JP2007074950A - Method for detecting methylated dna and/or non-methylated dna - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for detecting a methylated DNA and/or non-methylated DNA in high sensitivity by using a PCR method and DNA microarray; and further the method for detecting the methylated DNA and/or non-methylated DNA, capable of obtaining a detection result having a high correlation with the ratio of the presence of the methylated DNA and the non-methylated DNA. <P>SOLUTION: This method for detecting the methylated DNA and/or non-methylated DNA comprises (a) a process of bringing a reagent for modifying non-methylated cytosine in contact with a nucleic acid in a test specimen, (b) a process of obtaining a double-stranded DNA fragment by amplifying the nucleic acid in the test specimen, (c) a process of decomposing and/or removing the one strand of the double-stranded DNA fragment to make a single stranded DNA fragment and (d) a process of bringing the single stranded DNA fragment in contact with a DNA microarray carrying a probe capable of hybridizing the fragment. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a method for detecting methylated DNA and / or unmethylated DNA using bisulfite treatment, PCR method and DNA microarray.

  DNA methylation plays an important role in the regulation of DNA replication and expression. Methylation of eukaryotic DNA may occur at the 5-position of cytosine in a sequence aligned with “5′-C (cytosine) -G (guanine) -3 ′” (hereinafter referred to as “CpG sequence”). Many. In particular, CpG sequences are frequently present in the promoter regions of many genes and are called CpG islands (Non-patent Documents 1 and 2). In general, most of CpG islands in autosomes are methylated, but CpG islands that are densely present in the promoter region are not methylated (Non-patent Document 3). Furthermore, cytosine methylation plays a major role in gene expression control, and changes in the methylation pattern are thought to cause diseases and the like. Thus, revealing this methylation pattern can be important information in predicting disease treatment and prognosis.

  By the way, as a method for detecting methylated DNA, a methylation-specific PCR method (MSP method: Methylation-specific PCR method) is well known (Patent Documents 1 and 2 and Non-Patent Document 4). In this method, when DNA is treated with bisulfite, methylated cytosine remains, but unmethylated cytosine remains uracil (the same as T (thymine) as a PCR template). (Non-Patent Document 5) is a method of making the PCR primer recognize the difference and determining the presence or absence of methylated DNA and unmethylated DNA based on the presence or absence of PCR products. . That is, the MSP method is a method of amplifying only one of both DNAs by designing a PCR primer that can bind to a sequence containing methylated DNA or unmethylated DNA (however, a sequence after bisulfite treatment). It is.

A method for detecting methylated DNA or unmethylated DNA, in which this MSP method is combined with a detection method using a DNA microarray, is also well known (Patent Document 3). That is, the detection method is a method of labeling a PCR product obtained by using a primer labeled during PCR in the MSP method, and detecting it with a DNA microarray equipped with a predetermined probe.
JP 2004-8217 A Japanese Patent No. 3612080 Special Table 2004-501666 Bird, A., Cell, 70, 5-8, 1992 Gardiner-Garden, M. et al., J. Mol. Biol., 196, 261-282, 1987 Ng, HH. Et al., Curr. Opin. Genet. Dev., 9, 158-163, 1999 Herman JG et al., Proc. Natl. Acad. Sci. USA, 93, 9821-9826, 1996 Shapiro, R. et al., J. Amer. Chem., 92, 422, 1970

  However, in the detection method described above, there are many cases where the detection sensitivity by the DNA microarray is not sufficient, and further, with the recent progress of the technical level, a detection method that can exhibit higher detection sensitivity is strongly desired.

  In addition, by changing the PCR performed in the MSP method to a so-called competitive PCR method (using a set of primers), a probe that can amplify both methylated DNA and unmethylated DNA and hybridize to each amplified fragment. By using an on-board DNA microarray, both can be detected in the same process (see, for example, “Peng Hou et al., World Journal of Gastroenterology, 10 (24), 3553-3558, 2004”). Competitive PCR is the most commonly used method in quantitative PCR, in which two types of DNA that can be distinguished by their base sequences are amplified simultaneously in the same reaction solution. is there. Using this detection method, methylated DNA and unmethylated DNA are amplified together in the same reaction system, and both are detected in the same process by using a DNA microarray equipped with a probe that can hybridize to each amplified fragment. You can also Therefore, this method is expected to lead to the development of a method that enables calculation and quantification of the existing ratios of methylated DNA and non-methylated DNA.

  However, PCR products based on methylated DNA and unmethylated DNA are individually obtained in advance, and a hybridization solution is prepared using various samples in which both are mixed at various ratios, and then hybridized with each PCR product. When the probe to be obtained was brought into contact with the DNA microarray, there was a problem that a detection result sufficiently correlated with the mixing ratio was not obtained. That is, an effective calibration curve based on the relationship between the original presence ratio of methylated DNA and unmethylated DNA and the detection result of the PCR product could not be prepared. Therefore, even if methylated DNA and unmethylated DNA are actually detected using test samples derived from various tissues, reliable results cannot be obtained with respect to the presence ratio of both DNAs.

  Therefore, the problem to be solved by the present invention is to provide a method for detecting methylated DNA and / or unmethylated DNA with high sensitivity using bisulfite treatment, PCR method and DNA microarray, By using bisulfite treatment, PCR method (especially competitive PCR method) and DNA microarray, methylated DNA that can obtain detection results highly correlated with the presence of each of methylated DNA and unmethylated DNA And / or providing a method for detecting unmethylated DNA.

  The present inventor has intensively studied to solve the above problems. As a result, for a PCR product (double-stranded DNA fragment) obtained by PCR after bisulfite treatment, a hybridization solution was prepared using a single-stranded DNA fragment obtained by decomposing and / or removing one strand. The present inventors have found that the above-mentioned problems can be solved by contacting a DNA microarray on which a predetermined probe is mounted, thereby completing the present invention.

  That is, the present invention is as follows.

 (1) A method for detecting methylated DNA and / or unmethylated DNA, wherein (a) contacting a nucleic acid in a test sample with a reagent that modifies unmethylated cytosine; and (b) the test sample. A step of amplifying the nucleic acid therein to obtain a double-stranded DNA fragment, (c) a step of degrading and / or removing one strand of the double-stranded DNA fragment to form a single-stranded DNA fragment, and (d) ) Contacting the single-stranded DNA fragment with a DNA microarray on which an oligonucleotide probe capable of hybridizing with the fragment is mounted.

(2) (a) a reagent that modifies unmethylated cytosine, (b) a primer set capable of amplifying both a DNA containing methylated cytosine and a nucleic acid containing the modified base, wherein one primer is 5 ′ The set in which the terminal is phosphorylated, (c) an enzyme having λ exonuclease activity, and (d) a double-stranded DNA fragment amplified using the primer set of (b) above (c) A kit for detection of methylated DNA and / or unmethylated DNA, comprising a DNA microarray on which an oligonucleotide probe capable of hybridizing with a single-stranded DNA fragment obtained by treatment with the above enzyme is mounted.

 (3) From the detection result obtained by the method described in (1) above, judging whether the tumor is benign or malignant, including comparing the ratio of methylation for each chromosomal DNA derived from tumor tissue and normal tissue Method.

  According to the detection method of the present invention, methylated DNA and / or unmethylated DNA in a test sample can be detected with high sensitivity. Furthermore, it is possible to obtain a detection result having a high correlation with the existing ratio of methylated DNA and unmethylated DNA in the test sample. For example, with respect to chromosomal DNA derived from normal tissue or non-normal tissue (for example, tumor tissue), the ratio of those in which a predetermined DNA region (such as a promoter of a tumor suppressor gene) is methylated can be easily determined.

  Further, by comparing the ratio of methylation between tumor tissue and normal tissue, a highly reliable determination result can be obtained for benign or malignant tumor.

Hereinafter, the present invention will be described in detail.
1. SUMMARY OF THE INVENTION The present invention is a method for detecting methylated DNA and / or unmethylated DNA by combining a bisulfite treatment and PCR method and a detection method using a DNA microarray, and a hybridization solution (contacted with a DNA microarray). A single-stranded DNA fragment obtained by decomposing and / or removing one strand of an amplified fragment (double-stranded DNA fragment) after PCR It is.

