at starting, ■ and □; Cry1A toxin-displaying phage mixing ratio 0.1% at starting. C: Mixed region of Cry1Aa toxin-displaying phage and Cry1Ab toxin-displaying phage. ● and ○: Cry1Aa toxin-displaying phage mixture ratio at starting 2.5%, ◆ and ◇; Cry1Aa toxin-displaying phage mixing ratio at starting 0.75%. The result of the concentration operation from the Cry1Ab toxin-displaying phage of the Cry1Aa toxin-displaying phage is shown. In the figure, AC indicates the following items. A: A part of the phage eluted from the magnetic beads in the course of the concentration cycle was infected with E. coli to make plaques. The plaques were copied onto a nitrocellulose membrane, blocked with BSA, and then blocked with Cry1Aa toxin-specific monoclonal antibody 2F9. The result of having detected Cry1Aa toxin display phage and monitoring the ratio of Cry1Aa toxin display phage is shown. ● and ○; mixing ratio at starting: 1:10, ◆ and ◇; mixing ratio at starting: 1: 1000, ■ and □; mixing ratio at starting: 1: 1000000. B-C: PCR was performed on the phage solution using a Cry1Aa toxin-specific primer in an experimental group with a mixing ratio of 1: 1000000 at the start, and compared with a standard reaction (B) using a Cry1Aa toxin-displayed phage. (C) shows the results of quantitative evaluation of the amount of Cry1Aa toxin DNA contained in enrichment rounds 0 to 9 (R0 to R9) and monitoring the degree of enrichment of Cry1Aa toxin-displayed phages (C).

Claims (11)

A method for selecting mutants of a toxin protein having increased insecticidal activity against a target insect,
(1) producing a toxin-displaying phage in which an insecticidal toxin protein is expressed on T7 phage in a form binding to its receptor;
(2) Using the carrier to which the receptor is bound, a toxin-displaying phage having binding affinity for them is selected.
(3) Using the above system, a mutant having increased binding affinity for the receptor is selected.
A method for selecting mutants.   The method according to claim 1, wherein the toxin-displaying phage expression vector is obtained by infecting a host with a toxin-displaying phage expression vector, allowing the host to propagate and cloning the phage clone.   The method according to claim 1, wherein a mutant library is constructed using the system, and mutants having increased binding affinity for the receptor are selected from the mutants.   The method according to claim 1, wherein δ endotoxin is used as an insecticidal toxin protein, and cadherin-like protein, δ endotoxin binding molecule, or receptor substitute is used as a receptor.   The method according to claim 1, wherein a target mutant having an increased binding affinity is obtained by repeatedly selecting a mutant using a mutant obtained by mutating an existing insecticidal toxin protein.   The method of claim 1, wherein the carrier is a plate, gel, membrane, fiber or bead.   The method according to claim 1, wherein in the step of selecting a mutant, the operation of concentrating the toxin-displaying phage using magnetic beads to which the receptor is bound is repeated to obtain the concentrated toxin-displaying phage.   A mutant obtained by the selection method according to any one of claims 1 to 7 and having increased binding affinity for a receptor, or a gene encoding the mutant.   An insecticidal composition comprising the variant according to claim 8 as an active body.   A pest-resistant recombinant plant, wherein the gene encoding the mutant according to claim 8 is introduced into the plant so that the gene can be expressed.   The pest-resistant recombinant plant according to claim 10, wherein the plant is an edible crop.