  Conventionally, a hybridization solution was prepared using the amplified fragment after PCR as it was, and contacted with a DNA microarray for detection. However, in this case, there was a problem that the detection sensitivity was not sufficient. Especially, PCR products based on methylated DNA and unmethylated DNA (however, sequences after bisulfite treatment), which are very similar, differ in the base sequence of the amplified fragment only at the methylated cytosine site. In a system that is simultaneously detected by a DNA microarray equipped with a probe corresponding to each fragment obtained by the PCR method (competitive PCR method), in addition to insufficient detection sensitivity, the originality of methylated DNA and unmethylated DNA There is a problem that only a detection result having a low correlation with the existence ratio of can be obtained.

  In view of the above problems, the present inventors focused on the behavior of DNA fragments in the hybridization solution. That is, double-stranded DNA fragments obtained by PCR will exist in solution as single-stranded DNA fragments with complementary strands separated from each other by the preparation of the hybridization solution. One strand that can bind to the probe may partially interact with the other separated strand. As a result, the present inventor shows that the amount of DNA that should originally bind to the probe is competitively reduced. I found. In particular, as described above, when a hybridization solution is prepared using an amplified double-stranded DNA fragment having a similar base sequence, one strand of each fragment (a strand that can bind to the probe) Interacts not only with the other strand of its own fragment (the complementary strand of the one strand) but also with the complementary strand of one strand of another fragment (the strand that can bind to the probe) It is thought that the reliability will be further lowered.

Therefore, the inventor of the double-stranded DNA fragment obtained by the bisulfite treatment and the PCR method, the one that can bind to the probe by previously decomposing and / or removing the strand that does not bind to the probe. By preparing a hybridization solution after making it into single-stranded fragments and bringing them into contact with the DNA microarray, the above-mentioned problem of interaction can be solved, and detection can be performed with high sensitivity, and highly reliable detection. We found that results were obtained. The present invention has been completed based on such findings.

2. Method for detecting methylated DNA and / or unmethylated DNA The detection method of the present invention is a method for detecting methylated DNA and / or unmethylated DNA, and includes the following steps.

Step (a): contacting a nucleic acid in a test sample with a reagent that modifies unmethylated cytosine Step (b): a step of amplifying the nucleic acid in the test sample to obtain a double-stranded DNA fragment Step (c) Step of degrading and / or removing one strand of the double-stranded DNA fragment to form a single-stranded DNA fragment Step (d): an oligonucleotide probe capable of hybridizing the single-stranded DNA fragment with the fragment The process of making it contact with the DNA microarray by which the is mounted | worn Below, the detail of the detection method of this invention is demonstrated for every process.

(1) About step (a) In this step, a reagent for modifying unmethylated cytosine is brought into contact with a nucleic acid in a test sample.

  The test sample used in this step contains methylated DNA (DNA containing methylated cytosine) and / or unmethylated DNA (DNA containing unmethylated cytosine) as a nucleic acid. Here, the methylated DNA and / or unmethylated DNA preferably includes or can include a specific nucleic acid sequence including a target locus such as a CpG sequence. The nucleic acid in the test sample may be a nucleic acid molecule that includes the specific nucleic acid sequence as a part thereof, such as chromosomal DNA, or the entire sample is fragmented only by the specific nucleic acid sequence. Nucleic acid molecules may be used and are not limited.

  As a test sample, cells derived from any tissue, blood, body fluid may be used, for example, brain, heart, lung, spleen, kidney, liver, pancreas, gallbladder, esophagus, stomach, intestine, bladder, skeletal muscle, etc. Cell, blood and body fluid derived from various tissues. More specifically, for example, blood, cerebrospinal fluid, urine, sputum, pleural effusion, ascites, gastric fluid, intravesical body fluid and the like can be mentioned. The test sample is preferably prepared and purified as a DNA-containing sample that can be used for amplification before performing nucleic acid amplification (step (b)) described later. The preparation and purification can be performed according to a known nucleic acid extraction method. For example, various techniques according to the description of Maniatis et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY, pp 280,281, 1982) are adopted. it can.

  In addition, the test sample may be derived from a normal tissue or may be derived from a non-normal tissue such as a tumor tissue.

  With respect to a reagent that modifies unmethylated cytosine, “modification” means converting unmethylated cytosine to another base (nucleotide) from which unmethylated cytosine and methylated cytosine are distinguished.

As a reagent for modifying unmethylated cytosine, for example, bisulfite such as sodium bisulfite (NaHSO ₃₎ (bisulfite) but are preferably exemplified, is not limited. Unmethylated cytosine is modified but methylated cytosine Other reagents can be preferably used as long as they are unmodified reagents. Bisulfite reacts easily with the 5,6-double bond of cytosine but not with methylated cytosine. When cytosine reacts with bisulfite ions, it forms a sulfonated cytosine reaction intermediate that is prone to deamination, resulting in sulfonated uracil. The sulfonate group can be removed under alkaline conditions, resulting in the formation of uracil.

  Since uracil is recognized as thymine by DNA polymerase (Taq polymerase, etc.), when it is amplified by PCR using this as a template, 5-methyl-cytosine is originally present in the DNA sequence of the amplification product obtained. It will contain cytosine only where it was.

Bisulfite treatment of nucleic acid in a test sample can be performed using, for example, CpGenome ^™ DNA Modification Kit (CHEMICON # S7820), Methylamp ^™ DNA Modification Kit (Funakoshi), BisulFast ^™ Methylated DNA detection Kit (Toyobo), etc. it can.

(2) Step (b) In this step, after contacting the reagent in step (a), the nucleic acid in the test sample is amplified to obtain a double-stranded DNA fragment.

  The nucleic acid to be amplified in this step may be all or a part of the nucleic acid in the test sample, and is not limited. For details, refer to methylated DNA or unmethylated before contacting the reagent in step (a). It is preferred to amplify the nucleic acid containing the site that was DNA. The nucleic acid to be amplified is not limited. For example, promoters of various genes are preferable, and promoters of tumor suppressor genes are more preferable. Cancer suppressor gene promoters include p15, p16, LOX, RUNX3, TIG1, APC, Chfr, E-Cadherin, hMLH, DAP-Kinase1, RASSF1A, HRK, TSLC1, BNP3, BRCA1, SFRP1, etc. Is preferred.

  The amplification of the nucleic acid is preferably performed by PCR using the nucleic acid sequence to be amplified (or a sequence containing the nucleic acid sequence) as a template (template) and using an oligonucleotide primer (set) that specifically binds to the sequence. As long as the primer to be used can specifically bind (hybridize) as described above, its base sequence (base composition, number of bases, etc.) is not particularly limited, and can be appropriately designed.

  As primers that can be used in this step, for example, “methylated DNA” and “nucleic acid obtained by treating unmethylated DNA with a modifying reagent (step (a))” can be amplified together with substantially the same amplification efficiency. Primers are preferred. Here, “nucleic acid obtained by treating unmethylated DNA with a modifying reagent (step (a))” is a nucleic acid containing a base in which unmethylated cytosine is modified with a modifying reagent (step (a)). Specifically, the primer is preferably designed so that it can bind to a common nucleic acid sequence outside the nucleic acid obtained by treating the methylated DNA and unmethylated DNA with a modifying reagent. However, when there is no suitable common sequence, inosine is used as the base of a primer corresponding to a base that is different (not common) between both templates, or a primer designed using a non-base is used. You can also. When such a primer set is used, both the above-mentioned amplified fragment based on methylated DNA and the amplified fragment based on nucleic acid obtained by treating unmethylated DNA with a modifying reagent can be obtained in the same step. Since amplified fragments can be obtained with substantially the same amplification efficiency, both amplified fragments can be obtained at the same abundance ratio as the template.

  Further, in this step, two or more different primer sets can be used in combination. For example, primer sets that can specifically amplify promoter regions of various genes can be used in combination. In particular, as a preferred embodiment, the promoter regions of various tumor suppressor genes are amplified by the same PCR system, and all amplified fragments are simultaneously detected by a DNA microarray described later. Depending on the individual primer set, both a fragment based on methylated DNA and a fragment based on nucleic acid obtained by treating unmethylated DNA with a modifying reagent (step (a)) can be amplified.

  Other primers that can be used include, for example, primers that can distinguish methylated DNA from unmethylated DNA. That is, a primer that specifically binds to methylated DNA but does not bind to non-methylated DNA treated with a modifying reagent (step (a)), or conversely, unmethylated DNA binds to a modifying reagent (step Primers that specifically bind to the nucleic acid treated in (a)) but do not bind to methylated DNA can be used. When such a primer is used, only an amplified fragment based on a template to which the primer can bind is obtained.

  In the present invention, as will be described later, since the obtained amplified fragment is detected using a DNA microarray, at least one primer is labeled with a fluorescent label or the like so that the detection can be performed. It is preferable that Labeling can be performed on the 5 'end of the primer or the like. As the fluorescent label, for example, various reporter dyes (for example, Cy5, Cy3, VIC, FAM, HEX, TET, fluorescein, FITC, TAMRA, Texas red, Yakima Yellow, etc.) can be used.

  Moreover, as for the primer set which can be used at this process, it is preferable that one primer of the said set is a thing in which 5 'terminal was phosphorylated, for example. In the present invention, as will be described later (step (c)), it is important to decompose one strand of the amplified fragment (double-stranded DNA) into a single-stranded DNA fragment. If a primer whose end is phosphorylated is used, the DNA strand amplified by the primer in the amplified fragment can be easily degraded from the 5 ′ end by an enzyme having λ exonuclease activity.

  Similarly, in this step, it is also preferable to use a primer set in which one primer in the set is biotinylated at the 5 'end. In the present invention, as described later (step (c)), it is important to remove one strand of the amplified fragment (double-stranded DNA) to form a single-stranded DNA fragment. 'Using a primer with a biotinylated end, for example, by contacting a bead having streptavidin immobilized on its surface with an amplified fragment (double-stranded DNA) dissociated into single strands, Only the fragment amplified with the biotinylated primer can be immobilized on the beads, and then one strand can be easily removed by alkali denaturation and centrifugation to obtain a supernatant.

In nucleic acid amplification by PCR, the reaction conditions such as the composition of the reaction solution including DNA polymerase, primer, dNTP, buffer, template, etc., and the temperature and time of heat denaturation, annealing, extension, etc. are not particularly limited and are set as appropriate. be able to. In addition, the said reaction liquid composition and reaction conditions can also be set in consideration of the kind of a template, a primer, etc. as needed. For example, the number of PCR cycles is preferably 20 to 50. If the number of PCR cycles is within the above range, nucleic acid quantification is further improved and amplification of nonspecific PCR products is suppressed. An effect such as being able to be obtained can be obtained. In addition, the concentration of the primer set is preferably 0.05 to 0.5 μM, for example. Particularly, when PCR (Multiplex PCR) is performed in a multiplex, a lower concentration is preferable within this range. If the concentration of the primer set is within the above range, the nucleic acid can be amplified with the optimal amplification efficiency, and thus the effect of further improving the nucleic acid quantification can be obtained. Furthermore, the concentration of the nucleic acid serving as a template is preferably 0.01 to 50 ng / μl, for example.

(3) Step (c) In this step, one strand of the double-stranded DNA fragment obtained by the amplification in step (b) is decomposed and / or removed to obtain a single-stranded DNA fragment.

  In this step, the method for decomposing one strand of the amplified fragment is not limited. For example, a method using an enzyme having λ exonuclease activity is preferable. In the case of decomposing using the enzyme, as described above, it is necessary to use one having the 5 'end phosphorylated as one primer of the primer set used in the step (b). During the enzyme reaction, the composition of the reaction solution containing the amplified fragment, buffer, enzyme, etc., and the reaction conditions such as reaction temperature, reaction time, and enzyme inactivation conditions are not particularly limited. For example, a sequence template is prepared. It can set suitably according to conventional methods, such as a method used when doing. In the degradation using the above enzyme, for example, various kits such as Strandase kit (manufactured by NovaGen) can be used. In this step, one strand decomposed as described above may or may not be removed before the hybridization reaction described below, but is not limited, but is removed. It is preferable to keep it. Examples of the method for removing the decomposition product include purification using a column and cutoff using a filter.

In this step, the method for removing one strand of the amplified fragment is not limited, but for example, a method of removing by separating using beads is preferable. As the bead, one having streptavidin immobilized on its surface can be used. In this case, as one primer of the primer set used in step (b), the 5 ′ end is biotin. It is necessary to use a label. Regarding the immobilization of biotinylated fragments on beads, alkali denaturation treatment, centrifugation treatment, etc., the reaction solution composition such as amplification fragments, beads and buffers, and reaction conditions such as temperature and time are not particularly limited. It can be set appropriately according to the law. The removal using the above beads can be performed using, for example, Dynabeads M-280 Streptavidin (DYNAL), MagnaBind ^™ Streptavidin Beads (PIERCE), Magacell ^™ Streptavidin (Nacalai Tesque).

In the present invention, the single-stranded DNA fragment (fragment capable of binding to the probe) obtained after the above degradation and / or removal is labeled with a fluorescent label or the like so that it can be detected by a DNA microarray described later. It needs to be done. Therefore, it is necessary that the primer used for amplification of the single-stranded DNA fragment is labeled with a fluorescent label or the like.

(4) About step (d) In this step, the single-stranded DNA fragment obtained in step (c) is brought into contact with a DNA microarray on which an oligonucleotide probe (capture probe) capable of hybridizing with the fragment is mounted. .

  Specifically, the contact refers to preparing a hybridization solution containing a DNA fragment and binding (hybridizing) the DNA fragment in the solution to an oligonucleotide probe mounted on a DNA microarray.

  A hybridization solution using the single-stranded DNA fragment obtained in step (c) can be appropriately prepared according to a conventional method using a buffer solution such as SDS or SSC.

  The DNA microarray that can be used in this step is not limited as long as oligonucleotide probes that can hybridize with the various single-stranded DNA fragments obtained in step (c) are immobilized on a support. For example, as described above, when an amplified fragment based on methylated DNA and a fragment based on nucleic acid obtained by treating non-methylated DNA with a modifying reagent (step (a)) are amplified, they are derived from both amplified fragments. By fixing probes that can hybridize with each single-stranded DNA fragment to the support, all fragments can be detected simultaneously.

  Regarding the DNA microarray that can be used in this step, the form of the support is not limited, and any form such as a flat plate, a rod, or a bead can be used. When a flat plate is used as the support, a predetermined probe can be fixed on the flat plate with a predetermined interval for each type (spotting method, etc .; see Science 270, 467-470 (1995), etc.) . It is also possible to sequentially synthesize a predetermined probe for each type at a specific position on the flat plate (see, for example, photolithography method; Science 251, 767-773 (1991)). Other preferred support forms include those using hollow fibers. When hollow fibers are used as the support, a microarray obtained by fixing a predetermined probe to each hollow fiber for each type, converging and fixing all hollow fibers, and then repeating cutting in the longitudinal direction of the fibers ( Hereinafter, it is preferably referred to as “fiber type microarray”. This macroarray can also be described as a type in which a nucleic acid is immobilized on a through-hole substrate, and is also referred to as a so-called “through-hole type microarray” (see Japanese Patent No. 3510882).

  The method for fixing the probe to the support is not limited, and any binding mode may be used. Moreover, it is not limited to fix | immobilize directly to a support body, For example, a support body can be previously coated with polymers, such as a polylysine, and a probe can also be fixed to the support body after a process. Furthermore, when a tubular body such as a hollow fiber is used as the support, the tubular body can hold a gel-like material, and the probe can be fixed to the gel-like material.

  Hereinafter, the fiber type microarray will be described in detail. This microarray can be manufactured through the following steps (i) to (iv), for example.

(i) A step of producing an array by arranging a plurality of hollow fibers in three dimensions so that the longitudinal directions of the hollow fibers are the same direction
(ii) a step of embedding the array and producing a block
(iii) A step of introducing a gel precursor polymerizable solution containing an oligonucleotide probe into the hollow part of each hollow fiber of the block body to carry out a polymerization reaction and holding the gel-like substance containing the probe in the hollow part
(iv) The step of cutting the block body in a direction intersecting with the longitudinal direction of the hollow fiber to make the block body into a thin piece The material used for the hollow fiber is not limited, but for example, in JP 2004-163211 A The materials described are preferred.

  The hollow fibers are arranged three-dimensionally so that the lengths in the longitudinal direction are the same (step (i)). As an arrangement method, for example, a method of arranging a plurality of hollow fibers in parallel with a predetermined interval on a sheet-like material such as an adhesive sheet, forming a sheet, and then winding the sheet in a spiral manner (Japanese Patent Laid-Open No. 11-1990). No. 108928), or two perforated plates in which a plurality of holes are provided at a predetermined interval are overlapped so that the holes coincide with each other, and hollow fibers are passed through these holes, and then the two perforated plates And a method of temporarily fixing the gap between the two perforated plates and filling the periphery of the hollow fiber with a curable resin raw material to cure (see JP 2001-133453 A).

  The manufactured array is embedded so that the array is not disturbed (step (ii)). Examples of the embedding method include a method in which a polyurethane resin, an epoxy resin, or the like is poured into a gap between fibers, and a method in which fibers are bonded together by heat fusion.

  The embedded array is filled with a gel precursor polymerizable solution (gel forming solution) containing an oligonucleotide probe in the hollow part of each hollow fiber, and a polymerization reaction is performed in the hollow part (step (iii)). . Thereby, the gel-like thing with which the probe was fixed can be hold | maintained in the hollow part of each hollow fiber.

  The gel precursor polymerizable solution is a solution containing a reactive substance such as a gel-forming polymerizable monomer, and the solution can be converted into a gel by polymerizing and crosslinking the monomer. Say. Examples of such monomers include acrylamide, dimethylacrylamide, vinyl pyrrolidone, methylene bisacrylamide and the like. In this case, the solution may contain a polymerization initiator and the like.

  After fixing the probe in the hollow fiber, the block body is cut in a direction intersecting with the longitudinal direction of the hollow fiber (preferably in a direction perpendicular to the hollow fiber) to make a thin piece (step (iv)). The flakes thus obtained can be used as a DNA microarray. The thickness of the array is preferably about 0.01 mm to 1 mm. The block body can be cut by, for example, a microtome and a laser.

Preferred examples of the fiber microarray described above include a DNA chip (Genopal ^™ ) manufactured by Mitsubishi Rayon Co., Ltd.

  In this step, the contact between the hybridization solution and the DNA microarray, that is, the hybridization reaction, is carried out under reaction conditions (in order to allow the DNA fragments in the solution to hybridize with the probes mounted on the array under stringent conditions. Buffer type, pH, temperature, etc.) can be set appropriately.

  The “stringent conditions” mean conditions for washing the DNA microarray after hybridization. For example, the salt (sodium) concentration is 48 to 780 mM, and the temperature is 37 to 80 ° C. More preferably, the salt concentration is 97.5 to 390 mM, and the temperature is 50 to 75 ° C.

After washing, the detection intensity is measured for each spot with an apparatus capable of detecting the label of the DNA fragment bound to the probe. When a fluorescently labeled DNA fragment is bound, the fluorescence intensity can be measured using various fluorescence detection devices (for example, a cooled CCD fluorescence detection device manufactured by Mitsubishi Rayon Co., Ltd.).
After detection, for example, by the following process, the methylation rate (methylation level) can be calculated to evaluate the presence ratio of methylated DNA. That is, first, the following formula (I):
According to M / (M + U) (I), “the fluorescence intensity described above with respect to the sum of the“ fluorescence intensity (M) at the spot of the probe for methylated DNA ”and the fluorescence intensity (U) at the spot of the probe for unmethylated DNA”. The value of the ratio (M) ”can be obtained, and the methylation rate can be obtained from a calibration curve prepared in advance (see the Examples for details). This evaluation method can be used as a primer set in step (b), a primer that can amplify both a methylated DNA and a nucleic acid obtained by treating unmethylated DNA with a modifying reagent (step (a)). This is the case.

(5) Use of the detection method of the present invention The detection method of the present invention can be preferably used for, for example, a method for determining benign or malignant tumor. Specifically, from the detection result obtained by the detection method of the present invention, the benign or malignant tumor can be determined by comparing the methylation ratios for each chromosomal DNA derived from the tumor tissue and normal tissue. .

  Specifically, for the chromosomal DNA sample derived from tumor tissue and the chromosomal DNA sample derived from normal tissue, the detection method of the present invention (steps (a) to (d)) is performed using the same nucleic acid region as the detection target. To do. Here, the nucleic acid region is preferably a promoter of a tumor suppressor gene, more preferably a promoter of various cancer suppressor genes listed in the above “(2) step (b)”. This is because methylation of CpG islands in the tumor suppressor gene promoter plays a role equivalent to mutation or chromosome deletion as a mechanism of inactivation of the gene (gene silencing). The primer set used is unmethylated so that the promoter can be amplified in step (b) regardless of whether it is methylated in cytosine of the CpG sequence or unmethylated. A primer capable of amplifying both a nucleic acid obtained by treating DNA with a modifying reagent (step (a)) and methylated DNA is used. Two or more types of promoters of tumor suppressor genes to be detected can be selected, and can be detected simultaneously by using a primer set corresponding to each promoter region.

  Next, from the detection result and the above-mentioned formula (I), the methylation rate in the chromosomal DNA derived from the tumor tissue and the chromosomal DNA derived from the normal tissue (that is, the ratio of the promoter of the tumor suppressor gene to be detected is methylated) ) To determine the presence of the tumor, and hence the benign or malignant of the tumor. At this time, if a criterion for determining the degree of malignancy when the methylation rate in the tumor tissue is higher than the methylation rate in the normal tissue is set based on a large number of clinical data in advance, the criterion By comparison with the values, the presence of the tumor and the benign or malignant of the tumor can be easily determined.

  In addition, by analyzing clinical data on the methylation rate in tumor tissues and normal tissues for multiple tumor suppressor gene promoters, which tumor suppressor gene promoter is affected by methylation in any tumor. Whether it is easy or not can be grasped in advance. If this knowledge is utilized, it can be determined with higher reliability whether it is benign or malignant depending on the type of tumor.

  The tumor to be determined is not limited, and examples thereof include stomach cancer, lung cancer, head and neck cancer, esophageal cancer, breast cancer, liver cancer, colon cancer, prostate cancer, melanoma, brain tumor, lymphoma and the like.

Furthermore, the present invention includes a method for determining the nature of a tumor and a method for determining the risk of developing a tumor. The method for determining tumor properties utilizes the fact that abnormal DNA methylation may be related to the properties of tumor cells. Specifically, when the promoter of a tumor suppressor gene is methylated, knowledge that correlates the region of the methylated DNA with the nature of the tumor cell, such as good drug reactivity and good prognosis for a specific tumor, is used Is done. The method for determining the risk of developing a tumor is a method that utilizes abnormal DNA methylation accumulated in normal tissue, and is a method for determining what is likely to be a tumor tissue in the future even if it is a normal tissue. Specifically, when the promoter of a specific tumor suppressor gene is frequently methylated in a normal cell of a certain tissue, it can be determined that the risk of becoming a tumor in the future is high.

3. Kit for Detection of Methylated DNA and / or Unmethylated DNA The kit of the present invention is characterized by comprising the following components (a) to (d). In addition, about the detail of each structural component, the description mentioned above is applicable similarly.

(a) Reagent for modifying unmethylated cytosine
(b) A primer set capable of amplifying both a DNA containing methylated cytosine and a nucleic acid containing the modified base, wherein one primer is a phosphorylated 5 ′ end
(c) Enzyme having λ exonuclease activity
(d) An oligonucleotide probe capable of hybridizing with a single-stranded DNA fragment obtained by treating the double-stranded DNA fragment amplified using the primer set (b) with the enzyme (c) is mounted. DNA microarray The kit of the present invention can be effectively used for any of the detection method of the present invention, the determination method of benign / malignant tumor, the determination method of the nature of the tumor, and the determination method of the risk of developing a tumor.

The kit of the present invention may contain other components in addition to the above components. Other components include, for example, DNA polymerase, various buffers, sterilized water, Eppendorf tubes, phenol chloroform, chloroform, ethanol, nucleic acid coprecipitate, experimental operation manuals (instructions), and various PCRs as necessary. And other experimental equipment.

Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these examples.

1. Production of DNA microarray A through-hole type DNA microarray was produced by the following procedure.

(1) Probe preparation
As oligonucleotide probes (capture probes) mounted on the DNA microarray, 5′-terminal vinylated nucleic acid molecules having the sequence information shown in SEQ ID NOs: 1 to 8 below were used. A method for preparing these nucleic acid molecules is shown below.

First, in order to synthesize a terminal aminated nucleic acid (5'-O-aminohexyl-nucleic acid), each of the oligonucleotides having the nucleotide sequences shown in SEQ ID NOs: 1 to 8 below was synthesized by an automatic DNA synthesizer using an amidite reagent. did. Thereafter, in the final stage, aminolink ^™ (manufactured by PE Biosystems) was reacted with each oligonucleotide and then prepared by deprotection. In addition, the following probe names (for example, “p16-M” and the like) are expressed in the form of “tumor suppressor gene name— [probe for methylated DNA (M) or probe for unmethylated DNA (U)]”. ing.
"P16-M"
5'-GCCGCCCGCTACCTACTCTACCCCTCTCCGCAACCGCCGAACGCACTCGATCCG-3 '(SEQ ID NO: 1)
"P16-U"
5'-ACCACCCACTACCTACTCTACCCCTATCCACAACCACCAAACACACTCAATCCA-3 '(SEQ ID NO: 2)
"LOX-M"
5'-GCCAAACGCCCGAAACCGCCGACGACTCGCGCGAAAACTACTATTAACCGACGACG-3 '(SEQ ID NO: 3)
"LOX-U"
5'-ACCAAACACCCAAAACCACCAACAACTCACACAAAAACTACTATTAACCAACAACA-3 '(SEQ ID NO: 4)
"RUNX3-M"
5'-GCCCCAACGTCAAAAAACTACGACCCGAAAAAAAACGACAAAAACGCCTTCCGTAAAACCCGAACG-3 '(SEQ ID NO: 5)
"RUNX3-U"
5'-ACCCCAACATCAAAAAACTACAACCCAAAAAAAAACAACAAAAACACCTTCCATAAAACCCAAACA-3 '(SEQ ID NO: 6)
"TIG1-M"
5'-GCTCCGAACCCGTATCTATCGAATACCGAACCAACTTTCCTACGTCCATACAACCCCGCCGACAACG-3 '(SEQ ID NO: 7)
"TIG1-U"
5'-ACTCCAAACCCATATCTATCAAATACCAAACCAACTTTCCTACATCCATACAACCCCACCAACAACA-3 '(SEQ ID NO: 8)
(2) Production of hollow fiber bundle (hollow fiber array) A hollow fiber bundle (hollow fiber array) was produced using the array fixing device shown in FIG. Note that x, y, and z in FIG. 1 are three-dimensional axes orthogonal to each other, and the x-axis coincides with the longitudinal direction of the hollow fiber.

  First, two perforated plates 21 having a thickness of 0.1 mm were prepared, in which the distance between the centers of the holes was 0.42 mm, and a total of 144 holes having a diameter of 0.32 mm were provided in 12 rows each in length and width. These porous plates 21 were overlapped, and polycarbonate hollow fibers 31 (manufactured by Mitsubishi Engineering Plastics, containing 1% by mass of carbon black) were passed through each of the holes one by one.

  The position of the two perforated plates 21 is moved in a state where 0.1 N tension is applied to each hollow fiber 31 in the x-axis direction, so that two positions of 20 mm and 100 mm from one end of the hollow fiber 31 are provided. The perforated plate 21 was fixed to. That is, the interval between the two porous plates 21 was set to 80 mm.

  Next, the three surfaces surrounding the space between the perforated plates were surrounded by a plate-like object 41. In this way, a container having an open top only was obtained.

  Resin raw material was poured from the upper part of the obtained container. As a resin raw material, what added 2.5 mass% carbon black was used with respect to the total weight of a polyurethane resin adhesive (The Nippon Polyurethane Industry Co., Ltd. make, NIPPON 4276, Coronate 4403). After pouring the resin raw material, the container was allowed to stand at 25 ° C. for 1 week to cure the resin. After curing, the porous plate 21 and the plate-like object 41 were removed from the container to obtain a hollow fiber bundle. Of the fiber ends of the resulting hollow fiber bundle, one was sealed and the other was open.

(3) Production of gel-filled hollow fiber array Next, a gel precursor polymerizable solution containing a monomer and an initiator mixed at a blending ratio (concentration with respect to the probe) shown in Table 1 below was prepared. The solution was prepared for each type of probe prepared previously.

  As shown in Table 2, 80 μL of each prepared gel precursor polymerizable solution was dispensed into a predetermined well of a 384 microtiter plate. In Table 2, “B” means a blank well in which nothing is dispensed.

  Next, the 384 plate and the hollow fiber bundle after the above dispensing are placed in a desiccator, and after the inside of the desiccator is decompressed, one end portion of the hollow fiber bundle where the fiber bundle is not fixed is attached to the 384 plate. It was immersed in the dispensed solution. Thereafter, nitrogen gas was sealed in the desiccator to release the reduced pressure state, and a gel precursor polymerizable solution containing a probe was introduced into the hollow portion of the hollow fiber. Next, the inside of the container was brought to 70 ° C., and a polymerization reaction was carried out over 3 hours.

  In this manner, a hollow fiber bundle (gel-filled hollow fiber array) in which the probe was held in the hollow portion of the hollow fiber via the gel-like material was obtained.

(4) Thinning The hollow fiber bundle obtained in (3) above was sliced into 200 pieces with a thickness of 0.25 mm in a direction perpendicular to the longitudinal direction of the fiber using a microtome, and the obtained thin sheet was referred to as a DNA microarray. did.
2. Detection of methylated and unmethylated DNA
(1) Preparation of test sample Gastric epithelial tumor tissue and normal tissue were collected from a total of 26 patients (male and female), respectively. The collected tissue samples were stored at −80 ° C. until used for experiments. DNA extraction was performed using SepaGene (manufactured by Sanko Junyaku Co., Ltd.) and used as a test sample.

Separately, as a control sample for preparing a calibration curve, completely methylated DNA “CpGenome ^TM Universal Methylated DNA (CHEMICON # S7821)” and completely unmethylated DNA “CpGenome ^TM Universal Unmethylated DNA set (CHEMICON # S7822) VialA ”was used. Specifically, the following blended samples (i) to (v) having different methylation rate settings were prepared and used as follows.

Unmethylated DNA Methylated DNA Methylation rate
(i) 1.0μg 0μg 0%
(ii) 0.75μg 0.25μg 25%
(iii) 0.5μg 0.5μg 50%
(vi) 0.25μg 0.75μg 75%
(v) 0μg 1.0μg 100%
(2) Bisulfite treatment Bisulfite treatment is performed using CpGenome ^TM DNA Modification Kit (CHEMICON # S7820) to convert all unmethylated cytosine in the genomic DNA (chromosomal DNA) of the test sample into uracil. went.

  Specifically, first, genomic DNA of a test sample was adjusted to a concentration of 1 μg / 100 μl, 7 μl of 3M NaOH was added to this solution, mixed well, and then incubated at 50 ° C. for 10 minutes.

Next, Reagent I attached to the CpGenome ^™ DNA Modification Kit was weighed, and “Reagent I weight (g) ÷ 0.227 × 0.571 ml” of sterilized water was added to completely dissolve it.

  [20 × (Reagent I weight (g) ÷ 0.227)] μl of 3M NaOH was added to the above solution and mixed well to adjust the pH to about 5.

  To the genomic DNA solution after the incubation, 550 μl of Reagent I solution adjusted to pH 5 was added and mixed well. After mixing, it was incubated at 50 ° C. for 16 hours.

During the incubation, the following solutions were prepared:
・ 20mM NaOH / 90% EtOH solution:
To 900 μl of 98% ethanol, 93.4 μl of sterile water and 6.6 μl of 3M NaOH were added and mixed.
・ Reagent II solution included with CpGenome ^TM DNA Modification Kit:
1 μl of β-mercaptoethanol was added to 20 ml of sterilized water and mixed (1 solution).

The Reagent II reagent included in the CpGenome ^™ DNA Modification Kit was weighed, and one solution of “Reagent II weight (g) ÷ 1.35 × 750 μl” was added and completely dissolved.

After 16 hours, 10 μl of Reagent III attached to the well-suspended CpGenome ^™ DNA Modification Kit was taken and mixed with the incubated genomic DNA solution. Subsequently, 750 μl of Reagent II solution was further added, vortexed, and left at room temperature for 5 minutes in the dark.

  Then, after centrifuging at 16000 rpm for 1 minute with a centrifuge, the supernatant was completely removed so as not to disrupt the precipitate.

  After suspending in 1 ml of 70% ethanol, the supernatant was completely removed so as not to break the precipitate by centrifuging at 16000 rpm for 1 minute in a centrifuge. This operation was repeated two more times.

  50 μl of 20 mM NaOH / 90% EtOH solution was added and mixed well by flipping the tube, then spun down and left at room temperature for 5 minutes.

  Thereafter, 1 ml of 90% ethanol was added, vortexed and centrifuged again. After centrifugation, ethanol in the supernatant was completely removed. This operation was repeated once more.

  After completely removing ethanol from the supernatant, it was covered with parafilm, punctured with a needle, and allowed to dry for about 10 minutes.

  25 μl of buffer TE (10 mM Tris-HCl, 1 mM EDTA, pH 7.0) was added to the dried precipitate, and the tube was opened and mixed well.

  After spin down, it was incubated at 50 ° C. for 15 minutes. The entire amount of the white turbid solution was put into 0.22 μm (free from Millipore, model number: UFC3 0GV 0S) after sterilization and ultra-free MC and centrifuged at the maximum speed for 2 minutes. In this way, about 25 μl of a bisulfite-treated DNA solution was obtained.

(3) Multiplex PCR
The following PCR primers (i) to (viii) (Bex; SEQ ID NOs: 9 to 16) were purchased. The odd-numbered primers `` (i), (iii), (v), (vii) '' are fluorescently labeled with cy5 at the 5 ′ end, and even-numbered primers `` (ii), (iv), (vi ), (viii) "is phosphorylated (P) at the 5 'end. All were prepared to be 20 μM solutions. The primers (iv), (vi), (vii), and (viii) contain inosine (I) in the sequence.

(i) cy5-LOX-F:
cy5-GGTTAATTTGGTAAAAGGAGTGATG (SEQ ID NO: 9)
(ii) LOX-Rp:
P-TTATTCTCCCATTAAATCTACTAAC (SEQ ID NO: 10)
(iii) cy5-P16-F:
cy5-AGAAAGAGGAGGGGTTGGTTGGTTATTAGA (SEQ ID NO: 11)
(iv) p16-IR-p:
P-CAACCAATCAACCIAAAACTCCATACTACT (SEQ ID NO: 12)
(v) cy5-RUNX3-F:
cy5-GGGTAAATGTTAGAAATTTGTTTAGAA (SEQ ID NO: 13)
(vi) RUNX3-IR-p:
P-TTACAAAAATCACAAACCCIAAACAACAAAAACT (SEQ ID NO: 14)
(vii) cy5-TIG1-IF:
cy5-TGGGTTIGGATTAGGGAGTAGGTAG (SEQ ID NO: 15)
(viii) TIG1-IR-p:
P-AAAAACCCACCACIACCTTATTTCC (SEQ ID NO: 16)
Each primer was mixed in the following composition to prepare a multiplex primer mix.

Primers (i) to (viii) 50 μl each (total 400 μl)
Sterile water 600μl
1000μl total
Multiplex PCR was performed using the QIGEN Multiplex PCR kit (QIGEN) with GeneAmp9700 (Applied Biosystems, 50 μl, max mode) under the following reaction solution composition and reaction conditions.
<Reaction solution composition>
Template (bisulfite-treated genomic DNA) 2.5μl
Multiplex primer mix 10 μl
Multiplex Master Mix 25μl
Sterile water 12.5μl
50 μl total
<Reaction conditions>
The outline is shown below. In particular, regarding the cycle conditions, dissociation: 94 ° C. (30 sec) → annealing: 55 ° C. (1 min) → synthesis: 72 ° C. (30 sec) is performed for a total of 10 cycles, followed by dissociation : 94 ° C. (30 sec) → annealing: 60 ° C. (1 min) → synthesis: 72 ° C. (30 sec) for 40 cycles, 50 cycles in total.

  After the PCR, the PCR product was purified by the following procedures (a) to (h) using a QIAGEN MinElute PCR purification Kit (QIGEN).

  (a) 300 μl of buffer PB was added to 50 μl of the PCR reaction solution, mixed and placed on the column.

  (b) After centrifuging at 15000 rpm for 1 minute, the eluate was discarded and the column was inserted again into the receiving tube.

  (c) 750 μl of buffer PE was placed in the column and centrifuged at 15000 rpm for 1 minute.

  (d) The eluate was discarded and the column was inserted again into the receiving tube.

  (e) The buffer PE was thoroughly removed by centrifugation at 15000 rpm for 1 minute with nothing in the column.

  (f) The column was inserted into a new sterilized 1.5 ml tube, and 10 μl of sterilized water was added to the column.

  (g) Left at room temperature for 1 minute.

  (h) Centrifugation was performed at 15000 rpm for 1 minute to obtain about 9.5 μl of eluate.

(4) Single-stranded PCR product The purified PCR product (double-stranded DNA fragment) was converted into a single-stranded DNA fragment using the Strandase kit (NovaGen). Specifically, an enzyme treatment was performed by incubating at 37 ° C. for 20 minutes with the following reaction solution composition, and then heated at 75 ° C. for 10 minutes to inactivate the enzyme.

PCR product (M or U) 9.3 μl
10 × buffer 2μl
Strandase 4μl
Sterile water 4.7μl
20μl total
The reaction solution after the enzyme treatment was subjected to column purification using QIAGEN PCR MinElute purification kit (QIAGEN) and eluted with 10 μl once. Specific procedures (a) to (h) will be described below.

  (a) 300 μl of buffer PB was added to 20 μl of the reaction solution, mixed and placed on the column.

  (b) After centrifuging at 15000 rpm for 1 minute, the eluate was discarded and the column was inserted again into the receiving tube.

  (c) 750 μl of buffer PE was placed in the column and centrifuged at 15000 rpm for 1 minute.

  (d) The eluate was discarded and the column was inserted again into the receiving tube.

  (e) The buffer PE was thoroughly removed by centrifugation at 15000 rpm for 1 minute with nothing in the column.

  (f) The column was inserted into a new sterilized 1.5 ml tube, and 10 μl of sterilized water was added to the column.

  (g) Left at room temperature for 1 minute.

  (h) Centrifugation was performed at 15000 rpm for 1 minute to obtain about 9.5 μl of eluate.

  2 μl was taken from the obtained eluate, the absorbance at 260 nm was measured with a spectrophotometer (GeneSpec III, Hitachi Instrument Service), and the nucleic acid concentration was calculated. Thereafter, an appropriate amount of sterilized water was added to the obtained eluate to dilute to 5 ng / μl.

(5) Hybridization Each solution was mixed as follows to prepare a hybridization solution.

Single-stranded DNA fragment (5ng / μl) 16μl
20 x SSC 5μl
1% 20% SDS
Sterile water 78μl
100 μl total
Add 100 μl of hybridization solution to the above 1. The DNA microarray prepared in (1) was contacted (applied), and a hybridization reaction was performed at 65 ° C. for 16 hours.

(6) Washing After the hybridization reaction, the DNA microarray was washed according to the following procedures (a) to (d).

  (a) Ten ml of 0.5 × SSC was put into a sterilized centrifuge tube, and two of them were prepared.

  (b) One was kept at 70 ° C. and the other was kept at room temperature.

  (c) When the heated washing solution was heated to 70 ° C., the DNA microarray was taken out of the chamber and immersed for 60 minutes.

  (d) Thereafter, the DNA microarray was transferred from the washing solution at 70 ° C. to the washing solution at room temperature.

(7) Detection After the washing, the fluorescence signal of each spot was measured under the following detection conditions using a cooled CCD fluorescence detection device (model number: 0060304) manufactured by Mitsubishi Rayon.
<Detection conditions>
Central excitation wavelength: 630nm
Fluorescent filter: Cy5 filter Exposure time: 200 msec
(8) Methylation rate Based on the detection result of the test sample, “fluorescence intensity (M) at the spot of the probe for methylated DNA (M)” and “fluorescence intensity (at the spot of the probe for unmethylated DNA) ( The ratio of “the fluorescence intensity (M)” to the sum of “U)” was calculated. The results are shown in Table 4 below.

    M / (M + U) (I)

  Here, for the control sample described above, the same operation as the test sample was performed three times for each sample of each methylation rate, and a calibration curve was created based on the obtained detection results (see FIG. 2). From the calibration curve, the following relational expression (methylation rate calculation formula) was derived.

p16: Methylation rate (%) = 97.528 × [M / (M + U)] (R ² = 0.9465)
LOX: Methylation rate (%) = 107.99 × [M / (M + U)] (R ² = 0.9687)
RUNX3: Methylation rate (%) = 94.018 × [M / (M + U)] (R ² = 0.9522)
TIG1: Methylation rate (%) = 101.28 × [M / (M + U)] (R ² = 0.9707)
Each value shown in Table 4 was substituted into the above relational expression to calculate the methylation rate (%), and further evaluated in five stages according to the calculated methylation rate. Specifically, Level 1: Less than 20%; Level 2: 20% or more, less than 40%; Level 3: 40% or more, less than 60%; Level 4: 60% or more, less than 80%; Level 5: 80% Evaluation was divided into the above. The results are shown in Table 5 below.

1. Preparation of model nucleic acid corresponding to methylated DNA and unmethylated DNA The following two types of double-stranded DNA were synthesized. That is, as a model nucleic acid of methylated DNA, a DNA containing the nucleotide sequence of the promoter region of TIG1 was synthesized, and as a model nucleic acid of a nucleic acid obtained by bisulfite treatment of unmethylated DNA, cytosine (C) among the model nucleic acids of methylated DNA Synthesized DNA converted to thymine (T). Note that uracil (U) and thymine (T) are equivalent as PCR templates. However, in the latter DNA, C is converted to T in the strand corresponding to the sense strand.

Specifically, first, the following four types of oligonucleotides were synthesized. All synthesized oligonucleotides were dissolved in sterile water to 100 mM.
TIG1-Mcon1
5'-TGGGTTCGGATTAGGGAGTAGGTAGTCGTTGTCGGCGGGGTTGTATGGACGTAGGAAAGTTGGTTCGGTATTCGATAGATACGGG-3 '(SEQ ID NO: 17)
TIG1-Mcon2
5'-AAAAACCCACCACGACCTTATTTCCGCGAACGCCGACACTACCCGCTCCGAACCCGTATCTATCGAATACCGAACCAACTTTCCT-3 '(SEQ ID NO: 18)
TIG1-Ucon1
5'-TGGGTTTGGATTAGGGAGTAGGTAGTTGTTGTTGGTGGGGTTGTATGGATGTAGGAAAGTTGGTTTGGTATTTGATAGATATGGG-3 '(SEQ ID NO: 19)
TIG1-Ucon2
5'-AAAAACCCACCACAACCTTATTTCCACAAACACCAACACTACCCACTCCAAACCCATATCTATCAAATACCAAACCAACTTTCCT-3 '(SEQ ID NO: 20)
After mixing with the following reaction liquid composition, heating at 94 ° C. for 2 minutes, and leaving to cool at room temperature for 30 minutes, TIG1-Mcon1 and TIG1-Mcon2 and TIG1-Ucon1 and TIG1-Ucon2 are shown in FIG. Annealed as shown in FIG.

TIG1-Mcon1 (or TIG1-Ucon1) 5μl
TIG1-Mcon2 (or TIG1-Ucon2) 5μl
Second Strand Buffer 30μl
(Invitrogen)
Sterile water 103μl
143 μl total
The solution after the above reaction was placed on ice, mixed with the following reaction solution composition, and incubated at 16 ° C. for 2 hours after mixing. After that, 2 μl of T4 polymerase (Invitrogen) was added to the reaction system, and further incubated at 16 ° C. for 15 minutes to synthesize complementary strands for the single-stranded DNA on both sides of the annealed portion. (Referred to as “M” or “U”).

  The incubated solutions (2 types) were each column purified with a QIAGEN PCR purification kit (QIAGEN) and eluted with 100 μl once. Of these 100 μl, 1 μl was used as a template for PCR, and the following two kinds of double-stranded DNAs were amplified using the following primers under the following reaction solution composition and reaction conditions. The PCR was performed using GeneImp9700 (Applied Biosystems, 50 μl, 9600 emulation mode) using a QIGEN HotStarTaq PCR kit (QIGEN).

F primer:
5'-TGGGTTIGGATTAGGGAGTAGGTAG-3 '(SEQ ID NO: 21)
R primer:
5'-AAAAACCCACCACIACCTTATTTCC-3 '(SEQ ID NO: 22)
<Reaction solution composition>
Template (M or U) 1μl
10 × buffer 5μl
2.5 mM dNTP 4 μl
HotStarTaq 0.5μl
F primer (20μM) 1μl
R primer (20μM) 1μl
Sterile water 37.5μl
50 μl total
<Reaction conditions>
After heating at 94 ° C. for 10 minutes, “dissociation: 94 ° C. (30 sec) → annealing: 50 ° C. (30 sec) → synthesis: 72 ° C. (30 sec)” was performed for a total of 35 cycles, followed by heating at 72 ° C. for 5 minutes Then, it was cooled at 4 ° C.

  As a result of taking 1 μl of each of the reaction solutions after PCR (two types) and performing electrophoresis using an Agilent Bioanalyzer, one band was confirmed for each amplified fragment (see FIG. 4).

  The reaction solution after the PCR was subjected to column purification with a QIAGEN PCR MinElute purification kit (QIGEN) and eluted with 10 μl once. Of these, 2 μl was taken and the absorbance was measured and found to be as follows. These were diluted to make a solution of 10 pg / μl for both M and U.

M: 2.184 (A260) = 109.2 ng / μl
U: 1.999 (A260) = 99.9ng / μl
2. Amplification of model nucleic acid Next, the above-mentioned two kinds of double-stranded DNAs were individually amplified using the same PCR primer set.

  Specifically, amplification was performed with the following reaction solution composition and reaction conditions using the above M and U as templates and the following primers. The F primer is fluorescently labeled with cy5 at the 5 ′ end, and the R primer is phosphorylated (P) at the 5 ′ end. The PCR was performed using GeneImp9700 (Applied Biosystems, 50 μl, 9600 emulation mode) using a QIGEN HotStarTaq PCR kit (QIGEN).

F primer:
cy5-TGGGTTIGGATTAGGGAGTAGGTAG (SEQ ID NO: 23)
R primer:
P-AAAAACCCACCACIACCTTATTTCC (SEQ ID NO: 24)
<Reaction solution composition>
Template (M or U) (10pg / μl) 1μl
10 × buffer 5μl
2.5 mM dNTP 4 μl
HotStarTaq 0.5μl
F primer (20μM) 1μl
R primer (20μM) 1μl
Sterile water 37.5μl
50 μl total
<Reaction conditions>
After heating at 94 ° C. for 10 minutes, “dissociation: 94 ° C. (30 sec) → annealing: 50 ° C. (30 sec) → synthesis: 72 ° C. (30 sec)” was performed for a total of 35 cycles, followed by heating at 72 ° C. for 5 minutes Then, it was cooled at 4 ° C.

The reaction solution after the PCR was subjected to column purification with a QIAGEN PCR MinElute purification kit (QIGEN) and eluted with 10 μl once.
3. Single strand of amplified fragment One strand of the obtained amplified fragment was decomposed to obtain two types of single-stranded DNA. Specifically, the strandase kit (NovaGen) was used, and the strand phosphorylated in the amplified fragment was digested with Strandase.

  Specifically, the following reaction solution composition was mixed, incubated at 37 ° C. for 20 minutes, and then heated at 75 ° C. for 10 minutes to inactivate the enzyme (Strandase).

PCR product (M or U) 9.3 μl
(Eluate after column purification)
10 × buffer 2μl
Strandase 4μl
Sterile water 4.7μl
20μl total
The solution after the reaction was subjected to column purification with QIAGEN PCR MinElute purification kit (QIGEN) and eluted with 10 μl once. Of these, 2 μl was taken and the absorbance was measured and found to be as follows. These were diluted to a solution of 5 ng / μl for both single-stranded M and U (referred to as “Mss” and “Uss”, respectively).

Mss: 0.970 (A260) = 32.0 ng / μl
Uss: 0.982 (A260) = 32.4 ng / μl
As a result of electrophoresis of Mss and Uss with an Agilent Bioanalyzer, a single band was confirmed for each fragment (see FIG. 5).
4). Preparation of single-stranded model nucleic acid In addition to the above single-stranded DNA, the following two types of single-stranded DNA were synthesized as single-stranded model nucleic acids. That is, single-stranded DNAs composed of partial base sequences of the two types of single-stranded DNAs (Mss and Uss) were synthesized. Specifically, cy5-TIG1-M1 consists of a partial base sequence of Mss, and cy5-TIG1-U1 consists of a partial base sequence of Uss. These partial base sequences are sequences that are completely complementary to the base sequences of the probes mounted on the DNA microarray used for detection. In addition, any synthetic single-stranded DNA is fluorescently labeled with cy5 at the 5 ′ end.

cy5-TIG1-M1:
cy5-CGTTGTCGGCGGGGTTGTATGGACGTAGGAAAGTTGGTTCGGTATTCGATAGATACGGGTTCGGAGC (SEQ ID NO: 25)
cy5-TIG1-U1:
cy5-TGTTGTTGGTGGGGTTGTATGGATGTAGGAAAGTTGGTTTGGTATTTGATAGATATGGGTTTGGAGT (SEQ ID NO: 26)
5. Preparation of various detection samples and hybridization solutions Prepared single-stranded DNA (Mss and Uss) and synthetic single-stranded DNA (cy5-TIG1-M1 and cy5-TIG1-U1) Various detection samples were prepared at a blending ratio shown in FIG.

  To each detection sample (4 μl) using single-stranded DNA, the following mixed solution was added to prepare a total of 100 μl of hybridization solution.

20 x SSC 5μl
1% 20% SDS
Sterile water 90μl
96μl total
To each detection sample (10 μl) using synthetic single-stranded DNA, the following mixed solution was added to prepare a total of 100 μl of hybridization solution.

20 x SSC 5μl
1% 20% SDS
Sterile water 84μl
90μl total
6). Hybridization For each detection sample, 100 μl of hybridization solution was added to 1. The DNA microarray prepared in (1) was contacted (applied), and a hybridization reaction was performed at 65 ° C. for 16 hours.

After the hybridization reaction, as described in Example 1, 2. The DNA microarray was washed by the same procedure as in (6).
7). Detection of Fluorescent Label and Calculation of Methylation Rate After washing, using a cooled CCD fluorescence detection device (model number: 0060304) manufactured by Mitsubishi Rayon Co., under the same detection conditions as in Example 1, 2. (7), The fluorescence signal of each spot was measured. The photograph of FIG. 6 (a) shows that the intensity of the fluorescence signal at each spot differs for each detected sample.

  Based on the detection result for each detection sample, the second example 2 is performed. From the same formula (I) as in (7), “fluorescence intensity (M) at the spot of methylated DNA probe“ TIG1-M ”” and “fluorescence intensity at the spot of unmethylated DNA probe“ TIG1-U ” The value of the ratio of “the fluorescence intensity (M)” to the sum of “(U)” was calculated. A graph plotting the results is shown in FIG.

From the graph of FIG. 7, the detection result of the single-stranded DNA (samples A1 to A5) is almost the same as the detection result of the synthetic single-stranded DNA (samples B1 to B5), and the result is very reliable. I found out.
[Comparative Example 1]

  In “2. Amplification of model nucleic acid” in Example 2, PCR and column purification were carried out in the same manner except that the R primer was not phosphorylated at the 5 ′ end, and two types of double-stranded DNA were used. (Referred to as “Mds” and “Uds” respectively). 2 μl of the column-purified solution (10 μl) was taken and the absorbance was measured. These were diluted to give a 5 ng / μl solution of both single-stranded M and U.

Mds: 2.582 (A260) = 129.1ng / μl
Uds: 2.522 (A260) = 126.1ng / μl
As a result of electrophoresis of Mds and Uds with an Agilent Bioanalyzer, a single band was confirmed for each fragment (see FIG. 5).

  Using the prepared double-stranded DNA (Mds and Uds), various detection samples were prepared at the blending ratios shown in Table 8 below.

  To each of the detection samples (8 μl), the following mixed solution was added to prepare a total of 100 μl of hybridization solution.

20 x SSC 5μl
1% 20% SDS
Sterile water 86μl
Total 92μl
For each of the detection samples described above, see 6. of Example 2. And 7. In the same manner as described above, hybridization, detection of a fluorescent label, and calculation of the methylation rate were performed. A graph plotting the results is shown in FIG. The photograph in FIG. 6 (b) shows how the intensity of the fluorescence signal at each spot differs for each detected sample.

  From the graph of FIG. 7, the detection results of double-stranded DNA (samples C1 to C5) are significantly larger than the detection results of single-stranded DNA (samples A1 to A5) and synthetic single-stranded DNA (samples B1 to B5). It turns out that the results are unreliable.

It is the schematic which shows the arrangement | sequence fixing jig for manufacture of a hollow fiber bundle (hollow fiber array body). It is a graph which shows the detection result and calibration curve which used the control sample. It is a figure which shows the annealing site | part of a synthetic oligonucleotide. It is a photograph which shows the result of having electrophoresed the prepared model nucleic acid. It is a photograph which shows the result of having electrophoresed single-stranded DNA (Mss, Uss) and double-stranded DNA (Mds, Uds). (a) A photograph in which fluorescence of each spot is detected after a hybridization reaction between various samples of single-stranded DNA (Mss, Uss) and a DNA microarray. (b) It is the photograph which detected the fluorescence of each spot after hybridization reaction with various samples of double-stranded DNA (Mds, Uds) and DNA microarray. In Example 2 and Comparative Example 1, it is a graph which shows the result obtained by plotting the detection data (M / (M + U)) of the sample prepared using various model nucleic acids.

Explanation of symbols

11 hole 21 perforated plate 31 hollow fiber 41 plate

SEQ ID NO: 1 synthetic DNA
Sequence number 2: Synthetic DNA
Sequence number 3: Synthetic DNA
Sequence number 4: Synthetic DNA
Sequence number 5: Synthetic DNA
Sequence number 6: Synthetic DNA
Sequence number 7: Synthetic DNA
Sequence number 8: Synthetic DNA
Sequence number 9: Synthetic DNA
SEQ ID NO: 10: synthetic DNA
SEQ ID NO: 11: synthetic DNA
SEQ ID NO: 12: synthetic DNA
SEQ ID NO: 13: synthetic DNA
SEQ ID NO: 14: synthetic DNA
SEQ ID NO: 15: synthetic DNA
SEQ ID NO: 16: synthetic DNA
Sequence number 17: Synthetic DNA
Sequence number 18: Synthetic DNA
Sequence number 19: Synthetic DNA
SEQ ID NO: 20: synthetic DNA
SEQ ID NO: 21: synthetic DNA
Sequence number 22: Synthetic DNA
SEQ ID NO: 23: synthetic DNA
SEQ ID NO: 24: synthetic DNA
SEQ ID NO: 25: synthetic DNA
SEQ ID NO: 26: synthetic DNA

Claims (4)

A method for detecting methylated DNA and / or unmethylated DNA comprising:
(a) contacting a nucleic acid in a test sample with a reagent that modifies unmethylated cytosine;
(b) amplifying the nucleic acid in the test sample to obtain a double-stranded DNA fragment;
(c) decomposing and / or removing one strand of the double-stranded DNA fragment to form a single-stranded DNA fragment;
(d) contacting the single-stranded DNA fragment with a DNA microarray on which an oligonucleotide probe capable of hybridizing with the fragment is mounted.   The method according to claim 1, wherein the amplification is performed by using a primer set capable of amplifying both DNA containing methylated cytosine and nucleic acid containing the modified base. (a) a reagent for modifying unmethylated cytosine,
(b) a primer set capable of amplifying both a DNA containing methylated cytosine and a nucleic acid containing the modified base, wherein one primer is phosphorylated at the 5 ′ end;
(c) an enzyme having λ exonuclease activity, and
(d) An oligonucleotide probe capable of hybridizing with a single-stranded DNA fragment obtained by treating the double-stranded DNA fragment amplified using the primer set (b) with the enzyme (c) is mounted. A kit for detecting methylated DNA and / or unmethylated DNA, comprising a DNA microarray.   A method for determining benign or malignant tumor, comprising comparing the ratio of methylation for each chromosomal DNA derived from tumor tissue and normal tissue from the detection results obtained by the method according to claim 1 or 2.